A genetically modified Bordetella pertussis strain, its preparation method and application

Abstract

This invention discloses a genetically modified Bordetella pertussis strain, its preparation method, and its applications. Compared to Bordetella pertussis strain BAA-589, the described Bordetella pertussis strain possesses an element that reduces BP1569 gene expression. The Bordetella pertussis strain provided by this invention significantly increases OMV production and shows promising application prospects in promoting the development of Bordetella pertussis OMV vaccines.

Description

Technical Field

[0001] This invention belongs to the field of vaccinology, particularly the prevention and treatment of Bordetella pertussis infection. Specifically, it relates to a genetically modified Bordetella pertussis strain, its preparation method, and its application. Background Technology

[0002] Whooping cough, also known as pertussis, is a highly contagious respiratory illness caused by *Bordetella pertussis*. It is characterized by a violent coughing attack, followed by forceful inhalation and a distinctive whooping cough sound. *Bordetella pertussis* was first identified as the causative agent of whooping cough in 1906. *Bordetella pertussis* is a Gram-negative bacterium that specifically infects humans. The bacteria are transmitted from person to person through inhaled respiratory droplets. The vaccine used was called whole-cell pertussis (wP), which consisted of inactivated *Bordetella pertussis* combined with diphtheria and tetanus toxoids. Due to some serious complications of the wP vaccine, it was replaced by the acellular (aP) vaccine in the late 1990s. The aP vaccine contains a combination of some of the most important *Bordetella pertussis* virulence factors, such as pertussis toxin, filamentous hemagglutinin, *Bordetella pertussis* adhesin, and fimbriae 2 and 3.

[0003] However, pertussis persists in individuals vaccinated with the aP vaccine, and epidemiological data report an increase in pertussis incidence worldwide in recent years, possibly related to the evolution of pertussis strains and the shortened duration of protection provided by the aP vaccine. To prevent the resurgence of pertussis, there is an urgent need to develop a more effective new vaccine.

[0004] In recent years, increasing attention has been paid to the use of outer membrane vesicles (OMVs) as vaccines. For example, the OMV-based Neisseria meningitidis vaccine BEXSERO, containing OMV from the New Zealand strain NZ98 / 254, received approval from the European EMA and the US FDA in 2013 and 2015, respectively. US9623102B2 utilizes OMVs from Bordetella pertussis and Bordetella parapertussis to induce a strong immune response, reduce bacterial colonization, and ensure long-term efficacy.

[0005] OMVs (also known as "outer membrane vesicles") are double-membrane structures, typically spherical, with a diameter ranging from 20-250 nm (sometimes 10-500 nm). They bud off from the outer membrane of Gram-negative bacteria. The OMV membrane contains phospholipids (PL) internally and lipopolysaccharides (LPS) and PL externally, mixed with membrane proteins at different locations, largely reflecting the structure of the bacterial outer membrane from which it buds off. The lumen of an OMV may contain various compounds from the periplasm or cytoplasm, such as proteins, RNA / DNA, and peptidoglycan (PG). However, unlike bacterial cells, OMVs lack the ability to self-replicate. OMV vaccines offer several advantages: First, OMVs can carry most bacterial substances, including key antigens on the bacterial surface, but lack the ability to replicate. Second, OMVs possess natural adjuvant properties, strongly stimulating both innate and adaptive immune responses. Third, OMVs exhibit good stability to high temperatures and certain chemicals. These characteristics demonstrate the strong potential of OMVs as a novel form of bacterial vaccine.

[0006] However, *Bordeza pertussis* cannot secrete high levels of OMV, which greatly limits the development of pertussis OMV vaccines. Reports on increasing *Bordeza pertussis* OMV production are few. For example, Eline F. de Jonge et al. (Curr Res MicrobSci. 2022 Nov 12:3:100172.) found that simultaneous knockout of the *mlaF* and *pldA* genes in *Bordeza pertussis* led to the accumulation of outer membrane phospholipids and increased OMV production. Eline F de Jonge et al. also found that conditional knockout of the *pal* gene could also increase *Bordeza pertussis* OMV production (Res Microbiol. 2022 May-Jun;173(4-5):103937.). Furthermore, knockout of the *mltA* gene (CN 118853525 B) or specific point mutations in the *OmpA* protein (CN116438193A) of *Bordeza pertussis* also have the effect of increasing OMV production. Besides the targets mentioned above, few other novel targets for increasing OMV production have been reported in Bordetella pertussis. Therefore, there is an urgent need to find new targets to accelerate the development of Bordetella pertussis OMV vaccines. Summary of the Invention

[0007] To address the aforementioned technical problems in the prior art, this invention provides a genetically modified Bordetella pertussis strain, its preparation method, and its application.

[0008] Specifically, the present invention solves the above-mentioned technical problems through the following technical solutions:

[0009] A first aspect of the present invention provides a genetically modified Bordetella pertussis strain, which, compared with Bordetella pertussis strain BAA-589, has an element that reduces the expression of the BP1569 gene.

[0010] In some embodiments, the BP1569 gene encodes an amino acid sequence as shown in SEQ ID NO: 2 or a nucleotide sequence as shown in SEQ ID NO: 1.

[0011] In some embodiments, the element includes an inducible expression system or an antisense compound that targets the expression product of the BP1569 gene.

[0012] In some embodiments, the antisense compound is an antisense RNA, an antisense peptide nucleic acid (PNA), or a morpholino oligonucleotide (PMO).

[0013] In some implementations, the gene expression product is RNA.

[0014] In some embodiments, the inducible expression system is selected from the lacI-Ptac system, the T7-lac system, the arabad / PBAD system, the tetracycline Tet / tetR system, the rhamnose rhaBAD / rhaSR system, the copper ion CueR / PcopA system, the temperature-induced system, and the photo-induced system.

[0015] In some specific implementations, the inducible expression system is the lacI-Ptac system.

[0016] In some specific implementations, the lacI-Ptac system comprises a nucleotide sequence as shown in SEQ ID NO: 5.

[0017] In some specific implementations, the T7-lac system comprises a nucleotide sequence as shown in SEQ ID NO: 10.

[0018] In some specific implementations, the araBAD / PBAD system comprises a nucleotide sequence as shown in SEQ ID NO: 11.

[0019] In some specific implementations, the tetracycline Tet / tetR system comprises a nucleotide sequence as shown in SEQ ID NO: 12.

[0020] In some specific embodiments, the rhamnose rhaBAD / rhaSR comprises a nucleotide sequence as shown in SEQ ID NO: 13.

[0021] In some embodiments, the genetically modified Bordetella pertussis strain has at least a 20% lower expression level of the BP1569 gene compared to Bordetella pertussis strain BAA-589.

[0022] In some embodiments, the genetically modified Bordetella pertussis strain has a BP1569 gene expression level that is reduced by at least 50% compared to Bordetella pertussis strain BAA-589.

[0023] In some specific implementations, the genetically modified Bordetella pertussis strain exhibits at least an 88% reduction in the expression level of the BP1569 gene compared to Bordetella pertussis strain BAA-589.

[0024] A second aspect of the present invention provides a nucleic acid construct comprising:

[0025] (1) The upstream fragment of the BP1569 gene, the inducible expression system, and the 5' end fragment of the BP1569 gene; or,

[0026] (2) Nucleic acid encoding an antisense compound that targets the expression product of the BP1569 gene.

[0027] In this paper, the term "BP1569 gene upstream fragment" refers to a DNA fragment of no more than 1000 bp in length that is homologous to the upstream region of the BP1569 gene translation start site (ATG).

[0028] In this paper, the term "5' end fragment of the BP1569 gene" refers to a DNA fragment that is homologous to a region of no more than 1000 bp in length that begins at the translation start site (ATG) of the BP1569 gene.

[0029] In some embodiments, the upstream fragment of the BP1569 gene contains the nucleotide sequence shown in SEQ ID NO: 3, and the 5' end fragment of the BP1569 gene contains the nucleotide sequence shown in SEQ ID NO: 4.

[0030] In some embodiments, the inducible expression system is selected from the lacI-Ptac system, the T7-lac system, the arabad / PBAD system, the tetracycline Tet / tetR system, the rhamnose rhaBAD / rhaSR system, the copper ion CueR / PcopA system, the temperature-induced system, and the photo-induced system.

[0031] In some specific implementations, the nucleic acid construct is a plasmid backbone containing a foreign gene, the foreign gene containing a nucleotide sequence as shown in SEQ ID NO: 9, and the plasmid backbone containing a nucleotide sequence as shown in SEQ ID NO: 6.

[0032] A third aspect of the present invention provides a method for preparing a genetically modified Bordetella pertussis strain, the method comprising:

[0033] An element that reduces BP1569 gene expression was introduced into Bordetella pertussis strain BAA-589;

[0034] The elements are as defined in the Bordetella pertussis strain described in the first aspect of the present invention.

[0035] In some embodiments, the element includes a nucleic acid construct as described in the second aspect of the invention.

[0036] A fourth aspect of the present invention provides a method for preparing pertussis vesicles, the method comprising culturing a strain of Bordetella pertussis as described in the first aspect of the present invention and obtaining pertussis vesicles from the culture.

[0037] In some embodiments, the method includes culturing the Bordetella pertussis strain under conditions containing less than 40 μM of IPTG inducer.

[0038] In some embodiments, the method includes culturing the Bordetella pertussis strain under conditions containing less than 20 μM of IPTG inducer.

[0039] In some embodiments, the method includes culturing the Bordetella pertussis strain under conditions containing less than 8 μM of IPTG inducer.

[0040] The fifth aspect of the present invention provides the use of a nucleic acid construct as described in the second aspect of the present invention in the preparation of genetically modified Bordetella pertussis strains.

[0041] The sixth aspect of the present invention provides the use of Bordetella pertussis strains as described in the first aspect of the present invention, or nucleic acid constructs as described in the second aspect of the present invention, in the preparation of pertussis outer membrane vesicles.

[0042] A seventh aspect of the present invention provides a composition comprising a Bordetella pertussis strain as described in the first aspect of the present invention, a nucleic acid construct as described in the second aspect of the present invention, or a pertussis outer membrane vesicle prepared by the method described in the fourth aspect of the present invention.

[0043] In some embodiments, when the composition contains the Bordetella pertussis strain or the pertussis outer membrane vesicles, the composition is a vaccine or adjuvant.

[0044] The eighth aspect of the present invention provides the use of a Bordetella pertussis strain as described in the first aspect of the present invention or a composition as described in the seventh aspect in the preparation of a medicament for the prevention and / or treatment of Bordetella pertussis infection.

[0045] In some implementations, the drug includes a vaccine.

[0046] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0047] The reagents and raw materials used in this invention are all commercially available.

[0048] The positive and progressive effects of this invention are as follows:

[0049] The Bordetella pertussis strain provided by this invention has a significant effect on increasing OMV production and has good application prospects in promoting the development of Bordetella pertussis OMV vaccines. Attached Figure Description

[0050] Figure 1 Map of BP1569 gene editing plasmids.

[0051] Figure 2 PCR verification of the BP1569 gene conditional knockout strain.

[0052] Figure 3 Sequencing results for the BP1569 gene conditionally knocked-out strain.

[0053] Figure 4 The plate growth of the BP1569 gene conditionally knocked-out strain.

[0054] Figure 5 The expression of the BP1569 gene under different induction conditions.

[0055] Figure 6 The growth of the BP1569 gene conditionally knocked-out strain at 32h time points.

[0056] Figure 7 OMV concentration was measured at 24 h for the BP1569 gene conditional knockout strain.

[0057] Figure 8 The growth of the BP1569 gene conditionally knocked-out strain at 48 h time points.

[0058] Figure 9OMV concentration was measured at 48 h for the BP1569 gene conditional knockout strain. Detailed Implementation

[0059] To better understand this invention, some terms are first defined. Other definitions are listed throughout the detailed description section.

[0060] The term "OMV" stands for outer membrane vesicles, which refers to the outer membrane vesicles secreted by Gram-negative bacteria.

[0061] The term "IPTG," or Isopropyl β-D-thiogalactoside, is a commonly used inducer that can induce the expression of target genes as needed.

[0062] The term "NTA" stands for Nanoparticle Tracking Analysis, which is a detection method that uses the properties of light scattering and Brownian motion to obtain the particle size distribution of a sample in a liquid suspension.

[0063] The term "conditional knockout" refers to the inactivation, deletion, or reduction of a target gene under specific, artificially controlled conditions using an inducible recombination system. Conditional knockout provides flexibility in terms of timing and control for gene function studies, and is particularly crucial for the study of essential genes (i.e., genes whose direct knockout would lead to microbial death or inability to grow).

[0064] The term "antense compound" refers to a class of molecules that can regulate gene expression by specifically binding to target RNA (such as mRNA). Their mechanism of action is based on the principle of complementary base pairing; that is, by designing nucleic acid strands complementary to specific RNA sequences, they interfere with the normal function of RNA.

[0065] The term "gene expression product" refers to molecules with biological functions produced after genes undergo transcription, translation, and other processes. These are divided into RNA products, which are functional RNA molecules that are transcribed directly from genes without translation, including mRNA (messenger RNA, which guides subsequent protein synthesis), rRNA (ribosomal RNA, involved in ribosome assembly), tRNA (transfer RNA, responsible for amino acid transport), and microRNA (microRNA, regulating gene expression); and protein products, which are polypeptide chains synthesized from mRNA through ribosome translation. These proteins, after folding and modification (such as phosphorylation and glycosylation), form functional proteins and are the main expression products of the vast majority of genes (such as enzymes, structural proteins, and transcription factors).

[0066] The term "genetic intervention" refers to techniques or methods that artificially modify, regulate, or manipulate the genetic material (DNA or RNA) of an organism to alter its gene expression, function, or genetic characteristics. This includes, but is not limited to, gene editing techniques such as CRISPR-Cas9, TALENs, and ZFN, which use nucleases to target and cut DNA, inducing homologous recombination (HDR) or non-homologous end joining (NHEJ) to achieve gene knockout, knock-in, or modification; gene expression regulation techniques such as antisense technology: using antisense compounds (such as antisense RNA, siRNA, or shRNA) to inhibit the expression of specific genes; or inducible systems: such as Tet-On / Off and optogenetic tools (photoinducible promoters) to spatiotemporally regulate gene expression levels or function.

[0067] The term "inducible expression system" refers to an artificial regulatory system that precisely controls the expression of a target gene through specific external stimuli (such as chemicals, temperature, light, etc.). Its core feature is the "on-demand activation or deactivation" of gene expression, and it is widely used in basic research, bioengineering, and gene therapy.

[0068] The term "copper ion CueR / PcopA system" is an inducible expression system consisting of the copper-responsive regulatory protein CueR and the copper-inducible promoter PcopA. CueR binds to copper ions and activates PcopA, which then initiates the expression of downstream genes.

[0069] The term "temperature-induced system" is an inducible expression system in which the expression of downstream genes is induced by a heat-stimulated promoter (such as Phsp70) (activated at high temperatures (37℃-42℃)) or a cold-induced promoter (such as PcspA) (activated at low temperatures (such as 25℃-16℃)).

[0070] The term "photoinducible system" refers to an inducible expression system for light-induced gene expression, such as the blue light system (e.g., pC120): the photosensitive protein EL222 binds to the photo-oxygen voltage (LOV) domain, and blue light induces dimerization to activate the promoter, and the red / far-red light system: the PhyB-PIF3 module, which binds in red light and dissociates in far-red light.

[0071] The present invention is further illustrated below by way of examples, but these examples do not limit the invention to the scope of the embodiments described. Experimental methods not specifically described in the following examples were performed according to conventional methods and conditions, or as selected according to the product instructions. For illustrative purposes, the present invention uses the BAA-589 strain purchased from ATCC (American Type Culture Collection).

[0072] Example 1: Construction of BAA-589 strain with direct knockout of BP1569 gene

[0073] Homologous recombination was used to completely knock out the coding region of the BP1569 gene in strain BAA-589, but strains with complete BP1569 gene knockout were not successfully obtained, indicating that the BP1569 gene is an essential gene and is necessary for the growth of strain BAA-589. Knocking out this gene leads to the lethality of the strain.

[0074] Example 2: Construction of BAA-589 strain with conditional knockout of BP1569 gene

[0075] 2.1 Information on plasmid construction of BAA589ΔBP1569::Ptac-BP1569 strain

[0076] The plasmid for conditionally knocking out the BP1569 gene of Bordetella pertussis was constructed as follows: First, homologous arm fragments for gene editing of the BP1569 gene were amplified from the BAA-589 genome of Bordetella pertussis by PCR. The lacI-Ptac fragment of the induction system was amplified from the exogenous plasmid. The three fragments were then inserted into the plasmid backbone via homologous recombination. Colony PCR and plasmid sequencing were then used to ensure the correctness of the target sequence on the plasmid.

[0077] Table 1. Primer information for plasmid construction

[0078]

[0079] 2.2 Plasmid Transformation

[0080] Bordetella pertussis competent cells were prepared using pre-cooled 10% glycerol. The gene-editing plasmid constructed above was introduced into the competent cells via electroporation. The electroporation instrument parameters were set as follows: voltage 1.6-2.2 kV, resistance 200 Ω, capacitance 25 μF, and electroporation time not exceeding 5 ms. After electroporation, SS liquid medium (formulations shown in Tables 2 & 3) was added, and the cells were incubated in a shaker at 35-37℃ and 220-240 rpm for recovery. After recovery, the cells were centrifuged, most of the supernatant was discarded, and the bacterial resuspended cells were plated onto Bordet-Gengou agar plates containing 10 μg / ml gentamicin resistance. The plates were then incubated statically in an incubator at 35-37℃ until transformed single colonies grew.

[0081] Table 2. SS medium formulation:

[0082]

[0083] Table 3. Formulation of Bordetella pertussis growth factor:

[0084]

[0085] 2.3 Screening and Validation of Primary and Secondary Recombination

[0086] After single clones of appropriate size grow on electroporation plates, PCR is used to verify the recombination of the single clones. Single clones that have correctly undergone the first recombination (1HR) are obtained, which means that the gene-edited plasmid has been successfully recombinated into the genome of Bordetella pertussis under resistance pressure through homologous arm sequences.

[0087] Further, single-clonal colonies that correctly underwent 1HR recombination were streaked onto plates containing 1% DOG (2-Deoxy-D-galactose) for reverse selection. The plates were then incubated statically at 37°C until the single colonies reached an appropriate size. Single-clonal colonies from the reverse-selection plates were then subjected to PCR verification. The size of the PCR product bands determined the second recombination (2HR) form of the single colony. Figure 2 As shown, the PCR product band of the target mutant strain ΔBP1569::Ptac-BP1569 (3750bp) is significantly larger than the PCR product band of BAA-589 WT (2252bp), which is consistent with the expected mutant.

[0088] Table 4. Primer information for strain validation

[0089]

[0090] Furthermore, the PCR product of strain ΔBP1569::Ptac-BP1569 was sequenced to confirm that the edited sequence of the target mutant strain was consistent with the expectation. Figure 3 As shown, the sequencing results are correct.

[0091] Example 3: Growth of the strain on plates and determination of OMV yield

[0092] Because the BP1569 gene is conditionally knocked out, the growth of the strain was tested with and without the inducer. Figure 4 As shown, on BG plates containing 1 mM IPTG inducer, the ΔBP1569::Ptac-BP1569 strain grew well after streaking; however, on BG plates without the inducer, the ΔBP1569::Ptac-BP1569 strain barely grew after streaking. This indicates that the BP1569 gene is essential for the normal growth of Bordetella pertussis, and also demonstrates that the Ptac induction system functions well in Bordetella pertussis.

[0093] Example 4: Detection of BP1569 gene expression reduction under different IPTG induction concentrations

[0094] The above results demonstrate that the BP1569 gene in the ΔBP1569::Ptac-BP1569 strain can be induced to express by IPTG on BG plates. Furthermore, different concentrations of IPTG (e.g., 0 μM, 1.6 μM, 8.0 μM, 40 μM) were added to SS liquid medium to induce different degrees of BP1569 gene expression, and the expression and growth of the BP1569 gene were detected. After collecting bacterial cultures induced by different concentrations of IPTG (e.g., 0 μM, 1.6 μM, 8.0 μM, 40 μM), RNA extraction, reverse transcription, and quantitative real-time PCR (qPCR) experiments were performed according to the kit instructions. The expression levels of the BP1569 gene in strain ΔBP1569::Ptac-BP1569 relative to those in strain BAA-589 were calculated under different concentrations of IPTG (e.g., 0 μM, 1.6 μM, 8.0 μM, 40 μM). The primers used for qPCR verification of BP1569 gene expression are shown in the table below. The qPCR results are as follows. Figure 5 As shown, under conditions without inducer or with low concentrations of IPTG (1.6 μM, 8.0 μM), the expression level of the BP1569 gene in the ΔBP1569::Ptac-BP1569 strain was 12% lower than that in the BAA-589 strain. With further increases in inducer concentration (e.g., 40 μM), the expression level of the BP1569 gene in the ΔBP1569::Ptac-BP1569 strain significantly increased, reaching 230% of that in the BAA-589 strain. The growth of the strains is shown in the figure. Figure 6 As shown, the OD of strain ΔBP1569::Ptac-BP1569 was [data missing] in the absence of or with low concentrations of inducer (1.6 μM and 8 μM). 600 Very low, indicating low expression of the BP1569 gene; when the concentration of the inducer was increased (40 μM), the OD of the strain... 600 The significantly increased value indicates that the BP1569 gene was induced to express. These results demonstrate that the expression of the target gene BP1569 was successfully attenuated in the ΔBP1569::Ptac-BP1569 strain and can be induced by an inducer.

[0095] Table 5. Primer Information

[0096]

[0097] Example 5: OMV yield determination of strain

[0098] Furthermore, the OMV yield of the target strain ΔBP1569::Ptac-BP1569 in liquid medium was determined. First, the ΔBP1569::Ptac-BP1569 strain was activated on BG plates containing 1 mM IPTG, and the control strain BAA-589 was activated on BG plates. After colonies grew on the activated plates, cells were picked and cultured in 4 ml of SS liquid medium (at 35°C and 240 rpm in a shaker). After approximately 24 h of culture, transfer was performed. The ΔBP1569::Ptac-BP1569 strain was transferred to SS medium containing or without different concentrations of IPTG inducer (0.32 μM, 1.6 μM, 8.0 μM, 40 μM, 200 μM, and 1000 μM), and the BAA-589 strain was transferred to SS medium containing or without IPTG inducer (1000 μM). The initial OD of the transfer was determined. 600 Approximately 0.1.

[0099] After 24 hours of transfer, the OMV concentration of the strain was measured. 1 ml of bacterial culture was centrifuged at 10,000 rpm for 5 minutes. The supernatant was collected and filtered using a 0.22 µm filter. The filtered supernatant was diluted appropriately, and the OMV particle concentration was measured using a NanoSight Pro instrument according to the instruction manual. Figure 7 As shown, in the absence of or with low concentrations of inducer (0.32 μM, 1.6 μM, and 8 μM), the OMV concentration of the ΔBP1569::Ptac-BP1569 strain ranged from 6.5 E10 to 10.0 E10 / ml of bacterial culture. This was significantly higher than the OMV concentration of the ΔBP1569::Ptac-BP1569 strain (1.0 E10 to 1.5 E10 / ml of bacterial culture) under further increased inducer concentrations (40 μM, 200 μM, and 1000 μM), and also significantly higher than the OMV concentration of the BAA-589 strain (2.3 E10 to 2.6 E10 / ml of bacterial culture). These results indicate that conditional knockout or knockdown of the BP1569 gene expression can significantly increase the OMV production of Bordetella pertussis.

[0100] Following the above method, the OD of the bacterial culture at approximately 48 hours after transfer was measured. 600 The concentration of OMV was measured. Figure 8 As shown, compared with the 32h incubation time point ( Figure 6 ΔBP1569::Ptac-BP1569 strain without IPTG group OD 600 The value was 0.147. After 48 hours of cultivation, the OD of the BP1569::Ptac-BP1569 strain without IPTG inducer was... 600 Significantly elevated, OD 600 The value reached 2.21.

[0101] OMV concentration measurement results are as follows: Figure 9 As shown, under these conditions, the OMV concentration of strain ΔBP1569::Ptac-BP1569 still reached 9.1 E10 / ml of bacterial culture, which is significantly higher than the OMV concentration of strain BAA-589 (1.26 E10 / ml of bacterial culture). These results indicate that the increase in OMV production of strain ΔBP1569::Ptac-BP1569 is a continuous process, influenced by increased culture time and OD. 600 The increase will not reduce the output of OMV.

[0102] Sequence information

[0103] BP1569 gene nucleotide sequence (SEQ ID NO: 1)

[0104]

[0105] Amino acid sequence encoded by the BP1569 gene (SEQ ID NO: 2)

[0106] MRMNKRHAGASALMALALLAGCSDVNQLLGNEESVDYKSTRRGDPLSIPPDLTQANNDPRYKAPASGTATYSQFQQQGLQQQASAGQNTNVLPERADMRVERDGDLRWLVIERPPEQLFSKVVDFWTDTGFTVSVNNPQAGIIETDWAENRAKIPESWLRQVLGSVLETAWDSGEREKFRTRVERVNGHTEIYITHNQMLEKRVGSDGGQVQWTHGKEDPGLNAAMLARLMVYLGTDVDAARKLVAQAEAAPQAPKVQSVRAEGAMLVVDESFDRAWRRVGVALDSGGFAVDDRDRSAGEYFVRYVDTDTGAQNEQPGFFSRLFSSDKKAQAPQYRIRLTGSGTQTQVTVLDANGQRDSSATAQRMLSVLKDKMV

[0107] BP1569-up nucleotide sequence (SEQ ID NO: 3)

[0108] GCCAATATCCGGTAAACTCGTTGGTTTGATTGATTGAGGTCCGGCCAGACAGGCGCCGGGTCGCGGAGCCCGATAAACATGGCATCCTCAGCACCTGCCGCAACCGTGCAGTTCCAAGGCAGTTTGGTGGCCCTGGTCACCCCGATGCAGCCCGATGGCAGCCTCGACTACGACGCATACCGGTCCTTGATCGACTGGCACGTGGCCGAAGGCACCGATGGCCTGGTGGTGGTCGGCACCACCGGAGAATCTCCTTCCGTTTCGATGGAAGAGCACGCCGAGCTCATCCGCGTGGCGGTCGAGCACGCCGCCGGCCGCATTCCGGTCATCGCCGGCGTGGGCGCCAACTCCACCGACGAAGCCATCCATCTGGCCCGCCACGCCAAGGCGGTCGGCGCACAGGCCGGCCTGTCGGTCGTGCCGTACTACAACAAACCCAACCAGGAAGGCATCTACCGCCATTTCCGCGCGGTGGCCGAGGCGGTCGATCTGCCGACGGTGCTGTACAACGTGCCCGGCCGCACGGTGGCCGACATGTCCAACGACACGGTGCTGCGCCTGGCCGAAGTGCCGGGCATCATCGGCATCAAGGAAGCCACGGGCGACATTGCCCGGGGCGCCTTGCTGCTGCGCGAGGCGCCCGCCGGCTTCCAGGTGTTCAGCGGCGACGATCCGACCGCCGCGGCCCTGATCCTGCTGGGCGCGCGCGGTAATATTTCGGTGACGGCCAACGTGGCGCCGCGCCTGATGCATGAACTCTGTACGGCGGCGCGCGGCGGTGACGTGCCGCGCACGCGTGAACTCAATGCACGGTTAGCCCGTCTCAACAAGGCCTTGTTCATCGAGGCCAACCCTATCCCTGTCAAATGGGCGCTGGCCCAGATGGGCCACACAGCTCTTGGTTATCGTCTGCCGATGGTCGAGCTGAGCGAGCAGTACCACTCGCTGGTACGTACCGCCCTGCAGGAAGTGGGTCTGCTCTAAATATCGTGAGG

[0109] BP1569-down nucleotide sequence (SEQ ID NO: 4)

[0110] ATGCGTATGAACAAACGTCATGCCGGAGCGTCGGCATTGATGGCCCTGGCATTGCTGGCGGGCTGCAGCGATGTCAACCAGTTGCTGGGCAATGAAGAGTCGGTGGATTACAAAAGCACGCGGCGCGGCGACCCGCTCAGCATTCCACCCGACCTGACCCAGGCCAACAACGATCCGCGCTACAAGGCGCCTGCCTCCGGAACCGCGACCTACTCGCAATTCCAGCAGCAGGGCCTGCAGCAGCAGGCCAGCGCCGGCCAGAATACCAACGTGCTGCCGGAGCGCGCGGACATGCGTGTCGAGCGCGACGGCGACCTGCGCTGGCTGGTGATCGAGCGGCCGCCCGAGCAGCTGTTTTCCAAGGTGGTCGATTTCTGGACCGACACGGGCTTCACGGTCTCGGTCAACAATCCGCAGGCCGGCATCATCGAGACCGACTGGGCCGAGAACCGCGCCAAGATTCCGGAAAGCTGGCTGCGCCAGGTGCTCGGGTCGGTGCTGGAGACCGCGTGGGATAGCGGCGAGCGCGAGAAGTTCCGCACGCGGGTCGAGCGCGTCAATGGGCACACCGAGATCTACATCACGCACAACCAGATGCTGGAAAAGCGTGTCGGCTCGGATGGCGGCCAGGTGCAATGGACCCACGGCAAGGAAGACCCGGGCCTGAACGCGGCCATGCTGGCGCGCCTGATGGTGTACCTGGGCACCGACGTGGATGCGGCGCGCAAGCTGGTGGCGCAGGCCGAAGCGGCCCCGCAGGCGCCCAAGGTGCAGAGCGTGCGCGCCGAAGGCGCGATGCTGGTGGTCGACGAGTCGTTCGATCGCGCCTGGCGGCGCGTGGGCGTGGCCCTGGATTCGGGCGGCTTCGCGGTCGACGATCGCGACCGCAGCGCCGGCGAGTACTTCGTGCGCTACGTGGATACCGACACGGGCGCGCAGAACGAGCAGCCGGGCTTCTTCAGCCGCCTGTTCTCCAG

[0111] Upstream nucleotide sequence of the plasmid backbone insertion site (SEQ ID NO: 7)

[0112] ACAACTGGCGGTATGGATGC

[0113] Downstream nucleotide sequence of the plasmid backbone insertion site (SEQ ID NO: 8)

[0114] GGCGGGACCAGAGAAAAATC

[0115] The gene editing key fragment sequence (SEQ ID NO: 9) is as follows: positions 1-995 are BP1569-up (i.e., the upstream fragment of the BP1569 gene); positions 996-2493 are lacI-Ptac; and positions 2294-3470 are BP1569-down (i.e., the 5' end fragment of the BP1569 gene).

[0116]

[0117] While specific embodiments of the present invention have been described above, those skilled in the art should understand that these are merely illustrative examples, and various changes or modifications can be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the scope of protection of the present invention is defined by the appended claims.

Claims

1. A genetically modified Bordetella pertussis strain, characterized in that, The genetically modified Bordetella pertussis strain and the Bordetella pertussis strain ( Bordetella pertussis Compared to BAA-589, it has an element that reduces the expression of the BP1569 gene; the element includes an inducible expression system; wherein the inducible expression system is a lacI-Ptac system, and the BP1569 gene encodes the amino acid sequence shown in SEQ ID NO:

2.

2. The Bordetella pertussis strain as described in claim 1, characterized in that, The nucleotide sequence of the BP1569 gene is shown in SEQ ID NO:

1.

3. The Bordetella pertussis strain as described in claim 1 or 2, characterized in that, The genetically modified Bordetella pertussis strain and the Bordetella pertussis strain ( Bordetella pertussis Compared to BAA-589, the expression level of the BP1569 gene is reduced by at least 50%.

4. The Bordetella pertussis strain as described in claim 3, characterized in that, The BP1569 gene of the genetically modified Bordetella pertussis strain was induced to be expressed by the lacI-Ptac system, which contains the nucleotide sequence shown in SEQ ID NO:

5.

5. A method for preparing a genetically modified Bordetella pertussis strain, characterized in that, The method includes: To Bordetella pertussis strain ( Bordetella pertussis BAA-589 incorporates elements that reduce BP1569 gene expression; Wherein, the element is defined in any one of the Bordetella pertussis strains as described in any one of claims 1-4; The BP1569 gene encodes the amino acid sequence shown in SEQ ID NO:

2.

6. A method for preparing pertussis epithelial vesicles, characterized in that, The method includes culturing a Bordetella pertussis strain as described in any one of claims 1-4 and obtaining pertussis outer membrane vesicles from the culture.

7. The method as described in claim 6, characterized in that, The method involves culturing the Bordetella pertussis strain under conditions containing less than 40 μM of IPTG inducer.

8. The use of a nucleic acid construct in the preparation of a genetically modified Bordetella pertussis strain as described in any one of claims 1-4; The nucleic acid construct comprises: an upstream fragment of the BP1569 gene, an inducible expression system, and a 5' end fragment of the BP1569 gene; wherein... The upstream fragment of the BP1569 gene contains the nucleotide sequence shown in SEQ ID NO: 3, and the 5' end fragment of the BP1569 gene contains the nucleotide sequence shown in SEQ ID NO: 4; the inducible expression system is the lacI-Ptac system.

9. The use of the Bordetella pertussis strain as described in any one of claims 1-4 in the preparation of pertussis outer membrane vesicles.

10. A composition, characterized in that, The composition comprises the Bordetella pertussis strain as described in any one of claims 1-4.

11. The composition according to claim 10, characterized in that, The composition further comprises pertussis epithelial vesicles prepared according to the method of claim 6 or 7.

12. The composition according to claim 10 or 11, characterized in that, The composition is a vaccine.

13. Use of the Bordetella pertussis strain as described in any one of claims 1-4 or the composition as described in any one of claims 10-12 in the preparation of a medicament for the prevention of Bordetella pertussis infection; said medicament being a vaccine.

Images