Application of the S40 gene in breeding aphid-resistant plant varieties

Abstract

This invention discloses the application of the S40 gene in the field of plant genetic engineering technology in the breeding of aphid-resistant plant varieties. The nucleotide sequence of the S40 gene is shown in SEQ ID NO.1, and the amino acid sequence encoding the S40 gene is shown in SEQ ID NO.2. The S40 gene belongs to the senescence regulator gene category. Knocking out the S40 gene in plants can enhance the inhibition of aphid growth and development, while overexpression of the S40 gene increases the susceptibility of plants to aphids. In addition, the aphid-induced ROS level is significantly increased in the s40 mutant. As a novel insect-resistant gene in plants, the S40 gene regulates the plant's resistance to aphid infestation by regulating ROS homeostasis, which has high reference value and significance. This invention provides a theoretical basis and genetic resources for the development of aphid-resistant crop lines.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to the application of the S40 gene in the breeding of aphid-resistant plant varieties. Background Technology

[0002] Maize (Zea mays) is a globally important food and economic crop, serving as a staple food for humans, animal feed, and a vital source of industrial raw materials. During maize growth and development, the maize aphid (Rhopalosiphum maidis) has become one of the main causes of yield reduction. These aphids obtain nutrients from the host by piercing plant tissue and sucking sap from the phloem. Due to their extremely rapid reproduction rate, aphid infestations can spread quickly, severely weakening the crop's nutrient absorption and inhibiting plant growth. Aphids also secrete honeydew, which adheres to the leaf surface, especially the tassels, significantly reducing photosynthetic and pollination efficiency, thus negatively impacting crop yield and quality. More importantly, aphids are also vectors for viruses, transmitting various diseases that can lead to yield reduction or even plant death. In agricultural production, breeding aphid-resistant varieties is the most environmentally friendly and effective way to mitigate this pest threat.

[0003] Despite extensive research efforts dedicated to elucidating the genetic basis and molecular mechanisms of aphid resistance in maize, progress in aphid control research remains limited due to the complexity of aphid populations, the diversity of hosts, and the multiple influences of field environmental factors. Therefore, there is an urgent need to develop novel, naturally insect-resistant maize varieties. This is an effective and environmentally friendly approach with significant theoretical and practical implications for crop aphid resistance. Summary of the Invention

[0004] The purpose of this invention is to address existing technical problems by proposing the application of the S40 gene in the breeding of aphid-resistant plant varieties.

[0005] The present invention achieves the above objectives through the following technical solutions:

[0006] As a first aspect of the present invention, the application of the S40 gene in the breeding of aphid-resistant plant varieties is provided, wherein the nucleotide sequence of the maize S40 gene is shown in SEQ ID NO.1.

[0007] As a further optimization of the present invention, the amino acid sequence encoding the S40 gene is shown in SEQ ID NO.2.

[0008] As a further optimization of the present invention, the application approach is as follows: in the process of plant breeding, the S40 gene in plants is knocked out using CRISPR knockout technology or homozygous plant varieties with missing S40 gene function are screened from natural ecotypes, thereby obtaining aphid-resistant plant varieties.

[0009] As a further optimization of the present invention, the target sequence for knocking out the S40 gene in plants using CRISPR knockout technology is shown in SEQ ID NO.5.

[0010] As a further optimization of the present invention, the plant is either corn B73 or corn B104.

[0011] As a second aspect of the invention, a kit for identifying whether a plant has resistance to aphids is also provided, the kit comprising primer pairs as described in SEQ ID NO.3 and SEQ ID NO.4, the primer pairs being used for PCR amplification of the S40 gene.

[0012] As a further optimization of the present invention, the plant is either corn B73 or corn B104.

[0013] The beneficial effects of this invention are as follows:

[0014] This invention conducted insect resistance tests on s40 mutants obtained by knocking out the S40 gene using CRISPR technology, examining the survival rate, body weight, and reproductive capacity of aphids. The results showed that the survival rate, body weight, and reproductive capacity of aphids from the s40 mutants were significantly lower than those from wild-type B104 maize. Furthermore, physiological and biochemical assays were performed on the overexpressed material S40-OE, showing that S40-OE exhibited sensitivity to aphids. In addition, the level of aphid-induced reactive oxygen species (ROS) was significantly increased in the s40 mutants. The S40 gene, as a novel insect resistance gene in plants, regulates plant resistance to aphid infestation by modulating ROS homeostasis, and has high reference value and significance.

[0015] (2) Based on the new function of the maize S40 gene, the present invention has developed a new type of aphid-resistant material, which provides a theoretical basis and gene resources for the development of aphid-resistant crop lines. Attached Figure Description

[0016] Figure 1 All images are full-length CDS amplification electrophoresis diagrams of the S40 gene provided by this invention. In the diagrams, lane 1 is the DNA marker (100bp-2000bp), and lane 2 is the S40 gene fragment.

[0017] Figure 2 Results of mutation sites in wild-type B104 maize (top) and s40 mutant (bottom) provided by this invention;

[0018] Figure 3 Statistical results of aphid survival rates on wild-type B104 maize and s40 mutant provided for this invention;

[0019] Figure 4 The present invention provides statistical results on body weight in wild-type B104 maize and s40 mutant.

[0020] Figure 5 Statistical results of reproductive capacity on wild-type B104 maize and s40 mutant provided by this invention;

[0021] Figure 6 Statistical results of the survival rate of aphids in wild-type B104 maize and overexpression material S40-OE provided by this invention;

[0022] Figure 7 The body weight statistics of wild-type B104 maize and overexpression material S40-OE provided for this invention;

[0023] Figure 8 Statistical results of the reproductive capacity of wild-type B104 maize and overexpression material S40-OE provided for this invention;

[0024] Figure 9 Scatter plot of GO enrichment of the s40 mutant before and after being eaten by aphids, provided by the present invention.

[0025] Figure 10 The ROS levels of wild-type B104 maize and s40 mutant before and after being eaten by aphids, and the ROS levels of wild-type B104 maize and overexpression material S40-OE provided by this invention were detected. Detailed Implementation

[0026] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0027] 1. Materials and Reagents

[0028] Unless otherwise specified, all materials, reagents, or instruments used in this invention are conventional products that can be purchased commercially.

[0029] 2. Method

[0030] Unless otherwise specified, the methods used in this invention are conventional methods known to those skilled in the art. Where specific conditions are not specified, they should be performed under conventional conditions or conditions recommended by the manufacturer.

[0031] 2.1 Cloning of the maize S40 gene

[0032] Using wild-type maize variety B73 as material, total RNA was extracted and reverse transcribed to synthesize the first strand of cDNA, which was then used as a template for PCR amplification.

[0033] Specific amplification primers were designed based on the nucleotide sequence of the maize S40 gene. Amplification was performed using these primers, yielding a 555 bp fragment of the maize S40 gene (electrophoresis results are shown below). Figure 1 As shown in the figure, the maize S40 gene fragment was ligated into the T-cloning vector PEASY-T3 to obtain T3-S40, which was transformed into E. coli. Positive clones were selected and sequenced. The sequencing results were consistent with the predicted results. The nucleotide sequence of the maize S40 gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by the maize S40 gene is shown in SEQ ID NO.2.

[0034] The specific amplification primer sequences are shown in SEQ ID NO.3 and SEQ ID NO.4:

[0035] SEQ ID NO.3: S40-F: (5'>ATGGCCGGGAGCGCGAGG<3');

[0036] SEQ ID NO.4: S40-R: (5'>GTCCTCGAATCCGGTCTTC<3').

[0037] 2.2 Identification and Function of Maize Mutant Genes

[0038] 2.2.1 Knockout of the S40 gene: Using wild-type B104 maize as a background, the S40 gene was knocked out using the CRISPR / Cas9 system to obtain the aphid-resistant mutant s40 (denoted as s40 mutant). The specific steps are as follows:

[0039] The sgRNA oligonucleotide described in SEQ ID NO.5 was synthesized as the target sequence: 5'>CCGGGAGCGCGAGGTCGGCGG<3'. This sequence was amplified by PCR and introduced into the pCAMBIA-Ubi knockout vector containing CRISPR / Cas9 components. The vector was then transformed into wild-type B104 maize background by Agrobacterium infection to obtain the s40 mutant. The obtained transgenic lines of the s40 mutant were amplified and sequenced for identification. The amplification primers were designed as in Section 2.1. It was found that in the s40 mutant, one base was inserted into the first exon, resulting in protein inactivation. Figure 2 ).

[0040] 2.2.2 Inoculate wild-type B104 and s40 mutants at the four-leaf stage with aphids, and systematically evaluate their survival rate, body weight, and reproductive capacity. The procedure is as follows:

[0041] Wild-type B104 maize and s40 mutant were planted in separate pots. At the four-leaf stage, 20 wingless adult aphids were inoculated at the leaf pulvinus of the second leaf of each plant to determine the survival rate. The number of aphids was counted daily for 7 days.

[0042] The method of inoculating insects to determine their weight is similar to that used to determine their survival rate. After 7 days, 5 aphids were randomly selected and weighed, and the average weight of each aphid was taken as the average weight of a single aphid.

[0043] The method of inoculating the insects during the reproductive capacity test was similar to that used for the survival rate test. The number of aphids on each corn plant was counted after 21 days, and the phenotype was recorded.

[0044] The results are as follows Figure 3 , Figure 4 and Figure 5 As shown, the survival rate, weight and reproductive capacity of aphids on the s40 mutant were significantly lower than those on wild-type B104 maize, indicating that the s40 mutant can significantly inhibit the survival and growth of aphids.

[0045] 2.2.3 Using the Ubi promoter to drive the 3×Flag tag and the DNA sequence of the target gene S40, the modified pCAMBIA-Ubi vector was constructed to obtain the S40-OE overexpression vector. The S40-OE overexpression vector was introduced into wild-type B104 maize, and positive transgenic seedlings (denoted as overexpression material S40-OE) were obtained by screening. Specific amplification primers were used for amplification verification.

[0046] The specific primer sequences used for amplification verification are shown in SEQ ID NO.3 and SEQ ID NO.6:

[0047] SEQ ID NO.3: S40-F: (5'>ATGGCCGGGAGCGCGAGG<3');

[0048] SEQ ID NO.6: NOS-R: (5'>ATCGGGGAAATTCGAGCT<3');

[0049] Further experiments were conducted on the positive transgenic seedlings. Aphids were inoculated onto wild-type B104 maize at the four-leaf stage and three groups of overexpression materials S40-OE (numbered S40-OE#9, S40-OE#11 and S40-OE#12, respectively). The survival rate, body weight and reproductive capacity of the aphids were counted according to the same experimental method as in Section 2.2.2.

[0050] The results are as follows Figure 6 , Figure 7 and Figure 8 As shown in the experimental results, the overexpression material S40-OE exhibits sensitivity to aphids.

[0051] 2.2.4 To elucidate the molecular mechanism by which S40 regulates maize resistance to aphids, this study first performed transcriptome sequencing on s40 mutants and wild-type B104 maize before and after aphid infection.

[0052] The results are as follows Figure 9 As shown, Gene Ontology enrichment analysis revealed that the "oxidoreductase activity" related genes in the s40 mutant were specifically and significantly enriched after aphid feeding, while this pathway was not activated in B104. This indicates that the loss of S40 function enhances the aphid-induced redox response.

[0053] Furthermore, the ROS level of the leaf was detected using the H2DCFDA probe, and the specific operation is as follows:

[0054] Leaves before and after aphid treatment were collected and immersed in a buffer solution containing 10 mM Tris-HCl (pH 7.4), 50 mM KCl, 50 µM H2DCFDA, and 0.02% (v / v) Triton X-100. The solution was allowed to permeate at 0.6 MPa for 20 min, and the leaves were immediately imaged under a fluorescence microscope after rinsing.

[0055] The results are as follows Figure 10 As shown, the leaves of the s40 mutant exhibited higher basal ROS levels than wild-type B104 maize even before infection, and the ROS content of the s40 mutant leaves increased significantly after aphid feeding. Conversely, the ROS content of the leaves of the overexpression material S40-OE was significantly lower than that of wild-type B104 maize.

[0056] In summary, the S40 gene negatively regulates ROS accumulation in maize by inhibiting the expression of redox pathway-related genes. Its loss of function leads to a surge in ROS, thereby enhancing the maize plant's resistance to aphids.

[0057] 3. Conclusion

[0058] The s40 mutant, obtained by knocking out the maize S40 gene using CRISPR, showed significantly lower survival rate, body weight, and reproductive capacity compared to wild-type B104 maize in terms of aphids. The overexpressed material S40-OE exhibited susceptibility to aphids. Furthermore, transcriptomic analysis and ROS content detection revealed that the S40 gene negatively regulates maize ROS accumulation by inhibiting the expression of redox pathway-related genes; its loss of function leads to a ROS surge, thereby enhancing maize plant resistance to aphids.

[0059] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. S40 The use of genes in breeding aphid-resistant plant varieties, characterized in that, The S40 The nucleotide sequence of the gene is shown as SEQ ID NO. 1; The application approach is as follows: in the plant breeding process, CRISPR knockout technology is used to knock out the CRISPR knockout gene in plants. S40 Genes may be selected from natural ecotypes S40 Homozygous plant varieties with missing gene function can be used to obtain aphid-resistant plant varieties. The plant is maize.

2. The method of claim 1, S40 The use of the gene in breeding aphid-resistant plant varieties, characterized in that, The amino acid sequence of the gene is shown in SEQ ID NO.

2. S40 The amino acid sequence of the gene is shown in SEQ ID NO.

2.

3. The method of claim 1, S40 The use of the gene in breeding aphid-resistant plant varieties, characterized in that, The CRISPR knockout technology is used to knockout the target sequence of the gene in plants S40 The target sequence of the gene is shown as SEQ ID NO.

5.

4. The method of any one of claims 1-3 S40 The use of the gene for breeding aphid-resistant plant varieties, characterized in that, The plant is any one of maize B73, maize B104.

Images