Transdermal absorption composite microspheres, preparation method and application thereof

Abstract

The application relates to the technical field of biomaterials, and discloses a transdermal absorption composite microsphere as well as a preparation method and application. The preparation steps are as follows: polydeoxyribonucleic acid is added into water and stirred and mixed to obtain a polydeoxyribonucleic acid aqueous solution; a silk material solution is diluted, mixed with the polydeoxyribonucleic acid aqueous solution, and then mixed with a polylysine aqueous solution to obtain a composite solution system, which is stirred and mixed to obtain a water solution containing the composite microsphere; in the scheme, the composite microsphere with clear structure and specific function is automatically compressed by utilizing the supramolecular interaction between PDRN and the silk material and the attribute of PDRN conducive to folding, the preparation method is simple, and the application method is simpler.

Description

Technical Field

[0001] This invention relates to the field of biomaterials technology, specifically to the A61L field, and discloses a transdermal absorption composite microsphere, its preparation method, and its application. Background Technology

[0002] Microspheres are an important formulation form. Microsphere carriers, prepared using biodegradable polymer materials, enable the efficient encapsulation and controlled release of macromolecular active ingredients. Furthermore, microsphere carriers exhibit excellent adhesion and stability on the skin surface, allowing for sustained release of active ingredients and enhancing the skin barrier repair function. This makes them suitable for applications in medical dressings and high-end cosmetics.

[0003] Large molecular weight components such as hyaluronic acid (HA), various proteins and their derivatives, and polydeoxyribonucleic acid (PDRN) are difficult to absorb transdermally when applied directly to the skin, thus affecting their efficacy. Currently, when addressing the transdermal absorption problem through formulation technology, other excipients are introduced, leading to increased costs, larger molecular particle sizes, and compromised safety.

[0004] In the prior art, CN114642606A discloses a composition with skin barrier repair function, comprising: 0.01-0.5% high molecular weight hyaluronic acid or its salt, 0.1-1.0% hydrolyzed hyaluronic acid or its salt, 0.01-10% silk fibroin, 0.05-1% polydeoxyribonucleic acid, and 0.1-10% bosine. In this preparation, the raw materials are premixed and then emulsified with a solubilizer. After homogenization, the high molecular weight hyaluronic acid and solubilizer form a stable emulsion system that does not separate into layers. The resulting product has good lipophilicity, forming a stable hydrogel-liposome. However, the hydrogel-liposomes obtained in this technology are still relatively large in volume, and the introduction of solubilizers and other excipients in the formulation significantly reduces the safety factor.

[0005] If transdermal absorption cannot be addressed through formulation technology, macromolecular self-assembly microsphere technology can be considered. However, macromolecules are large and difficult to compress. For example, CN119978449A discloses a method for preparing and applying elastic porous silk fibroin microspheres with adjustable particle size, wherein the diameter of the porous microspheres is 20 μm to 1 mm. The microspheres prepared by this invention are rigid microspheres, chemically inert, and have low biocompatibility, which cannot achieve controlled-release delivery of active ingredients and is not conducive to transdermal absorption.

[0006] Furthermore, the microsphericization technology for multiple macromolecular components is more complex and difficult to microsphericize than for single macromolecules due to the interactions between macromolecules. For example, CN120204480A discloses an injectable sodium hyaluronate-silk fibroin composite hydrogel, its preparation method, and its application. It consists of sodium hyaluronate composite gel particles and a sodium hyaluronate solution. The sodium hyaluronate composite gel particles include silk fibroin sponge microspheres and sodium hyaluronate gel particles. The silk fibroin sponge microspheres are loaded onto the sodium hyaluronate gel particles. The silk fibroin sponge microspheres are prepared by physical cross-linking, resulting in rigid microspheres with a D50 of 10-30 μm and a D90 within 100 μm. It also contains sodium hyaluronate gel particles with a D50 of 150-300 μm and a D90 within 800 μm. This particle size is suitable for injectable products, but when used for direct application, it clearly cannot achieve transdermal absorption.

[0007] In the existing technology "Construction of Multifunctional Composite Microparticles and Their Application in Diabetic Wound Healing" (Li Xiaoming. Construction of Multifunctional Composite Microparticles and Their Application in Diabetic Wound Healing [D]. Beijing: Beijing University of Chemical Technology, 2023), silk fibroin solution and polylysine solution are mixed, and silk fibroin is modified by polylysine. Then, silk fibroin-polylysine composite microsphere powder is obtained by separation in an organic volatile solvent. Then, PDRN is added and treated by electrostatic adsorption. In essence, it is to obtain microsphere structure by simple electrostatic adsorption and layer-by-layer assembly. Through electron microscopy, it can be observed that the microsphere structure obtained by electrostatic adsorption is that after silk fibroin and polylysine are formed into spheres, a layer of PDRN is adsorbed on the surface of the sphere. Electron microscopy results can directly see that the silk fibroin sphere is surrounded by a layer of PDRN structure. Due to the presence of the outer adsorption structure, the transdermal absorption performance still needs to be improved. Meanwhile, the mass concentration ratio of filamentin to polylysine in this reference is 3:7 to 3:42, which requires alcohol precipitation in ethanol solution to form microspheres. Using organic solvents is not conducive to simpler and wider applications.

[0008] In summary, it is of great significance to study a composite microsphere that does not rely on organic solvents or various formulations, has simple raw materials and preparation processes, good transdermal absorption, and can be directly applied for absorption, as well as its preparation method. Summary of the Invention

[0009] The purpose of this invention is to provide transdermal absorbable silk core protein composite microspheres, their preparation method, and their applications, in order to solve the problems mentioned in the background art.

[0010] To solve the above-mentioned technical problems, the present invention provides the following technical solution:

[0011] A method for preparing transdermal absorbable composite microspheres includes the following steps: intertwining and compressing silk material and polydeoxyribonucleic acid under the action of polylysine to obtain composite microspheres;

[0012] The mass ratio of silk material to polylysine is 1:(0.006~0.2), the mass ratio of silk material to polydeoxyribonucleic acid is 1:(1~10), and the mass ratio of polylysine to polydeoxyribonucleic acid is 1:(5~150).

[0013] Preferably, the particle size of the composite microspheres is 50nm~500nm.

[0014] Preferably, the silk material includes at least one of silk protein, hydrolyzed silk protein, hydrolyzed silk, and silk amino acids.

[0015] Preferably, the silk material is fibroin.

[0016] The silk fibroin described in this invention, also known as silk protein or silk fibroin, is the main component of natural silk fibroin fiber. The reason why this invention chooses silk fibroin and PDRN to prepare transdermal absorbable silk fibroin composite microspheres is that PDRN molecules contain deoxyribose, phosphate groups, and various base structures, exhibiting negative charge; while the amino acid sequence of silk fibroin contains a large number of amino acid molecules such as lysine (K), glycine (G), proline (P), histidine (H), and arginine (R), and these amino acid molecules have strong intermolecular forces with PDRN;

[0017] Based on this, this invention uses molecular docking simulations to determine that there is a supramolecular interaction between PDRN and filamentin, with the interaction force between PDRN and filamentin being -4.21 kcal / mol. From the perspective of molecular docking simulations, an interaction between two molecules is generally considered to exist if the force is below -0.6 kcal / mol. This invention utilizes the supramolecular interaction between PDRN and filamentin to enable filamentin and polydeoxyribonucleic acid to spontaneously and systematically arrange and combine under non-covalent driving through a reversible dynamic process, ultimately reaching thermodynamic equilibrium. This results in flexible microspheres with well-defined structures and specific functions, small particle size, and a simple preparation process that does not contain organic solvents.

[0018] Preferably, the polylysine includes at least one of basal polylysine and modified polylysine.

[0019] Preferably, the polylysine is a base amino acid.

[0020] Basic polylysine provides a cationic environment, which triggers the formation of complex microparticles.

[0021] Preferably, the polylysine is a mixture of basic polylysine and modified polylysine in a mass ratio of 1:(0.5~0.8).

[0022] The use of modified polylysine to partially replace basic polylysine further improved transdermal absorption.

[0023] Preferably, the preparation of the modified polylysine includes the following steps: adding phospholipid polyethylene glycol carboxyl groups to water and stirring evenly, adding 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, abbreviated as such in the examples) and N-hydroxysuccinimide (NHS, abbreviated as such in the examples), stirring at 25-30°C for 5-10 min, adding dropwise to a buffer solution containing basic polylysine (the buffer solution is a phosphate buffer solution with a pH of 7.4, abbreviated as PBS solution in the examples), stirring at 25-30°C for 20-24 h, purifying, and lyophilizing to obtain modified polylysine.

[0024] Preferably, the mass ratio of phospholipid polyethylene glycol carboxyl group, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, N-hydroxysuccinimide, and basic polylysine is (1~1.5):(0.15~0.2):(0.1~0.15):(4~5).

[0025] The addition of polyethylene glycol-modified polylysine further introduces flexible substances into the microspheres, enhancing their deformability and reversible recovery properties, thus achieving more efficient transdermal absorption. The introduction of phospholipid polyethylene glycol replaces some cross-linking points, increasing the space for movement, enhancing overall fluidity, and promoting absorption. However, the introduction should not be excessive, as excessive introduction will affect the cationic environment and cause the microsphere structure to become too loose, affecting the particle size and making it prone to disintegration.

[0026] Preferably, the specific preparation steps of the composite microspheres are as follows: adding polydeoxyribonucleic acid (PDRN) to water and stirring evenly to obtain an aqueous solution of PDRN; diluting the silk material solution and mixing it with the PDRN aqueous solution; adding an aqueous solution of polylysine to obtain a composite solution system; stirring and mixing to obtain an aqueous solution containing the composite microspheres.

[0027] Preferably, the mixing time is 5 to 120 minutes and the mixing speed is 200 to 12000 rpm.

[0028] Preferably, the composite microspheres prepared by this method can be applied to the fields of medical dressings or cosmetics; wherein, when applied to dressings, the composite microspheres can serve as sustained-release carriers; when applied to cosmetics, the dosage form includes any one of aqueous solutions, emulsions, creams, serums, sprays, topical masks, or sheet masks.

[0029] Preferably, when the composite microspheres prepared in this scheme are used, they also include a preservative with a mass fraction of 0.1% to 2%; the amount of preservative used can be adjusted according to the subsequent application.

[0030] Compared with existing technologies, the beneficial effects achieved by this invention are as follows: This method mixes aqueous solutions of fibroin and PDRN, which, under the action of a polylysine composition, interpenetrate, entangle, and fold and compress, preparing a flexible composite microsphere that can pass through the stratum corneum gap without the need for organic solvents or the addition of solubilizers and other excipients. This improves the transdermal absorption effect, solves the problem of transdermal absorption of large PDRN and fibroin molecules, and maximizes the technical effect of high absorbency with a simple process. The composite microsphere can be directly absorbed by application, without the need for complex processes such as injection.

[0031] (1) Due to the large molecular weight of silk and PDRN, transdermal absorption is difficult, and conventional preparation methods cannot obtain a suitable particle size for transdermal absorption. They can only be injected into the body, limiting their applicability. Using other organic solvents to assist in the preparation of microspheres with smaller particle sizes poses safety risks. This solution utilizes macromolecular self-assembly microsphere technology, leveraging the supramolecular interaction between PDRN and silk core protein to rapidly form composite microspheres in a cationic environment provided by polylysine. Specifically, the two components interpenetrate, entangle, and fold, rather than undergoing simple electrostatic adsorption. From a microscopic perspective, this structure is similar to using silk core protein and PDRN as threads, first weaving the "threads" into a "rope," and then winding the "rope" into a "sphere," ultimately preparing a flexible silk core protein composite microsphere with a particle size of 50nm~500nm. This allows for direct transdermal absorption through application. After entering the skin, the difference between the internal and external skin environments triggers dissociation, restoring the original shape and achieving transdermal delivery of the active ingredient. Furthermore, this solution does not introduce other excipients and does not affect safety.

[0032] (2) The process of the present invention has been optimized: First, the fibrous protein and PDRN are mixed and dispersed in a solution system. Then, a polylysine solution that provides a cationic environment is added. In the resulting mixed solution system, the fibrous protein and PDRN are intertwined and bound together by intermolecular forces, and automatically fold and compress to obtain a solution system containing fibrous protein composite microspheres. Compared with traditional electrostatic adsorption spheres, there is no external adsorption structure, so it is easier to penetrate the cell membrane and enter the cell. It can pass through the keratinocyte gap to achieve the effect of improving transdermal absorption. At the same time, the present invention is prepared directly in an aqueous solution without the need for organic solvents, making the process and raw materials simpler.

[0033] (3) The amount of each raw material added to the composite microspheres needs to be controlled. The amount of polylysine added needs to be controlled. A high concentration will result in a large proportion of cations in the overall solution, resulting in a large particle size of the composite microspheres, or even the formation of a hydrogel. A high content of filoin will cause precipitation, leading to instability of the system. Similarly, the order of addition is very important. Changing the order of addition of filoin, polylysine and PDRN will prevent the formation of the composite microspheres required by this invention. In the prior art, the process reported in the references cannot form microspheres after mixing the solution. It is necessary to precipitate the microspheres in the ethanol solution. This is significantly different from the method of this invention, which directly prepares microspheres in the aqueous solution.

[0034] (4) Furthermore, this scheme introduces modified polylysine, in which polyethylene glycol phosphate is used to enhance the deformable and reversible recovery properties of flexible microspheres, so as to achieve more efficient transdermal absorption; the introduction of phospholipid polyethylene glycol replaces some cross-linking points, increases the movement space, enhances the overall fluidity, and promotes absorption; however, the introduction should not be too much, as too much introduction will affect the cationic environment on the one hand, and on the other hand, it will cause the microsphere structure to be too loose, the particle size will be affected and it will be easy to disintegrate. Attached Figure Description

[0035] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used in conjunction with embodiments of the invention to explain the invention and do not constitute a limitation thereof. In the drawings:

[0036] Figure 1 A molecular model for PDRN;

[0037] Figure 2 A molecular model for filamentin;

[0038] Figure 3 A simulation diagram of the binding of PDRN and filocene.

[0039] Figure 4 Electron micrograph of the PDRN compression process;

[0040] Figure 5 Here is an electron microscope image of the composite microspheres from Example 1;

[0041] Figure 6 The graph shows the diffusion detection results of the samples from Example 1 and Comparative Example 1; the red line represents the sample from Example 1, and the gray line represents the sample from Comparative Example 1 (silk heart protein).

[0042] Figure 7 The graph shows the stability test results of the samples from Example 1 and Comparative Example 1; the left side is the sample from Comparative Example 1, and the right side is the sample from Example 1. Detailed Implementation

[0043] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0044] It should be noted that there are no special restrictions on the manufacturers of the raw materials involved in this invention. Exemplary examples include: silk core protein (Suzhou Suhao Biomaterials Technology Co., Ltd.), PDRN (Ruijiming Biotechnology Co., Ltd., Shanghai Huiwen Biotechnology Co., Ltd.), basic polylysine (Shandong Freda Biotechnology Co., Ltd., Shanghai Maclean Biochemical Technology Co., Ltd.), and phospholipid polyethylene glycol carboxyl group (DSPE-PEG2000-COOH).

[0045] Unless otherwise specified, all figures below are parts by weight or mass ratios.

[0046] Verification experiment: Verification of whether PDRN and filamentin can undergo supramolecular self-assembly: Step 1: Extract a portion of the PDRN sequence from the salmon genome sequence and construct a PDRN model; the A strand of the PDRN sequence (SEQ ID NO.1) is: CTACTTCCTCTCTAAGGACCAGGGGAAGAGTTGACAACATAGTGT;

[0047] The PDRN sequence B strand (SEQ ID NO.2) is: ACACTATGTTGTCAACTCTTCCCCTGGTCCTTAGAGAGGAAGTAG;

[0048] Step 2: Obtain the silk protein PDB file from the RCSB PDB: Homepage website. The silk protein amino acid sequence is shown in SEQ ID NO.3; see the sequence listing for details.

[0049] Step 3: Use AutoDockTools-1.5.6 to open the PDRN and filamentin pdb files and perform molecular simulation docking experiments;

[0050] Specifically, Figure 1 For PDRN model, Figure 2 The model of the silk core protein; molecular docking calculation results are as follows: Figure 3 As shown, the interaction force between PDRN and silk protein is -4.21 kcal / mol. From the perspective of molecular docking calculation simulation, it is generally considered that an interaction exists between two molecules if the force is below -0.6 kcal / mol. In summary, there is a strong intermolecular interaction between PDRN and silk protein.

[0051] Example 1: 1 part PDRN was added to 50 parts water and stirred until homogeneous to obtain an aqueous solution of PDRN; the silk protein solution was diluted with water to a concentration of 1 wt% to obtain a diluted silk protein solution; 0.05 parts basic polylysine was added to 25 parts water and stirred until homogeneous to obtain an aqueous solution of polylysine; 100 parts of the diluted silk protein solution was mixed with the aqueous solution of PDRN and stirred at 600 rpm for 60 min, and then the aqueous solution of polylysine was added and stirred at 600 rpm for 30 min to obtain an aqueous solution containing composite microspheres, which was used as a sample.

[0052] Example 2: 1 part PDRN was added to 50 parts water and stirred evenly to obtain an aqueous solution of PDRN; the silk protein solution was diluted with water to a concentration of 1 wt% to obtain a diluted silk protein solution; 0.05 parts basic polylysine was added to 25 parts water and stirred evenly to obtain an aqueous solution of polylysine; 100 parts of the diluted silk protein solution was mixed with the aqueous solution of PDRN and stirred at 600 rpm for 60 min; then the aqueous solution of polylysine was added and stirred at 600 rpm for 30 min; 1 part of the preservative hexanediol was added and stirred evenly to obtain an aqueous solution containing composite microspheres, which was used as a sample.

[0053] Example 3: 1 part PDRN was added to 50 parts water and stirred evenly to obtain an aqueous solution of PDRN; the silk protein solution was diluted with water to a concentration of 1 wt% to obtain a diluted silk protein solution; 0.2 parts basic polylysine was added to 25 parts water and stirred evenly to obtain an aqueous solution of polylysine; 100 parts of the diluted silk protein solution was mixed with the aqueous solution of PDRN and stirred at 600 rpm for 60 min, and then the aqueous solution of polylysine was added and stirred at 600 rpm for 30 min to obtain an aqueous solution containing composite microspheres, which was used as a sample.

[0054] Example 4: 1 part PDRN was added to 50 parts water and stirred evenly to obtain an aqueous solution of PDRN; the silk protein solution was diluted with water to a concentration of 1 wt% to obtain a diluted silk protein solution; 0.3 parts basic polylysine was added to 25 parts water and stirred evenly to obtain an aqueous solution of polylysine; 100 parts of the diluted silk protein solution were mixed with the aqueous solution of PDRN and stirred at 600 rpm for 60 min; then the aqueous solution of polylysine was added and stirred at 600 rpm for 30 min to obtain the sample.

[0055] Example 5: 1 part PDRN was added to 50 parts water and stirred until homogeneous to obtain an aqueous solution of PDRN; the silk protein solution was diluted with water to a concentration of 1 wt% to obtain a diluted silk protein solution; 0.006 parts basic polylysine was added to 25 parts water and stirred until homogeneous to obtain an aqueous solution of polylysine; 100 parts of the diluted silk protein solution was mixed with the aqueous solution of PDRN and stirred at 600 rpm for 60 min; then the aqueous solution of polylysine was added and stirred at 600 rpm for 30 min to obtain an aqueous solution containing composite microspheres, which was used as a sample.

[0056] Example 6: 1 part PDRN was added to 50 parts water and stirred until homogeneous to obtain an aqueous solution of PDRN; the silk protein solution was diluted with water to a concentration of 2 wt% to obtain a diluted silk protein solution; 0.05 parts basic polylysine was added to 25 parts water and stirred until homogeneous to obtain an aqueous solution of polylysine; 100 parts of the diluted silk protein solution was mixed with the aqueous solution of PDRN and stirred at 600 rpm for 60 min; then the aqueous solution of polylysine was added and stirred at 600 rpm for 30 min to obtain the sample.

[0057] Example 7: 1 part of phospholipid polyethylene glycol carboxyl group was added to 15 parts of water and stirred evenly. 0.15 parts of EDC and 0.1 parts of NHS were added and stirred at 25°C for 10 min. The mixture was then added dropwise to a PBS solution of basic polylysine (containing 5 parts of basic polylysine and 39 parts of PBS solution with pH 7.4). The mixture was stirred at 25°C for 24 h. Unreacted substances, solvents, and catalysts were removed by purification. The mixture was then lyophilized to obtain modified polylysine.

[0058] One part of PDRN was added to 50 parts of water and stirred until homogeneous to obtain an aqueous solution of PDRN. The silk protein solution was diluted with water to a concentration of 1 wt% to obtain a silk protein diluent. 0.05 parts of polylysine (basic polylysine and modified polylysine in a mass ratio of 1:0.5) were added to 25 parts of water and stirred until homogeneous to obtain an aqueous solution of polylysine. 100 parts of the silk protein diluent were mixed with the PDRN aqueous solution and stirred at 600 rpm for 60 min. Then, the aqueous solution of polylysine was added and stirred at 600 rpm for 30 min to obtain an aqueous solution containing composite microspheres, which was used as the sample.

[0059] Comparative Example 1: This comparative example is a fibrous protein aqueous solution: 1 part of fibrous protein was added to 100 parts of water and stirred evenly to obtain the sample.

[0060] Comparative Example 2: This comparative example is a PDRN aqueous solution: 1 part PDRN is added to 100 parts water and stirred evenly to obtain the solution, which is used as the sample.

[0061] Comparative Example 3: 1 part of PDRN was added to 50 parts of water and stirred evenly to obtain an aqueous solution of PDRN; the silk protein solution was diluted with water to a concentration of 1 wt% to obtain a silk protein diluent; 100 parts of the silk protein diluent were mixed with the aqueous solution of PDRN, 25 parts of water were added, and the mixture was stirred at 600 rpm for 60 min to obtain the sample; no composite microspheres were prepared in this comparative example.

[0062] Comparative Example 4: 1 part PDRN was added to 50 parts water and stirred until homogeneous to obtain an aqueous solution of PDRN; the silk protein solution was diluted with water to a concentration of 1 wt% to obtain a silk protein diluent; 0.05 parts basic polylysine was added to 25 parts water and stirred until homogeneous to obtain an aqueous solution of polylysine; 100 parts silk protein diluent and the aqueous solution of polylysine were mixed and stirred at 600 rpm for 60 min, and then the aqueous solution of PDRN was added and stirred at 600 rpm for 30 min to obtain the sample; no composite microspheres were prepared in this comparative example.

[0063] Comparative Example 5: 1 part PDRN was added to 50 parts water and stirred until homogeneous to obtain an aqueous solution of PDRN; the silk protein solution was diluted with water to a concentration of 1 wt% to obtain a diluted silk protein solution; 0.05 parts sodium hyaluronate was added to 25 parts water and stirred until homogeneous to obtain an aqueous solution of sodium hyaluronate; 100 parts of the diluted silk protein solution were mixed with the aqueous solution of PDRN and stirred at 600 rpm for 60 min, and then the aqueous solution of sodium hyaluronate was added and stirred at 600 rpm for 30 min to obtain the sample; no composite microspheres were prepared in this comparative example.

[0064] Comparative Example 6: 1 part of PDRN was added to 50 parts of water and stirred until homogeneous to obtain an aqueous solution of PDRN; the silk protein solution was diluted with water to a concentration of 1 wt% to obtain a diluted silk protein solution; 0.03 parts of basic polylysine and 0.02 parts of sodium hyaluronate were added to 25 parts of water and stirred until homogeneous to obtain an aqueous solution of the mixture; 100 parts of the diluted silk protein solution were mixed with the aqueous solution of PDRN and stirred at 600 rpm for 60 min, and then the aqueous solution of the mixture was added and stirred at 600 rpm for 30 min to obtain an aqueous solution containing composite microspheres, which was used as the sample.

[0065] Performance Test 1: Particle Size Test

[0066] (1) Referring to GB / T 19077-2016 Particle size distribution by laser diffraction, particle size data were collected using a laser particle size analyzer, and the particle size of the samples obtained in the example was tested. The test results are shown in Table 1; (2) Electron micrographs of the silk core protein composite microspheres prepared in Example 1 are shown in Table 1. Figure 5 As shown;

[0067] Table 1:

[0068]

[0069] As shown in the examples, the polylysine concentration was relatively high, but did not exceed 0.2%, resulting in a high proportion of cations in the overall solution and a larger particle size of the resulting composite microspheres. In Example 4, the polylysine content was too high, and the final sample was not an aqueous solution of composite microspheres, but a hydrogel. However, considering all factors, the presence of polylysine is necessary in the reaction system. Furthermore, as shown in Comparative Example 4, changing the order of addition of fibroin, polylysine, and PDRN prevents the formation of the composite microspheres required by this invention. In Example 6, the fibroin content was too high. Although composite microspheres could still form, excess fibroin precipitated out, leading to system instability. Conversely, while reducing the fibroin concentration did not significantly affect the formation of composite microspheres, from an application perspective, a low fibroin content would affect the product obtained. In summary, the proportions and order of addition of each raw material need to be controlled.

[0070] Performance Test 2: Transdermal Absorption Detection

[0071] Samples prepared in Examples 1, 7, 1, and 6 were used to prepare 0.1% (m / m) composite microsphere aqueous solution test sample 1, 0.1% (m / m) composite microsphere aqueous solution test sample 7, and 0.1% (m / m) fibroin aqueous solution test sample, respectively. These were used as diffusion solutions and added to an in vitro diffusion cell. The rotation speed was set to 100 rpm. The transdermal diffusion tester software was started, the diffusion cell temperature was set to 25℃, and the test time was 24 hours (with 2-hour intervals). The test was started, and samples were collected within the set time. The fibroin content was determined using the BCA method. After the test, the collected samples were analyzed and processed. The diffusion amount detection results of the samples in Example 1 and 1 are shown in the figure. Figure 6 Table 2 shows the comparison of diffusion amounts at 6 h and 12 h for samples from Examples 1, 7, Comparative Examples 1 and 6.

[0072] Table 2:

[0073]

[0074] The diffusion amount in the examples was much greater than that in the comparative examples, and it gradually increased over time. This shows that the transdermal absorption of the composite microspheres prepared in the examples was significantly higher than that in comparative example 1, indicating that the composite microspheres prepared in this invention can more easily penetrate the cell membrane and enter the cell. As can be seen from comparative example 6, adding the new sodium hyaluronate component actually leads to a decrease in the effect.

[0075] Performance Test 3: Stability Test

[0076] The samples obtained from Examples 1-7, Comparative Examples 1-2, and Comparative Example 6 were placed at room temperature (25°C) in the dark for 60 days, and the stability of the samples was observed. The specific results are shown in Table 3. Figure 7 ;

[0077] Table 3:

[0078]

[0079] Figure 7 The left image shows a 5% silk core protein aqueous solution sample placed at room temperature (25℃) in the dark for 60 days (Comparative Example 1), and the right image shows a 5% silk core protein composite microsphere solution sample placed at room temperature (25℃) in the dark for 60 days (Example 1). It can be seen that the microsphere-treated silk core protein solution has better stability and no obvious stratification phenomenon is observed, indicating that microsphere treatment can improve the spatial structure of silk core protein, avoid the conformational transformation of silk core protein, and improve the stability of aqueous solution.

[0080] In summary, the composite microspheres prepared by this invention differ from common microspheres in the field. They are not simple layer-by-layer self-assembled structures, but rather formed through supramolecular self-assembly of fibroin and PDRN via intermolecular forces. Furthermore, they utilize the folding properties of PDRN, a nucleic acid-like substance, to automatically compress into microspheres capable of permeating cell membranes and entering cells, achieving transdermal absorption. This process achieves high transdermal absorption using simple techniques without the use of solubilizers or other excipients or organic solvents. These composite microspheres can be absorbed directly by spraying or applying, eliminating the need for cosmetic injections.

[0081] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for preparing transdermal absorption composite microspheres, characterized in that: Includes the following steps: By intertwining and folding silk materials with polydeoxyribonucleic acid under the action of polylysine, composite microspheres are obtained. The specific preparation steps of the composite microspheres are as follows: Polydeoxyribonucleic acid is added to water and stirred evenly to obtain an aqueous solution of polydeoxyribonucleic acid; the silk material solution is diluted and mixed with the aqueous solution of polydeoxyribonucleic acid; an aqueous solution of polylysine is added to obtain a composite solution system; the mixture is stirred and mixed to obtain an aqueous solution containing the composite microspheres. In the raw materials for the composite microspheres, the mass ratio of silk material to polylysine is 1:(0.006~0.2), the mass ratio of silk material to polydeoxyribonucleic acid is 1:(1~10), and the mass ratio of polylysine to polydeoxyribonucleic acid is 1:(5~150). The silk material is fibroin.

2. The method for preparing a transdermal absorption composite microsphere according to claim 1, characterized in that: The particle size of the composite microspheres is 50nm~500nm.

3. The method for preparing a transdermal absorption composite microsphere according to claim 1, characterized in that: The polylysine is based on polylysine.

4. The method for preparing a transdermal absorption composite microsphere according to claim 1, characterized in that: The polylysine is a mixture of basic polylysine and modified polylysine in a mass ratio of 1:(0.5~0.8); The preparation of the modified polylysine includes the following steps: Add phospholipid polyethylene glycol carboxyl groups to water and stir evenly. Add 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide. Stir at 25-30°C for 5-10 min. Drop the mixture into a buffer solution containing basic polylysine. Stir at 25-30°C for 20-24 h. Purify and freeze-dry to obtain modified polylysine. The mass ratio of phospholipid polyethylene glycol carboxyl groups, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, N-hydroxysuccinimide, and basic polylysine is (1-1.5):(0.15-0.2):(0.1-0.15):(4-5).

5. The composite microspheres prepared by the method for preparing transdermal absorbable composite microspheres according to claim 1.

6. An application of the composite microspheres according to claim 5, characterized in that: It is used in the preparation of sustained-release materials for medical dressings or cosmetic materials.

Images