Recombinant rabies virus as well as construction method and application thereof

By inserting a fluorescent protein gene for nuclear localization signals into the rabies virus cDNA and designing a ribozyme sequence, the complexity of introducing T7 RNA polymerase in existing technologies was solved, enabling efficient packaging and visualization of recombinant rabies virus, improving experimental efficiency and viral titer, and ensuring genetic stability.

CN121294539APending Publication Date: 2026-01-09LANZHOU INST OF BIOLOGICAL PROD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511322513.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-16
Publication Date
2026-01-09

AI Technical Summary

Technical Problem

Existing reverse genetics techniques require the introduction of an auxiliary plasmid expressing T7 RNA polymerase when constructing recombinant rabies virus, which increases operational complexity and biosafety risks, and lacks in-depth exploration of the dynamic mechanisms of viral infection.

Method used

By constructing a fluorescent protein gene containing nuclear localization signals and inserting it into rabies virus cDNA, and designing upstream and downstream ribozyme sequences, recombinant plasmids and helper plasmids were used to transfect host cells in a specific ratio, achieving efficient packaging and visualization of recombinant rabies virus.

Benefits of technology

This method enables efficient packaging of recombinant rabies virus and visualization of the viral replication process, reducing experimental time and biosafety risks, improving the accuracy of cell counting and experimental efficiency, and ensuring the genetic stability and high titer of the virus.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121294539A_ABST
    Figure CN121294539A_ABST
Patent Text Reader

Abstract

The invention discloses a recombinant rabies virus as well as a construction method and application thereof, and belongs to the technical field of reverse genetics. The technical problem to be solved is to provide a construction method of a recombinant rabies virus with a visual virus position and to realize efficient packaging of the recombinant virus, and the key point of the technical scheme is that the construction method of the recombinant rabies virus comprises the following steps: S1, constructing a recombinant plasmid containing recombinant rabies virus cDNA through whole-genome synthesis; s2, respectively amplifying N, P, M, G and L genes from the recombinant plasmid, and respectively constructing auxiliary plasmids containing the N, P, M, G and L genes; s3, transfecting host cells with the recombinant plasmids and helper plasmids corresponding to the N, P, M, G and L genes according to the mass ratio of 5: (0.2-1): (0.2-1): (0.2-1): (0.2-1): (0.2-1): (0.2-1) to obtain the recombinant rabies virus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of reverse genetics technology, and relates to rabies virus, specifically to a recombinant rabies virus, its construction method, and its application. Background Technology

[0002] For understanding the technical content of this invention: Rabies virus (RABV) belongs to the family Rhabdoviridae, genus Rabievirus. Its genome is a single-stranded negative-sense RNA of approximately 12 kb, with five viral genes (N, P, M, G, and L) arranged sequentially from the 3′ to 5′ ends, encoding nucleoprotein, phosphoprotein, matrix protein, glycoprotein, and RNA polymerase, respectively. In the host, the viral glycoprotein G mediates the binding of viral particles to cell surface receptors, allowing them to enter the cell via endocytosis. Subsequently, pH-mediated membrane fusion releases the RABV genome into the cytoplasm. The polymerase complex composed of L, N, and P, packaged within the infected viral particle, initiates transcription, replication, assembly, and budding to produce progeny viruses using the negative-sense RNA of the genome as a template. As a neurotropic and highly lethal pathogen, although post-exposure prophylaxis (PEP) can effectively block disease progression, direct research into the viral activity status remains challenging due to biosafety limitations, and a deeper understanding of the dynamic mechanisms of viral infection is lacking.

[0003] Reverse genetics is a commonly used technique in virology research. This method starts with the nucleic acid sequence of the viral genome and allows for targeted manipulation of the virus (such as gene mutation, insertion, and deletion) to create viral variants with specific gene mutations. This method is an important tool for studying viral pathogenesis mechanisms and developing vaccines and antiviral drugs.

[0004] Relevant patent documents retrieved: This document, published in China (CN105441483A) on March 30, 2016, discloses the complete sequence of the fixed rabies virus strain Evelyn-Rokitnicki-Abelseth (ERA), and methods for sequencing it and other strains of the rabies virus genus. It also describes a reverse genetics system for rabies virus, particularly the use of the ERA strain as a model T7 RNA polymerase to promote viral recovery. This T7 RNA polymerase contains an eight-amino acid nuclear localization signal (NLS) at its N-terminus. In addition to the parental ERA virus strain, several other derived viruses are described, including ERA- (without the psi- region)ERAgreen1 (with a green fluorescent protein gene inserted in the psi- region) and ERAgreen2 (with a green fluorescent protein inserted in the region between the phosphoprotein and matrix protein genes).

[0005] Relevant non-patent literature retrieved: The journal or book title is "Plos Neglected Tropical Diseases", the article title is "A highthroughput neutralization test based on GFP expression by recombinant rabiesvirus", volume number 12 (12), publication date 2018.12.14. This article discloses the use of recombinant RABV ERA to express GFP with nuclear localization signal (NLS) to achieve high-efficiency quantification. Among them, when transfecting BSR cells cultured to 90% confluence in a six-well plate, a combination of 6 plasmids was used: the full-length viral genome cDNA plasmid pERA-NLS-hMGFP was added at a concentration of 3.0 μg / well, and five helper plasmids (pTN plasmid 1.0 μg / well, pMP plasmid 0.5 μg / well, pML plasmid 0.5 μg / well, pMG plasmid 0.5 μg / well, which can transcribe and express the N, P, L and G proteins encoded by RABV) and pNLST7 plasmid 1.0 μg / well. Seven to ten days after transfection, the recombinant ERA-NLS-hMGFP virus was recovered and then amplified in fresh BSR cells until the viral titer reached 10. 7 FFU / ml.

[0006] The prior art represented by the aforementioned documents has at least the following unresolved technical problems or defects: An additional helper plasmid expressing T7 RNA polymerase needs to be introduced to express T7 RNA polymerase in the host cell. This enzyme specifically recognizes the T7 promoter on the vector and initiates the transcription of viral mRNA, thereby driving viral genome replication and packaging.

[0007] The relevant evidence is that the literature titled "A high throughput neutralization test based on GFP expression by recombinant rabies virus" describes the addition amount of the "pNLS T7" helper plasmid as 1.0 μg / well.

[0008] Other content that is useful for understanding, searching, and examining this invention: The key concepts and steps of reverse genetics manipulation are as follows: 1. Genome Synthesis: First, the viral genome is artificially synthesized based on the known viral genome sequence. This step can be done through chemical synthesis or by cloning specific fragments from the viral genome; 2. Cloning into a Vector: The synthesized viral genome is cloned into an appropriate vector (usually a plasmid), which can be expressed in host cells; 3. Introduction into Host Cells: Through transfection, the vector containing the viral genome, along with other helper plasmids required for viral replication and packaging, is introduced into host cells; 4. Viral Reconstitution: The enzyme system in the host cell transcribes and translates the viral genome, generating new viral particles. These newly generated viral particles can be released from the host cell, producing viruses with specific gene mutations; 5. Analysis and Application: By observing and analyzing the phenotypes of these recombinant viruses (such as infectivity, pathogenicity, antigenicity, etc.), researchers can understand the impact of gene mutations on viral characteristics. This information can be used for viral gene research, vaccine development, and antiviral drug screening.

[0009] Applications of reverse genetics include: 1. Basic research: Reverse genetics allows scientists to precisely manipulate viral genomes to study the function of each gene and its role in the viral life cycle; 2. Vaccine development: By introducing specific gene mutations, attenuated vaccines or altering the antigenic properties of viruses can be generated, thereby developing new vaccines; 3. Antiviral drug screening: By generating viral strains with reporter genes, the effectiveness of potential antiviral drugs can be screened and evaluated; 4. Gene therapy: Reverse genetics can also be used to develop gene therapy methods by modifying the viral genome to enable it to carry and express therapeutic genes.

[0010] The advantages of reverse genetics include: 1. Precision: Specific mutations can be introduced into the viral genome to precisely study the effects of these mutations; 2. Flexibility: Applicable to various viruses, including RNA and DNA viruses; 3. Wide range of applications: Can be used in multiple fields such as basic research, vaccine development, drug screening, and gene therapy. Summary of the Invention

[0011] The purpose of this invention is to provide a method for constructing recombinant rabies virus with visualized viral location, and to achieve efficient packaging of recombinant virus.

[0012] Therefore, this invention constructs a recombinant active rabies virus based on reverse genetics, aiming to visualize and trace the virus life cycle, laying the foundation for further research on the infection mechanism of rabies virus.

[0013] This invention provides a method for constructing recombinant rabies virus, comprising the following steps: S1. Construct a recombinant plasmid containing recombinant rabies virus cDNA through whole-genome synthesis; S2. Amplify the N, P, M, G, and L genes from the recombinant plasmid, and construct helper plasmids containing the N, P, M, G, and L genes respectively; S3. Transfect host cells with the recombinant plasmid and the helper plasmids corresponding to the N, P, M, G, and L genes at a mass ratio of 5:0.2-1:0.2-1:0.2-1:0.2-1:0.2-1 to obtain recombinant rabies virus.

[0014] Terminology Explanation: Unless otherwise defined, all technical terms in this document have the same meanings as commonly understood by one of ordinary skill in the art to which the subject matter of the claims pertains. Unless otherwise stated, all patents, patent inventions, and publications cited in this document are incorporated herein by reference in their entirety. If multiple definitions exist for terms in this document, the definitions in this chapter shall prevail.

[0015] It should be understood that the above brief description and the following detailed description are exemplary and for illustrative purposes only, and do not limit the subject matter of the invention in any way. In this invention, the singular is used in conjunction with the plural unless otherwise specifically stated. It should also be noted that, unless otherwise stated, the use of “or” or “or” means “and / or”. Furthermore, the use of the term “comprising” and other forms such as “including,” “containing,” and “contains” are not limiting.

[0016] Definitions of standard chemical terms can be found in the references “Molecular Cloning: A Laboratory Manual (4th Edition)”, Science Press Co., Ltd., March 2017, 1st edition, and “Handbook of Genetic Engineering”, SyraWood Publishing House, 2017, 1st edition, and “Made in China 2017”.

[0017] Unless otherwise stated, conventional methods within the scope of the art, such as PCR, nuclease digestion and ligation, and virus transfection of cells, shall be used.

[0018] Unless specifically defined herein, the use of all commercially available products herein employs standard techniques. For example, it may be carried out using the manufacturer's instructions for use with the kit, or in accordance with methods known in the art or the description of this invention. The techniques and methods described herein can generally be implemented according to conventional methods well known in the art, based on the descriptions in the various summary and more specific documents cited and discussed in this specification.

[0019] The terms "nucleic acid sequence" or "nucleotide sequence" include double-stranded or single-stranded DNA and / or RNA. They also include known types of modifications such as methylation, "capping," and the replacement of one or more natural nucleotides with similar substances.

[0020] The term "vector" is a nucleic acid molecule capable of transporting another nucleic acid. Vectors can be, for example, plasmids, granules, viruses, or bacteriophages. The term should also be interpreted to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells. An "expression vector" is a vector that, when present in a suitable environment, can direct the expression of one or more transgenic proteins carried by the vector. A "plasmid vector" is a relatively small, independent circular DNA molecule (typically 1-200 kb in size) separate from chromosomal DNA. Plasmids are transferable, can replicate independently, or can integrate into chromosomal DNA and replicate along with it.

[0021] The term "host cell" refers to a cell that can receive foreign genes (target genes) and express them within itself to produce the required proteins.

[0022] To achieve the objective, the present invention provides the following technical solution: On one hand, the present invention provides a method for constructing recombinant rabies virus, comprising the following steps: S1. Insert the fluorescent protein gene with nuclear localization signal into the rabies virus cDNA sequence, and add upstream ribozyme sequence and downstream ribozyme sequence to the cDNA to construct recombinant cDNA, and then construct a recombinant plasmid containing recombinant cDNA. S2. Amplify the N gene, P gene, M gene, G gene and L gene from the recombinant plasmid, and construct helper plasmids containing the N gene, P gene, M gene, G gene and L gene, respectively. S3. Transfect host cells with the recombinant plasmid and the helper plasmids corresponding to the N, P, M, G and L genes at a mass ratio of 5:0.2-1:0.2-1:0.2-1:0.2-1:0.2-1 to obtain recombinant rabies virus.

[0023] Preferably, the upstream ribozyme sequence in step S1 has the sequence shown in SEQ ID NO.21, and the downstream ribozyme sequence has the sequence shown in SEQ ID NO.22.

[0024] Preferably, the nuclear localization signal in step S1 includes a monotype classical nuclear localization signal, a bintype classical nuclear localization signal, or a nuclear localization signal recognized by transporter β2.

[0025] Preferably, the nuclear localization signal is a monogenotypic classical nuclear localization signal, which is the SV40 large T antigen nuclear localization signal.

[0026] Preferably, the nuclear positioning signal has the sequence shown in SEQ ID NO.17.

[0027] Preferably, the fluorescent protein in step S1 includes green fluorescent protein, red fluorescent protein, and blue fluorescent protein.

[0028] Preferably, the fluorescent protein is green fluorescent protein.

[0029] Preferably, the gene for the green fluorescent protein has the sequence shown in SEQ ID NO.18.

[0030] Preferably, the fluorescent protein gene with nuclear localization signal is inserted between different genes in the rabies virus cDNA sequence.

[0031] Preferably, the fluorescent protein gene with nuclear localization signal is inserted between the P gene and the M gene in the rabies virus cDNA sequence.

[0032] Preferably, the vectors used in step S1 to construct the recombinant plasmid containing recombinant cDNA include pcDNA3.1 vector, pCI vector, pSI vector, p3xFLAG-CMV vector, pCEP4 vector, or pCAGGS vector.

[0033] Preferably, the vector is a pcDNA3.1 vector.

[0034] Preferably, the recombinant plasmid in step S1 includes the sequence shown in SEQ ID NO.1.

[0035] Preferably, the N gene in step S2 includes the sequence shown in SEQ ID NO.12.

[0036] Preferably, the P gene in step S2 includes the sequence shown in SEQ ID NO.13.

[0037] Preferably, the M gene in step S2 includes the sequence shown in SEQ ID NO.14.

[0038] Preferably, the G gene in step S2 includes the sequence shown in SEQ ID NO.15.

[0039] Preferably, the L gene in step S2 includes the sequence shown in SEQ ID NO.16.

[0040] On the other hand, the present invention provides a recombinant rabies virus prepared by the above-described construction method.

[0041] On the other hand, the present invention provides the above-described construction method or the application of the above-described recombinant rabies virus.

[0042] Preferably, the application includes virus tracing, screening of anti-rabies virus drugs, or determination of anti-rabies virus drug activity.

[0043] The beneficial effects of this invention are as follows: Compared with existing technologies, the present invention has better technical effects in terms of visualization and tracing of the virus replication process, efficient packaging, and stable inheritance.

[0044] (1) The recombinant rabies virus provided in this invention can assist in the efficient screening and development of anti-rabies virus drugs and rabies vaccines. Compared with the traditional RFFIT method, the modification of the reporter gene coupled with the viral infection process allows the virus to be directly counted without acetone inactivation post-treatment. This reduces the use of acetone, a precursor chemical, shortens the experimental time, and reduces the risk of biological material leakage. Furthermore, since GFP is nuclear-localized, the accuracy of cell counting is greatly improved, enabling automated cell counting, reducing human observation errors, and significantly improving experimental efficiency.

[0045] (2) In this study, a biologically active rabies virus strain was successfully rescued from a fully synthesized cDNA sequence using reverse genetics. The results showed that the strain could infect host cells such as BSR and BHK-21 at the laboratory level and could amplify within the cells. After continuous passage, its infectivity did not significantly degrade, indicating that the recombinant strain had good genetic stability, ensuring efficient viral packaging and producing a high titer of recombinant rabies virus. Obvious nuclear localization fluorescence was observed during virus growth, indicating successful insertion of the GFP gene, thus enabling visualization and tracing of the viral replication process.

[0046] (3) The present invention designs and adds ribozyme sequences upstream and downstream of cDNA to achieve self-cleavage of viral mRNA sequence, removes non-viral sequences such as polyA tail after vector promoter, and avoids interference of these non-viral sequences with viral packaging. Attached Figure Description

[0047] Figure 1This is a schematic diagram showing the structure of the rCVS-11-GFP plasmid in Example 1 and its insertion position into the pcDNA3.1(-) vector.

[0048] Figure 2 This is an electrophoresis image of the recombinant plasmid from Example 1 (without enzyme digestion).

[0049] Figure 3 Electrophoresis image of the recombinant plasmid after double enzyme digestion in Example 1 ( Nhe Ⅰ& Kpn I).

[0050] Figure 4 The images show fluorescence images of BSR cells (left) and BHK-21 cells (right) infected with the recombinant rCVS-11-GFP strain in Example 3. Detailed Implementation

[0051] The following non-limiting embodiments are intended to enable those skilled in the art to gain a more comprehensive understanding of the present invention, but do not limit the invention in any way. The following content is merely an exemplary description of the scope of protection claimed by the present invention, and those skilled in the art can make various changes and modifications to the present invention based on the disclosed content, and such changes should also fall within the scope of protection claimed by the present invention.

[0052] The present invention will be further described below by way of specific embodiments. Unless otherwise specified, all instruments, devices, equipment, reagents, products, etc., used in the embodiments of the present invention are obtained through conventional commercial means.

[0053] The sources of the experimental materials involved in this invention are described in Table 1.

[0054] Table 1. Explanation of the source of experimental materials

[0055] Example 1: Plasmid Construction This invention uses the complete genome sequence of rabies virus strain CVS-11 (GenBank: GQ918139.1) as a template. Based on reverse genetics, a green fluorescent protein (GFP) gene with an SV40 nuclear localization signal (NLS) is inserted between the P and M genes of the CVS-11 virus. Transcription initiation signals (TIS) and transcription termination signals (TPS) are added upstream and downstream of the NLS-GFP gene (the GFP gene with the SV40 nuclear localization signal) to control the transcription of the NLS-GFP gene. Simultaneously, ribozyme sequences are designed at the 5' and 3' ends of the cDNA to generate an mRNA sequence close to that of the natural virus during transcription. Nhe I and Kpn I restriction endonuclease sites are used upstream and downstream of the target sequence to facilitate its insertion into the pcDNA3.1(-) vector. The recombinant rCVS-11-GFP full gene was synthesized by Nanjing GenScript and inserted into the pcDNA3.1(-) vector (see...). Figure 1 In addition, the N, P, M, G, and L genes were amplified from the cDNA sequence by PCR, with restriction endonuclease sites added to both upstream and downstream primers. Nhe I and Kpn I. Insert the pcDNA3.1(-) vector to construct the helper plasmid (see...) Figure 2 After the above recombinant plasmids were constructed, they were all verified by DNA sequencing and... Nhe Ⅰ& Kpn I. Double enzyme digestion identification showed that the size of the target gene fragments all met the theoretical expectations (see...). Figure 3 ).

[0056] Specifically, the rCVS-11-GFP recombinant plasmid was constructed by Nanjing GenScript Biotech Co., Ltd., and its cDNA sequence is shown in SEQ ID NO.1. Using the rCVS-11-GFP recombinant plasmid as a template, the N, P, M, G, and L genes were amplified, respectively. The primers used for amplification are shown in Table 2.

[0057] Table 2 Primer Description

[0058] Plasmid extraction: The plasmid containing the above-mentioned rCVS-11-GFP recombinant plasmid and each helper plasmid was extracted. E. coliDH5α was inoculated into 3 ml of ampicillin-resistant LB medium and incubated at 37°C for 6-8 h to activate the culture. Then, 1 ml of the activated culture was added to 100 ml of LB medium and incubated overnight at 37°C. Subsequent procedures were performed according to the instructions for the plasmid extraction kit provided in the reagent list.

[0059] The sequences of each part of the rCVS-11-GFP recombinant plasmid are shown below: The N gene sequence is SEQ ID NO.12: The P gene sequence is SEQ ID NO.13: ATGAGCAAGATCTTTGTTAATCCGAGTGCAATCAGAGCCGGTCTGGCCGATCTTGAGATGGCCGAAGAGACTGTTGATCTGATCAACAGAAACATAGAAGACAATCAGGCTCATCTCCAGGGAGAACCCATAGAAGTGGACAACCTCCCTGAGGACATGAAGCGACTTCACCTGGACGATGAAAAATCGTCCAACCTTGGTGAGATGGTTAGGGTGGGAGAAGGCAAGTATCGAGAGGACTTTCAGATGGATGAGGGAGAGGACCCCAACCTCCTGTTCCAATCGTACCTGGATAATGTTGGAGTCCAAATAGTCAGACAAATGAGGTCAGGAGAGAGATTCCTCAAGATATGGTCACAGACCGTAGAGGAAATTGTATCCTATGTCACGGTCAACTTTCCTAACCCTCCAAGAAGGTCTTCGGAGGATAAATCAACCCAGACTACTGGCAGAGAGCTCAAGAAGGAGACAACGTCTGCTTTCTCTCAGAGAGAAAGCCAACCTTCGAAAGCTAGGATGGTGGCTCAAGTTGCCCCTGGTCCTCCAGCCCTTGAATGGTCAGCCACCAATGAAGAAGATGATCTATCAGTAGAGGCTGAGATCGCTCATCAGATTGCTGAAAGCTTTTCCAAGAAGTACAAGTTTCCCTCCCGATCTTCAGGAATATTCTTGTATAATTTTGAGCAACTGAAGATGAACCTTGATGACATAGTTAAAGAGGCAAAAAATGTACCGGGCGTGACCCGTCTGGCCCATGATGGATCCAAAATCCCCCTGAGATGCGTACTGGGATGGGTCGCTTTGGCTAATTCCAAAAAATTCCAATTACTAGTCGAGGCTGACAAGCTAAGCAAAATCATGCAAGATGATTTGAATCGCTATACATCCTGCTAA; The M gene sequence is SEQ ID NO.14: ATGAACGTTCTACGCAAGATAGTGAAAAAATGTAGGGATGAGGACACTCAAAAGCCCTCTCCTGTGTCAGCCCCTCCGTATGACGATGACCTGTGGCTTCCACCTCCTGAATATGTCCCGCTGAAAGAACTCACAAGCAAGAAGAACATGAGGAACTTTTGTGTCAACGGGGAGGTTAAAGCGTGTAGCCCAAATGGTTACTCATTCAGGATTTTGCGGCACATTCTGAGATCATTCAACGAGATATACTCTGGGAATCATAGGATGATTGGGTTAGTCAAAGTTGTTGTTGGACTAGCTTTATCAGGAGCTCCAGTACCTGAGGGCATGAACTGGGTATACAAATTGAGGAGAACCCTTATATTCCAGTGGGCTGATTCCAGGGGCCCTCTTGAAGGGGAGGAGTTAGAATACTCTCAAGAGATCACTTGGGATGATGATACTGAATTCGTCGGATTGCAAATAAGAGTGAGCGCAAGACAATGTCATATTCAAGGCAGGATCTGGTGTATCAACACGAACTCGAGGGCATGTCAACTATGGTCTGACATGTCTCTTCAGACACAAAGGTCTGAAGAGGACAAAGACTCTTCTCTGCTTCTAGAATAA; The G gene sequence is SEQ ID NO. 15: The L gene sequence is SEQ ID NO.16: The NLS nucleotide sequence is SEQ ID NO.17: ATGCCTCCTAAGAAGAAACGCAAGGTC; The GFP nucleotide sequence is SEQ ID NO.18: GCCCAGTCCAAGCACGGCCTGACCAAGGAGATGACCATGAAGTACCGCATGGAGGGCTGCGTGGACGGCCACAAGTTCGTGATCACCGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGGTGGAGGGCGGCCCCTTGCCCTTCGCCGAGGACATCTTGTCCGCCGCCTTCATGTACGGCAACCGCGTGTTCACCGAGTACCCCCAGGACATCGTCGACTACTTCAAGAACTCCTGCCCCGCCGGCTACACCTGGGACCGCTCCTTCCTGTTCGAGGACGGCGCCGTGTGCATCTGCAACGCCGACATCACCGTGAGCGTGGAGGAGAACTGCATGTACCACGAGTCCAAGTTCTACGGCGTGAACTTCCCCGCCGACGGCCCCGTGATGAAGAAGATGACCGACAACTGGGAGCCCTCCTGCGAGAAGATCATCCCCGTGCCCAAGCAGGGCATCTTGAAGGGCGACGTGAGCATGTACCTGCTGCTGAAGGACGGTGGCCGCTTGCGCTGCCAGTTCGACACCGTGTACAAGGCCAAGTCCGTGCCCCGCAAGATGCCCGACTGGCACTTCATCCAGCACAAGCTGACCCGCGAGGACCGCAGCGACGCCAAGAACCAGAAGTGGCACCTGACCGAGCACGCCATCGCCTCCGGCTCCGCCTTGCCCTGA; The transcription initiation signal (TIS) sequence is SEQ ID NO.19: ACGCTTAACAACAAAACCAGAGAAGAAAAAGACAGCGTCAATTGCAAAGCAAAAATGTAACACCCCTACA; The transcription termination signal (TTP) sequence is SEQ ID NO.20: GCCGGATATTACCGAAAGCCTGTGCATGCTAAAATTCTTGTATGATGCATCTTGAAAAAAACAAGATCTTGAATCCGGACCTCTGGTTGTTTGATTGTTTTTTCCATCTTTATTGTTTTTTTGTTAAGCGT; The upstream ribozyme nucleotide sequence is SEQ ID NO.21: CAAGCGTCTGATGAGGCCGTGAGGCCGAAACTCGTAAGAGTC; The downstream ribozyme nucleotide sequence is SEQ ID NO.22: CTGTACTTGTATCAGTACACTGACGAGTCCCTAAAGGACGAAACGCTTAAC.

[0060] Example 2: Recombinant Virus Rescue BSR cells from the laboratory were cultured until they filled 60-80% of a T25 cell flask. Simultaneously, the recombinant plasmid containing rCVS-11-GFP and helper plasmids containing N, P, M, G, and L were mixed thoroughly and co-transfected into BSR cells. Twenty-four hours after transfection, the cell culture was transferred to a cryogenic environment, and fluorescence was observed on days 1, 3, 5, 7, and 9 post-transfection. The appearance of fluorescence, showing an increase from isolated points to a wider area, indicated successful virus packaging.

[0061] Specifically, the packaging method for recombinant rabies virus is as follows: (1) Cell pretreatment 24 hours before transfection, passage BSR cells at a ratio of 1:3 to 1:4 to ensure that the cell density reaches the optimal range of 60-80% confluence at the time of transfection.

[0062] (2) Preparation before transfection Collect cells, discard the original culture medium, and gently wash three times (2 mL / T25 flask each time) with pre-warmed serum-free DMEM at 37°C to thoroughly remove serum components (avoid serum protein inhibition of transfection complex formation). Finally, add 4 mL of serum-free DMEM culture medium for later use.

[0063] (3) Preparation of transfection complex (taking T25 culture flask as an example) Tube A: 5 μg rCVS-11-GFP recombinant plasmid + 500 μl serum-free DMEM; Tube B: PEI transfection reagent (at a mass ratio of 1:2 to 1:5 of total DNA) + 500 μl of serum-free DMEM; After gently mixing by blowing, slowly add the solution from tube B to tube A, gently vortex to mix, and let stand at room temperature for 10-15 minutes to form a stable transfection complex.

[0064] (4) Plasmid compatibility selection (rCVS-11-GFP recombinant plasmid in 5 μg samples): rCVS-11-GFP recombinant plasmid: helper plasmid = 5:1:1:1:1:1 (total helper plasmid 5 μg).

[0065] After the reaction is complete, add the above reaction system to 4 ml of culture medium and incubate at 37°C for 4 h. Then discard the culture supernatant and replace it with DMEM complete medium containing 10% FBS. 24 h after transfection, transfer the culture flask to 34-36°C and continue incubation for 7-10 days until continuous fluorescent foci are observed.

[0066] Example 3: Recombinant virus infects cells The virus prepared in Example 2 was collected and used to infect cells. The results showed that the strain could infect host cells such as BSR and BHK-21 at the laboratory level (see Example 2). Figure 4 The virus can amplify within cells, and its infectivity did not significantly degrade after continuous passage, indicating that the recombinant strain has good genetic stability. Obvious nuclear localization fluorescence was observed during viral growth, indicating successful GFP gene insertion, thus enabling visualization and tracing of the viral replication process.

[0067] Virus titer determination: The viral titer was determined according to the method described in "2025 Edition of the Chinese Pharmacopoeia, Part IV, General Chapter 3512 (Determination of Rabies Immunoglobulin Titer)", and the titer of recombinant rabies virus was found to be 10. 7 FFU / ml.

[0068] Example 4: Preparation of Recombinant Virus The plasmid was constructed according to the method in Example 1, except that the recombinant plasmid rCVS-11-GFP (5 μg) and the helper plasmids N, P, M, G, and L (0.2 μg, 0.2 μg, 0.2 μg, 0.2 μg, 0.2 μg, 0.2 μg, respectively) were used for transfection (i.e., the total ratio was 5:0.2:0.2:0.2:0.2:0.2), with all other aspects remaining the same. Then, the effectiveness was verified according to the methods in Examples 2-3, and the viral titer obtained was measured to be 10. 4 FFU / ml.

[0069] Comparative Example 1: Removal of Ribozyme Sequence The plasmid was constructed according to the method in Example 1, except that the upstream and downstream ribozyme sequences of the cDNA in the plasmid were removed, while everything else remained the same; then the method in Examples 2-3 was followed, but recombinant virus could not be obtained.

[0070] Comparative Example 2: Changing the plasmid concentration ratio The plasmid was constructed according to the method in Example 1, except that the recombinant plasmid rCVS-11-GFP (5 μg) and the helper plasmids N, P, M, G and L (masses of 1.5 μg, 0.5 μg, 0.5 μg, 0.5 μg and 1.5 μg, respectively) were transfected (i.e., the total ratio was 5:1.5:0.5:0.5:0.5:1.5), and everything else remained the same; then the method in Examples 2-3 was followed, but the recombinant virus could not be obtained.

[0071] Comparative Example 3: Changing the plasmid concentration ratio The plasmid was constructed according to the method in Example 1, except that the recombinant plasmid rCVS-11-GFP (5 μg) and the helper plasmids of N, P, M, G and L (masses of 1.0 μg, 1.5 μg, 1.5 μg, 1.5 μg and 1.0 μg, respectively) were transfected (i.e., the total ratio was 5:1:1.5:1.5:1.5:1), and everything else remained the same; then the method in Examples 2-3 was followed, but the recombinant virus could not be obtained.

[0072] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A method for constructing recombinant rabies virus, characterized in that, Includes the following steps: S1. Insert the fluorescent protein gene with nuclear localization signal into the rabies virus cDNA sequence, and add upstream ribozyme sequence and downstream ribozyme sequence to the cDNA to construct recombinant cDNA, and then construct a recombinant plasmid containing recombinant cDNA. S2. Amplify the N gene, P gene, M gene, G gene and L gene from the recombinant plasmid, and construct helper plasmids containing the N gene, P gene, M gene, G gene and L gene, respectively. S3. Transfect host cells with the recombinant plasmid and the helper plasmids corresponding to the N, P, M, G and L genes at a mass ratio of 5:0.2-1:0.2-1:0.2-1:0.2-1:0.2-1 to obtain recombinant rabies virus.

2. The construction method according to claim 1, characterized in that, The upstream ribozyme sequence in step S1 has the sequence shown in SEQ ID NO.21, and the downstream ribozyme sequence has the sequence shown in SEQ ID NO.

22.

3. The construction method according to claim 1, characterized in that, The nuclear localization signal mentioned in step S1 includes monotypic classical nuclear localization signal, bintypic classical nuclear localization signal, or nuclear localization signal recognized by transporter β2.

4. The construction method according to claim 3, characterized in that, The nuclear localization signal is a monogenotyping classic nuclear localization signal, which is the SV40 large T antigen nuclear localization signal.

5. The construction method according to claim 4, characterized in that, The nuclear positioning signal has the sequence shown in SEQ ID NO.

17.

6. The construction method according to claim 1, characterized in that, The fluorescent proteins mentioned in step S1 include green fluorescent protein, red fluorescent protein, and blue fluorescent protein.

7. The construction method according to claim 6, characterized in that, The fluorescent protein is green fluorescent protein.

8. The construction method according to claim 7, characterized in that, The gene for the green fluorescent protein has the sequence shown in SEQ ID NO.

18.

9. The construction method according to claim 1, characterized in that, The fluorescent protein gene carrying a nuclear localization signal is inserted between different genes in the rabies virus cDNA sequence.

10. The construction method according to claim 9, characterized in that, The fluorescent protein gene carrying the nuclear localization signal is inserted between the P gene and the M gene in the rabies virus cDNA sequence.

11. The construction method according to claim 1, characterized in that, The vectors used in step S1 to construct the recombinant plasmid containing recombinant cDNA include pcDNA3.1 vector, pCI vector, pSI vector, p3xFLAG-CMV vector, pCEP4 vector, or pCAGGS vector.

12. The construction method according to claim 11, characterized in that, The vector is pcDNA3.1 vector.

13. The construction method according to claim 1, characterized in that, The recombinant plasmid described in step S1 includes the sequence shown in SEQ ID NO.

1.

14. The construction method according to claim 1, characterized in that, The N gene mentioned in step S2 includes the sequence shown in SEQ ID NO.

12.

15. The construction method according to claim 1, characterized in that, The P gene mentioned in step S2 includes the sequence shown in SEQ ID NO.

13.

16. The construction method according to claim 1, characterized in that, The M gene mentioned in step S2 includes the sequence shown in SEQ ID NO.

14.

17. The construction method according to claim 1, characterized in that, The G gene mentioned in step S2 includes the sequence shown in SEQ ID NO.

15.

18. The construction method according to claim 1, characterized in that, The L gene mentioned in step S2 includes the sequence shown in SEQ ID NO.

16.

19. The recombinant rabies virus prepared by the construction method according to any one of claims 1-18.

20. The construction method according to any one of claims 1-18 or the application of the recombinant rabies virus according to claim 19.

21. The application according to claim 20, characterized in that, The applications include virus tracing, screening of anti-rabies virus drugs, or determination of the activity of anti-rabies virus drugs.

Citation Information

Patent Citations

  • Hydrophobia virus composition and method thereof

    CN105441483A