Liver-targeted protein degradation agent conjugate and application thereof

Abstract

The invention provides a liver-targeted protein degradation agent conjugate and an application of the liver-targeted protein degradation agent conjugate. Specifically, the invention provides a conjugate or a pharmaceutically acceptable salt thereof, and the protein binding conjugate is shown as a formula (A), wherein the variables are as defined herein.

Description

Technical Field

[0001] This application belongs to the pharmaceutical field, specifically relating to a class of liver-targeting protein degradation agent conjugates and their uses. Background Technology

[0002] Liver cancer is a malignant disease that seriously threatens human life and health. Due to the lack of specific drugs, the five-year survival rate for liver cancer patients is only 10%, making the clinical treatment situation extremely challenging. Currently, the main clinical interventions are limited by efficacy and safety, necessitating the development of novel drug intervention methods. BET family proteins play an important role in normal cell growth and cell cycle regulation. Studies have shown that liver cancer cells respond well to BET inhibitors, making them potential targets for liver cancer treatment. However, regrettably, there are currently no approved BET inhibitors. Their main drawbacks are the short duration of action of traditional inhibitors and the existence of certain on-target toxicity, especially platelet toxicity, which is showing a high incidence in clinical practice.

[0003] In summary, there is an urgent need in this field to develop new liver-targeting drugs with low toxicity. Summary of the Invention

[0004] The purpose of this invention is to provide a class of liver-targeting protein degradation agent conjugates and their use in the treatment of liver cancer and liver fibrosis.

[0005] In one aspect of the invention, a conjugate or a pharmaceutically acceptable salt thereof is provided, wherein the conjugate is as shown in formula (A).

[0006]

[0007] in,

[0008] The subscript z is 1, 2, or 3;

[0009] X a and X b One is CH or N, and the other is CH;

[0010] L 1 For the connector part;

[0011] L P It can be a cleavable or incuttable linking group;

[0012] R is absent or represents one or two modifying groups;

[0013] A is R E3 -R Linker -; where R E3 For the E3 ligase ligand moiety, R LinkerFor use with or without the E3 ligase ligand moiety and the BET family protein binding moiety as shown in Formula IA;

[0014]

[0015] L 2 Selected from the following group: amide, carbonyl, C1-8 alkylene amide, C1-8 alkylene carbonyl and C1-15 alkylene;

[0016] Ar is an aromatic ring or a heteroaromatic ring;

[0017] Bm is a ligand of ASGPR.

[0018] In another preferred embodiment, the subscript z is 1 or 2.

[0019] In another preferred embodiment, when z is 2 or 3, each They can be different or the same, but the same is preferred.

[0020] In another preferred embodiment, Bm, L P X a X b A, L 2 Ar is defined in equation (I).

[0021] In another preferred embodiment, when z is 1, the coupling is as shown in formula (I);

[0022]

[0023] Among them, Bm and L 1 L P X a X b A, L 2 Ar is defined below.

[0024] In another preferred embodiment, the coupling is as shown in formula (I).

[0025]

[0026] in,

[0027] X a and X b One is CH or N, and the other is CH;

[0028] L 1 For the connector part;

[0029] L P It can be a cleavable or incuttable linking group;

[0030] R is absent or represents one or two modifying groups;

[0031] A is R E3 -R Linker -; where R E3 For the E3 ligase ligand moiety, R Linker For use with or without the E3 ligase ligand moiety and the BET family protein binding moiety as shown in Formula IA;

[0032]

[0033] L 2 Selected from the following group: amide, carbonyl, C1-8 alkylene amide, C1-8 alkylene carbonyl and C1-15 alkylene;

[0034] Ar is an aromatic ring or a heteroaromatic ring;

[0035] Bm is a ligand of ASGPR.

[0036] In another preferred embodiment, Bm is as shown in equation IB;

[0037]

[0038] in,

[0039] R B1 It can be -NHAc or -OH;

[0040] R B2 It is -OH or -PO3H2;

[0041] W Bn It can be CO or NH;

[0042] L B Each independently as such-(W B1 ) q1 -W Ba -(W B2 ) q2 -W Bb -(W B3 ) q3 -W Bc -(W B4 ) q4 - The divalent group shown; wherein, W Ba W Bb and W Bc Each is independently selected from the following groups: none, O, CO, NH, CONH, and NHCO;

[0043] W B1 W B2 W B3 and W B4Each is independently a C1-3 alkylene (preferably -CH2-) or a C1-2 alkylene -O (preferably -CH2CH2O-);

[0044] q1, q2, q3 and q4 are each independent integers from 0 to 15 (preferably 0, 1, 2, 3, 4, 5 or 6);

[0045] a can be 1, 2, or 3.

[0046] In another preferred embodiment, at least q1 and q2 are not 0.

[0047] In another preferred embodiment, W Ba W Bb and W Bc At least one of them is not zero.

[0048] In another preferred example, q1+q2+q3+q4≥4.

[0049] In another preferred embodiment, each L B They are the same or different.

[0050] In another preferred embodiment, L B The length of the chain ranges from 5 to 20 atoms.

[0051] In another preferred embodiment, Bm is selected from Table B below:

[0052] Table B

[0053]

[0054]

[0055] In another preferred example, X a and X b All are CH.

[0056] In another preferred embodiment, R is absent or represents one or two groups selected from the group consisting of: nitro, deuterium, halogen (such as fluorine, chlorine), C1-4 alkyl (such as methyl), and C1-4 alkoxy (such as methoxy).

[0057] In another preferred embodiment, L P for Among them, the better, To be with L 1 The connection point; To and Connection point of NH in Z; 1 and Z 2 Each is independently either absent (not present) or an amino acid residue, Z 3 and Z 4 Each is an amino acid residue.

[0058] In another preferred embodiment, Z 1 For the absence of glycine residues; and / or, Z 2 The following amino acid residues are absent or selected: L-glutamine residue, D-glutamine residue, L-glutamate residue, D-glutamate residue, L-aspartic acid residue, D-aspartic acid residue, L-alanine residue, D-alanine residue, and glycine residue; and / or, Z 3 Selected from the group consisting of: L-valine residues, D-valine residues, L-alanine residues, D-alanine residues, L-phenylalanine residues, D-phenylalanine residues, and glycine residues; and / or, Z 4 Selected from the following group: L-alanine residue, D-alanine residue, L-citrulline residue, D-citrulline residue, L-asparagine residue, D-asparagine residue, L-lysine residue, D-lysine residue, L-phenylalanine residue, D-phenylalanine residue, and glycine residue.

[0059] In another preferred embodiment, L P Selected from the following table:

[0060]

[0061] in, To be with L 1 The connection point; and To and The connection point.

[0062] In another preferred embodiment, when the subscript z is 1, L 1 It is a bivalent connector. In another preferred embodiment, when the subscript z is 1s, L 1 It is a trivalent connector. In another preferred embodiment, when the subscript z is 1, L 1 It is a tetravalent connector.

[0063] In another preferred embodiment, L 1 -W La -(W L1 ) q1 -W Lb -[(W L2 ) q2 -W Lc -(W L3 ) q3 -W Ld ] z1 -;in,

[0064] W La W Lc and W LdEach is independently selected from the group consisting of: none, W, C1-2 alkylene, C1-2 alkylene-W-, -W-C1-2 alkylene, and C1-2 alkylene-W-C1-2 alkylene;

[0065] W Lb Selected from the following group: none, W, C1-2 alkylene, C1-2 alkylene-W-, -W-C1-2 alkylene, C1-2 alkylene-W-C1-2 alkylene, W 1 C1-2 alkylene-W 1 -W 1 (-C1-2 alkylene-)2, -C1-2 alkylene-W 1 (-C1-2 alkylene-)2, W 2 C1-2 alkylene-W 2 -W 2 (-C1-2 alkylene-)3 and -C1-2 alkylene-W 2 (-C1-2 alkylene-)3;

[0066] in,

[0067] W is independently selected from the following groups: O, S, CO, NH, CONH, NHCO, -C≡C-, -CH=CH- and -NHCONH-;

[0068] W 1 Selected from the following groups: -N=, -CH=, -CON=, -NHCON=;

[0069] W 2 Selected from the following group: =C=;

[0070] W L1 W L2 and W L3 Each is independently a C1-3 alkylene (preferably -CH2-) or a C1-2 alkylene -O-C1-2 alkylene (preferably -CH2OCH2-);

[0071] q1, q2 and q3 are each independent integers from 0 to 20 (preferably integers from 1 to 16);

[0072] The subscript z1 is 1, 2 or 3 (preferably 1 or 2).

[0073] In another preferred embodiment, when z1 is 1, W Lb Definition same as W La W Lc and W Ld .

[0074] In another preferred embodiment, when z1 is 1, W LbSelected from the group consisting of: none, W, C1-2 alkylene, C1-2 alkylene-W-, -W-C1-2 alkylene, and C1-2 alkylene-W-C1-2 alkylene.

[0075] In another preferred embodiment, when z1 is 2, W Lb Selected from the following group: W 1 C1-2 alkylene-W 1 -W 1 (-C1-2 alkylene-)2, and -C1-2 alkylene-W 1 (-C1-2 alkylene-)2 is absent.

[0076] In another preferred embodiment, when z1 is 3, W Lb Selected from the following group: W 2 C1-2 alkylene-W 2 -W 2 (-C1-2 alkylene-)3 and -C1-2 alkylene-W 2 (-C1-2 alkylene)3.

[0077] In another preferred embodiment, the subscript z1 is the same as the subscript z.

[0078] In another preferred embodiment, when the subscript z1 is 1, L 1 -W La -(W L1 ) q1 -W Lb -(W L2 ) q2 -W Lc -(W L3 ) q3 -W Ld -

[0079] In another preferred embodiment, L 1 -W La -(W L1 ) q1 -W Lb -(W L2 ) q2 -W Lc -(W L3 ) q3 -W Ld -;in,

[0080] W La W Lb W Lc and W LdEach of the following is independently selected: none, W, C1-2 alkylene, C1-2 alkylene-W-, -W-C1-2 alkylene, and C1-2 alkylene-W-C1-2 alkylene; wherein W is independently selected from the following: O, S, CO, NH, CONH, NHCO, -C≡C-, -CH=CH- and -NHCONH-;

[0081] W L1 W L2 and W L3 Each is independently a C1-3 alkylene (preferably -CH2-) or a C1-2 alkylene -O-C1-2 alkylene (preferably -CH2OCH2-);

[0082] q1, q2 and q3 are each independent integers from 0 to 20 (preferably integers from 1 to 16).

[0083] In another preferred embodiment, W La For the end connected to Bm, and W La Selected from the group consisting of NH, CO, -NH-C1-2 alkylene, -CO-C1-2 alkylene, wherein CO or NH is connected to Bm.

[0084] In another preferred embodiment, W Ld To be with L P One end of the connection, and W Ld Selected from the following groups: None, CO, CONH.

[0085] In another preferred embodiment, q1, q2, and q3 are each independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15.

[0086] In another preferred embodiment, L 1 -W La -(W L1 ) q1 -W Ld -or L 1 -W La -(W L1 ) q1 -W Lb -(W L2 ) q2 -W Ld -

[0087] In another preferred embodiment, L 1 The length is 5 to 50 chain atoms; preferably, 8 to 40 chain atoms.

[0088] In another preferred embodiment, L 1 Selected from the following table:

[0089]

[0090] Where n and m are defined the same as q1, q2 and q3; To be with L P The connection point; This is the connection point with Bm.

[0091] In another preferred embodiment, L 1 When it is a monovalent connector, L 1 Selected from the following table:

[0092]

[0093] In another preferred embodiment, L 1 When it is a bivalent connector, L 1 Selected from the following table:

[0094]

[0095]

[0096] In another preferred embodiment, L 1 When it is a trivalent connector, L 1 Selected from the following table:

[0097]

[0098] In another preferred example, n and m are each an independent integer from 1 to 15.

[0099] In another preferred embodiment, n is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13.

[0100] In another preferred embodiment, m is 1, 2, 3, 4, or 5.

[0101] In another preferred embodiment, the BET family protein binding portion represented by formula IA is as shown in formula IA-1 or IA-2.

[0102]

[0103] In another preferred embodiment, the BET family protein binding site represented by formula IA is shown in IA-2.

[0104] In another preferred embodiment, L 2 In this context, the amide is -CONH-, -CON(C1-8 alkyl)-, and / or the carbonyl group is -CO-.

[0105] In another preferred embodiment, L 2 In the amide, the amino group is linked to A.

[0106] In another preferred embodiment, L2 Selected from the following groups: -NHCO-, -(CH2) m - and -CO-; where m is an integer from 1 to 12.

[0107] In another preferred embodiment, the aromatic ring or heteroaromatic ring is substituted or unsubstituted.

[0108] In another preferred embodiment, Ar is a C6-10 aromatic ring or a 5- to 10-membered heteroaromatic ring (preferably, the heteroaromatic ring is a nitrogen-containing heteroaromatic ring, more preferably, the nitrogen-containing heteroaromatic ring contains only nitrogen atoms as heteroatoms); preferably, Ar is a benzene ring or a 5- or 6-membered nitrogen-containing heteroaromatic ring (such as pyridine).

[0109] In another preferred embodiment, the C6-10 aromatic ring or the 5- to 10-membered heteroaromatic ring is substituted or unsubstituted.

[0110] In another preferred embodiment, the benzene ring or the 5- or 6-membered nitrogen-containing heteroaromatic ring is substituted or unsubstituted.

[0111] In another preferred embodiment, in Ar, the substitution means that one or more hydrogen atoms in the group are replaced by substituents selected from the group consisting of halogens and C1-4 alkyl groups.

[0112] In another preferred embodiment, Ar is

[0113] In another preferred embodiment, R Linker This is a linker that is either absent or used to connect the E3 ligase ligand portion to the BET family protein binding portion as shown in Formula IA.

[0114] In another preferred embodiment, R Linker Selected from the following group:

[0115] in,

[0116] Representative and The junction of the middle methylene group;

[0117] * Represents R E3 Connection position

[0118] n is an integer from 0 to 20 (preferably, an integer from 3 to 13, such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13; even better, 7, 8, 9, 10 or 11).

[0119] In another preferred embodiment, R Linker for

[0120] in,

[0121] Representative and The junction of the middle methylene group;

[0122] * Represents R E3 Connection position

[0123] n is an integer from 0 to 20 (preferably, an integer from 3 to 13, such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13; even better, 7, 8, 9, 10 or 11).

[0124] In another preferred embodiment, R E3 Selected from the following group:

[0125]

[0126]

[0127] Among them, W E3 Selected from the following group: NH, divalent groups formed by click chemical reactions (such as...) In another preferred embodiment, R E3 Selected from the following group:

[0128]

[0129] in,

[0130] R 1 It is an H or C1-3 alkyl group;

[0131] Representative and The junction of the methylene group.

[0132] In another preferred example, A is selected from the following group:

[0133]

[0134] in,

[0135] n is an integer from 0 to 20 (preferably, an integer from 3 to 13, such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13; more preferably, 7, 8, 9, 10 or 11);

[0136] Representative and L 2 The connection point; and Representative and The junction of the methylene group. In another preferred embodiment,

[0137] Selected from the following group:

[0138]

[0139] In another preferred embodiment, the coupling agent is selected from Table A.

[0140]

[0141]

[0142]

[0143] In a second aspect of the invention, a pharmaceutical composition is provided comprising (i) a conjugate as described in the first aspect or a pharmaceutically acceptable salt thereof, and (ii) one or more pharmaceutically acceptable carriers.

[0144] In another preferred embodiment, the pharmaceutical composition further includes one or more additional therapeutic agents.

[0145] In another preferred embodiment, the therapeutic agent is a drug used to treat or prevent liver disease or its complications.

[0146] In another preferred embodiment, the additional therapeutic agent is a PD1 / PD-L1 inhibitor.

[0147] In another preferred embodiment, the additional therapeutic agent is a kinase inhibitor.

[0148] In another preferred embodiment, the kinase inhibitor is selected from the group consisting of VEGFR2 inhibitors, VEGFR3 inhibitors, PDGFRβ inhibitors, FLT3 inhibitors, c-Kit inhibitors, or combinations thereof.

[0149] In another preferred embodiment, the additional therapeutic agent is sorafenib.

[0150] In a third aspect of the invention, a pharmaceutical combination is provided, comprising: (1) a conjugate as described in the first aspect or a pharmaceutically acceptable salt thereof and (2) one or more additional therapeutic agents.

[0151] In another preferred embodiment, the drug combination is used to treat or prevent liver diseases; wherein the liver diseases are liver cancer and liver fibrosis.

[0152] In another preferred embodiment, the additional therapeutic agent is as defined above.

[0153] In a fourth aspect of the invention, a kit is provided comprising: (1) a conjugate as described in the first aspect or a pharmaceutically acceptable salt thereof and (2) one or more additional therapeutic agents.

[0154] In another preferred embodiment, the kit is used to treat or prevent liver diseases; wherein the liver diseases are liver cancer and liver fibrosis.

[0155] In another preferred embodiment, the additional therapeutic agent is as defined above.

[0156] In a fifth aspect of the invention, there is provided the use of the conjugate as described in the first aspect or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating or preventing liver diseases; wherein the liver diseases are liver cancer and liver fibrosis.

[0157] In another preferred embodiment, the conjugate can also be used in combination with other therapeutic agents.

[0158] In another preferred embodiment, the additional therapeutic agent is as defined above.

[0159] In a sixth aspect of the invention, a method for treating or preventing liver disease is provided, the method comprising administering to a subject in need a therapeutically effective amount of the conjugate as described in the first aspect or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the conjugate as described in the first aspect or a pharmaceutically acceptable salt thereof.

[0160] In another preferred embodiment, the liver disease is as defined above.

[0161] In another preferred embodiment, the method further includes administering one or more additional therapeutic agents to the subject in need.

[0162] In another preferred embodiment, the one or more additional therapeutic agents may be administered to the subject before, simultaneously with, or after the protein binding conjugate as described in the first aspect or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the protein binding conjugate as described in the first aspect or a pharmaceutically acceptable salt thereof.

[0163] In another preferred embodiment, the additional therapeutic agent is as defined above.

[0164] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0165] Figure 1 The protein degradation activity of representative conjugates was demonstrated.

[0166] Figure 2 The differences in degradation activity of representative conjugates were shown.

[0167] Figure 3 The study demonstrated the differences in in vitro antitumor activity of representative conjugates.

[0168] Figure 4The in vivo antitumor activity of representative conjugates was demonstrated.

[0169] Figure 5 The in vivo platelet toxicity of representative conjugates was demonstrated.

[0170] Figure 6 The in vitro anti-hepatic fibrosis activity of the representative conjugates was demonstrated.

[0171] Figure 7 The in vivo anti-hepatic fibrosis activity of the representative conjugates was demonstrated. Detailed Implementation

[0172] Through long-term and in-depth research, the inventors have discovered a novel class of liver-targeting protein degrading agent conjugates. These protein degrading agent conjugates, using ethers, exhibit excellent in vitro and in vivo stability. Based on this, the inventors have completed this invention.

[0173] the term

[0174] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. As used herein, when referring to a specifically enumerated numerical value, the term “about” means that the value can vary from the enumerated value by no more than 1%. For example, the expression “about 100” includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0175] As used in this article, the term "chain atom" refers to an atom located on the main chain in a chain-like group.

[0176] As used herein, unless otherwise defined, the term "alkyl" itself, or as part of another substituent, refers to a straight-chain or branched hydrocarbon group having a specified number of carbon atoms (i.e., C64 ... 1-6 (Indicates 1-6 carbons). Preferably, the alkyl group specifically has 1-4 carbons, i.e., C1-C2. 1-4 Alkyl groups. Examples of alkyl groups include, but are not limited to: methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, sec-butyl, n-pentyl, n-hexyl, n-heptyl, n-octyl, etc.

[0177] As used herein, the term "alkylene" itself, or as part of another substituent, refers to a divalent group derived from an alkane as defined above. Alkylenes typically have 1-24 (preferably 1-10) carbon atoms.

[0178] As used herein, the term "cycloalkyl" refers to a hydrocarbon ring (preferably fully saturated) having a specified number of ring atoms (e.g., C3-20 cycloalkyl, C4-6 cycloalkyl) and having no more than one double bond between the ring apexes. This term also includes bicyclic and polycyclic hydrocarbon rings, such as bridged rings, fused rings, spirocyclic rings, etc. The term "heterocyclic alkyl" refers to a cycloalkyl ring having a specified number of ring atoms (e.g., 4-20 membered heterocyclic alkyl) and containing one to five heteroatoms selected from N, O, and S, wherein the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen atom is optionally quaternized. Heterocyclic alkyl can be monocyclic, bicyclic, or polycyclic systems (e.g., bridged rings, fused rings, spirocyclic rings, etc.). Non-limiting examples of heterocyclic alkyl groups include pyrrolidine, imidazoline, pyrazolidine, butyrolactam, valproic acid, imidazolidinone, hydantoin, dioxolane, benzodiimide, piperidine, 1,4-dioxane, morpholine, thiomorpholine, thiomorpholine-S-oxide, thiomorpholine-S,S-oxide, piperazine, pyran, pyridone, 3-pyrrolidine, thiaran, pyranone, tetrahydrofuran, tetrahydrothiophene, quinine ring, etc. Heterocyclic alkyl groups can be attached to the rest of the molecule via a cyclic carbon or heteroatom.

[0179] Unless otherwise stated, the term "aryl" or "aromatic ring" refers to a polyunsaturated (usually aromatic) hydrocarbon group, which may be a monocyclic or fused together or covalently linked polycyclic (up to three rings). The term "heteroaryl" or "heteroaromatic ring" refers to an aryl group (or ring) containing 1 to 5 heteroatoms selected from N, O, and S, wherein the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen atom is optionally quaternized. Heteroaryl groups may be attached to the rest of the molecule by carbon atoms or heteroatoms. Non-limiting examples of aryl groups include phenyl, naphthyl, and biphenyl, while non-limiting examples of heteroaryl groups include pyridyl, pyrazinyl, pyrazinyl, pyrimidinyl, triazinyl, quinolinyl, quinoxalinyl, quinazolinyl, terpineyl, phthalazinyl, benzotriazinyl, purine, benzimidazolyl, benzopyrazolyl, benzotriazolyl, benzoisoxazolyl, and isobenzofuranyl. furyl), isoindolyl, indoleyl, benzotriazinyl, thienopyridyl, thienopyrimidinyl, pyrazolopyrimidinyl, imidazopyridine, benzothiazolyl, benzofuranyl, benzothiaphenyl, indolyl, quinolinyl, isoquinolinyl, isothiazolyl, pyrazolyl, indazoleyl, pteridinyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, thiadiazolyl, pyrroleyl, thiazolyl, furanyl, thiaphenyl, etc.

[0180] In some embodiments, the terms above (such as alkyl, aryl / aromatic, and heteroaryl / heteroaryl) will include substituted and unsubstituted forms of the specified group. Preferred substituents for each type of group are provided below. For brevity, the terms aryl and heteroaryl will refer to the substituted or unsubstituted forms as provided below, while the term "alkyl" and the associated aliphatic group refer to the unsubstituted form unless specified otherwise.

[0181] The substituents of alkyl groups (including those commonly referred to as alkylene, alkenyl, ynyl, and cycloalkyl) can be a variety of groups selected from the group consisting of: -halogen, -OR a -NR a R b -SR a -SiR a R b R c -OC(O)R a -C(O)R a -CO2R a -CONR a R b -OC(O)NR a R b -NR b C(O)R a -NR a -C(O)NR b R c -NR b C(O)2R a -NH-C(NH2)=NH, -NR a C(NH2)=NH、-NH-C(NH2)=NR a -S(O)R a -S(O)2R a -S(O)2NR a R b -NR a S(O)2R b -CN and -NO2, in quantities ranging from zero to (2M'+1), where M' is the total number of carbon atoms in this group. R a R b and R c Each independently represents hydrogen, and the unsubstituted C. 1-8 Alkyl, unsubstituted heteroalkyl, unsubstituted aryl, aryl substituted with 1-3 halogens, unsubstituted C 1-8 Alkyl, C 1-8 Alkoxy or C 1-8 Thioalkoxy, or unsubstituted aryl-C 1-4 Alkyl group. When R a and Rb When attached to the same nitrogen atom, they can combine with the nitrogen atom to form 3-, 4-, 5-, 6-, or 7-membered rings. For example, -NR a R b This refers to a group including 1-pyrrolidinyl and 4-morpholinyl. The term "acyl," used alone or as part of another group, refers to a group in which the two substituents on the carbon closest to the junction of the group are replaced by =O groups (e.g., -C(O)CH3, -C(O)CH2CH2OR). a wait).

[0182] Similarly, the substituents of aryl (aromatic ring) and heteroaryl (heteroary ring) compounds are diverse and are typically selected from: -halogen, -OR a -OC(O)R a -NR a R b -SR a -R a -CN, -NO2, -CO2R a -CONR a R b -C(O)R a -OC(O)NR a R b -NR b C(O)R a -NR b C(O)2R a -NR a -C(O)NR b R b '、-NH-C(NH2)=NH、-NR a C(NH2)=NH、-NH-C(NH2)=NR a -S(O)R a -S(O)2R a -S(O)2NR a R b -NR a S(O)2R b -N3, perfluoro(C1-C4)alkoxy and perfluoro(C1-C4)alkyl, in quantities ranging from zero to the total number of open valences on the aromatic ring system; where R a R b and R b 'Independently selected from hydrogen, C 1-8 Alkyl, C 3-6 cycloalkyl, C 2-8 alkenyl, C 2-8 Alkynyl, unsubstituted aryl, and heteroaryl, (unsubstituted aryl)-C 1-4Alkyl and unsubstituted aryloxy-C 1-4 Alkyl groups. Other suitable substituents include each of the above aryl substituents attached to the ring atom via an alkylene chain of 1-4 carbon atoms.

[0183] As used herein, the term "amino acid residue" refers to the group formed by removing an H atom from the N-terminal -NH2 group and removing an OH atom from the C-terminal -COOH group of an amino acid. Generally, the segment of an amino acid (residue) including the N-terminus and C-terminus is called the main chain, while the part that determines the specific type of amino acid is called the side chain. Unless otherwise defined, amino acids in this document include both native and non-native amino acids, including D-type and / or L-type amino acids. Examples of amino acids include, but are not limited to, Ala (A), Arg I, Asn (N), Asp (D), Cys (C), Gln (Q), GI (E), Gly (G), His (H), Ile (I), Leu (L), Lys (K), Met (M), Phe (F), Pro (P), Ser (S), Thr (T), Trp (W), Tyr (Y), and Val (V). Preferably, in this document, the amino acid is selected from the group consisting of: L-glycine (L-Gly), L-alanine (L-Ala), β-alanine (β-Ala), L-glutamic acid (L-Glu), L-aspartic acid (L-Asp), L-histidine (L-His), L-arginine (L-Arg), L-lysine (L-Lys), L-valine (L-Val), L-serine (L-Ser), and L-threonine (L-Thr); furthermore, when the amino acid has two or more amino groups and / or two or more carboxyl groups, the term also includes groups formed by removing one H from -NH2 and -OH from -COOH on different carbon atoms, such as the divalent group -C(O)-(CH2)2-C(COOH)-NH- formed by removing one H from -NH2 and non-α-COOH of glutamic acid respectively.

[0184] In this document, unless otherwise defined, bonds indicated by dashed lines or marked with wavy lines represent positions that connect to other parts of the molecule.

[0185] For the compounds presented herein, a bond from a substituent (typically an R group) to the center of the ring will be understood as a bond that provides a connection at any available vertex of the aromatic ring.

[0186] In this invention, the term "pharmaceuticalally acceptable" refers to a substance that is suitable for use in humans and / or animals without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), i.e., a substance with a reasonable benefit / risk ratio.

[0187] In this invention, the term "effective amount" or "therapeutic effective amount" refers to the amount of a therapeutic agent that treats, alleviates, or prevents a target disease or condition, or the amount that exhibits a detectable therapeutic or preventative effect. The precise effective amount for a given subject depends on that subject's body size and health status, the nature and severity of the condition, and the chosen therapeutic agent and / or combination of therapeutic agents. Therefore, pre-specifying an accurate effective amount is useless. However, for a given condition, the effective amount can be determined using routine experiments, and a clinician can judge it accordingly.

[0188] Unless otherwise specified, all compounds mentioned in this invention are intended to include all possible optical isomers, such as compounds with a single chirality, or mixtures of various chiral compounds (i.e., racemates). In all compounds of this invention, each chiral carbon atom may optionally be in the R configuration or the S configuration, or a mixture of the R and S configurations.

[0189] As used herein, the term "pharmaceutically acceptable salt" refers to a salt formed by the compounds of the present invention with an acid or base that is suitable for use as a medicine. Pharmaceutically acceptable salts include both inorganic and organic salts. A preferred class of salts are those formed by the compounds of the present invention with an acid. Suitable acids for forming salts include, but are not limited to: inorganic acids such as hydrochloric acid, hydrobromic acid, hydrofluoric acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenesulfonic acid, and benzenesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid.

[0190] Unless otherwise specified, the term “amino acid” as used in this article is intended to include any common amino acid, such as aspartic acid, glutamic acid, cysteine, asparagine, phenylalanine, glutamine, tyrosine, serine, methionine (methionine), tryptophan, glycine, valine, leucine, alanine, isoleucine, proline, threonine, histidine, lysine, and arginine.

[0191] The couplings, compositions containing them, and applications of the present invention

[0192] As used herein, the term "conjugate" (also referred to herein as "conjugate of the present invention" or "liver-targeting protein degrader conjugate") means the conjugate as described in the first aspect.

[0193] Protein degradation technology, due to its unique mechanism of action, can maintain a relatively long-lasting pharmacological effect. However, protein degraders themselves lack tissue targeting, and their associated systemic toxicity is a major obstacle in drug development. This invention develops a novel class of liver-targeting protein degrader conjugates by conjugating protein degraders with small-molecule ligands of the desialyl glycoprotein receptor (ASGPR) via a linker fragment. Utilizing the highly specific expression of ASGPR in the liver, a more precise drug action mechanism is achieved than with traditional drugs.

[0194] In some respects, this article provides a liver-targeting protein degrader conjugate of formula (I) or a pharmaceutically acceptable salt thereof.

[0195]

[0196] Among them, L 1 L P L 2 R, A, Ar and Bm are defined as in the first aspect.

[0197] As used herein, protein degraders refer to a class of compounds that can target and induce protein degradation via the ubiquitination-proteasome pathway. Generally, these degraders consist of a ligand (as shown in Formula IA) of the target protein (e.g., BET family proteins) and an E3 ubiquitin ligase ligand (e.g., R...). E3 For example, through a linker (such as R) Linker The bifunctional small molecule formed by linking together can simultaneously bind to the target protein to be degraded and the E3 ubiquitin ligase, so that the target protein is brought close to the E3 ubiquitin ligase and is ubiquitinated and labeled, and then recognized and degraded by the proteasome in the cell.

[0198] In some implementations, L 1 For bridging; L P R represents a polypeptide fragment; R represents a modifying group; A represents an E3 ligase ligand and linker; L represents... 2 It is an amide, carbonyl, or alkyl chain; Ar is an aromatic ring or heterocyclic ring; Bm is a ligand of ASGPR.

[0199] In some implementations, L 1 Selected from, but not limited to, the group consisting of:

[0200]

[0201] Where: n and m are integers from 1 to 10; For L P The connection point; This is the connection point for Bm.

[0202] In some implementations, L P Selected from, but not limited to, the group consisting of the following

[0203]

[0204] Ideally, Z 1 Z 2 Z 3 and Z 4 Each amino acid residue is either absent or has an L- or D-configuration, provided that Z... 1 Z 2 Z 3 and Z 4 At least two of them are amino acid residues; To be with L 1 The connection point; and This is the connection point for the aniline portion on the right.

[0205] In some implementation schemes, Z 1 The presence or absence of glycine; and / or Z 2 The group consisting of or not present, or selected from, the following: and / or L-glutamine, D-glutamine, L-glutamic acid, D-glutamic acid, L-aspartic acid, D-aspartic acid, L-alanine, D-alanine, and glycine; and / or Z 3 Choose from the following groups: L-valine, D-valine, L-alanine, D-alanine, L-phenylalanine, D-phenylalanine, and glycine; and / or Z. 4 Choose from the following groups: L-alanine, D-alanine, L-citrulline, D-citrulline, L-asparagine, D-asparagine, L-lysine, D-lysine, L-phenylalanine, D-phenylalanine, and glycine.

[0206] In some implementations, L 2 Selected from, but not limited to, the group consisting of: -NHCO-, -(CH2) m - and -CO-; where m is an integer from 1 to 12.

[0207] In some embodiments, R is absent or represents one or two groups selected from the group consisting of: nitro, deuterium, fluorine, chlorine, methyl, and methoxy. (R is 1-2).

[0208] In some implementations, A is selected from, but is not limited to, the group consisting of:

[0209]

[0210] Preferably: n is an integer between 0 and 10; To be with L 2 The connection point; and This is the connection point with the left benzyl portion.

[0211] In some implementations, Ar is a substituted or unsubstituted aromatic ring or heteroaromatic ring.

[0212] In some implementations, the ligands of the ASGPR are selected from Table B.

[0213] In some implementations, the coupling agent is selected from Table A.

[0214] In some implementations, the coupling agent is selected from Table A above.

[0215] In some implementation schemes, z, L 1 L P L 2 A, R, Ar and Bm are each independently the corresponding groups in the specific couplings or specific compounds prepared in the examples shown in Table A.

[0216] In some implementations, L 1 L P L 2 A, R, Ar and Bm are each independently the corresponding groups in the specific couplings or specific compounds prepared in the examples shown in Table A.

[0217] Pharmaceutical Compositions and Administration

[0218] Because the conjugates provided by this invention (sometimes also called protein degrader conjugates or liver-targeting protein degrader conjugates) have excellent ability to target and degrade BET family proteins in liver diseases and have anti-tumor activity, and the activity of the conjugates is highly correlated with ASGPR expression, the conjugate drugs of this invention can be used to treat or prevent various liver diseases (such as liver cancer, liver fibrosis, etc.).

[0219] The aforementioned conjugates can be administered to subjects (e.g., humans) in therapeutically effective amounts via appropriate routes. For conjugate drugs (or antibody-drug conjugates), subjects requiring treatment may be patients at risk or suspected of having a condition related to the activity or expression level of a specific antigen. Such patients can be identified through routine physical examinations.

[0220] Conventional methods, known to those skilled in the art of medicine, can be used to administer the pharmaceutical composition to a subject, depending on the type of disease to be treated or the site of the disease. This composition can also be administered via other conventional routes, such as parenteral administration, oral administration, via inhalation spray, topical administration, rectal administration, nasal administration, oral administration, vaginal administration, or via implantation. The term "parenteral" as used herein includes subcutaneous, intradermal, intravenous, intramuscular, intra-articular, intra-articular, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques. Furthermore, it can be administered via injectable reservoir routes, such as using injectable or biodegradable materials and methods with 1-, 3-, or 6-month reservoirs.

[0221] Injectable compositions may contain various carriers such as vegetable oils, dimethylactamide, dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethanol, polyols (glycerol, propylene glycol, liquid polyethylene glycol, etc.). For intravenous injection, water-soluble antibodies may be administered via infusion, thereby delivering a pharmaceutical formulation containing the antibody and physiologically acceptable excipients. Physiologically acceptable excipients may include, for example, 5% glucose, 0.9% saline, Ringer's solution, or other suitable excipients. Intramuscular preparations, such as sterile formulations of a suitable soluble salt form of the antibody, may dissolve and administer pharmaceutical excipients such as aqueous injections, 0.9% saline, or 5% glucose solutions.

[0222] The pharmaceutical compositions of the present invention contain a safe and effective amount of the conjugate of the present invention and a pharmaceutically acceptable carrier. Such carriers include (but are not limited to): saline, buffer solutions, glucose, water, glycerol, ethanol, and combinations thereof. Generally, pharmaceutical formulations should be matched to the route of administration. The pharmaceutical compositions of the present invention can be formulated as solutions, for example, prepared using conventional methods with physiological saline or aqueous solutions containing glucose and other excipients. The pharmaceutical compositions are preferably manufactured under aseptic conditions. The dosage of the active ingredient is a therapeutically effective amount.

[0223] The effective amount of the conjugate described in this invention can vary depending on the administration method and the severity of the disease to be treated. A preferred effective amount can be determined by those skilled in the art based on various factors (e.g., through clinical trials). These factors include, but are not limited to: the pharmacokinetic parameters of the antibody-drug conjugate, such as bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, and the route of administration. Generally, satisfactory results are obtained when the conjugate of this invention is administered at a dose of approximately 0.01 mg to 50 mg / kg animal body weight (preferably 0.1 mg to 20 mg / kg animal body weight). For example, due to the urgency of the treatment condition, several separate doses can be administered monthly, or the dose can be reduced proportionally.

[0224] The compounds of this invention can be administered alone or in combination with other pharmaceutically acceptable therapeutic agents or adjuvants.

[0225] When using the pharmaceutical composition, a safe and effective amount of the antibody-drug conjugate of the present invention is applied to the mammal (such as a human) requiring treatment. The dosage administered is the pharmaceutically considered effective dose. For a person weighing 60 kg, the single dose is typically 1–2000 mg, preferably 5–500 mg. Of course, the specific dosage should also take into account factors such as the route of administration and the patient's health condition, which are all within the scope of the skills of a skilled physician.

[0226] The main advantages of this invention include:

[0227] (a) The conjugates of the present invention have good in vivo and in vitro stability;

[0228] (b) The conjugates of the present invention have significantly improved hydrophilicity, overcoming the bottleneck of difficult administration of traditional protein degrading agents.

[0229] (c) In in vitro antitumor experiments, the cell activity of the conjugate of the present invention was positively correlated with ASGPR expression, suggesting that the drug safety was improved.

[0230] (d) In vivo studies have shown that long-term administration of the conjugate of the present invention alone or in combination with sorafenib can not only effectively inhibit tumor growth, but also significantly alleviate BET inhibitor-related hematologic toxicity.

[0231] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0232] Example 1: Synthesis of a novel liver-targeting degradation agent conjugate

[0233] Option 1. Synthesis of key intermediates

[0234]

[0235] General Step 1: Compound 2 (1.0 equivalent), the corresponding benzyl monocarboxylate 1A-F (1.1 equivalent), and N,N-diisopropylethylamine (4.0 equivalent) were dissolved in dichloromethane (10 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.05 equivalent) was added, and the mixture was reacted overnight at room temperature. After the reaction was complete as monitored by TLC, the mixture was poured into water, extracted with dichloromethane, and the organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-8%) to obtain the corresponding intermediate. This intermediate (1.0 equivalent) and 10% palladium on carbon (50 mg) were added to methanol (10 mL), and the mixture was reacted overnight at room temperature under hydrogen atmosphere. After the reaction was monitored by LC-MS until it was complete, the mixture was filtered, and the filtrate was concentrated under reduced pressure to obtain the corresponding title compound (yield 40-60%).

[0236] Step 2.1: Synthesis of Compound 3A

[0237] The title compound (320 mg) was obtained from compounds 2 and 1A using general step 2. 1H NMR (400MHz, DMSO-d6) δ7.91-7.73(m,9H),6.78(s,1H),5.21(d,J=3.4Hz,3H),4.97(dd,J=1 1.3,3.4Hz,3H),4.49(d,J=8.4Hz,3H),4.07-3.99(m,11H),3.93-3.78(m,5H),3.74-3.67(m ,3H),3.61-3.53(m,20H),3.44-3.41(m,3H),3.07-3.00(m,12H),2.29(t,J=6.4Hz,6H),2.1 1(s,9H),2.05(t,J=7.1Hz,6H),2.00(s,9H),1.89(s,9H),1.78(s,9H),1.56-1.42(m,18H).

[0238] Step 2.2: Synthesis of compound 3B

[0239] The title compound (307 mg) was obtained from compounds 2 and 1B using general step 2. 1 H NMR (400MHz, DMSO-d6) δ7.90-7.82(m,6H),7.79-7.73(m,3H),6.78(s,1H),5.22(d,J=3.4Hz ,3H),4.97(dd,J=11.2,3.4Hz,3H),4.49(d,J=8.5Hz,3H),4.07-3.98(m,11H),3.93-3.78(m ,5H),3.76-3.67(m,3H),3.58-3.39(m,39H),3.09-2.98(m,12H),2.29(t,J=6.4Hz,6H),2.1 1(s,9H),2.05(t,J=7.1Hz,6H),2.00(s,9H),1.90(s,9H),1.78(s,9H),1.55-1.41(m,18H).

[0240] Step 2.3: Synthesis of compound 3C

[0241] The title compound (201 mg) was obtained from compounds 2 and 1C using general step 2.

[0242] Step 2.4: Synthesis of Compound 3D

[0243] The title compound (352 mg) was obtained from compounds 2 and 1D using general step 2. 1H NMR (400MHz, DMSO-d6) δ7.89-7.80 (m, 6H), 7.75 (t, J = 5.7Hz, 3H), 7.00 (s, 1H), 5.22 (d, J = 3.4Hz, 3H), 4. 97(dd,J=11.2,3.4Hz,3H),4.49(d,J=8.5Hz,3H),4.07-4.00(m,9H),3.93-3.82(m,3H),3.76-3.67(m,3 H),3.58-3.50(m,12H),3.45-3.36(m,3H),3.07-2.98(m,12H),2.28(t,J=6.4Hz,6H),2.18(t,J=7.4Hz, 2H),2.11(s,9H),2.07-1.98(m,17H),1.90(s,9H),1.78(s,9H),1.56-1.44(m,20H),1.26-1.21(m,10H).

[0244] Step 2.5: Synthesis of compound 3E

[0245] The title compound (374 mg) was obtained from compounds 2 and 1E using general step 2. 1 H NMR (400MHz, DMSO-d6) δ11.98(s,1H),7.92-7.82(m,6H),7.78(t,J=5.6Hz,3H),7.01(s,1H),5.22(d,J=3.4Hz ,3H),4.97(dd,J=11.2,3.4Hz,3H),4.49(d,J=8.4Hz,3H),4.06-3.99(m,9H),3.92-3.84(m,3H),3.74-3.68(m ,3H),3.57-3.50(m,12H),3.44-3.39(m,3H),3.07-3.00(m,12H),2.28(t,J=6.4Hz,6H),2.18(t,J=7.4Hz,2H) ,2.11(s,9H),2.05(t,J=7.2Hz,8H),2.00(s,9H),1.90(s,9H),1.78(s,9H),1.54-1.42(m,22H),1.23(s,20H).

[0246] Step 2.6: Synthesis of compound 3F

[0247] The title compound (263 mg) was obtained from compounds 2 and 1F using general step 2. 1H NMR(400MHz,DMSO-d6)δ7.88-7.82(m,6H),7.76(t,J=5.5Hz,3H),7.00(s,1H),5.22(d,J=3.4Hz,3H),4 .97(dd,J=11.3,3.4Hz,3H),4.49(d,J=8.4Hz,3H),4.07-3.99(m,9H),3.90-3.84(m,3H),3.73-3.69(m ,3H),3.57-3.50(m,12H),3.44-3.41(m,2H),3.08-2.99(m,12H),2.28(t,J=6.4Hz,6H),2.18(t,J=7.4 Hz,3H),2.11(s,9H),2.07-1.99(m,17H),1.90(s,9H),1.78(s,9H),1.56-1.38(m,24H),1.23(s,38H).

[0248] Scheme 2. Synthesis of couplings 13A, 13B, 13D, 13E, and 13F

[0249]

[0250] Step 1: Synthesis of Compound 5

[0251] Compound 4 (2.00 g, 5.08 mmol) and N,N-diisopropylethylamine (1.68 mL, 10.2 mmol) were dissolved in acetonitrile (40 mL), and ethylsulfonyl chloride (578 μL, 6.10 mmol) was added. The mixture was reacted at room temperature for 2 hours. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (ethyl acetate / dichloromethane = 0-40%) to give the title compound (1.47 g, 70% yield). 1 H NMR (400MHz, DMSO-d6) δ10.09(s,1H),8.10(d,J=6.9Hz,1H),7.59(d,J=8.2Hz,2H),7.37(d,J=8.3Hz,2H),6.73(d,J=8.9Hz,1H),4.72(s,2 H),4.49-4.36(m,1H),3.88-3.78(m,1H),1.99-1.90(m,1H),1.39(s,9H),1.31(d,J=7.0Hz,3H),0.90-0.80(m,6H).HRMS(ESI-TOF):Calcd for C 20 H 31 ClN3O4,[M+H] + ,412.1998,found 412.1998.

[0252] Step 2: Synthesis of Compound 8

[0253] Compound 6 (1.50 g, 2.68 mmol), compound 7 (669 mg, 2.94 mmol), and N,N-diisopropylethylamine (1.77 mL, 10.7 mmol) were dissolved in dichloromethane (60 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.02 g, 2.68 mmol) was added, and the mixture was reacted at room temperature for 1 hour. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (1.40 g, 80% yield). 1 HNMR (400MHz, DMSO-d6) δ9.81(s,1H),8.96(s,1H),8.48(t,J=6.1Hz,1H),7.86(d,J=9.4Hz,1H),7.38(d,J=7.8Hz,1H),6.91(d, J=1.8Hz,1H),6.80(dd,J=7.8,1.8Hz,1H),5.13(d,J=3.6Hz,1H),4.54(d,J=9.4Hz,1H),4.45(t,J=8.0Hz,1H),4.35(s,1H),4.29 (dd,J=16.2,6.5Hz,1H),4.12(dd,J=16.2,5.5Hz,1H),3.69-3.61(m,2H),3.33-3.29(m,2H),2.45(s,3H),2.32-2.22(m,1H),2.1 4-2.07(m,1H),2.07-2.00(m,1H),1.97-1.87(m,1H),1.56-1.44(m,4H),1.28-1.22(m,12H),0.93(s,9H).HRMS(ESI-TOF):Calcd forC 33 H 50 N7O5S, [M+H] + ,656.3594,found 656.3592.

[0254] Step 3: Synthesis of Compound 9

[0255] Compound 8 (1.00 g, 1.52 mmol) and compound 5 (691 mg, 1.68 mmol) were dissolved in N,N-dimethylformamide (20 mL), and potassium carbonate (631 mg, 4.57 mmol) was added. The mixture was reacted at room temperature for 1 hour. After the reaction was monitored by LC-MS until complete, the compound was poured into water, extracted with ethyl acetate, and the organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (610 mg, yield 39%). 1 H NMR (400MHz, DMSO-d6) δ10.06(s,1H),8.99(s,1H),8.48(t,J=6.1Hz,1H),8.09(d,J=7.0Hz,1H),7.88(d,J=9.3Hz,1H),7.62(d,J=8.6Hz,2 H),7.49(d,J=7.8Hz,1H),7.43(d,J=8.3Hz,2H),7.10(d,J=1.7Hz,1H),6.95-6.89(m,1H),6.74(d,J=8.8Hz,1H),5.17-5.12(m,2H),4.59-4 .31(m,5H),4.19(dd,J=16.8,5.4Hz,1H),3.88-3.80(m,1H),3.71-3.60(m,2H),3.33-3.28(m,2H),2.41(s,3H),2.32-2.22(m,1H),2.15-2 .08(m,1H),2.05-2.00(m,1H),1.98-1.87(m,2H),1.57-1.41(m,5H),1.38(s,9H),1.33-1.21(m,15H),0.96-0.80(m,15H).LC-MS(ESI):m / z 1031.5[M+H] + .

[0256] Step 4: Synthesis of Compound 11

[0257] Compound 9 (600 mg, 0.58 mmol) and triphenylphosphine (458 mg, 1.75 mmol) were dissolved in tetrahydrofuran (15 mL) and water (1 mL), and reacted overnight at room temperature under nitrogen protection. After the reaction was completed by LC-MS, the mixture was concentrated under reduced pressure. The residue, compound 10 (306 mg, 0.61 mmol), and N,N-diisopropylethylamine (288 μL, 1.75 mmol) were dissolved in dichloromethane (15 mL) and methanol (2 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (243 mg, 0.64 mmol) was added, and the mixture was reacted at room temperature for 2 hours. After the reaction was completed by LC-MS, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-12%) to give the title compound (476 mg, two-step yield 55%). 1 H NMR (400MHz, DMSO-d6) δ11.93(s,1H),10.06(s,1H),8.98(s,1H),8.48(t,J=6.0H z,1H),8.41(t,J=5.7Hz,1H),8.12-8.05(m,2H),7.92(s,1H),7.87(d,J=9.3Hz,1 H),7.76(s,1H),7.66-7.58(m,3H),7.49(d,J=7.8Hz,1H),7.43(d,J=8.3Hz,2H), 7.30-7.25(m,2H),7.11-7.07(m,1H),6.92(d,J=8.3Hz,1H),6.74(d,J=8.9Hz,1H ),5.95(s,1H),5.18-5.12(m,3H),4.58-4.32(m,6H),4.24-4.15(m,1H),3.88-3. 80(m,1H),3.68-3.61(m,5H),3.18-3.15(m,2H),2.91(s,3H),2.40(s,3H),2.31- 2.22(m,1H),2.16-1.85(m,6H),1.52-1.41(m,4H),1.38(s,9H),1.31(d,J=7.0Hz ,3H),1.26-1.19(m,12H),0.92(s,9H),0.88-0.80(m,6H).HRMS(ESI-TOF):Calcd for C 76 H 97 F2N 12 O 13 S2,[M+H] + ,1487.6702,found 1487.6701.

[0258] Step 5: Synthesis of Compound 12

[0259] Compound 11 (400 mg, 0.27 mmol) was dissolved in dichloromethane (10 mL), and trifluoroacetic acid (2 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS, the solution was concentrated under reduced pressure. The residue was slurryed with diethyl ether to give the title compound (396 mg, 98% yield). LC-MS (ESI): m / z 1387.7 [M+H] + .

[0260] General Step 6: Compound 12 (1.0 equivalent), compounds 3A / 3B / 3D / 3E / 3F (1.0 equivalent), and N,N-diisopropylethylamine (4 equivalent) were dissolved in dimethyl sulfoxide (4 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.1 equivalent) was added, and the mixture was reacted at room temperature for 30 minutes. After the reaction was complete as monitored by LC-MS, lithium hydroxide monohydrate (6.0 equivalent) and water (1.0 mL) were added to the reaction solution, and the mixture was reacted at room temperature for 30 hours. After the reaction was complete as monitored by LC-MS, the title compound was purified by Prep-HPLC (two-step yield 30-50%).

[0261] Step 6.1: Synthesis of Compound 13A

[0262] The title compound (21 mg) was obtained from compounds 12 and 3A via a general synthetic route. 1H NMR (400MHz, DMSO-d6) δ11.94(s,1H),10.05(s,1H),8.98(s,1H),8.48(d,J=6.4Hz,1 H),8.42(d,J=6.2Hz,2H),8.08(d,J=2.5Hz,1H),7.92(s,1H),7.91-7.82(m,4H),7.78 -7.72(m,4H),7.63(dd,J=8.8,4.2Hz,6H),7.53-7.46(m,2H),7.43(d,J=8.4Hz,2H), 7.31-7.25(m,2H),7.09(s,1H),6.95-6.88(m,1H),6.79(s,1H),5.95(s,1H),5.18-5. 11(m,3H),4.63-4.28(m,18H),4.22(d,J=8.4Hz,4H),3.96(s,2H),3.80(s,2H),3.74 -3.49(m,43H),3.32-3.27(m,4H),3.19-3.10(m,2H),3.07-3.00(m,12H),2.91(s,3H) ,2.41(s,3H),2.29(t,J=6.5Hz,7H),2.17-1.88(m,12H),1.80(s,9H),1.54-1.41(m, 22H),1.32(d,J=7.1Hz,3H),1.25-1.20(m,12H),0.93-0.82(m,15H).LC-MS(ESI):m / z 1495.3[(M+2H) / 2] + .

[0263] Step 6.2: Synthesis of Compound 13B

[0264] The title compound (19 mg) was obtained from compounds 12 and 3B via a general synthetic route. 1H NMR(600MHz,DMSO-d6)δ11.93(s,1H),10.03(s,1H),8.98(s,1H),8.47(s,1H),8.39( d,J=7.1Hz,2H),8.07(d,J=2.5Hz,1H),7.92(s,1H),7.85(t,J=5.3Hz,4H),7.78-7.7 1(m,4H),7.63(d,J=8.8Hz,6H),7.52-7.41(m,4H),7.28(d,J=3.9Hz,2H),7.09(s,1H ),6.92(d,J=7.8Hz,1H),6.79(s,1H),5.96(s,1H),5.20-5.11(m,3H),4.62-4.53(m,7 H),4.50-4.33(m,7H),4.32-4.28(m,1H),4.22(d,J=8.4Hz,4H),3.95(s,2H),3.80(s ,2H),3.74-3.39(m,62H),3.29(s,4H),3.15(s,2H),3.08-3.00(m,12H),2.91(s,3H) ,2.41(s,3H),2.29(t,J=6.6Hz,7H),2.20-1.86(m,12H),1.80(s,9H),1.55-1.39(m, 22H),1.32(d,J=7.1Hz,3H),1.27-1.19(m,12H),0.95-0.81(m,15H).LC-MS(ESI):m / z 1583.3[(M+2H) / 2] + .

[0265] Step 6.3: Synthesis of Compound 13D

[0266] The title compound (14 mg) was obtained from compounds 12 and 3D via a general synthetic route. 1H NMR(400MHz,DMSO-d6)δ11.94(s,1H),9.99(s,1H),8.98(s,1H),8.49(s,1H),8.4 1(t,J=5.6Hz,1H),8.20(d,J=6.8Hz,1H),8.07(d,J=2.5Hz,1H),7.93-7.73(m,10 H),7.68-7.57(m,6H),7.50(d,J=7.8Hz,1H),7.43(d,J=8.2Hz,2H),7.28(d,J=3. 6Hz,2H),7.09(s,1H),7.02(s,1H),6.91(d,J=7.9Hz,1H),5.95(s,1H),5.20-5.10 (m,3H),4.64-4.32(m,16H),4.25-4.17(m,5H),3.75-3.62(m,14H),3.58-3.41(m ,22H),3.32-3.27(m,4H),3.15(d,J=8.3Hz,2H),3.08-3.01(m,12H),2.91(s,3H), 2.40(s,3H),2.28(t,J=6.3Hz,7H),2.21-1.91(m,16H),1.80(s,9H),1.53-1.41( m,24H),1.31(d,J=6.9Hz,3H),1.22(s,22H),0.94-0.82(m,15H).LC-MS(ESI):m / z 1485.3[(M+2H) / 2] + .

[0267] Step 6.4: Synthesis of compound 13E

[0268] The title compound (26 mg) was obtained from compounds 12 and 3E via a general synthetic route. 1H NMR (800MHz, DMSO-d6) δ11.92(s,1H),9.96(s,1H),8.97(s,1H),8.46(t,J=6.2Hz,1H),8.40(t,J=5.6Hz,1H),8. 17(d,J=6.9Hz,1H),8.07(d,J=2.5Hz,1H),7.92(s,1H),7.87-7.80(m,5H),7.77-7.73(m,4H),7.65-7.59(m,6H), 7.49(d,J=7.7Hz,1H),7.43(d,J=8.4Hz,2H),7.27(d,J=2.6Hz,2H),7.09(d,J=1.7Hz,1H),6.99(s,1H),6.92(dd, J=7.8,1.6Hz,1H),5.95(s,1H),5.18-5.10(m,3H),4.61-4.53(m,8H),4.49-4.45(m,4H),4.42-4.33(m,3H),4.24 -4.17(m,5H),3.72-3.67(m,6H),3.67-3.62(m,8H),3.57-3.47(m,19H),3.44-3.41(m,3H),3.29(t,J=6.2Hz,3H) ,3.15(s,2H),3.06-3.02(m,12H),2.91(s,3H),2.40(s,3H),2.28(t,J=6.5Hz,7H),2.21-2.16(m,1H),2.15-2.09 (m,2H),2.07-2.02(m,9H),1.99-1.94(m,1H),1.93-1.89(m,1H),1.80(s,9H),1.54-1.40(m,28H),1.31(d,J=7.1 Hz,3H),1.26-1.18(m,34H),0.92(s,9H),0.87(d,J=6.8Hz,3H),0.84(d,J=6.7Hz,3H).HRMS(ESI-TOF):Calcdfor C 148 H 226 F2N 22 O 40 S2,[(M+2H) / 2] + ,1526.7863,found 1526.7860.

[0269] Step 6.5: Synthesis of compound 13F

[0270] The title compound (15 mg) was obtained from compounds 12 and 3F via a general synthetic route. 1H NMR(400MHz,DMSO-d6)δ11.94(s,1H),9.97(s,1H),8.98(s,1H),8.48(s,1H),8.41(t ,J=5.6Hz,1H),8.17(d,J=6.9Hz,1H),8.08(d,J=2.5Hz,1H),7.92(s,1H),7.90-7.81( m,5H),7.75(d,J=7.2Hz,4H),7.64(d,J=9.0Hz,6H),7.49(d,J=7.8Hz,1H),7.43(d,J =8.4Hz,2H),7.28(d,J=3.8Hz,2H),7.09(s,1H),7.01(s,1H),6.92(d,J=7.9Hz,1H),5 .94(s,1H),5.17-5.12(m,3H),4.63-4.33(m,16H),4.24-4.15(m,5H),3.75-3.61(m, 14H),3.59-3.38(m,25H),3.30-3.28(m,4H),3.14(s,2H),3.09-2.98(m,12H),2.91(s ,3H),2.41(s,3H),2.28(t,J=6.4Hz,7H),2.23-1.93(m,16H),1.80(s,9H),1.57-1.33 (m,28H),1.32-1.30(m,3H),1.25-1.20(m,47H),0.94-0.82(m,15H).LC-MS(ESI):m / z 1597.4[(M+2H) / 2] + .

[0271] Scheme 3. Synthesis of couplings 19A / 19B / 19E

[0272]

[0273] Step 1: Synthesis of Compound 15

[0274] Compound 14 (1.50 g, 3.13 mmol) and N,N-diisopropylethylamine (2.07 mL, 12.5 mmol) were dissolved in acetonitrile (30 mL), and ethylsulfonyl chloride (356 μL, 3.76 mmol) was added. The reaction was carried out at room temperature for 2 hours. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (ethyl acetate / dichloromethane = 0-60%) to give the title compound (1.09 g, 70% yield). 1H NMR(400MHz,DMSO-d6)δ10.20(s,1H),8.04(d,J=7.6Hz,1H),7.62(d,J=8.5Hz,2H),7.42-7 .33(m,2H),6.77(d,J=9.0Hz,1H),6.09(t,J=5.8Hz,1H),5.46(s,2H),4.72(s,2H),4.48-4. 38(m,1H),3.87-3.79(m,1H),2.97(dh,J=25.8,6.4Hz,2H),1.98-1.90(m,1H),1.75-1.65(m ,1H),1.64-1.54(m,1H),1.48-1.35(m,11H),0.84(dd,J=16.7,6.7Hz,6H).LC-MS(ESI):m / z 498.3[M+H] + .

[0275] Step 2: Synthesis of Compound 16

[0276] Compound 8 (650 mg, 0.99 mmol) and compound 15 (543 mg, 1.09 mmol) were dissolved in N,N-dimethylformamide (10 mL), and potassium carbonate (410 mg, 2.97 mmol) was added. The mixture was reacted at room temperature for 1 hour. After the reaction was monitored by LC-MS until complete, the mixture was poured into water, extracted with ethyl acetate, washed with saturated brine, dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (472 mg, yield 41%). LC-MS (ESI): m / z 1117.6 [M+H] + .

[0277] Step 3: Synthesis of Compound 17

[0278] Compound 16 (420 mg, 0.38 mmol) and triphenylphosphine (296 mg, 1.18 mmol) were dissolved in tetrahydrofuran (10 mL) and water (1 mL), and reacted overnight at room temperature under nitrogen protection. After the reaction was completed by LC-MS, the mixture was concentrated under reduced pressure. The residue, compound 10 (190 mg, 0.38 mmol), and N,N-diisopropylethylamine (251 μL, 1.52 mmol) were dissolved in dichloromethane (5 mL) and methanol (1 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (159 mg, 0.42 mmol) was added, and the mixture was reacted at room temperature for 2 hours. After the reaction was completed by LC-MS, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-12%) to give the title compound (471 mg, two-step yield 79%).1 H NMR (400MHz, DMSO-d6) δ11.95(s,1H),10.11(s,1H),8.98(s,1H),8.49(d,J=6.7Hz,1 H),8.42(t,J=5.6Hz,1H),8.08(d,J=2.5Hz,1H),8.02(d,J=7.6Hz,1H),7.90(d,J=18 .3Hz,2H),7.77(s,1H),7.66-7.59(m,3H),7.50(d,J=7.8Hz,1H),7.43(d,J=8.2Hz,2 H),7.30-7.26(m,2H),7.09(s,1H),6.92(d,J=7.9Hz,1H),6.78(d,J=8.9Hz,1H),5.9 9(t,J=5.8Hz,1H),5.43(s,2H),5.19-5.12(m,3H),4.60-4.31(m,6H),4.23-4.15(m, 1H),3.84(t,J=7.9Hz,1H),3.64(d,J=8.5Hz,5H),3.15(s,2H),3.06-2.94(m,2H),2. 91(s,3H),2.41(s,3H),2.32-2.22(m,1H),2.15-1.87(m,6H),1.73-1.56(m,2H),1.3 8(s,16H),1.23(d,J=6.0Hz,12H),0.94-0.81(m,15H).LC-MS(ESI):m / z1573.7[M+H] + .

[0279] Step 4: Synthesis of Compound 18

[0280] Compound 17 (300 mg, 0.19 mmol) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, the mixture was concentrated under reduced pressure. The residue was slurried with diethyl ether to give the title compound (295 mg, 98% yield). 1HNMR(400MHz,DMSO-d6)δ11.95(s,1H),10.24(s,1H),8.99(s,1H),8.71(d,J=7.6 Hz,1H),8.50(s,1H),8.42(t,J=5.8Hz,1H),8.08(d,J=3.4Hz,4H),7.92(s,1H),7 .88(d,J=9.2Hz,1H),7.76(s,1H),7.67-7.58(m,3H),7.50(d,J=7.9Hz,1H),7.44 (d,J=8.3Hz,2H),7.28(d,J=5.8Hz,2H),7.10(s,1H),6.92(d,J=8.0Hz,1H),6.05 (s,1H),5.50(s,2H),5.16(s,2H),4.58-4.44(m,4H),4.41-4.34(m,2H),4.22-4. 16(m,1H),3.64(d,J=9.6Hz,6H),3.15(s,2H),2.98(s,3H),2.91(s,3H),2.40(s, 3H),2.31-2.22(m,1H),2.15-1.99(m,4H),1.95-1.87(m,1H),1.78-1.58(m,3H), 1.42(d,J=25.7Hz,7H),1.26-1.19(m,12H),0.98-0.90(m,15H).LC-MS(ESI):m / z 1473.6[M+H] + .

[0281] General Step 5: Compound 18 (1.0 equivalent), compounds 3A / 3B / 3E (1.0 equivalent), and N,N-diisopropylethylamine (4 equivalent) were dissolved in dimethyl sulfoxide (4 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.1 equivalent) was added, and the mixture was reacted at room temperature for 30 minutes. After the reaction was complete as monitored by LC-MS, lithium hydroxide monohydrate (6.0 equivalent) and water (1.0 mL) were added to the reaction solution, and the mixture was reacted at room temperature for 30 minutes. After the reaction was complete as monitored by LC-MS, the title compound was purified by Prep-HPLC (two-step yield 30-50%).

[0282] Step 5.1: Synthesis of Coupling 19A

[0283] The title compound (17 mg) was obtained from compounds 18 and 3A via a general synthetic route. 1H NMR(400MHz,DMSO-d6)δ11.95(s,1H),10.10(s,1H),8.98(s,1H),8.51(s,1H),8. 46-8.35(m,2H),8.08(d,J=2.5Hz,1H),7.95-7.83(m,5H),7.76(d,J=5.8Hz,4H), 7.69-7.57(m,6H),7.50(d,J=7.8Hz,2H),7.43(d,J=8.2Hz,2H),7.31-7.25(m,2H ),7.10(s,1H),6.91(d,J=7.9Hz,1H),6.80(s,1H),6.06-5.98(m,1H),5.45(s,2H ),5.19-5.10(m,3H),4.66-4.29(m,17H),4.26-4.08(m,5H),3.97(s,2H),3.81-3 .79(m,2H),3.74-3.42(m,46H),3.31-3.28(m,2H),3.19-3.11(m,2H),3.10-2.96 (m,14H),2.91(s,3H),2.41(s,3H),2.29(t,J=6.5Hz,7H),2.16-1.86(m,12H),1. 80(s,9H),1.62-1.35(m,26H),1.23(s,12H),0.95-0.81(m,15H).LC-MS(ESI):m / z 1538.3[(M+2H) / 2] + .

[0284] Step 5.2: Synthesis of Coupling 19B

[0285] The title compound (21 mg) was obtained from compounds 18 and 3B via a general synthetic route. 1H NMR(600MHz,DMSO-d6)δ11.93(d,J=2.7Hz,1H),10.07(s,1H),8.97(s,1H),8.47(s,1H),8.40(t, J=5.6Hz,1H),8.34(d,J=7.5Hz,1H),8.07(d,J=2.5Hz,1H),7.91(s,1H),7.88-7.81(m,4H),7.78- 7.70(m,4H),7.65-7.58(m,6H),7.50-7.45(m,2H),7.42(d,J=8.5Hz,2H),7.28-7.26(m,2H),7.09 (d,J=1.7Hz,1H),6.91(d,J=7.8Hz,1H),6.78(s,1H),5.98(s,1H),5.41(s,1H),5.18-5.07(m,3H) ,4.60-4.52(m,4H),4.49-4.30(m,7H),4.21(d,J=8.5Hz,4H),3.95(d,J=2.5Hz,2H),3.80(s,2H), 3.72-3.45(m,64H),3.44-3.39(m,4H),3.14(s,2H),3.06-3.00(m,14H),2.91(s,3H),2.40(s,3H) ,2.28(t,J=6.4Hz,7H),2.13-1.83(m,12H),1.80(s,9H),1.72-1.58(m,2H),1.54-1.39(m,26H),1 .22(d,J=8.9Hz,14H),0.92(s,9H),0.88(d,J=6.8Hz,3H),0.82(d,J=6.8Hz,3H).LC-MS(ESI):m / z 1626.3[(M+2H) / 2] + .

[0286] Step 5.3: Synthesis of Coupling 19E

[0287] The title compound (20 mg) was obtained from compounds 18 and 3E via a general synthetic route. 1H NMR(400MHz,DMSO-d6)δ11.95(s,1H),10.04(s,1H),8.98(s,1H),8.50(s,1H),8 .42(t,J=5.4Hz,1H),8.12(d,J=7.2Hz,1H),8.08(d,J=2.5Hz,1H),7.94-7.81(m, 7H),7.77(d,J=5.9Hz,4H),7.65(d,J=9.1Hz,5H),7.50(d,J=7.7Hz,1H),7.43(d, J=8.3Hz,2H),7.30-7.26(m,2H),7.09(s,1H),7.02(s,1H),6.92(d,J=8.0Hz,1H) ,6.00(s,1H),5.44(s,2H),5.15(s,3H),4.64-4.33(m,17H),4.22(d,J=8.3Hz,6 H),3.77-3.59(m,16H),3.58-3.46(m,20H),3.31-3.27(m,2H),3.09-2.98(m,14H ),2.91(s,3H),2.40(s,3H),2.32-1.94(m,24H),1.80(s,9H),1.59-1.36(m,30H) ,1.27-1.17(m,34H),0.92(s,9H),0.85(dd,J=12.7,6.6Hz,6H).LC-MS(ESI):m / z 1570.4[(M+2H) / 2] + .

[0288] Scheme 4. Synthesis of couplings 28B / 28D / 28E

[0289]

[0290] Step 1: Synthesis of Compound 21

[0291] Compound 20 (2.50 g, 8.92 mmol) and N,N-diisopropylethylamine (4.4 mL, 26.76 mmol) were dissolved in dichloromethane (80 mL), and methanesulfonyl chloride (1.04 g, 13.38 mmol) was added. The mixture was reacted at room temperature for 1 hour. After the reaction was completed by TLC monitoring, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (ethyl acetate / dichloromethane = 0-10%) to give the title compound (1.47 g, 55% yield). 1H NMR(400MHz,DMSO-d6)δ10.01(s,1H),7.63-7.54(m,2H),7.41-7.34(m,2H),7.05( t,J=6.1Hz,1H),4.72(s,2H),3.72(d,J=5.8Hz,2H),1.40(s,9H).LC-MS(ESI):m / z 321.0[M+Na] + .

[0292] Step 2: Synthesis of Compound 22

[0293] Compound 8 (900 mg, 1.37 mmol) and compound 21 (492 mg, 1.64 mmol) were dissolved in acetonitrile (3 mL) and tetrahydrofuran (3 mL), and cesium carbonate (1.34 g, 4.11 mmol) was added. The reaction was carried out at room temperature for 30 minutes. After the reaction was monitored by LC-MS until complete, the mixture was filtered. The filtrate was concentrated under reduced pressure and purified by column chromatography (methanol / dichloromethane = 0-7%) to give the title compound (832 mg, yield 63%). 1 H NMR (400MHz, DMSO-d6) δ9.97(s,1H),8.98(s,1H),8.47(t,J=6.1Hz,1H),7.86(d,J=9.3Hz,1H),7.62(d,J=8.5Hz,2H),7.49(d,J=7.8 Hz,1H),7.46-7.41(m,2H),7.10(d,J=1.6Hz,1H),7.04(t,J=6.1Hz,1H),6.92(dd,J=7.8,1.6Hz,1H),5.16(s,2H),5.12(d,J=3.6Hz, 1H),4.55(d,J=9.4Hz,1H),4.47(t,J=8.0Hz,1H),4.43-4.33(m,2H),4.26-4.16(m,1H),3.76-3.62(m,4H),2.41(s,3H),2.32-2.22( m,1H),2.16-2.00(m,2H),1.97-1.88(m,1H),1.57-1.45(m,4H),1.40(s,9H),1.26(d,J=13.7Hz,14H),0.93(s,9H).LC-MS(ESI):m / z 918.5[M+H] + .

[0294] Step 3: Synthesis of Compound 23

[0295] Compound 22 (220 mg, 0.24 mmol) and triphenylphosphine (94 mg, 0.36 mmol) were dissolved in tetrahydrofuran (10 mL) and water (1 mL), and reacted overnight at 50 °C under nitrogen protection. After the reaction was completed by LC-MS, the mixture was concentrated under reduced pressure. The residue, compound 10 (120 mg, 0.24 mmol), and N,N-diisopropylethylamine (158 μL, 0.96 mmol) were dissolved in dichloromethane (20 mL) and methanol (10 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (137 mg, 0.36 mmol) was added, and the mixture was reacted at room temperature for 2 hours. After the reaction was completed by LC-MS, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-8%) to give the title compound (181 mg, two-step yield 55%). 1 H NMR (600MHz, DMSO-d6) δ11.92(d,J=2.7Hz,1H),9.97(s,1H),8.97(s,1H),8.46(t,J=6.1Hz,1H),8 .40(t,J=5.6Hz,1H),8.07(d,J=2.5Hz,1H),7.91(s,1H),7.85(d,J=9.3Hz,1H),7.75(s,1H),7.64 -7.58(m,3H),7.48(d,J=7.8Hz,1H),7.44-7.41(m,2H),7.27(d,J=3.0Hz,2H),7.09(d,J=1.7Hz,1 H),7.03(t,J=6.2Hz,1H),6.91(dd,J=7.8,1.6Hz,1H),5.76(s,1H),5.15(s,2H),5.12(d,J=3.6Hz, 1H),4.54(d,J=9.4Hz,1H),4.46(t,J=8.0Hz,1H),4.40-4.33(m,2H),4.20(dd,J=16.6,5.4Hz,1H) ,3.72(d,J=6.1Hz,2H),3.65(d,J=5.2Hz,2H),3.63(s,3H),3.15(s,1H),2.91(s,3H),2.40(s,3H) ,2.30-2.23(m,1H),2.14-2.08(m,1H),2.06-2.00(m,1H),1.94-1.88(m,1H),1.50(d,J=12.9Hz,1 H),1.45(s,3H),1.39(s,9H),1.35-1.31(m,1H),1.29-1.16(m,15H),0.92(s,9H).LC-MS(ESI):m / z 1373.5[M+H] + .

[0296] Step 4: Synthesis of Compound 24

[0297] Compound 23 (170 mg, 0.12 mmol) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS, the solution was concentrated under reduced pressure. The residue was slurryed with diethyl ether to give the title compound (154 mg, 90% yield). LC-MS (ESI): m / z 1274.5 [M+H] + .

[0298] Step 5: Synthesis of Compound 26

[0299] Compound 24 (150 mg, 0.10 mmol), compound 25 (49 mg, 0.13 mmol), and N,N-diisopropylethylamine (66 μL, 0.4 mmol) were dissolved in dichloromethane (10 mL), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (57 mg, 0.15 mmol) were added. The reaction was carried out at room temperature for 1 hour. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (124 mg, yield 76%). 1HNMR(600MHz,DMSO-d6)δ11.92(s,1H),9.90(s,1H),8.97(s,1H),8.47(t,J=6.1Hz,1H),8.44-8.38(m,2H),8.1 9(d,J=8.0Hz,1H),8.07(d,J=2.5Hz,1H),7.95-7.90(m,2H),7.85(d,J=9.3Hz,1H),7.75(s,1H),7.67-7.57(m, 3H),7.49(d,J=7.7Hz,1H),7.47-7.42(m,2H),7.28-7.24(m,6H),7.22-7.15(m,1H),7.09(d,J=1.7Hz,1H),6.9 9(t,J=6.1Hz,1H),6.92(dd,J=7.7,1.6Hz,1H),6.09-5.80(m,1H),5.16(s,2H),5.12(d,J=3.6Hz,1H),4.57-4. 51(m,2H),4.46(t,J=8.0Hz,1H),4.41-4.33(m,2H),4.20(dd,J=16.6,5.4Hz,1H),3.96-3.84(m,2H),3.77(dd, J=16.7,5.8Hz,1H),3.68-3.60(m,6H),3.55(d,J=6.0Hz,2H),3.14(s,2H),3.08(dd,J=13.8,4.5Hz,1H),2.91( s,3H),2.81(dd,J=13.9,9.8Hz,1H),2.40(s,3H),2.30-2.22(m,1H),2.14-2.06(m,1H),2.06-2.00(m,1H),1.9 4-1.87(m,1H),1.54-1.42(m,4H),1.37(s,9H),1.32(s,1H),1.29-1.15(m,14H),0.92(s,9H).LC-MS(ESI):m / z 1635.6[M+H] + .

[0300] Step 6: Synthesis of Compound 27

[0301] Compound 26 (120 mg, 0.07 mmol) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS, the solution was concentrated under reduced pressure. The residue was slurryed with diethyl ether to give the title compound (119 mg, 98% yield). LC-MS (ESI): m / z 1535.6 [M+H] + .

[0302] General Step 7: Compound 27 (1.0 equivalent), compounds 3B / 3D / 3E (1.0 equivalent), and N,N-diisopropylethylamine (4.0 equivalent) were dissolved in dimethyl sulfoxide (4 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.1 equivalent) was added, and the mixture was reacted at room temperature for 30 min. After the reaction was complete as monitored by LC-MS, lithium hydroxide monohydrate (6.0 equivalent) and water (1 mL) were added to the reaction solution, and the mixture was reacted at room temperature for 30 min. After the reaction was complete as monitored by LC-MS, the title compound was purified by Prep-HPLC (two-step yield 30-50%).

[0303] Step 7.1: Synthesis of Coupling 28B

[0304] The title compound (16 mg) was obtained from compounds 27 and 3B via a general synthetic route. 1H NMR(600MHz,DMSO-d6)δ11.92(s,1H),9.90(s,1H),8.97(s,1H),8.49-8.44(m,1H),8.43-8.38(m,2H),8 .17(d,J=8.0Hz,1H),8.10(t,J=5.7Hz,1H),8.07(d,J=2.5Hz,1H),7.92-7.89(m,2H),7.87-7.82(m,4H) ,7.76-7.72(m,4H),7.66-7.59(m,6H),7.49(d,J=7.7Hz,1H),7.44(d,J=8.4Hz,2H),7.27-7.25(m,6H), 7.20-7.17(m,1H),7.09(d,J=1.7Hz,1H),6.91(d,J=7.8Hz,1H),6.78(s,1H),5.15(s,2H),5.12(d,J=3. 5Hz,1H),4.59(t,J=5.7Hz,4H),4.55(d,J=6.4Hz,4H),4.47(d,J=4.4Hz,4H),4.21(d,J=8.4Hz,4H),3.9 6-3.84(m,4H),3.81-3.75(m,5H),3.72-3.66(m,7H),3.65-3.59(m,12H),3.57-3.49(m,42H),3.44-3.3 9(m,5H),3.30-3.29(m,4H),3.30(s,1H),3.06-3.00(m,13H),2.90(s,3H),2.40(s,3H),2.28(t,J=6.5H z,7H),2.13-2.00(m,8H),1.80(s,9H),1.54-1.38(m,24H),1.22(s,13H),0.91(s,9H).LC-MS(ESI):m / z 1657.2[(M+2H) / 2] + .

[0305] Step 7.2: Synthesis of Coupling 28D

[0306] The title compound (21 mg) was obtained from compounds 27 and 3D via a general synthetic route. 1H NMR(600MHz,DMSO-d6)δ11.92(s,1H),9.90(s,1H),8.98(s,1H),8.48(s,1H),8.40(s,2H),8. 17(d,J=7.9Hz,1H),8.09-8.02(m,3H),7.92(s,1H),7.88-7.82(m,4H),7.77-7.72(m,4H),7.6 7-7.58(m,6H),7.50(d,J=7.8Hz,1H),7.45(d,J=8.4Hz,2H),7.29-7.24(m,7H),7.22-7.16(m, 1H),7.09(s,1H),7.00(s,1H),6.92(d,J=7.9Hz,1H),5.19-5.11(m,3H),4.59(t,J=5.7Hz,4H) ,4.55(t,J=7.2Hz,5H),4.48(d,J=4.5Hz,4H),4.42-4.33(m,2H),4.22(d,J=8.4Hz,4H),3.74 -3.62(m,17H),3.57-3.48(m,18H),3.46-3.39(m,3H),3.30-3.29(m,4H),3.15(s,3H),3.04(t ,J=6.6Hz,12H),2.91(s,3H),2.41(s,4H),2.28(t,J=6.4Hz,7H),2.12(t,J=7.4Hz,3H),2.05( t,J=7.4Hz,9H),1.80(s,9H),1.54-1.40(m,30H),1.22(s,24H),0.92(s,9H).LC-MS(ESI):m / z 1559.3[(M+2H) / 2] + .

[0307] Step 7.3: Synthesis of Coupling 28E

[0308] The title compound (22 mg) was obtained from compounds 27 and 3E via a general synthetic route. 1H NMR(600MHz,DMSO-d6)δ11.92(s,1H),9.89(s,1H),8.97(s,1H),8.47(s,1H),8.42-8.36(m,2H) ,8.17(d,J=8.0Hz,1H),8.09-8.03(m,3H),7.92(s,1H),7.88-7.82(m,4H),7.77-7.72(m,4H),7 .67-7.57(m,6H),7.49(d,J=7.8Hz,1H),7.44(d,J=8.3Hz,2H),7.29-7.24(m,6H),7.22-7.16(m ,1H),7.09(d,J=1.7Hz,1H),7.00(s,1H),6.92(d,J=7.9Hz,1H),5.19-5.11(m,3H),4.63-4.44( m,12H),4.41-4.32(m,2H),4.22(d,J=8.4Hz,4H),3.98-3.83(m,1H),3.80-3.74(m,1H),3.73-3 .61(m,17H),3.58-3.47(m,20H),3.44-3.39(m,8H),3.29(t,J=6.2Hz,4H),3.08-3.00(m,13H), 2.91(s,3H),2.40(s,3H),2.28(t,J=6.4Hz,6H),2.12(t,J=7.4Hz,3H),2.05(t,J=7.4Hz,9H),1 .96-1.85(m,1H),1.80(s,9H),1.55-1.39(m,27H),1.21(s,35H),0.92(s,9H).LC-MS(ESI):m / z 1601.3[(M+2H) / 2] + .

[0309] Scheme 5. Synthesis of Coupling 36B

[0310]

[0311] Step 1: Synthesis of Compound 30

[0312] Compound 29 (450 mg, 1.04 mmol) was dissolved in dichloromethane (10 mL), and thionyl chloride (110 μL, 1.55 mmol) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was monitored by LC-MS until complete, the solution was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-8%) to give the title compound (390 mg, yield 83%). 1H NMR (400MHz, DMSO-d6) δ10.05(s,1H),7.91(d,J=7.8Hz,1H),7.61(d,J=8.2Hz ,2H),7.38(d,J=8.3Hz,2H),6.06-5.91(m,1H),5.68-5.24(m,2H),4.73(s,2H ),4.50-4.40(m,1H),4.16-4.09(m,2H),3.08-2.88(m,2H),2.48-2.32(m,3H) ,2.01-1.57(m,5H),1.51-1.32(m,2H),1.18(t,J=7.1Hz,3H).LC-MS(ESI):m / z 453.2[M+H] + .

[0313] Step 2: Synthesis of Compound 31

[0314] Compound 8 (200 mg, 0.31 mmol) and compound 30 (152 mg, 0.34 mmol) were dissolved in acetonitrile (8 mL) and tetrahydrofuran (8 mL), and cesium carbonate (397 mg, 1.22 mmol) was added. The mixture was reacted overnight at room temperature. After the reaction was monitored by LC-MS until complete, the mixture was filtered, and the filtrate was purified by column chromatography (methanol / dichloromethane = 0-12%) to give the title compound (213 mg, yield 65%). 1H NMR (600MHz, DMSO-d6) δ10.00(s,1H),8.98(s,1H),8.47(t,J=6.0Hz,1H),7.88(dd,J=20.7, 8.6Hz,2H),7.64(d,J=8.4Hz,2H),7.49(d,J=7.8Hz,1H),7.44(d,J=8.4Hz,2H),7.10(d,J=1 .7Hz,1H),6.94-6.90(m,1H),5.98(t,J=5.8Hz,1H),5.42(s,2H),5.16(s,2H),5.13(d,J=3. 6Hz,1H),4.55(d,J=9.4Hz,1H),4.49-4.44(m,2H),4.40-4.34(m,2H),4.24-4.17(m,1H),4.1 5-4.10(m,2H),3.69-3.62(m,2H),3.32-3.29(m,4H),3.06-2.99(m,1H),2.98-2.91(m,1H), 2.49-2.43(m,3H),2.41(s,4H),2.31-2.24(m,1H),2.14-2.08(m,1H),2.06-2.00(m,1H),1.9 5-1.86(m,2H),1.84-1.70(m,2H),1.68-1.60(m,1H),1.52(p,J=6.9Hz,3H),1.45(d,J=8.2H z,2H),1.40-1.34(m,1H),1.25(s,10H),1.18(t,J=7.1Hz,3H),0.93(s,9H).LC-MS(ESI):m / z 1072.5[M+H] + .

[0315] Step 3: Synthesis of Compound 32

[0316] Compound 31 (85 mg, 0.08 mmol) and triphenylphosphine (31 mg, 0.12 mmol) were dissolved in tetrahydrofuran (5 mL) and water (100 μL), and reacted overnight at 50 °C under nitrogen protection. After the reaction was completed by LC-MS, the mixture was concentrated under reduced pressure. The residue, compound 17 (40 mg, 0.08 mmol), and N,N-diisopropylethylamine (26 μL, 0.16 mmol) were dissolved in dichloromethane (5 mL), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (33 mg, 0.09 mmol) was added. The mixture was reacted at room temperature for 1 hour. After the reaction was completed by LC-MS, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-12%) to give the title compound (77 mg, two-step yield 64%).1 H NMR(600MHz,DMSO-d6)δ11.93(d,J=2.7Hz,1H),10.00(s,1H),8.98(s,1H),8.47(t, J=6.2Hz,1H),8.40(t,J=5.7Hz,1H),8.07(d,J=2.5Hz,1H),7.93-7.75(m,6H),7.66 -7.59(m,3H),7.49(d,J=7.8Hz,1H),7.44(d,J=8.3Hz,2H),7.28(d,J=3.4Hz,2H),7 .10(s,1H),6.92(d,J=7.9Hz,1H),5.99(s,1H),5.16(s,2H),4.55(d,J=9.4Hz,1H),4 .49-4.44(m,2H),4.40-4.34(m,2H),4.22-4.18(m,1H),4.14-4.10(m,2H),3.65(s, 2H),3.63(s,3H),3.15(s,3H),3.06-2.93(m,3H),2.91(s,3H),2.45(t,J=8.3Hz,3H ),2.41(s,4H),2.29-2.24(m,1H),2.14-1.60(m,9H),1.50(d,J=8.5Hz,1H),1.45(t ,J=7.3Hz,4H),1.39-1.35(m,1H),1.25-1.16(m,18H),0.92(s,9H).LC-MS(ESI):m / z 1528.6[M+H] + .

[0317] Step 4: Synthesis of Compound 33

[0318] Compound 32 (75 mg, 0.05 mmol) was dissolved in methanol (3 mL) and water (1 mL), and lithium hydroxide monohydrate (8 mg, 0.20 mmol) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was monitored by LC-MS until complete, the pH was adjusted to acidic, and the mixture was extracted with dichloromethane. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to give the title compound (43 mg, yield 58%). 1H NMR(600MHz,DMSO-d6)δ12.88(s,1H),11.93(d,J=2.7Hz,1H),9.88(s,1H),8.98(s,1 H),8.47(t,J=6.1Hz,1H),8.40(t,J=5.6Hz,1H),8.07(d,J=2.5Hz,1H),7.95(d,J=7.8 Hz,1H),7.92(s,1H),7.85(d,J=9.3Hz,1H),7.76(s,1H),7.67-7.59(m,3H),7.49(d,J =7.8Hz,1H),7.44(d,J=8.3Hz,2H),7.28(d,J=3.4Hz,2H),7.10(s,1H),6.92(d,J=7.9 Hz,1H),5.98(s,1H),5.16(s,2H),4.55(d,J=9.4Hz,1H),4.51-4.32(m,5H),4.22-4. 18(m,1H),3.67-3.62(m,6H),3.15(s,2H),2.96(s,2H),2.91(s,3H),2.43(d,J=20.6H z,8H),2.30-2.23(m,1H),2.15-2.00(m,2H),1.96-1.87(m,2H),1.82-1.75(m,2H),1. 68-1.59(m,1H),1.55-1.33(m,7H),1.30-1.15(m,15H),0.92(s,9H).LC-MS(ESI):m / z 1500.5[M+H] + .

[0319] Step 5: Synthesis of Compound 34

[0320] Compound 33 (40 mg, 0.03 mmol), N-Boc-1,6-diaminohexane (12 mg, 0.05 mmol), and N,N-diisopropylethylamine (18 μL, 0.11 mmol) were dissolved in dichloromethane (5 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (15 mg, 0.04 mmol) was added, and the reaction was carried out at room temperature for 30 minutes. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-12%) to give the title compound (42 mg, 93% yield). LC-MS (ESI): m / z 1698.8 [M+H] + .

[0321] Step 6: Synthesis of Compound 35

[0322] Compound 34 (40 mg, 0.02 mmol) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS, the solution was concentrated under reduced pressure. The residue was slurryed with diethyl ether to give the title compound (31 mg, yield 77%). LC-MS (ESI): m / z 1598.7 [M+H] + .

[0323] Step 7: Synthesis of Coupling 36B

[0324] Compound 35 (1.0 equivalent), compound 3B (1 equivalent), and N,N-diisopropylethylamine (4.0 equivalent) were dissolved in dimethyl sulfoxide (4 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.1 equivalent) was added, and the reaction was carried out at room temperature for 30 min. After the reaction was monitored by LC-MS to ensure completion, lithium hydroxide monohydrate (6.0 equivalent) and water (1 mL) were added to the reaction solution, and the reaction was carried out at room temperature for 30 min. After the reaction was monitored by LC-MS to ensure completion, the title compound (16 mg, 50% yield in two steps) was purified by Prep-HPLC. 1 HNMR(600MHz,DMSO-d6)δ11.92(s,1H),10.16(s,1H),8.97(s,1H),8.46(s,1H),8 .40(t,J=5.8Hz,1H),8.07(d,J=2.5Hz,1H),7.92(s,1H),7.88-7.80(m,5H),7.76 (s,3H),7.69-7.59(m,6H),7.49(d,J=7.8Hz,1H),7.43(d,J=8.3Hz,2H),7.27(s, 2H),7.09(s,1H),6.92(d,J=7.8Hz,1H),6.79(d,J=6.0Hz,1H),5.44(s,1H),5.18 -5.11(m,2H),4.66-4.32(m,11H),4.25-4.18(m,3H),3.84(s,2H),3.80(s,2H),3 .72-3.62(m,12H),3.58-3.49(m,46H),3.18-3.02(m,25H),2.91(s,5H),2.44-2. 38(m,9H),2.29(t,J=6.5Hz,7H),2.13-1.99(m,9H),1.95-1.89(m,1H),1.80(s,1 2H),1.60(s,4H),1.54-1.38(m,30H),1.24(s,22H),0.92(s,9H).LC-MS(ESI):m / z 1688.9[(M+2H) / 2] +.

[0325] Scheme 6. Synthesis of Coupling 45B

[0326]

[0327] Step 1: Synthesis of Compound 37

[0328] Compound 29 (300 mg, 0.69 mmol), di(p-nitrobenzene) carbonate (420 mg, 1.38 mmol), and N,N-diisopropylethylamine (455 mg, 2.76 mmol) were dissolved in dichloromethane (10 mL) and reacted overnight at room temperature. After the reaction was completed by LC-MS, the mixture was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-8%) to give the title compound (362 mg, yield 88%).

[0329] Step 2: Synthesis of Compound 39

[0330] Compound 8 (200 mg, 0.31 mmol) and compound 38 (104 mg, 0.37 mmol) were dissolved in N,N-dimethylformamide (10 mL), and potassium carbonate (128 mg, 0.93 mmol) was added. The mixture was reacted overnight at 50 °C under nitrogen protection. After the reaction was monitored by LC-MS until complete, the mixture was poured into water, extracted with ethyl acetate, washed with saturated brine, dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (121 mg, yield 47%).

[0331] Step 3: Synthesis of Compound 40

[0332] Compound 39 (110 mg, 0.13 mmol) and triphenylphosphine (52 mg, 0.20 mmol) were dissolved in tetrahydrofuran (5 mL) and water (100 μL), and reacted overnight at 50 °C under nitrogen protection. After the reaction was completed by LC-MS, the mixture was concentrated under reduced pressure. The residue, compound 10 (65 mg, 0.13 mmol), and N,N-diisopropylethylamine (86 μL, 0.52 mmol) were dissolved in dichloromethane (5 mL), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (59 mg, 0.16 mmol) was added. The mixture was reacted at room temperature for 1 hour. After the reaction was completed by LC-MS, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-12%) to give the title compound (97 mg, two-step yield 58%).

[0333] Step 4: Synthesis of Compound 41

[0334] Compound 40 (90 mg, 0.07 mmol) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, the mixture was concentrated under reduced pressure. The residue was slurried with diethyl ether to give the title compound (87 mg, 98% yield).

[0335] Step 5: Synthesis of Compound 42

[0336] Compound 41 (85 mg, 0.07 mmol), compound 37 (47 mg, 0.08 mmol), and N,N-diisopropylethylamine (43 μL, 0.26 mmol) were dissolved in dichloromethane (10 mL) and reacted overnight at room temperature. After the reaction was complete as monitored by LC-MS, the mixture was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0–8%) to give an intermediate. This intermediate and lithium hydroxide monohydrate (12 mg, 0.07 mmol) were dissolved in methanol (3 mL) and water (600 μL) and reacted at room temperature for 1 hour. After the reaction was complete as monitored by LC-MS, the mixture was purified by Prep-HPLC to give the title compound (107 mg, 94% yield in two steps).

[0337] Step 6: Synthesis of Compound 43

[0338] Compound 42 (80 mg, 0.05 mmol), N-Boc-1,3-diaminopropane (9 mg, 0.05 mmol), and N,N-diisopropylethylamine (76 μL, 0.20 mmol) were dissolved in dichloromethane (5 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (23 mg, 0.06 mmol) was added, and the reaction was carried out at room temperature for 30 minutes. After the reaction was monitored by LC-MS until complete, the title compound (76 mg, 85% yield) was purified by Prep-HPLC.

[0339] Step 7: Synthesis of Compound 44

[0340] Compound 43 (76 mg, 0.04 mmol) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, the mixture was concentrated under reduced pressure. The residue was slurried with diethyl ether to give the title compound (74 mg, 98% yield).

[0341] Step 8: Synthesis of Coupling 45

[0342] Compound 44 (1.0 equivalent), compound 3B (1.0 equivalent), and N,N-diisopropylethylamine (4.0 equivalent) were dissolved in dimethyl sulfoxide (4 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.1 equivalent) was added, and the mixture was reacted at room temperature for 30 min. After the reaction was complete as monitored by LC-MS, lithium hydroxide monohydrate (6.0 equivalent) and water (1 mL) were added to the reaction solution, and the mixture was reacted at room temperature for 30 min. After the reaction was complete as monitored by LC-MS, the title compound (13 mg, 50% yield in two steps) was purified by Prep-HPLC. 1 HNMR(600MHz,DMSO-d6)δ11.92(s,1H),10.11(s,1H),8.98(s,1H),8.40(s,1H),8.07(d,J =2.5Hz,1H),7.92(s,1H),7.84(t,J=6.1Hz,5H),7.80-7.71(m,6H),7.65-7.58(m,6H),7. 48(d,J=7.8Hz,1H),7.32(d,J=8.2Hz,2H),7.27(s,2H),7.07(s,1H),6.90(d,J=7.7Hz,0H ),6.78(s,1H),5.42(s,2H),5.13(d,J=3.5Hz,1H),5.02(s,1H),4.59(t,J=5.7Hz,4H),4.5 5(d,J=6.2Hz,4H),4.49-4.41(m,5H),4.33(d,J=21.8Hz,2H),4.22(d,J=8.4Hz,3H),3.87 (s,2H),3.80(s,2H),3.73-3.62(m,16H),3.58-3.49(m,49H),3.44-3.41(m,7H),3.13(t, J=6.7Hz,4H),3.03(d,J=6.6Hz,12H),2.91(s,4H),2.44(d,J=8.2Hz,8H),2.29(t,J=6.5H z,7H),2.16-1.87(m,11H),1.80(s,17H),1.55-1.39(m,27H),1.24(s,16H),0.92(s,10H).

[0343] Scheme 7. Synthesis of couplings 52B / 52C / 52E

[0344]

[0345] Step 1: Synthesis of Compound 46

[0346] Compound 10 (600 mg, 1.2 mmol) was dissolved in a boranetetrahydrofuran complex (2 M, 15 mL) and reacted overnight at 60 °C. After the reaction was complete as monitored by LC-MS, it was quenched with methanol, concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-5%) to give the intermediate. This intermediate and Dysmart oxidant (1.53 g, 3.6 mmol) were dissolved in dichloromethane (30 mL) and reacted at room temperature for 2 hours. After the reaction was complete as monitored by LC-MS, it was extracted with dichloromethane, the organic phase was washed once with 10% sodium thiosulfate aqueous solution and once with saturated brine, dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-5%) to give the title compound (542 mg, 93% yield). LC-MS (ESI): m / z 485.2 [M+H] + .

[0347] Step 2: Synthesis of Compound 48

[0348] Compound 46 (200 mg, 0.41 mmol), compound 47 (352 mg, 0.49 mmol), and N,N-diisopropylethylamine (203 μL, 1.23 mmol) were dissolved in dichloromethane (20 mL) and methanol (5 mL). After stirring overnight at room temperature, sodium cyanoborohydride (84 mg, 1.23 mmol) was added, and the reaction was continued for 1 hour. The title compound (187 mg, 39% yield) was purified by Prep-HPLC.

[0349] Step 3: Synthesis of Compound 50

[0350] Compound 48 (180 mg, 0.15 mmol), compound 49 (118 mg, 0.18 mmol), and N,N-diisopropylethylamine (99 μL, 0.26 mmol) were dissolved in dichloromethane (10 mL) and reacted overnight at room temperature. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (205 mg, yield 86%).

[0351] Step 4: Synthesis of Compound 51

[0352] Compound 50 (200 mg, 0.13 mmol) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, the mixture was concentrated under reduced pressure. The residue was slurried with diethyl ether to give the title compound (197 mg, 98% yield).

[0353] General Step 5: Compound 51 (1.0 equivalent), compounds 3B / 3C / 3E (1 equivalent), and N,N-diisopropylethylamine (4.0 equivalent) were dissolved in dimethyl sulfoxide (4 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.1 equivalent) was added, and the mixture was reacted at room temperature for 30 minutes. After the reaction was complete as monitored by LC-MS, lithium hydroxide monohydrate (6.0 equivalent) and water (1 mL) were added to the reaction solution, and the mixture was reacted at room temperature for 30 minutes. After the reaction was complete as monitored by LC-MS, the title compound was purified by Prep-HPLC (two-step yield 30-60%).

[0354] Step 5.1: Synthesis of Coupling 52B

[0355] The title compound (11 mg) was obtained from compounds 51 and 3B via a general synthetic route. 1 H NMR (600MHz, DMSO-d6) δ11.88(s,1H),10.06(s,1H),8.98(s,1H),8.56(t,J=6.1Hz,1H),8.34(s,1H),8.09(s,1H),7. 84(t,J=5.7Hz,5H),7.73(t,J=5.8Hz,3H),7.67-7.52(m,6H),7.47-7.37(m,4H),4.98(s,2H),4.65-4.53(m,4H),4.4 7-4.20(m,12H),3.96(s,2H),3.80(s,2H),3.73-3.48(m,83H),3.07-2.99(m,20H),2.45(s,3H),2.32-1.88(m,16H), 1.80(s,9H),1.55-1.34(m,26H),1.19(t,J=30.8Hz,14H),0.93(s,9H),0.88(d,J=6.7Hz,3H),0.82(d,J=6.7Hz,3H).

[0356] Step 5.2: Synthesis of Coupling 52C

[0357] The title compound (12 mg) was obtained from compounds 51 and 3C via a general synthetic route. 1H NMR (600MHz, DMSO-d6) δ11.88(s,1H),10.02(s,1H),8.98(s,1H),8.56(t,J=6.1Hz,1H),8.13(s,1H),8.09(s,1H),7.87-7.78(m,6H ),7.74(t,J=5.7Hz,3H),7.68-7.51(m,6H),7.44-7.37(m,4H),7.26-7.14(m,2H),7.00(s,1H),4.97(s,1H),4.55(d,J=9.4Hz,6H), 4.39(d,J=46.0Hz,6H),4.22(d,J=8.4Hz,6H),3.73-3.62(m,22H),3.54(d,J=10.8Hz,23H),3.08-3.00(m,21H),2.45(s,3H),2.31- 1.89(m,22H),1.80(s,9H),1.55-1.32(m,33H),1.23(d,J=13.8Hz,19H),0.93(s,11H),0.86(d,J=6.5Hz,3H),0.83(d,J=6.7Hz,3H).

[0358] Step 5.3: Synthesis of Coupling 52E

[0359] The title compound (17 mg) was obtained from compounds 51 and 3E via a general synthetic route. 1H NMR (600MHz, DMSO-d6) δ11.88(s,1H),10.00(s,1H),8.98(s,1H),8.56(t,J=6.2Hz,1H),8.09(s,2H),7.84(t,J=5.7Hz,6H),7.74(t, J=5.7Hz,3H),7.67-7.55(m,6H),7.44-7.37(m,4H),7.26-7.13(m,2H),6.99(s,1H),4.97(s,1H),4.55(d,J=9.4Hz,5H),4.46-4.34(m ,6H),4.22(d,J=8.4Hz,6H),3.73-3.61(m,20H),3.57-3.47(m,32H),3.18(s,2H),3.07-3.00(m,20H),2.45(s,3H),2.31-1.90(m,21H ),1.80(s,9H),1.51(h,J=7.1Hz,17H),1.46-1.40(m,11H),1.22(s,34H),0.93(s,11H),0.86(d,J=6.7Hz,3H),0.83(d,J=6.8Hz,3H).

[0360] Scheme 8. Synthesis of couplings 60A / 60B

[0361]

[0362] Step 1: Synthesis of Compound 54

[0363] Compound 12 (1.0 equivalent), compound 53 (0.5 equivalent), and N,N-diisopropylethylamine (6.0 equivalent) were dissolved in dichloromethane (5...

[0364] 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (2.0 equivalents) was added to a solution of [unspecified substance] mL, and the reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, the solution was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-20%) to give the title compound (109 mg, yield 67%).

[0365] Step 2: Synthesis of Compound 55

[0366] Compound 54 (1.0 equivalent) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, the mixture was concentrated under reduced pressure. The residue was slurried with diethyl ether to give the title compound (99 mg, yield 98%).

[0367] Step 3: Synthesis of Coupling 60A

[0368] Compound 55 (1.0 equivalent), compound 3E (1.0 equivalent), and N,N-diisopropylethylamine (4.0 equivalent) were dissolved in dimethyl sulfoxide (4 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.1 equivalent) was added, and the mixture was reacted at room temperature for 30 min. After the reaction was complete as monitored by LC-MS, lithium hydroxide monohydrate (6.0 equivalent) and water (1 mL) were added to the reaction solution, and the mixture was reacted at room temperature for 30 min. After the reaction was complete as monitored by LC-MS, the title compound was purified by Prep-HPLC (two-step yield 31%). LC-MS (ESI): m / z 1522.8 [(M+3H) / 3] + .

[0369] Step 4: Synthesis of Compound 56

[0370] Compound 27 (1.0 equivalent), compound 53 (0.5 equivalent), and N,N-diisopropylethylamine (6.0 equivalent) were dissolved in dichloromethane (5 mL), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (2.0 equivalent) were added. The reaction was carried out at room temperature for 1 hour. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-20%) to give the title compound (91 mg, yield 51%).

[0371] Step 5: Synthesis of Compound 57

[0372] Compound 56 (1.0 equivalent) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, the mixture was concentrated under reduced pressure. The residue was slurried with diethyl ether to give the title compound (85 mg, 99% yield).

[0373] Step 6: Synthesis of Coupling 60B

[0374] Compound 57 (1.0 equivalent), compound 3C (1.0 equivalent), and N,N-diisopropylethylamine (4.0 equivalent) were dissolved in dimethyl sulfoxide (4 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.1 equivalent) was added, and the mixture was reacted at room temperature for 30 min. After the reaction was complete as monitored by LC-MS, lithium hydroxide monohydrate (6.0 equivalent) and water (1 mL) were added to the reaction solution, and the mixture was reacted at room temperature for 30 min. After the reaction was complete as monitored by LC-MS, the title compound was purified by Prep-HPLC (22% yield in two steps). LC-MS (ESI): m / z 1574.7 [(M+3H) / 3] + .

[0375] Scheme 9. Synthesis of coupling compound 60C / 60E

[0376]

[0377] Step 1: Synthesis of Compound 59

[0378] Compound 10 (1.0 equivalent), compound 58 (1.1 equivalent), and N,N-diisopropylethylamine (4.0 equivalent) were dissolved in dichloromethane (5 mL), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.1 equivalent) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (178 mg, yield 53%).

[0379] Step 2: Synthesis of Compound 61

[0380] Compound 6 (1.0 equivalent), 1-imidazolium sulfonyl azide hydrochloride (1.2 equivalent), and potassium carbonate (2.0 equivalent) were dissolved in methanol (10 mL) and reacted overnight at room temperature. After the reaction was completed by LC-MS, the mixture was filtered, and the filtrate was concentrated under reduced pressure and purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (312 mg, yield 79%).

[0381] Step 3: Synthesis of Compound 62

[0382] Compound 59 (1.0 equivalent), compound 61 (1.2 equivalent), copper sulfate pentahydrate (0.2 equivalent), and sodium ascorbate (0.5 equivalent) were dissolved in 1,4-dioxane (3 mL), tert-butanol (2 mL), and water (1 mL), and reacted at 50 °C for 1 hour. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure and purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (168 mg, yield 83%).

[0383] Step 4: Synthesis of Compound 63

[0384] Compound 62 (1.0 equivalent) and compound 21 (1.2 equivalent) were dissolved in acetonitrile (3 mL) and tetrahydrofuran (3 mL), and cesium carbonate (3.0 equivalent) was added. The mixture was reacted at room temperature for 30 minutes. After the reaction was monitored by LC-MS until complete, the mixture was filtered. The filtrate was concentrated under reduced pressure and purified by column chromatography (methanol / dichloromethane = 0-7%) to give the title compound (141 mg, yield 53%).

[0385] Step 5: Synthesis of Compound 64

[0386] Compound 63 (1.0 equivalent) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, the mixture was concentrated under reduced pressure. The residue was slurried with diethyl ether to give the title compound (140 mg, 98% yield).

[0387] Step 6: Synthesis of Compound 65

[0388] Compound 64 (1.0 equivalent), compound 25 (0.5 equivalent), and N,N-diisopropylethylamine (6.0 equivalent) were dissolved in dichloromethane (5 mL), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (2.0 equivalent) were added. The reaction was carried out at room temperature for 1 hour. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-20%) to give the title compound (98 mg, yield 67%).

[0389] Step 7: Synthesis of Compound 66

[0390] Compound 65 (1.0 equivalent) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, the mixture was concentrated under reduced pressure. The residue was slurried with diethyl ether to give the title compound (95 mg, yield 96%).

[0391] Step 8: Synthesis of Compound 67

[0392] Compound 66 (1.0 equivalent), compound 53 (0.5 equivalent), and N,N-diisopropylethylamine (6.0 equivalent) were dissolved in dichloromethane (5 mL), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (2.0 equivalent) were added. The reaction was carried out at room temperature for 1 hour. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-20%) to give the title compound (63 mg, yield 53%).

[0393] Step 9: Synthesis of Compound 68

[0394] Compound 67 (1.0 equivalent) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, the mixture was concentrated under reduced pressure. The residue was slurried with diethyl ether to give the title compound (63 mg, yield 98%).

[0395] General Step 10: Compound 68 (1.0 equivalent), compounds 3B / 3C (1 equivalent), and N,N-diisopropylethylamine (4.0 equivalent) were dissolved in dimethyl sulfoxide (4 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.1 equivalent) was added, and the mixture was reacted at room temperature for 30 minutes. After the reaction was complete as monitored by LC-MS, lithium hydroxide monohydrate (6.0 equivalent) and water (1 mL) were added to the reaction solution, and the mixture was reacted at room temperature for 30 minutes. After the reaction was complete as monitored by LC-MS, the title compound was purified by Prep-HPLC (two-step yield 20-30%).

[0396] Step 9.1: Synthesis of Coupling 60C

[0397] The title compound (15 mg) was obtained from compounds 68 and 3C via a standard synthetic route. LC-MS (ESI): m / z 1590.8 [(M+3H) / 3] + .

[0398] Step 9.2: Synthesis of Coupling 60E

[0399] The title compound (7 mg) was obtained from compounds 68 and 3B via a standard synthetic route. LC-MS (ESI): m / z 1665.4 [(M+3H) / 3] + .

[0400] Scheme 10. Synthesis of Coupling 60D

[0401]

[0402] Step 1: Synthesis of Compound 71

[0403] Compounds 69 (1.0 equivalent), 70 (1.0 equivalent), and N,N-diisopropylethylamine (4.0 equivalent) were dissolved in dichloromethane (5 mL), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.2 equivalent) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (110 mg, yield 78%).

[0404] Step 2: Synthesis of Compound 72

[0405] Compound 71 (1.0 equivalent) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, the mixture was concentrated under reduced pressure. The residue was slurried with diethyl ether to give the title compound (105 mg, yield 96%).

[0406] Step 3: Synthesis of Compound 73

[0407] Compound 72 (1.0 equivalent), 1-imidazolium sulfonyl azide hydrochloride (1.2 equivalent), and potassium carbonate (2.0 equivalent) were dissolved in methanol (10 mL) and reacted overnight at room temperature. After the reaction was monitored by LC-MS until complete, the mixture was filtered, and the filtrate was concentrated under reduced pressure and purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (118 mg, yield 76%).

[0408] Step 4: Synthesis of Compound 74

[0409] Compound 59 (1.0 equivalent), compound 73 (1.2 equivalent), copper sulfate pentahydrate (0.2 equivalent), and sodium ascorbate (0.5 equivalent) were dissolved in 1,4-dioxane (3 mL), tert-butanol (2 mL), and water (1 mL), and reacted at 50 °C for 1 hour. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure and purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (81 mg, yield 77%).

[0410] Step 5: Synthesis of Compound 75

[0411] Compound 74 (1.0 equivalent) and compound 21 (1.2 equivalent) were dissolved in acetonitrile (3 mL) and tetrahydrofuran (3 mL), and cesium carbonate (3.0 equivalent) was added. The mixture was reacted at room temperature for 30 minutes. After the reaction was monitored by LC-MS until complete, the mixture was filtered. The filtrate was concentrated under reduced pressure and purified by column chromatography (methanol / dichloromethane = 0-7%) to give the title compound (57 mg, yield 56%).

[0412] Step 6: Synthesis of Compound 76

[0413] Compound 75 (1.0 equivalent) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, the mixture was concentrated under reduced pressure. The residue was slurried with diethyl ether to give the title compound (57 mg, 99% yield).

[0414] Step 7: Synthesis of Compound 77

[0415] Compound 76 (1.0 equivalent), compound 25 (0.5 equivalent), and N,N-diisopropylethylamine (6.0 equivalent) were dissolved in dichloromethane (5 mL), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (2.0 equivalent) were added. The reaction was carried out at room temperature for 1 hour. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-20%) to give the title compound (62 mg, yield 61%).

[0416] Step 8: Synthesis of Compound 78

[0417] Compound 77 (1.0 equivalent) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, the mixture was concentrated under reduced pressure. The residue was slurried with diethyl ether to give the title compound (60 mg, yield 96%).

[0418] Step 9: Synthesis of Compound 79

[0419] Compound 78 (1.0 equivalent), compound 53 (0.5 equivalent), and N,N-diisopropylethylamine (6.0 equivalent) were dissolved in dichloromethane (5 mL), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (2.0 equivalent) were added. The reaction was carried out at room temperature for 1 hour. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-20%) to give the title compound (32 mg, yield 47%).

[0420] Step 10: Synthesis of Compound 80

[0421] Compound 79 (1.0 equivalent) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, the mixture was concentrated under reduced pressure. The residue was slurried with diethyl ether to give the title compound (31 mg, 98% yield).

[0422] Step 11: Synthesis of Compound 60D

[0423] Compound 80 (1.0 equivalent), compound 3C (1 equivalent), and N,N-diisopropylethylamine (4.0 equivalent) were dissolved in dimethyl sulfoxide (4 mL). 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.1 equivalent) was added, and the mixture was reacted at room temperature for 30 min. After the reaction was complete as monitored by LC-MS, lithium hydroxide monohydrate (6.0 equivalent) and water (1 mL) were added to the reaction solution, and the mixture was reacted at room temperature for 30 min. After the reaction was complete as monitored by LC-MS, the title compound (7 mg, 21% yield in two steps) was purified by Prep-HPLC. LC-MS (ESI): m / z 1581.4 [(M+3H) / 3] + .

[0424] Example 2: In vitro antitumor activity test of liver-targeting protein degradation agent conjugate

[0425] In vitro antitumor activity assay: Huh-7 cells (4 × 10^3 cells / well) were seeded in 96-well plates containing 100 μL of 1×DMEM, 10% fetal bovine serum, and 1% penicillin / streptomycin (15140-122, Gibco, Rockville, MD, USA). After 24 hours, the medium was replaced with 0.2 mL of the above medium containing the specified dose of the compound, and the plates were incubated at 37°C for three days. Cell viability was measured using the CellTiter-Glo cell viability assay kit (G1111, Promega, Madison, WI, USA) according to the manufacturer's instructions. A dose-response curve was generated, and the half-maximal inhibitory concentration (IC50) was calculated using GraphPad v9.0.2 (San Diego, CA, USA). 50 As shown in Table 1, the novel conjugates exhibited good in vitro antitumor activity, where "+++" indicates IC50. 50 Less than or equal to 200nM; "++" indicates IC 50 Between 200 and 1000 nM; "+" indicates IC 50 Greater than or equal to 1000 nM.

[0426] Table 1. In vitro antitumor activity of Huh7 cell line

[0427]

[0428]

[0429] Example 3: Protein degradation activity test of liver-targeting protein degradation agent conjugate

[0430] Western blot analysis: After treating cells with the specified concentration and time, the culture medium was removed, cells were washed with phosphate-buffered saline (PBS), and cells were lysed (100 μL) in ice-cold RIPA lysis buffer (BP-115DG, Boston BioProducts, Ashland, MA, USA) containing EDTA and EGTA. Cells were immediately placed on ice, scraped, and collected into 1.5 mL centrifuge tubes. After incubating the cell lysate on ice for 30 min, it was centrifuged at 15000 g and 4 °C for 15 min. The cell pellet was discarded, and the supernatant was collected for Western blotting analysis. The supernatant was rapidly frozen and stored at -80 °C for long-term storage. The protein concentration of the cell lysate was determined using a biuret protein quantification kit (P0010, Beyotime, Tianjin, China). After protein quantification, cell lysates containing a quarter volume of 4×Laemmli sample buffer (1610747, Bio-Rad, Hercules, CA, USA) and 5% β-mercaptoethanol were heated at 95°C for 5 minutes. The sample (20 μg) was then electrophoretically transferred to a 0.22 μm polyvinylidene fluoride (PVDF) membrane (Millipore, Bedford, MA, USA) using a wet electrotransfer system (Bio-Rad, Richmond, CA, USA). The transferred membrane was blocked at room temperature for 1 hour in TBS-T buffer (50 mM Trisbase, 150 mM sodium chloride (NaCl), 0.1% (v / v) Tween-20) containing 5% (w / v) skim milk powder for 1 hour. The membrane was washed three times with TBS-T and incubated overnight at 4°C with primary antibody. The membrane was washed three more times with TBS-T for 15 minutes each time and then incubated at room temperature in the dark with secondary antibody for 1 hour. The membrane was then washed three more times with TBS-T for 5 minutes each time. Protein bands were detected using the GeneGnome XRQ-NPC system (Synoptics, Fredrick, MD), and quantitative analysis was performed using Image Studio software. The experiments showed that representative compounds degraded BET family proteins in a time- and concentration-dependent manner and effectively induced downstream c-Myc downregulation. Figure 1 ).

[0431] Example 4: The activity of liver-targeting protein degrader conjugates is highly correlated with ASGPR expression.

[0432] Construction of ASGPR knockdown cell lines: ASGPR knockdown plasmids were constructed using the pCDH-MSCV-E2F-eGFP lentiviral vector. ASGPR shRNA plasmids (target sequences: GCATGTGGGAAGAAAGAT and GCACCACATAGGCCCTGTGAA) were constructed using the pLKO.1 lentiviral vector. The plasmids were transfected into HEK-293T cells, and the collected lentivirus was transfected into Huh-7 cells. Subsequently, the cells were cultured for three days in selection medium containing 2 μg / mL puromycin (ant-pr-1, InvivoGen, USA). The efficiency of ASGPR knockdown was verified by Western blot analysis.

[0433] 4.1. Degradation activity of representative conjugates

[0434] First, the protein degradation activity of representative compounds was evaluated using an in vitro constructed ASGPR knockdown Huh7 cell line (with non-knockdown cells as a control). The results showed ( Figure 2 After ASGPR knockdown, the protein degradation activity of conjugate 13E decreased significantly, demonstrating that the activity of this type of conjugate depends on receptor expression and has potential safety advantages.

[0435] 4.2. Differences in in vitro antitumor activity

[0436] Compared to normal Huh7 cells, the cell viability of compound 13E was significantly reduced in ASGPR knockdown Huh7 cells. Figure 3 This further demonstrates that the cellular activity of the conjugate is highly correlated with receptor expression, suggesting that the systemic tissue toxicity of the conjugate to patients with low ASGPR expression may be improved.

[0437] Example 4: Solubility test of representative coupling compounds

[0438] Solubility determination: Excess compounds 13E and GNE-987 were added to deionized water, sonicated for 10 minutes, and then centrifuged at 10,000 rpm for 10 minutes. The supernatant was separated, and the concentrations of compounds 13E and GNE-987 were determined by high performance liquid chromatography (HPLC).

[0439] Table 2. Solubility differences of representative coupling compounds

[0440]

[0441] As shown in Table 2, traditional PROTAC drugs usually have poor water solubility, while the representative conjugate 13E has excellent water solubility, which is more than 1,000 times higher than that of GNE-987, and can be directly administered in vivo using physiological saline as a formulation.

[0442] Example 5: In vivo antitumor activity of representative conjugates

[0443] In vivo tumor suppression experiment: Four-week-old male BALB / c nude mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (China). These mice were housed under specific pathogen-free (SPF) conditions at an ambient temperature of 20-21°C and a relative humidity of 40%-60%, with a 12-hour dark / 12-hour light cycle, and free access to standard food and water for two weeks. Experiments were conducted when the mice reached a weight of approximately 22 grams. This study followed the Guidelines for the Care and Use of Laboratory Animals. All experimental parameters were kept consistent during data analysis. All experimental protocols were approved by the Animal Ethics Committee of the Kunming Institute of Zoology, Chinese Academy of Sciences (IACUC-RE-2023-04-007). All procedures complied with principles of animal protection, welfare, and ethics, as well as relevant national guidelines. The tumor model was established by inoculating 5 × 10^6 Huh-7 cells suspended in a 100 μL LMEM and Matrigel (1:1) mixture into the right abdomen of each mouse, forming a Huh-7 cell implant. Matrigel (#356234, Corning Incorporated, Corning, NY, USA) was thawed on ice the night before use. After three weeks, the tumor volume reached approximately 150 mm^3. Tumor volume (V) was calculated using the formula V = L / 2 × W^2 by measuring tumor length (L) and width (W). Mice were divided into two or four groups based on tumor size to ensure that the average tumor size in each group was similar, and each group was administered via a different route of administration. Sorafenib (SOR) was prepared as an injection (5% DMSO + 40% PEG300 + 5% Tween-80 + 50% saline), while compound 13E was dissolved in saline. Mice received intraperitoneal injections of the indicated drugs and solutions. Body weight and tumor size were measured every three days after injection. To investigate the synergistic effect of compound 13E and SOR, mice were sacrificed when the tumor volume reached 1500 mm^3.

[0444] Experimental results showed that conjugate 13E (administered once every 3 days) and sorafenib (administered once every 2 days) had comparable antitumor activity when administered as monotherapy, while their combination therapy completely inhibited tumor growth. Figure 4 A). Furthermore, long-term combination therapy can completely inhibit tumor growth and maintain this effect for more than two months. Figure 4 B), and can significantly prolong the survival time of mice. Figure 4 C) This suggests that the conjugate possesses good in vivo antitumor activity. Furthermore, no significant toxic side effects were observed with either the conjugate 13E alone or in combination with sorafenib.

[0445] Example 6: Preliminary in vivo safety evaluation of representative conjugates

[0446] Blood and Tissue Sampling: Following the experiments in Example 5, mice were fasted for 12 hours and then euthanized by exsanguination under isopentane anesthesia. Whole blood samples were collected and divided into two portions: one portion was allowed to coagulate naturally at room temperature to obtain serum for biochemical analysis, and the other portion was placed in an EDTA tube and analyzed for complete blood cell count (CBC) using a Mindray BC-5000Vet automated hematology analyzer (Mindray, Shenzhen, China) within 4 hours. After weighing, the liver and tumor tissues were cut into three parts: one part was fixed in 10% formalin for histopathological examination, and the other two parts were immediately rapidly frozen in liquid nitrogen for tissue extraction and Western blot analysis. These tissue samples were stored at -80°C until use.

[0447] The results showed that long-term combined use of conjugate 13E and sorafenib did not significantly damage platelets. Figure 5 This indicates the good safety of the coupling.

[0448] Example 7: In vitro stability evaluation of representative conjugates

[0449] An appropriate amount of conjugate 13E was dissolved in PBS (pH=7.4) or cell culture medium, and observed for one week at room temperature and 37°C, respectively. During the experiment, the samples were taken every 24 hours and the purity was determined by HPLC.

[0450] The results showed that the purity of conjugate 13E was greater than 90% at the experimental endpoint, indicating that it has good stability.

[0451] Example 8: Evaluation of an in vitro anti-liver fibrosis model of representative conjugates

[0452] Experimental Methods: We evaluated the effects of 13E on fibrosis markers in TGF-β-activated LX-2 cells to investigate its potential anti-fibrotic effect. First, LX-2 cells were treated with different concentrations (5 and 10 ng / mL) of TGF-β, and the expression of fibrosis-related proteins Col1A1 and Mmp2 was detected. Subsequently, quantitative PCR was used to analyze the changes in the expression of fibrosis markers and to assess the role of 13E in reversing TGF-β-induced fibrosis gene expression.

[0453] The results showed that TGF-β treatment significantly upregulated the mRNA expression levels of Col1A1 and Mmp2 in LX-2 cells, successfully establishing an in vitro liver fibrosis model. Quantitative PCR analysis revealed a significant decrease in the mRNA levels of Col1A1 and Mmp2 in the 13E treatment group, suggesting that 13E can effectively reverse TGF-β-induced fibrosis gene expression. Figure 6 ).

[0454] Example 9: Evaluation of an in vivo anti-liver fibrosis model of representative conjugates

[0455] Experimental Methods: To evaluate the anti-hepatic fibrosis effect of 13E in vivo, liver fibrosis was induced in a high-fat choline-deficient diet (CDAA-HFD) mouse model, and the expression of fibrosis markers in the liver was analyzed by quantitative PCR. First, the mRNA levels of key fibrosis-related genes (such as α-sma, Tgfβ, and Mmp2) were detected by qPCR to verify the anti-fibrotic effect of 13E.

[0456] The results showed that quantitative PCR analysis revealed significantly increased mRNA levels of α-sma, Tgfβ, and Mmp2 in the liver of CDAA-HFD group mice, indicating a significant acceleration of liver fibrosis. After 13E treatment, the mRNA expression of these genes significantly decreased, indicating that 13E can effectively inhibit the expression of genes associated with liver fibrosis. Figure 7 ).

[0457] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A conjugate or a pharmaceutically acceptable salt thereof, characterized in that, The conjugate is represented by Formula (A), wherein, the subscript z is 1, 2, or 3; X a and one of X b is CH or N, the other is CH; L 1 for the linker moiety; L P is a cleavable or non-cleavable linker; R is absent or represents 1 or 2 modifying groups; A is R E3 -R Linker -; wherein R E3 is an E3 ligase ligand moiety, R Linker is nothing or a linker for connecting the E3 ligase ligand moiety and the BET family protein binding moiety as shown in Formula IA; L 2 selected from the group consisting of amide, carbonyl, Ci-8alkylene-amide, Ci-8alkylene-carbonyl, and Ci-15alkylene; Ar is an aromatic or heteroaromatic ring; Bm is a ligand for ASGPR.

2. The conjugate of claim 1, wherein, L 1 -W La -(W L1 ) q1 -W Lb -[(W L2 ) q2 -W Lc -(W L3 ) q3 -W Ld ] z1 -; wherein, W La , W Lc and W Ld are each independently selected from the group consisting of null, W, C1-2alkylene, C1-2alkylene-W-, -W-C1-2alkylene, and C1-2alkylene-W-C1-2alkylene; W Lb selected from the group consisting of: none, W, C1-2alkylene, C1-2alkylene-W-, -W-C1-2alkylene, C1-2alkylene-W-C1-2alkylene, W 1 , C1-2alkylene-W 1 , -W 1 (-C1-2alkylene-)2, -C1-2alkylene-W 1 (-C1-2alkylene-)2, W 2 , C1-2alkylene-W 2 , -W 2 (-C1-2alkylene-)3, and -C1-2alkylene-W 2 (-C1-2alkylene-)3; wherein, each W is independently selected from the group consisting of O, S, CO, NH, CONH, NHCO, -C≡C-, -CH=CH-, and -NHCONH-; W 1 selected from the group consisting of -N=, -CH=, -CON=, -NHCON=; W 2 selected from the group consisting of =C=; W L1 , W L2 and W L3 each independently is C1-3alkylene (preferably -CH2-) or C1-2alkylene-O-C1-2alkylene (preferably -CH2OCH2-); each of q1, q2, and q3 is independently an integer from 0 to 20; the subscript z1 is 1, 2, or 3.

3. The conjugate of claim 1, wherein L 1 selected from the following table:

4. The conjugate of claim 1, wherein The conjugate is represented by Formula (I), wherein, X a and one of X b is CH or N, the other is CH; L 1 is a linker moiety; L P is a cleavable or non-cleavable linker; R is absent or represents 1 or 2 modifying groups; A is R E3 -R Linker -; wherein R E3 is an E3 ligase ligand moiety, R Linker is nothing or a linker for connecting the E3 ligase ligand moiety and the BET family protein binding moiety as shown in Formula IA; L 2 selected from the group consisting of amide, carbonyl, Ci-8alkylene-amide, Ci-8alkylene-carbonyl, and Ci-15alkylene; Ar is an aromatic or heteroaromatic ring; Bm is a ligand for ASGPR.

5. The conjugate of claim 1 or 4, wherein Bm is represented by Formula IB; wherein, R B1 is -NHAc or -OH; R B2 is -OH or -PO3H2; W Bn CO or NH; L B each independently is a divalent radical as indicated by -(W B1 ) q1 -W Ba -(W B2 ) q2 -W Bb -(W B3 ) q3 -W Bc -(W B4 ) q4 -; wherein W Ba , W Bb , and W Bc are each independently selected from the group consisting of none, O, CO, NH, CONH, and NHCO; W B1 , W B2 , W B3 and W B4 are each independently C1-3alkylene or C1-2alkylene-O; each of q1, q2, q3, and q4 is independently an integer from 0 to 15; a is 1, 2, or 3.

6. The conjugate of claim 1 or 4, wherein Bm is selected from Table B: Table B 7. The conjugate of claim 1 or 4, wherein X a and X b are each CH.

8. The conjugate of claim 1 or 4, wherein The conjugate has one or more features selected from the group consisting of: (a) L P is preferably wherein, is the point of attachment to L 1 ; is the point of attachment to NH in Z 1 ; 2 each Z 3 and Z 4 is independently an amino acid residue; (c) L 2 selected from the group consisting of -NHCO-, -(CH2) m - and -CO-; wherein m is an integer from 1 to 12; (d) R is absent or represents 1 or 2 groups selected from the group consisting of nitro, deuterium, halogen, C1-4alkyl, C1-4alkoxy; (e) Ar is a C6-10aromatic ring or a 5- to 10-membered heteroaromatic ring.

9. The conjugate of claim 1 or 4, wherein, The conjugate has one or more features selected from the group consisting of: (a) Z 1 is nothing or a glycine residue; Z 2 is nothing or an amino acid residue selected from the group consisting of an L-glutamine residue, a D-glutamine residue, an L-glutamic acid residue, a D-glutamic acid residue, an L-aspartic acid residue, a D-aspartic acid residue, an L-alanine residue, a D-alanine residue, and a glycine residue; Z 3 is selected from the group consisting of an L-valine residue, a D-valine residue, an L-alanine residue, a D-alanine residue, an L-phenylalanine residue, a D-phenylalanine residue, and a glycine residue; and Z 4 is selected from the group consisting of an L-alanine residue, a D-alanine residue, an L-citrulline residue, a D-citrulline residue, an L-asparagine residue, a D-asparagine residue, an L-lysine residue, a D-lysine residue, an L-phenylalanine residue, a D-phenylalanine residue, and a glycine residue; (c) Ar is a benzene ring or a 5- or 6-membered nitrogen-containing heteroaromatic ring; (d) R Linker To wherein, representing the point of attachment to the methylene group; * represents the position of attachment to R E3 ; n is an integer from 0 to 20; (e) R E3 selected from the group consisting of: wherein, R 1 is H or C1-3alkyl; representing the point of attachment to the methylene group.

10. The conjugate of claim 1 or 4, wherein The conjugate has one or more features selected from the group consisting of: (a) L P selected from the following table: wherein is a point of attachment to L 1 ; and is a point of attachment to ; (c) Ar is (d) A is selected from the group consisting of: wherein, n is an integer from 0 to 20; represents the point of attachment to L 2 ; and represents the point of attachment to the methylene group in.

11. The conjugate of claim 1 or 4, wherein, selected from the group consisting of:

12. The conjugate of claim 1, wherein, the conjugate is selected from Table A Table A 13. A pharmaceutical composition comprising (i) the conjugate of claim 1 or 4, or a pharmaceutically acceptable salt thereof, and (ii) one or more pharmaceutically acceptable carriers.

14. A kit comprising: (1) the conjugate of claim 1 or 4, or a pharmaceutically acceptable salt thereof, and (2) one or more additional therapeutic agents.

15. The kit of claim 14, wherein The additional therapeutic agent is a PD1 / PD-L1 inhibitor or a kinase inhibitor, and the kinase inhibitor is selected from the group consisting of a VEGFR2 inhibitor, a VEGFR3 inhibitor, a PDGFRβ inhibitor, a FLT3 inhibitor, a c-Kit inhibitor, or a combination thereof.

16. Use of the conjugate or a pharmaceutically acceptable salt thereof according to claim 1 or 4 for the manufacture of a medicament for the treatment or prevention of liver diseases; wherein, The liver disease is a liver cancer and a liver fibrosis disease.

17. The use according to claim 16, characterized in that, The conjugate can also be used in combination with an additional therapeutic agent.

18. The use of claim 16, wherein, The additional therapeutic agent is a PD1 / PD-L1 inhibitor or a kinase inhibitor, and the kinase inhibitor is selected from the group consisting of a VEGFR2 inhibitor, a VEGFR3 inhibitor, a PDGFRβ inhibitor, a FLT3 inhibitor, a c-Kit inhibitor, or a combination thereof.

Images