A lipase mutant capable of esterifying short-chain fatty acids in aqueous phase, construction method and application

By site-directed mutagenesis of Burkholderia lipase, H24T, A191M, and H24T-A191M mutants were constructed, solving the problem of low esterification efficiency in aqueous systems. This enabled highly efficient catalysis of the esterification reaction of isoamyl alcohol and acetic acid, making it suitable for aqueous esterification reactions. This addresses the technical challenges of esterification reactions in existing technologies and improves the efficiency and selectivity of esterification reactions.

CN121294399BActive Publication Date: 2026-02-10HEFEI UNIV OF TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511864276.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-11
Publication Date
2026-02-10
Estimated Expiration
2045-12-11

AI Technical Summary

Technical Problem

Existing lipases have low efficiency in catalyzing the esterification of short-chain fatty acids in aqueous systems and are prone to reverse hydrolysis, making it difficult to effectively remove isoamyl alcohol from baijiu and affecting the quality of the liquor.

Method used

By performing site-directed mutagenesis on lipases derived from Burkholderia, particularly by mutating histidine at position 24 to threonine and alanine at position 191 to methionine, H24T, A191M, and H24T-A191M double-point mutants were constructed to improve their esterification performance in aqueous phase.

Benefits of technology

The mutant significantly improved the esterification efficiency of isoamyl alcohol and acetic acid under high water activity conditions, reduced the impact of hydrolysis, and has the potential to remove isoamyl alcohol from baijiu. It is suitable for aqueous phase esterification applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121294399B_ABST
    Figure CN121294399B_ABST
Patent Text Reader

Abstract

The present application relates to the field of genetic engineering and enzyme engineering, in particular to a lipase mutant capable of esterifying short-chain fatty acids in aqueous phase, a construction method and application thereof. Based on a Burkholderia-derived lipase, two single-point mutants H24T and A191M and a double-point combination mutant H24T-A191M are screened. The mutant can catalyze the esterification reaction of isoamyl alcohol and acetic acid under high water activity conditions, and the esterification product is less affected by hydrolysis. The mutant obtained by the present application is more suitable for industrial production than the natural lipase, and can be particularly used in the field of removing fusel oil and catalyzing aging of liquor, and has good application prospect and industrial value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and enzyme engineering, and in particular to a lipase mutant capable of aqueous esterification of short-chain fatty acids, its construction method, and its application. Background Technology

[0002] Isoamyl alcohol is one of the aroma compounds in baijiu (Chinese liquor). Excessive isoamyl alcohol content can cause discomfort after drinking, leading to headaches and dizziness. Research on reducing isoamyl alcohol in baijiu using biological methods presents certain challenges. Baijiu systems are mostly aqueous systems, and highly efficient enzymes capable of achieving low-concentration substrate esterification in aqueous systems are extremely rare. Esterification using short-chain fatty acids with isoamyl alcohol is also difficult. Conventional lipases are significantly affected by the water activity of the system; when the proportion of organic phase in the system is too low, the reverse reaction of esterification—hydrolysis—will occur.

[0003] Lipases are serine hydrolases whose main function is to catalyze the hydrolysis of lipid molecules such as triglycerides. This enzyme plays a crucial role in lipid metabolism in organisms by catalyzing the breakdown of triglycerides into glycerol and free fatty acids. The main factors affecting lipase function are water activity and the polarity of the reaction system. Conventional lipases primarily function through hydrolysis in an aqueous environment.

[0004] Currently, most studies only aim to improve the esterification capacity of enzymes by adding molecular sieves to remove water or using solvent-free systems. However, as the reaction proceeds, water, as a byproduct, cannot be effectively removed. Furthermore, excessive ethanol in baijiu (Chinese liquor) can lead to side reactions catalyzed by lipases, with short-chain fatty acid ethyl esters as the main products. Therefore, there is an urgent need in this field to conduct relevant research to improve the aqueous-phase esterification capacity of short-chain fatty acids. Summary of the Invention

[0005] To address the problem of low aqueous phase esterification efficiency of short-chain fatty acids by lipases, this invention provides a lipase mutant capable of aqueous phase esterification of short-chain fatty acids, its construction method, and its application.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] A lipase mutant capable of aqueous phase esterification of short-chain fatty acids, wherein the amino acid sequence is any one of SEQ ID NO. 4, SEQ ID NO. 6, and SEQ ID NO. 8.

[0008] The method for constructing the lipase mutant of the present invention involves mutating the amino acids at positions 24 and / or 191 of the wild-type lipase with the amino acid sequence shown in SEQ ID NO.2 (the corresponding nucleotide sequence is shown in SEQ ID NO.1).

[0009] The lipase obtained by mutating histidine at position 24 to threonine, as shown in SEQ ID NO.2, is named H24T, and its amino acid sequence is shown in SEQ ID NO.4.

[0010] The lipase with the amino acid sequence shown in SEQ ID NO.2 was obtained by mutating alanine at position 191 to methionine and named it A191M. Its amino acid sequence is shown in SEQ ID NO.6.

[0011] The lipase with the amino acid sequence shown in SEQ ID NO.2 was obtained by mutating histidine at position 24 to threonine and alanine at position 191 to methionine. It was named H24T-A191M and its amino acid sequence is shown in SEQ ID NO.8.

[0012] The specific construction steps are as follows:

[0013] (1) Using the nucleotide sequence shown in SEQ ID NO.1 as a template, design site-directed mutagenesis primers according to the rationally designed sites, perform PCR amplification to obtain the gene containing the mutation site, and then construct a vector containing the gene encoding the mutant.

[0014] (2) Transform the gene vector containing the coding mutant into the host cell;

[0015] (3) Screen and verify the recombinant cells constructed in the previous step to obtain positive clones. Then, culture and ferment to produce enzymes, collect cells by centrifugation, break the cells using an ultrasonic cell disruptor, and centrifuge to obtain crude enzyme solution containing lipase mutant.

[0016] A gene encoding the above-mentioned lipase mutant, having the sequence of any one of SEQ ID NO. 3, SEQ ID NO. 5, or SEQ ID NO. 7.

[0017] A recombinant vector containing the above-mentioned coding gene, and using pET-Duet as the expression vector.

[0018] A recombinant cell containing the aforementioned gene or the aforementioned recombinant vector, in the form of *Escherichia coli* (E. coli). Escherichia coli () is the expression host.

[0019] The lipase mutants, genes, recombinant vectors, and recombinant cells described in this invention can be used to carry out esterification reactions in an aqueous phase to catalyze the preparation of isoamyl acetate from isoamyl alcohol and acetic acid.

[0020] Compared with the prior art, the outstanding effect of the present invention is as follows:

[0021] (1) Based on Burkholderia-derived lipases, this invention modifies the molecular structure of lipases through rational design and site-directed mutagenesis biotechnology, analyzes the effect of mutated residues on aqueous esterification of the enzyme, and finally screens and obtains two single-point mutants H24T and A191M and one double-point combined mutant H24T-A191M. This mutant can catalyze the esterification reaction of isoamyl alcohol and acetic acid under high water activity conditions, and the esterification product is less affected by hydrolysis.

[0022] (2) Natural lipases have extremely low efficiency in catalyzing the esterification of short-chain fatty acids under aqueous conditions. The mutant of this invention can undergo esterification with short-chain fatty acids under aqueous conditions, and has the potential to be used to remove fusel oils from baijiu (Chinese liquor).

[0023] (3) The lipase mutant obtained by this invention is more suitable for aqueous phase esterification than the wild type, which is more conducive to the flexibility of the production process.

[0024] The following description, in conjunction with the accompanying drawings and specific embodiments, further illustrates the lipase mutants for aqueous phase esterification of short-chain fatty acids described in this invention, their construction methods, and applications. Attached Figure Description

[0025] Figure 1 This is the gas chromatogram of the sample before the reaction.

[0026] Figure 2 for Figure 1 Detailed magnified images with retention times of 6-12 minutes.

[0027] Figure 3 The image shows the gas chromatogram of the sample after the catalytic reaction of the mutant H24T-A191M.

[0028] Figure 4 for Figure 3 Detailed magnified images with retention times of 6-12 minutes.

[0029] Figure 5 The images show the protein electrophoresis diagrams of the three positive mutants of this invention: H24T, A191M, and H24T-A191M. Detailed Implementation

[0030] The pET-Duet vectors used in the following examples were purchased from Invitrogen.

[0031] The culture media involved in the following examples are as follows:

[0032] (1) LB liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.

[0033] (2) LB solid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 15 g / L.

[0034] The detection methods involved in the following embodiments are as follows:

[0035] Lipase activity was determined using the p-NPP method.

[0036] In the experimental group, 10 μL of 20 mM p-NPP was added to 180 μL of Tris-HCl (pH 8.0) buffer, preheated at 65 °C for 5 min, mixed with 10 μL of enzyme solution, and reacted at 40 °C for 10 min. The reaction was terminated by adding 600 μL of 1 M Na₂CO₃ reagent, and the absorbance was measured at 410 nm. Enzyme activity was calculated based on the amount of p-nitrophenol released. In the control group, the reaction was carried out with deionized water at 40 °C for 10 min, and the reaction was terminated by adding 600 μL of 1 M Na₂CO₃ reagent. The absorbance was measured at 410 nm.

[0037] Enzyme activity is defined as the amount of enzyme required to generate 1 μmol of p-nitrophenol per minute under conditions of pH 8.0 and 65 °C. The protein concentration of the enzyme solution was determined using the Bradford method.

[0038] Example 1 Construction of recombinant plasmid containing lipase mutant

[0039] The specific steps are as follows:

[0040] (1) Construction of recombinant plasmids containing wild-type lipase

[0041] The synthesized nucleotide sequence is the wild-type lipase nucleotide sequence shown in SEQ ID NO.1, and is used with the pET-Duet vector. Hind Ⅲ enzymes and Ecord Ⅰ After enzyme digestion and ligation, the recombinant vector pET-Duet- was prepared. boker .

[0042] (2) Obtaining recombinant vectors containing mutants

[0043] Using whole plasmid PCR technology, the recombinant vector pET-Duet- prepared in step (1) was... boker Site-directed mutagenesis was performed using the templates to obtain recombinant plasmids containing mutant genes: pET-Duet-H24T, pET-Duet-C28D, pET-Duet-M112Y, pET-Duet-K189R, pET-Duet-A191M, pET-Duet-V243L, and pET-Duet-H24T-A191M.

[0044] The designed primer sequences are as follows (as shown in SEQ ID No: 9-SEQ ID No: 20):

[0045] H24T-F: CGTGGACCGGCGCGTGTGCTACGC

[0046] H24T-R:CGCCGGTCCACGCACCGTGAACCAG

[0047] C28D-F: GCGTGGGATTACGCGCACGTTTGCGGCG

[0048] C28D-R: GCGTAATCCCACGCGCCGTGCCAC

[0049] M112Y-F: CCACTCTTATGGTGGTCTGGCGATCACTG

[0050] M112Y-R:ACCACCATAAGAGTGGCCAACCAGCACC

[0051] K189R-F: CTGGCGCGTCGGGCGCTGTACGACGAT

[0052] K189R-R: GCCCGACGCGCCAGCGCACGGTATGC

[0053] A191M-F: GAAACGGATGCTGTACGACGATGCGGCG

[0054] A191M-R:GTACAGCATCCGTTTCGCCAGCGCACG

[0055] V243L-F: CGGATCGTCTGATTCTGCCGGCCTGCAAC

[0056] V243L-R: GCAGAATCAGACGATCCGCCAGACATTTGATGTAG.

[0057] The PCR amplification program was set as follows: first, pre-denaturation at 95℃ for 5 min; then 30 cycles; denaturation at 95℃ for 30 s, annealing at 72℃ for 30 s, extension at 58℃ for 3.5 min, and incubation at 4℃. PCR products were detected by 0.8% agarose gel electrophoresis.

[0058] The final amplified fragment is used Dpn Enzyme I was incubated in a 37°C water bath for 1 hour to remove the template, and then the PCR mixture was chemically transformed to... E. coli In BL 21 competent cells, the transformation solution was plated on LB solid medium containing ampicillin (100 μg / mL), plasmids were extracted and sequenced. The sequencing was performed by Genewiz Suzhou.

[0059] Example 2: Construction of recombinant Escherichia coli engineered strain producing lipase and expression, isolation, purification, and screening of lipase.

[0060] The specific steps are as follows:

[0061] (1) The recombinant plasmid pET-Duet- obtained in Example 1 was respectively... boker pET-Duet-H24T, pET-Duet-C28D, pET-Duet-M112Y, pET-Duet-K189R, pET-Duet-A191M, pET-Duet-V243L, pET-Duet-H24T-A191M, convert to E. coli Genetically engineered bacteria were prepared from BL21 competent cells as follows: E. coli BL21 / pET-Duet- boker , E. coli BL21 / pET-Duet-H24T E. coli BL21 / pET-Duet-C28D E. coli BL21 / pET-Duet-M112Y, E. coli BL21 / pET-Duet- K189R E. coli BL21 / pET-Duet- A191M, E. coli BL21 / pET-Duet- V243L E. coli BL21 / pET-Duet-H24T-A191M.

[0062] (2) The genetically engineered bacteria prepared in step (1) were inoculated into 10 mL of LB liquid medium containing 100 µg / mL ampicillin and cultured overnight at 37°C and 200 rpm to prepare seed culture.

[0063] The prepared seed culture was transferred to 100 mL of LB liquid medium containing 100 µg / mL ampicillin at an inoculation rate of 2% (v / v), and cultured at 30 °C for 20 h to obtain the fermentation broth. The fermentation broth was centrifuged at 8000×g and 4 °C for 5 min to obtain cell cells. After washing the cells three times, they were resuspended in 10 mL of disodium hydrogen phosphate-sodium dihydrogen phosphate buffer (pH 7.0).

[0064] The resuspended cells were treated with an ultrasonic disruptor under ice bath conditions for 30 min, centrifuged for 30 min (8000×g, 4℃), and the supernatant was discarded to obtain the crude enzyme solution.

[0065] The supernatant was filtered through a 0.22 µm filter and then loaded onto a 1 mL Ni affinity column, which was pre-equilibrated with 50 mM wash buffer (20 mM Tris and 500 mM NaCl, pH 7.4). Unbound proteins and lipases were then eluted with elution buffer (20 mM Tris, 500 mM NaCl and 500 mM imidazole, pH 7.4) using a linear gradient. Pure enzyme solutions containing wild-type lipase, H24T, C28D, M112Y, K189R, A191M, V243L, and H24T-A191M were prepared.

[0066] The purified enzyme solutions were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Figure 5 The image shows the protein electrophoresis diagrams of the three positive mutants of this invention. Lanes 1-3 are mutants H24T, A191M, and H24T-A191M, respectively. There is a clear band at 31.9 kDa, which proves that lipase is expressed.

[0067] (3) In order to test the effect of single-point mutation on aqueous esterification efficiency, the pure enzyme prepared in step (2) was subjected to aqueous esterification experiment for preliminary screening.

[0068] Take 100 µL of the pure enzyme prepared in step (2), determine the enzyme activity according to the lipase activity assay method, concentrate the enzyme to 10000U, and add it to the simulation system at a dosage of 5%. The reaction system is as follows: total volume 10 ml, containing 50 mM isoamyl alcohol, 50 mM acetic acid, 1 M ethanol, and the remaining component is deionized water. Reaction conditions: 40℃, 10 h, rotation speed 220 rpm.

[0069] The results showed that the isoamyl acetate conversion rates of mutants H24T and A191M, as well as the combined mutant H24T-A191M, were 8.2%, 7.3%, and 26.3%, respectively. The isoamyl acetate conversion rate of the control group was 0.03%. The isoamyl acetate conversion rates of other mutants were all between 0% and 2%. It can be seen that the substrate specificity and aqueous phase esterification efficiency of the mutant H24T-A191M of this invention are significantly higher than those of other mutants.

[0070] Figures 1-4 Internal standards 1 through 3 are internal standards used in gas chromatography quantitative detection, namely tert-amyl alcohol, amyl acetate, and 2-ethylbutyric acid. Figures 1-2 The image shows the chromatogram of the sample before the reaction. As can be seen from the image, no isoamyl acetate was formed. Figures 3-4 The image shows a chromatogram of a sample after adding the H24T-A191M lipase mutant obtained in this invention. As can be seen from the image, a large amount of isoamyl acetate is generated. The above results show that the lipase mutant obtained in this invention has a high aqueous isoamyl acetate conversion ability.

[0071] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A lipase mutant capable of aqueous-phase esterification of short-chain fatty acids, characterized in that: Its amino acid sequence is any one of SEQ ID NO. 4, SEQ ID NO. 6, and SEQ ID NO.

8.

2. The method for constructing the lipase mutant according to claim 1, characterized in that: Mutate the amino acids at positions 24 and / or 191 of the wild-type lipase, as shown in SEQ ID NO.

2.

3. A gene encoding the lipase mutant of claim 1, characterized in that: The sequence is any one of SEQ ID NO. 3, SEQ ID NO. 5, and SEQ ID NO.

7.

4. A recombinant vector, characterized in that: It contains the gene as described in claim 3.

5. The recombinant vector according to claim 4, characterized in that: pET-Duet was used as the expression carrier.

6. A recombinant cell, characterized in that: It contains the gene as described in claim 3 or the recombinant vector as described in claim 4 or 5.

7. The recombinant cell according to claim 6, characterized in that: Escherichia coli was used as the expression host.

8. The use of the recombinant vector of claim 4 or 5 and the recombinant cell of claim 6 or 7 in the preparation of lipase mutants.

9. The application of the lipase mutant of claim 1 in an esterification reaction in an aqueous phase, characterized in that: Isoamyl acetate was prepared by catalytic reaction of isoamyl alcohol and acetic acid.

Citation Information

Patent Citations

  • Lipase mutant and application thereof

    CN113943721A

  • Esterase mutant, engineering bacterium and application in splitting R, S-2, 6-dimethyl phenyl amino methyl propionate

    CN119931987A