Application of rGSTA3 protein in resisting avian influenza virus infection

Abstract

The invention discloses application of rGSTA3 protein in resisting avian influenza virus infection, and belongs to the technical field of biology. A recombinant plasmid containing an rGSTA3 protein coding sequence is transformed into an escherichia coli expression system, IPTG is used for inducing expression of the rGSTA3 protein, the expressed rGSTA3 protein is purified, high-concentration purified rGSTA3 protein is obtained through ultrafiltration and concentration, the protein regulates replication of H9N2 avian influenza virus to a certain extent by regulating expression of an interleukin receptor in chicken red blood cells, and the recombinant plasmid containing the rGSTA3 protein coding sequence is obtained. The compound can be used as a novel regulator or a drug candidate, and is used for preventing and treating H9N2 avian influenza virus infection.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to the application of rGSTA3 protein in resisting avian influenza virus infection. BACKGROUND

[0002] H9N2 subtype avian influenza virus is currently classified as low pathogenic avian influenza virus, but its continuous antigenic drift and genetic recombination lead to the frequent emergence of virus variants, making the immune protection effect of existing vaccines face serious challenges. Although vaccination strategies are generally used in large-scale farms, due to the rapid evolution of H9N2 virus, the antigenic matching degree between vaccine strains and epidemic strains decreases, leading to immune failure, reduced protection efficacy, and even outbreaks of epidemic in vaccinated chicken flocks. This phenomenon seriously affects the healthy development of poultry industry and increases the risk of virus cross-species transmission, so it is urgent to further study the immune escape mechanism of H9N2 virus and explore new antiviral strategies.

[0003] In recent years, it has been found that recombinant Glutathione S-Transferase A3 (rGSTA3) plays an important role in regulating host immune response. GST family proteins not only participate in cell detoxification and antioxidant processes, but also play a key role in immune regulation, such as affecting the expression of inflammatory factors and the activation of immune cells. In addition, Inter leukin Receptors (ILRs) mediated cellular immune response is an important way for the host to resist virus infection, and abnormal expression of interleukins and their receptors is closely related to the progression of many diseases. In the avian immune system, AvBDs, Toll-like receptors (TLRs) and related cytokines have been confirmed to be involved in the immune regulation of red blood cells, but the expression changes of ILRs in chicken red blood cells after H9N2 virus infection and the interaction mechanism with rGSTA3 are still unclear. In addition, whether chicken red blood cells participate in antiviral immune response and whether H9N2 infection affects the expression of immune-related factors in red blood cells still lack systematic research. These knowledge gaps limit the development of new antiviral strategies, making the prevention and control of H9N2 still face great challenges. SUMMARY

[0004] The purpose of the present application is to provide the application of rGSTA3 protein in resisting avian influenza virus infection to solve the problems existing in the prior art. The present application obtains a recombinant rGSTA3 protein by using E. coli expression system, which regulates the replication of H9N2 avian influenza virus to a certain extent by regulating the expression of interleukin receptors in chicken red blood cells, and can be used as a new type of regulator or drug candidate for preventing and treating H9N2 avian influenza virus infection.

[0005] To achieve the above object, the present application provides the following scheme:

[0006] The present application provides an application of rGSTA3 protein in preparing interleukin receptor modulators against avian influenza virus, wherein the CDS sequence of the coding sequence of the rGSTA3 protein is shown as SEQ ID NO. 1.

[0007] The avian influenza virus includes H9N2 subtype avian influenza virus.

[0008] The present application also provides an application of rGSTA3 protein in preparing a medicine for preventing avian influenza virus, wherein the CDS sequence of the coding sequence of the rGSTA3 protein is shown as SEQ ID NO. 1.

[0009] The avian influenza virus includes H9N2 subtype avian influenza virus.

[0010] The present application also provides an application of rGSTA3 protein in preparing a medicine for treating avian influenza virus infection, wherein the CDS sequence of the coding sequence of the rGSTA3 protein is shown as SEQ ID NO. 1.

[0011] The avian influenza virus includes H9N2 subtype avian influenza virus.

[0012] Further, the preparation method of the rGSTA3 protein comprises the following steps:

[0013] The recombinant plasmid containing the coding sequence of the rGSTA3 protein is transformed into an E. coli expression system, the expression of the rGSTA3 protein is induced by IPTG, the expressed rGSTA3 protein is purified, and high-concentration purified rGSTA3 protein is obtained through ultrafiltration concentration.

[0014] Further, the temperature of the induction is 37℃.

[0015] Further, the time of the induction is 10-12h.

[0016] Further, the construction method of the recombinant plasmid comprises adding enzyme cutting sites and homologous arm sequences to the coding sequence of the rGSTA3 protein to obtain a modified sequence; and connecting the modified sequence with a linearized plasmid after enzyme cutting to obtain the recombinant plasmid.

[0017] Further, the enzyme cutting is double enzyme cutting by using restriction enzymes EcoRI and XhoI.

[0018] Further, the modified sequence is shown as SEQ ID NO. 2.

[0019] The present application discloses the following technical effects:

[0020] The application obtains a recombinant rGSTA3 protein by using an E. coli expression system, proves the safety of the rGSTA3 protein to chicken red blood cells through experiments, and can significantly reduce the virus load of H9N2 avian influenza virus in chicken red blood cells, and successfully constructs an H9N2 avian influenza virus infection model; it is preliminarily verified that the rGSTA3 protein regulates the replication of H9N2 avian influenza virus to a certain extent by regulating the expression of interleukin receptors in chicken red blood cells. The application enriches the theoretical basis of the interaction between H9N2 virus and chicken red blood cells, and indicates that rGSTA3 can be used as a new type of regulator or drug candidate for preventing and treating H9N2 avian influenza virus infection, and is expected to make important contributions to the healthy development of the poultry industry and public health safety. BRIEF DESCRIPTION OF DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0022] Figure 1 It is a construction map of pCold-TF-rGSTA3-His plasmid;

[0023] Figure 2 It is a Western blotting identification map of rGSTA3 protein, wherein M is a protein molecular weight marker; 1 is the ultrasonic fragmentation supernatant of uninduced E. coli BL21 cells transformed by pcold-TF-GSTA3; 2 is the ultrasonic fragmentation supernatant of induced E. coli BL21 cells transformed by pcold-TF-GSTA3;

[0024] Figure 3 It is rGSTA3 protein eluted under different concentrations of elution buffer;

[0025] Figure 4 It is a SDS-PAGE identification map of purified rGSTA3 protein, wherein M is a protein molecular weight marker; Peak 1 is the primary purified rGSTA3 protein eluted by 20 mM concentration of elution buffer; Peak 2 is the primary purified rGSTA3 protein eluted by 100 mM concentration of elution buffer;

[0026] Figure 5 It is the determination result of hemolysis test of rGSTA3 protein;

[0027] Figure 6Inhibition of chicken red blood cell hemagglutination by rGSTA3 protein

[0028] Figure 7 Standard curve of H9N2 recombinant plasmid

[0029] Figure 8 Detection of virus load in red blood cells in in vitro experiment

[0030] Figure 9 Agarose gel electrophoresis of interleukin receptor associated factor mRNA expression in chicken red blood cells

[0031] Figure 10 Expression levels of interleukin receptor associated factors IL1R1 (A), IL1R2 (B), IL1RL1 (C), IL2RB (D), NFIL3 (E), IL-7R (F), IL10RA (G), IL13RA1 (H), IL17RA (I) and IL18R1 (J) mRNA in chicken red blood cells at 0, 2, 6 and 10 h in in vitro experiment

[0032] Figure 11 Weight change curve of chickens

[0033] Figure 12 Hemagglutination inhibition test results of the infection model

[0034] Figure 13 Virus load results in chicken lung (A) and kidney (B) tissues

[0035] Figure 14 Virus discharge amount of chicken throat swabs (A) and anal swabs (B)

[0036] Figure 15 Detection results of virus load in red blood cells in in vivo experiment

[0037] Figure 16 Expression levels of interleukin receptor associated factors IL1R1 (A), IL1R2 (B), IL1RL1 (C), IL2RB (D), NFIL3 (E), IL-7R (F), IL10RA (G), IL13RA1 (H), IL17RA (I) and IL18R1 (J) mRNA in chicken red blood cells at 3d, 7d and 14d in in vitro experiment DETAILED DESCRIPTION

[0038] Various exemplary embodiments of the present application will now be described in detail, which should be considered in a descriptive sense only and not for purposes of limitation. The present application is directed to certain aspects, features and embodiments of the application.

[0039] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, where a range of values is provided, it is understood that each intervening value, to the upper and lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intervening value in the stated range and any other stated or intervening value in that stated range is encompassed. The upper and lower limits of these smaller ranges can independently be included or excluded in the range, and are also encompassed by the application, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included.

[0040] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe in detail the methods and / or materials which are related to the present application. In the case of conflict between the content of the specification and that of any document incorporated herein by reference, the content of the specification prevails.

[0041] Many modifications and variations of the present application described in the specific embodiments of the application can be made by those skilled in the art without departing from the spirit or scope of the application. Other implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only.

[0042] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.

[0043] Example 1 Prokaryotic expression and biological activity analysis of glutathione-S-transferase A3 protein

[0044] 1. Obtaining of glutathione-S-transferase A3 gene rGSTA3

[0045] According to the CDS coding region sequence (SEQ ID NO. 1) of chicken rGSTA3 gene (GenBank: NM_001001777.1) on NCBI, two specific primers with added enzyme cutting sites and homologous arm sequences were designed, and the sequences shown in SEQ ID NO. 2-3 were obtained, which were synthesized by Nanjing Jinweizhi Biotechnology Co., Ltd.

[0046] SEQ ID NO. 1:

[0047] atgtctgggaagccagttctgcactatgccaacacacgaggccgaatggaatcagtacgctggctgctagcggctgctggagttgagtttgaagaaaaatttctggaaaaaaaggaagatctccaaaagttaaagtcagatggatccctgctgttccagcaagtgcccatggtggagattgatgggatgaagatggtgcagaccagagccatcctcaactacatagcagggaaatacaatctctacgggaaggatctgaaggagagagccctaattgacatgtatgtggaaggactggcagatctgtacgagttaatcatgatgaacgtcgtccaaccagcagataaaaaggaggaacatcttgctaatgctttggataaggccgcaaacagatatttcccagtctttgagaaggttttgaaggaccacggacatgactttcttgttggcaacaagctgagcagagcagacgtgcatttactggaaaccattttagcggtggaagagtcgaagcctgatgcacttgcaaaatttcccctcttgcagagttttaaagcaagaacaagcaatatccccaacatcaagaaattcctgcagcctggcagccaaaggaaaccacgcctagaggaaaaagatataccaagactgatggcaattttccac.

[0048] F: accCTCGAGatgtctgggaagccagttctgcactatgccaacacacgaggccga, SEQ ID NO. 2;

[0049] R: cttGAATTCtcagtggaaaattgccatcagtcttggtatatctttttcctctag, SEQ ID NO. 3.

[0050] 2. Construction and identification of recombinant expression plasmid

[0051] The DH5a competent bacteria containing the pCold-TF plasmid were cultured at a constant temperature of 37°C to ensure that the bacterial cells were fully grown and the plasmid was stably replicated. After the culture was completed, the plasmid DNA was extracted from the bacterial solution using a standardized plasmid extraction method. Subsequently, the extracted plasmid DNA was accurately cut using a double enzyme cutting technique, and the fragments were separated and recovered by agarose gel electrophoresis to ensure that pure linearized plasmid fragments were obtained. The purified linearized plasmid fragments were connected to the rGSTA3 gene fragments for homologous recombination to construct the recombinant plasmid pCold-TF-rGSTA3-His. The construction map of the recombinant plasmid is shown in Figure 1 The connected recombinant plasmid was transformed into LB medium containing ampicillin to screen for successfully transformed positive colonies. The positive colonies were selected for expansion culture to increase the number of bacterial cells and the yield of plasmids. The recombinant plasmid was extracted again and identified by double enzyme cutting, and the band was observed by gel electrophoresis to confirm the correctness of the recombinant plasmid. Finally, the bacterial solution containing the positive recombinant plasmid was sent to Shanghai Sangon Biological Engineering Co., Ltd. for sequencing to verify the sequence accuracy of the recombinant plasmid.

[0052] 3. Glutathione-S-transferase A3 protein expression and purification

[0053] 5 μL of the recombinant plasmid verified by sequencing was introduced into 50 μL of BL21 (DE3) competent cells, which were placed in an ice bath for 30 min, then heated at 42°C for 90 s, and then ice-bathed again for 3 min. Then 600 μL of LB medium without antibiotics was added, and the culture was recovered at 37°C for 1 h. After centrifugal treatment, the bacterial solution was spread on an LB plate containing ampicillin (Amp + ) and cultured at 37°C for 12 h. A single colony was picked and inoculated into LB liquid medium containing ampicillin (Amp + ), and cultured at 37°C for 5 h, and then verified by PCR technology.

[0054] The verified bacterial solution was inoculated into LB medium containing ampicillin (Amp + ) at a ratio of 1:100, and cultured at 37°C until the OD 600 value was 0.7-1.0. Then 1 mM of isopropyl-β-D-thiogalactoside (IPTG) was added, and the culture was continued at 37°C for 10-12 h to induce the expression of rGSTA3 protein.

[0055] After induction, the bacteria were collected by centrifugation at 8000 rpm for 5 min, and the bacterial pellet was resuspended in phosphate buffered saline (PBS). The bacteria were sonicated in an ice bath (3 s on, 5 s off, for a total of 30 min) until the bacterial solution was clear. The supernatant was collected by centrifugation at 4°C. The rGSTA3 protein in the supernatant was identified by Western blotting, and the results are shown in Figure 2 .

[0056] Gradient elution was performed using an AKTA system (buffer B containing 20-1000 mM imidazole), with an elution flow rate of 2 mL / min and a pressure limit of 0.3 MPa. The eluate from each gradient was collected and identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The protein of interest was then concentrated and stored.

[0057] Next, the collected supernatant was loaded onto a pre-equilibrated Histrap column, and the protein of interest was separated and obtained by elution with a gradient concentration of imidazole solution (20-1000 mM). The elution flow rate was 2 mL / min, and the pressure limit was 0.3 MPa. The eluate from different concentrations of imidazole elution was identified by SDS-PAGE, and the eluate containing the protein of interest was concentrated after SDS-PAGE identification. The Histrap column elution results of the target protein are shown in Figure 3 , and the SDS-PAGE identification results are shown in Figure 4 .

[0058] 4. Recombinant protein activity analysis

[0059] (1) Hemolysis test to evaluate the toxicity of rGSTA3 protein

[0060] Blood was collected from the wing vein of a chicken, and after anticoagulation, the red blood cells were centrifuged at 2500 r / min for 15 min, and the supernatant was discarded. The red blood cells were washed with PBS until the supernatant was colorless. 40 μL of red blood cell paste was taken and added to 1 mL of rGSTA3 protein PBS solution (test group), PBS (negative control), or distilled water (positive control). After incubation at 37°C for 3 h, the mixture was centrifuged at 2500 r / min for 15 min, and 100 μL of the supernatant was taken to measure the absorbance at 540 nm (OD). The hemolysis rate was calculated as follows:

[0061] Hemolysis rate = 〔(sample OD value - negative control OD value) / (positive control OD value - negative control OD value)〕 × 100%.

[0062] The results are shown in Figure 5 , which indicate that rGSTA3 protein has no toxicity to chicken red blood cells and does not cause hemolysis of chicken red blood cells. Figure 5

[0063] ​(2) Hemagglutination test to evaluate the anti-viral activity of rGSTA3 protein against H9N2 avian influenza virus

[0064] Mix 25 μL H9N2 virus solution with 5 μL rGSTA3 (concentration 10 mg·mL -1 ) and incubate at 37°C for 30 min, and set up a control with 25 μL H9N2 virus solution. Collect the incubated samples and dilute them by 2-fold in a 96-well V-shaped plate using sterile PBS. Then, prepare 25 μL fresh 1% chicken red blood cells and add them to the diluted samples. Finally, observe the results after standing at room temperature for 30 min.

[0065] The results are shown in Table 1. Figure 6 As shown in Table 1, the hemagglutination activity of H9N2 virus solution is 1:6, while that of H9N2 virus solution treated with rGSTA3 protein is 1:2; this indicates that rGSTA3 protein can significantly reduce the titer of H9N2 avian influenza virus.

[0066] Example 2 In vitro study on the intervention of glutathione-S-transferase A3 protein in H9N2 avian influenza virus infection

[0067] 1. Treatment of chicken red blood cells

[0068] Collect fresh chicken blood through the subclavian vein and collect it in an anticoagulant tube. In a clean bench, transfer the anticoagulated blood to a 2 mL centrifuge tube, add an equal volume of PBS buffer, and mix gently by blowing and sucking. After equalization, centrifuge at 4°C, 1000 r / min for 10-15 min, and discard the supernatant and middle white membrane layer. Repeat the above washing steps 3 times to obtain pure red blood cell paste.

[0069] 2. Establishment of a quantitative standard curve for the virus

[0070] According to the 6-segment neuraminidase (NA) gene sequence (MW100328.1) of H9N2 virus published by NCBI, specific primers were designed using SnapGene software.

[0071] F: TGGAATCTGARGGAACTTACAAAAT, SEQ ID NO. 4;

[0072] R: AAGGCAGCRAACCCCATTGCA, SEQ ID NO. 5.

[0073] The viral RNA was extracted, the target fragment was amplified by PCR, and the product was purified by agarose gel electrophoresis identification, connected to pMD19-T Vector carrier and transformed into DH5a competent cells, and the positive clone was sequenced to prepare the recombinant plasmid standard, and the standard curve was established after gradient dilution. The standard curve of H9N2 subtype avian influenza virus is: y = ‒3.2248 x +39.123, R 2 ≥ 0.99, as Figure 7 shown.

[0074] 3. Recombinant protein and infected H9N2 avian influenza red blood cell in vitro interaction test

[0075] Fresh chicken red blood cells were randomly divided into three groups, and 100 μL of H9N2 virus liquid (H9N2) was inoculated in the virus control group, 5 μL of rGSTA3 protein obtained in Example 1 with a concentration of 10 mg·mL -1 was added to the intervention group after inoculation with an equal amount of H9N2 virus (H9N2+rGSTA3 protein), and the blank control group was added with DMEM medium as control (Control). After incubation at 37℃, samples were taken at 0, 2, 6 and 10h, respectively, and the red blood cell precipitate was collected by centrifugation and the RNA was extracted, and the changes of virus adsorption and internalization efficiency were analyzed by qRT-PCR.

[0076] qRT-PCR analysis: based on the CDS region sequence of interleukin receptor-related factor published by NCBI, specific primers were designed by SnapGene. The reaction system was 10 μL (containing SYBR Premix Ex Taq II 5 μL, cDNA template 1 μL, upstream and downstream primers each 0.2 μL, ROX II 0.2 μL, ddH2O 3.4 μL), and the standard program was run on QuantStudio5 real-time fluorescent quantitative PCR instrument according to 95℃ pre-denaturation for 3 min, 95℃ for 30 s, 58℃ for 30 s for 40 cycles, 95℃ for 1 min, 55℃ for 30 s, with β-actin as the internal reference, and the relative expression amount of the gene was analyzed by 2 -ΔΔCt method. The primer information is shown in Table 1.

[0077] Table 1 Amplification primer information of immune cytokines

[0078]

[0079] The change of viral load is shown in Figure 8 : compared with the virus control group, the copy number of H9N2 avian influenza virus in the intervention group decreased significantly at 6 h.

[0080] The expression of interleukin receptor associated factors in chicken red blood cells was verified by agarose gel electrophoresis. The results were verified by using a gel imaging system and compared with a DNA ladder, as shown in Figure 9 Figure 2, the sizes of the interleukin receptor associated factors (IL1R1, IL1R2, IL1RL1, IL2RB, NFIL3, IL-7R, IL10RA, IL13RA1, IL17RA and IL18R1) were all around 100 bp, which was consistent with the expectation. Sequencing and alignment of the PCR amplified fragments were performed by Shanghai Sungene, and the results showed that they were consistent with the target sequences, indicating that the interleukin receptor associated factors IL1R1, IL1R2, IL1RL1, IL2RB, NFIL3, IL-7R, IL10RA, IL13RA1, IL17RA and IL18R1 were expressed in chicken red blood cells.

[0081] The qRT-PCR results of the expression of interleukin receptor associated factors in chicken red blood cells are shown in Figure 10 Figure 3. Overall, the relative expression of these genes showed dynamic changes at different time points (0 h, 2 h, 6 h and 10 h). The transcription levels of IL1R1, IL10RA, IL17RA and IL18R1 in the H9N2 group were significantly up-regulated at 2 h, while the transcription levels of IL1R2, IL1RL1, NFIL3 and IL-7R were significantly down-regulated. In addition, IL2RB in the H9N2 group was significantly up-regulated at 6 h, and IL2RB in the rGSTA3 protein group was further up-regulated at 6 h. Furthermore, the transcription levels of IL1R2 and NFIL3 in the rGSTA3 protein group were up-regulated at 2 h, and the transcription levels of IL1R1, NFIL3, IL10RA and IL18R1 were down-regulated at 2 h.

[0082] Example 3 In vivo intervention of glutathione-S-transferase A3 protein on H9N2 avian influenza virus infection

[0083] 1. Construction of animal model

[0084] Forty-five 1-day-old Isa Brown chicks were selected and continuously fed with basal diet and daily drinking water for 14 days under experimental conditions to make the maternal antibodies disappear. Then, the chicks were randomly divided into three groups, with 15 chicks in each group, namely the blank group, the H9N2 group and the protein group. The chicks in the protein group were injected with 50 μg of rGSTA3 recombinant protein per day for 3 days, and the chicks in the blank group and the H9N2 group were injected with the same volume of PBS per day to exclude variables other than experimental factors. Subsequently, the chicks in the H9N2 group and the protein group were challenged with the virus. The chicks in the challenge group and the protein group were inoculated with 200 μL of H9N2 subtype avian influenza virus (A / chicken / Shanxi / 1.23 TGRL003-O / 2019, hemagglutination titer of 2 6TCID 50 was 10 4.5 TCID 50 / mL, the blank group was inoculated with the same volume of PBS in the same way, and the weight change and clinical symptoms of each group of chickens were monitored and recorded daily.

[0085] 2. Sample collection and processing

[0086] Pharyngeal swabs of chickens in the challenge group were collected on days 3, 7 and 14, blown and mixed, then centrifuged, 200 μL of supernatant was aspirated, 20 μL of proteinase K was added, and the sample was placed in a rapid magnetic bead method DNA / RNA extraction kit for RNA extraction. After the program ended, the sample was aspirated and reverse transcribed into cDNA. Using a 2.5 mL syringe, 1-2 mL of subwing venous blood was collected from each group of chickens on days 3, 7 and 14 after challenge, immediately transferred to an anticoagulant tube, and used for subsequent extraction of red blood cell RNA; internal organ nucleic acid extraction: 0.1 g of lung, kidney and bursa of Fabricius were taken into 2 mL centrifuge tubes and 1 mL of normal saline was added, and the high-throughput tissue grinder was used for grinding to extract the tissue sample RNA.

[0087] 3. Verification of animal model

[0088] Using a 2.5 mL syringe, 1-2 mL of subwing venous blood was collected from each group of chickens on days 3, 7 and 14, and placed in a 2 mL centrifuge tube, and after standing, the supernatant was aspirated with a pipette and transferred to a new centrifuge tube. Subsequently, the change in specific antibody levels in the chicken body was detected by hemagglutination inhibition test.

[0089] 4. qRT-PCR detection of viral load and interleukin receptor-associated factor expression level in chickens infected with H9N2 avian influenza virus

[0090] The extracted pharyngeal swab and internal organ RNA, as well as red blood cell RNA, were detected for viral load using qRT-PCR technology, and the cDNA prepared from the red blood cells was detected for interleukin receptor-associated factor expression, following the method of Example 2.

[0091] 5. Results

[0092] The infection and transmission of H9N2 avian influenza virus has a latent period, and on day 3 after challenge, the chickens showed symptoms such as listlessness and loss of appetite. On day 7 after challenge, the chickens showed weight loss and yellow-green feces. The reason for the weight loss of the chickens may be due to a variety of factors, including respiratory symptoms, decreased appetite, and immune system affected. On day 14 after challenge, all symptoms were significantly improved. For example Figure 11As shown, with the increase of days of challenge, the body weight of the chicken showed a trend of first decrease and then increase. The body weight of the protein group was higher than that of the H9N2 virus group. In addition, hemagglutination inhibition test was used to detect whether the test animals were infected with H9N2 avian influenza virus. By detecting the specific antibody level of H9N2 avian influenza virus in serum, it was judged whether the chicken was infected with H9N2 avian influenza virus. As shown in the figure, Figure 12 As shown, the specific antibody titer of the blank group was 2 0 , and the specific antibody level of the challenge group was 2 7 , which proved that the infection model was successfully constructed.

[0093] The virus load in the tissue was as shown in the figure Figure 13 , in the early stage of infection, the virus load in each organ was high, and with the increase of infection days, the virus load gradually decreased. In the H9N2 virus group, the lung and kidney had the highest virus load on the 3rd day after infection with H9N2 virus, and then showed a downward trend, and compared with the H9N2 virus group, the virus load of the protein group decreased.

[0094] The virus load of the pharyngeal and anal swabs was as shown in the figure Figure 14 The virus shedding rules of the oropharyngeal swab and the cloacal swab were basically the same, both reached the peak of virus shedding on the 3rd day, and the virus shedding amount of the pharyngeal swab was higher than that of the cloacal swab, and the virus shedding rules were different due to the difference of the strains. In the early stage of infection, the virus needs a certain time for replication and amplification, and when the virus reaches a certain number in the host cell, it leads to an increase in virus shedding. Another reason may be that H9N2 virus infection can induce immune suppression in the host, leading to an increase in the apoptosis rate of immune cells and impaired immune function. This immune suppression may make the virus more easily replicate and spread in the host, thus leading to an increase in virus shedding. However, with the extension of time, the immune function of the animal body recovers, thus leading to a decrease in virus copy number on the 7th day. Compared with the virus positive control group, the copy number of H9N2 avian influenza virus in the oropharyngeal swab of the protein group decreased on the 3rd day after infection.

[0095] The detection results of the virus load in the red blood cells in the in vivo test were as shown in the figure Figure 15 Compared with the virus positive control group, the copy number of H9N2 avian influenza virus in the protein group significantly decreased on the 7th day after infection.

[0096] The expression level of interleukin receptor-associated factor in chicken red blood cells was as shown in the figure Figure 16As shown, the relative expression of these genes showed dynamic changes at different time points (3 d, 7 d and 14 d) in general. The transcription levels of IL1R2, IL1RL1, IL-7R, IL13RA1, IL17RA and IL18R1 were significantly up-regulated at 3 d, while the transcription levels of IL1R1, IL2RB and NFIL3 were significantly down-regulated. In addition, the rGSTA3 proteome was up-regulated at 3 d in the transcription levels of IL1R2, IL2RB, IL-7R, IL17RA and IL18R1.

[0097] The above-described embodiments are merely preferred ways of the present application, and are not intended to limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope of the present application as defined by the claims.

Claims

1. The application of an rGSTA3 protein in the preparation of an interleukin receptor modulator against avian influenza virus, characterized in that, The CDS sequence of the rGSTA3 protein encoding sequence is shown in SEQ ID NO.1; The avian influenza virus includes the H9N2 subtype of avian influenza virus.

2. The application of an rGSTA3 protein in the preparation of a drug for preventing avian influenza virus, characterized in that, The CDS sequence of the rGSTA3 protein encoding sequence is shown in SEQ ID NO.1; The avian influenza virus includes the H9N2 subtype of avian influenza virus.

3. The application of an rGSTA3 protein in the preparation of a drug for treating avian influenza virus infection, characterized in that, The CDS sequence of the rGSTA3 protein encoding sequence is shown in SEQ ID NO.1; The avian influenza virus includes the H9N2 subtype of avian influenza virus.

4. The application according to any one of claims 1-3, characterized in that, The method for preparing the rGSTA3 protein includes the following steps: The recombinant plasmid containing the rGSTA3 protein coding sequence was transformed into an E. coli expression system, and the expression of the rGSTA3 protein was induced by IPTG. The expressed rGSTA3 protein was purified and concentrated by ultrafiltration to obtain a high concentration of purified rGSTA3 protein.

5. The application according to claim 4, characterized in that, The induction temperature was 37°C.

6. The application according to claim 4, characterized in that, The induction time is 10-12 hours.

7. The application according to claim 4, characterized in that, The method for constructing the recombinant plasmid includes adding restriction enzyme sites and homologous arm sequences to the coding sequence of the rGSTA3 protein to obtain a modified sequence; and ligating the modified sequence to a linearized plasmid after restriction enzyme digestion to obtain the recombinant plasmid.

8. The application according to claim 7, characterized in that, The enzyme digestion was performed by double digestion with restriction endonucleases EcoRI and XhoI.

9. The application according to claim 8, characterized in that, The modified sequence is shown in SEQ ID NO.2.

Images