Biomarker for diagnosing colorectal cancer and application thereof

Abstract

The invention relates to the technical field of tumor molecular biology, in particular to a biomarker for diagnosing colorectal cancer, a non-diagnostic method for detecting piR-44078 in vitro, a preparation for diagnosing colorectal cancer and application of an inhibitor of the piR-44078 in preparation of a medicine for treating the colorectal cancer. According to the application, expression up-regulation of the piR-44078 is detected in colorectal cancer tissues and plasma, after the piR-44078 is knocked down by using an inhibitor in colorectal cancer cell lines HCT116, HT29 and SW620, a CCK8 experiment and a transwell experiment are carried out, and the cell activity and migration ability in a knock-down group are obviously reduced, that is, the silent piR-44078 inhibits proliferation and migration of colorectal cancer cells.

Description

Technical Field

[0001] This application relates to the field of tumor molecular biology technology, and in particular to a biomarker for diagnosing colorectal cancer, a method for in vitro detection of piR-44078 for non-diagnostic purposes, a formulation for colorectal cancer diagnosis, and the use of an inhibitor of piR-44078 in the preparation of a drug for treating colorectal cancer. Background Technology

[0002] Colorectal cancer (CRC) is a common and serious malignant tumor of the digestive tract that poses a significant threat to human health worldwide. Publicly available epidemiological data show that the number of new cases each year is enormous, constituting a significant public health burden.

[0003] Despite continuous progress in the clinical diagnosis and treatment of colorectal cancer, with procedures such as colonoscopy, sigmoidoscopy, and fecal occult blood testing becoming standard, existing treatment strategies still have significant limitations. First, the early symptoms of the disease are often atypical and insidious, leading to many patients being diagnosed at a stage beyond the optimal intervention window. Second, its incidence is rising among younger populations, posing new challenges to early screening and warning. Furthermore, colorectal cancer exhibits high tumor heterogeneity, meaning that different patients respond significantly differently to the same treatment regimen. For patients with metastases, conventional treatments such as surgery, radiotherapy, and chemotherapy are often less than ideal, resulting in a bottleneck in prognosis. Therefore, developing novel diagnostic tools capable of accurate identification in the early or precancerous stages of the disease, and exploring novel therapeutic targets that can effectively inhibit tumor progression, are key scientific issues that urgently need to be addressed in this field.

[0004] In recent years, research on the function of non-coding RNAs in tumor biology has provided new perspectives for addressing the aforementioned issues. Among them, Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNA molecules composed of 24–31 nucleotides. They play crucial roles in epigenetic and post-transcriptional regulation by binding to members of the Piwi protein family. Studies have shown that piRNA expression is tissue-specific, and its dysregulation is closely related to the development and progression of various human malignancies. This suggests that specific piRNA molecules have the potential to become novel biomarkers for tumor diagnosis and highly valuable therapeutic targets.

[0005] However, although the potential importance of piRNAs has been preliminarily revealed, it remains unclear which specific piRNA molecules play a key driving role in colorectal cancer. There is an urgent need in this field to discover and functionally validate specific piRNAs with a clear causal relationship to the occurrence and development of colorectal cancer, and to translate them into diagnostic indicators or therapeutic targets with clinical application value. Summary of the Invention

[0006] In view of this, the purpose of this invention is to overcome the shortcomings of the prior art and provide a specific piRNA molecule closely related to colorectal cancer and its application. This piRNA molecule is a 30bp piR-44078, located at chr19:40016845-40016872(+) in the genome; it is associated with colorectal cancer and can serve as a molecular marker for colorectal cancer diagnosis and a therapeutic target.

[0007] First, this application provides a biomarker for diagnosing colorectal cancer, the biomarker being piR-44078, whose nucleotide sequence is shown in SEQ ID NO.1. Specifically, SEQ ID NO.1 is UCCUAAAAGUUGAUGAGCAGGGACUUUCCA.

[0008] Based on a general inventive concept, this application provides a biomarker for diagnosing colorectal cancer, the biomarker being piR-44078, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0009] Based on a general inventive concept, this application provides a method for in vitro detection of piR-44078 for non-diagnostic purposes, the method comprising: using a reagent capable of specifically detecting piR-44078 to detect the expression level of piR-44078 in a biological sample from a subject; wherein the nucleotide sequence of the piR-44078 is as shown in SEQ ID NO.1.

[0010] Preferably, the reagent capable of specifically detecting piR-44078 includes: a primer pair that specifically amplifies piR-44078 or a probe that specifically hybridizes with piR-44078; the primer pair includes the RT primer as shown in SEQ ID NO.2, the F primer as shown in SEQ ID NO.3, and the R primer as shown in SEQ ID NO.4; the nucleotide sequence of the probe is shown in SEQ ID NO.5.

[0011] Preferably, the method is real-time quantitative PCR or in situ hybridization.

[0012] Based on a general inventive concept, this application provides a formulation for the diagnosis of colorectal cancer, the formulation comprising a reagent capable of specifically detecting the expression level of piR-44078 in a sample; the nucleotide sequence of said piR-44078 is shown in SEQ ID NO.1.

[0013] Preferably, the formulation is a real-time quantitative PCR detection kit or an in situ hybridization detection kit;

[0014] The real-time quantitative PCR detection kit contains primer pairs for detecting piR-44078; the primer pairs contain an RT primer as shown in SEQ ID NO.2, an F primer as shown in SEQ ID NO.3, and an R primer as shown in SEQ ID NO.4; the in situ hybridization detection kit contains a probe that specifically hybridizes with piR-44078; the nucleotide sequence of the probe is shown in SEQ ID NO.5.

[0015] Specifically, SEQ ID NO.2 is:

[0016] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGAAAGGT

[0017] SEQ ID NO.3 is: TCCTAAAAGTAGATGAGCAGGGA

[0018] SEQ ID NO.4 is: GTCGTATCCAGTGCAGGGTCCGAGGT

[0019] SEQ ID NO.5 is: UGGAAAGUCCCUGCUCAUCUACUUUUAGGA

[0020] Based on a general inventive concept, this application provides the use of an inhibitor of piR-44078 in the preparation of a medicament for treating colorectal cancer, wherein the nucleotide sequence of piR-44078 is shown in SEQ ID NO.1.

[0021] Preferably, the inhibitor is an oligonucleotide molecule capable of knocking down piR-44078 expression; the inverse complementary sequence of the inhibitor is shown in SEQ ID NO.6. Specifically, the inverse complementary sequence (5'-3') of the inhibitor is: UGGAAAGUCCCUGCUCAUCUACUUUUAGGA

[0022] This invention uses qPCR to detect the expression level of piR-44078 in clinical tissues and plasma of colorectal cancer patients. It was found that piR-44078 was significantly upregulated in colorectal cancer tissues or plasma of colorectal cancer patients compared with normal colorectal tissues and plasma of healthy volunteers. The results were statistically significant, indicating that piR-44078 can be used as a biomarker for the auxiliary diagnosis of colorectal cancer, providing a new detection method for the diagnosis of colorectal cancer.

[0023] Compared with the prior art, this application has the following significant advantages:

[0024] 1. Provides a novel, high-value biomarker for colorectal cancer: This application reveals and validates for the first time that a specific piRNA molecule—piR-44078—is closely related to the occurrence and development of colorectal cancer. This provides a novel biomarker and potential therapeutic target for the field of colorectal cancer.

[0025] 2. High diagnostic sensitivity and specificity: Due to the high specificity and significant differences in the expression of piR-44078 in colorectal cancer tissues, using it as a detection target can effectively distinguish cancerous tissue from normal tissue. Therefore, kits based on the detection of piR-44078 (such as qPCR kits or in situ hybridization kits) can achieve high sensitivity and high specificity in the diagnosis of colorectal cancer.

[0026] 3. Convenient diagnostic methods, easy to promote and apply: The qPCR detection primers and in situ hybridization probes provided in this application have clear and highly specific sequences, and can be standardized for mass production. The diagnostic reagents or kits are easy to operate, have a short detection cycle, and are relatively inexpensive.

[0027] 4. Providing new targets and drug directions for colorectal cancer treatment: This application proposes for the first time a strategy to treat colorectal cancer by inhibiting the expression of piR-44078. By designing inhibitors targeting piR-44078, the progression of colorectal cancer can be intervened at the molecular level, providing a clear direction and candidate molecules for the development of novel targeted therapies.

[0028] 5. Broad application prospects of the biomarker: The piR-44078 biomarker provided in this application is not limited to single diagnosis or treatment. It can also be used in the fields of prognosis, efficacy monitoring, and recurrence risk assessment of colorectal cancer, and has the potential to become a key molecule throughout the entire management of colorectal cancer, with great application value. Attached Figure Description

[0029] To more clearly illustrate the technical solutions of the embodiments of this application, the drawings used in the embodiments of this application will be briefly introduced below. Obviously, the drawings described below are only some implementation methods of this application. For those skilled in the art, other drawings can be obtained based on the drawings without creative effort.

[0030] Figure 1 The expression of piR-44078 in colorectal cancer cell lines and tissues was shown; among them, Figure 1 A is a bar chart showing the relative expression levels of piR-44078 in various colorectal cancer cell lines (SW480, SW620, HT29, HCT116, LOVO) and normal colonic epithelial cell line (NCM460) detected by qPCR. Figure 1 B is a bar chart showing the relative expression levels of piR-44078 in colorectal cancer tissues (T) and adjacent normal tissues (N) as detected by qPCR; Figure 1 C represents the expression of piR-44078 in the plasma of colorectal cancer patients and healthy volunteers, detected by qPCR.

[0031] Figure 2 The expression and localization of piR-44078 in paired colorectal cancer tissues and adjacent normal tissues were shown; among them, Figure 2 A is a scatter plot showing the relative expression levels of piR-44078 in 15 pairs of paired colorectal cancer tissues and corresponding adjacent normal tissues detected by qRT-PCR; Figure 2 B is a representative micrograph of the expression localization of piR-44078 in colorectal cancer tissue and adjacent tissue detected by in situ hybridization; Figure 2 C is a bar chart that statistically analyzes the proportion of high and low expression of piR-44078 in colorectal cancer tissues and adjacent non-cancerous tissues.

[0032] Figure 3 The effect of in vitro interference with piR-44078 on the proliferation ability of colorectal cancer cells was demonstrated; among them, Figure 3 A is a bar graph showing the knockdown efficiency of piR-44078 inhibitor in HCT116, HT29 and SW620 cells as verified by qPCR; Figure 3 B shows representative clones of the negative control group (NC) and the piR-44078 inhibitor group in HCT116, HT29 and SW620 cells after the plate clone experiment. Figure 3 C is the correct answer. Figure 3 A bar chart showing the statistical analysis of cell clone counts in each group of B; Figure 3D, 3E, and 3F are growth curves showing the cell viability of the NC group and the inhibitor group in HCT116, HT29, and SW620 cells at different time points (24, 48, 72, and 96 hours) as detected by the CCK-8 assay.

[0033] Figure 4 The study demonstrated the effect of in vitro interference with piR-44078 on the migration ability of colorectal cancer cells; among which, Figure 4 A shows representative photographs of cells crossing the membrane in HCT116, HT29, and SW620 cells after the Transwell migration assay, comparing the negative control group (NC) and the piR-44078 inhibitor group. Figure 4 B is the correct answer. Figure 4 A bar chart showing the statistical analysis of the number of cells that crossed the membrane in each group in group A.

[0034] Figure 5 The study demonstrated the effect of in vivo interference with piR-44078 on the growth of colorectal cancer xenograft tumors; among which, Figure 5 A shows tumor tissue images from the NC and inhibitor treatment groups; Figure 5 B is a growth curve of tumor volume changes over time in the NC group and the piR-44078 inhibitor group during the experiment; Figure 5 C is a bar chart showing the statistical weight of the tumors stripped from the NC group and the inhibitor group at the end of the experiment. Figure 5 D shows representative HE staining micrographs of tumor tissues from the NC group and the inhibitor group; Figure 5 E shows representative micrographs of Ki-67 immunohistochemical staining of tumor tissues from the NC group and the inhibitor group.

[0035] Figure 6 The receiver operating characteristic (ROC) curves for distinguishing colorectal cancer tissue from adjacent non-cancerous tissue by piR-44078 expression levels are shown in the figure, with the area under the curve (AUC) and 95% confidence interval (CI) marked. Detailed Implementation

[0036] The embodiments described in this specification are merely for explaining this application and are not intended to limit this application.

[0037] For simplicity, this paper only explicitly discloses some numerical ranges. However, any lower limit can be combined with any upper limit to form an unspecified range; and any lower limit can be combined with other lower limits to form an unspecified range, just as any upper limit can be combined with any other upper limit to form an unspecified range. Furthermore, although not explicitly stated, every point or individual value between the endpoints of a range is included within that range. Therefore, each point or individual value can be used as its own lower or upper limit, combined with any other point or individual value, or combined with other lower or upper limits to form an unspecified range.

[0038] The present application is further illustrated below with reference to embodiments. It should be understood that these embodiments are merely illustrative, as various modifications and variations will be apparent to those skilled in the art within the scope of the disclosure of this application. Unless otherwise stated, all parts, percentages, and ratios reported in the following embodiments are based on mass, and all reagents used in the embodiments are commercially available or synthesized by conventional methods and can be used directly without further processing, and the instruments used in the embodiments are commercially available.

[0039] The colorectal cancer cell lines HCT116, HT29, and SW620 used in this application are from the ATCC cell bank.

[0040] Cell culture was performed using RPMI-1640 medium supplemented with 10% fetal bovine serum.

[0041] The inhibitor used to knock down piR-44078 was synthesized by Guangzhou Ruibo Technology Co., Ltd.

[0042] The colorectal cancer and paired adjacent normal tissue samples involved in this application were collected from the First People's Hospital of Changde City. The inclusion criteria were: patients who had not undergone surgery or radiotherapy / chemotherapy, and who did not have other serious autoimmune diseases or major illnesses. Sample collection took place between 2022 and 2023. Clinical samples collected included patient-related information such as name, gender, age, hospital number, pathological type, and pathological stage. Informed consent was obtained from all patients for all clinical tissue and blood samples.

[0043] In this application, the primers for the patient's RNA were designed online on the Primer 3.0 website based on their splicing sites, and the primer synthesis was completed by Changsha Qingke Biotechnology Co., Ltd.

[0044] U6 is used as an internal reference, and the primer sequences are shown in Table 1 below.

[0045] Table 1. U6 Internal Reference Primer Sequence List

[0046]

[0047] The primers used to test piR-44078 expression by PCR are shown in Table 2.

[0048] Table 2 Primer sequence list for PCR testing

[0049]

[0050] The piR-44078 inhibitor sequence used in this application is:

[0051] inhibitor (5'-3'): UGGAAAGUCCCUGCUCAUCUACUUUUAGGA

[0052] All experimental results in this application were analyzed using statistical analysis: t-tests were used to analyze differences between two groups. Paired t-tests were used to analyze the difference in piR-44078 expression between cancerous and adjacent tissues of the same patient. P < 0.05 was considered statistically significant, and all p-values ​​were analyzed using two-tailed tests. Statistical analysis was performed using SPSS 26.0 and Graphpad Prism 9.0 software.

[0053] Example 1: Expression of piR-44078 in colorectal cancer cells, tissues, and plasma.

[0054] 1. Extract total RNA from cells, tissues, and plasma.

[0055] Place the cells or ground tissue sample in an appropriate amount of Trizol reagent (750 μL for a 250 μL serum sample), vortex thoroughly to mix, and incubate at room temperature for 5 minutes. Then, add 200 μL of chloroform, vortex vigorously for 15 seconds, and incubate at room temperature for 10 minutes. Centrifuge at 12000 g (g is the acceleration due to gravity) for 15 minutes at 4°C. Carefully transfer the colorless aqueous supernatant to a new RNase-free centrifuge tube, add 450 μL of isopropanol, gently invert to mix, and incubate at 4°C for 30 minutes to precipitate RNA. Then, centrifuge at 12000 g for 10 minutes at 4°C and discard the supernatant. Wash the RNA precipitate twice with pre-cooled 75% ethanol (prepared with DEPC water). Discard the ethanol, briefly dry the RNA precipitate in a clean air chamber until translucent, and finally dissolve in an appropriate amount of RNase-free water; store for later use.

[0056] 2. Reverse transcription

[0057] In each reaction system, 1 µg of total RNA was added, along with 1 µL of gene-specific reverse transcription primer (10 µM), and the total volume was brought to 12 µL with RNase-free water. The mixture was gently mixed, briefly centrifuged, and incubated at 65°C for 5 minutes to break down the RNA secondary structure and promote primer annealing, followed immediately by cooling on ice for 1–2 minutes. Then, the following components were added sequentially: 2 µL of dNTP mixture (10 mM), 1 µL of RevertAid™ M-Mul RT reverse transcriptase (200 U / µL), and 1 µL of RiboLock RNase Inhibitor (20 U / µL), followed by water to a total reaction volume of 20 µL. After thorough mixing and brief centrifugation, the mixture was incubated at 42°C for 60 minutes according to the reagent instructions for reverse transcription synthesis, followed by incubation at 70°C for 5 minutes to terminate the reaction. The resulting cDNA product can be directly used for subsequent quantitative PCR.

[0058] 3. Real-time quantitative PCR (qPCR) reaction system and procedure

[0059] Prepare the qPCR reaction system according to the kit instructions, with a total volume of 20 μL. Add the following to each reaction system sequentially: 10 μL qPCR Mix Buffer, 1 μL forward primer, 1 μL reverse primer, and 1 μL template cDNA. Then add 7 μL of nuclease-free water (ddH2O) to bring the total volume to 20 μL. After adding each component, gently mix and briefly centrifuge to collect the liquid, ensuring no air bubbles are present.

[0060] The PCR amplification program was set as follows: First, pre-denaturation was performed at 99℃ for 5 minutes; then 40 cycles were performed (each cycle included 95℃ for 10 seconds, 60℃ for 30 seconds, and 65℃ for 60 seconds); finally, amplification was terminated at 95℃ for 10 seconds. After amplification, melting curves were automatically plotted to verify the specificity of the amplified products. All samples were performed in triplicate, and normalization analysis was performed using U6 as an internal reference gene.

[0061] 4. Results Analysis

[0062] First, calculate the 2-1 of the target gene and the internal reference. -△△Ct Bar charts were generated and statistical analysis was performed using Graphpad Prism 9.0. The expression of piR-44078 in colorectal cancer cell lines, tissues, and plasma is shown in [reference needed]. Figure 1 . Figure 1A represents the expression of piR-44078 in colorectal cancer cell lines and normal colonic epithelial cell lines detected by qPCR. Compared with the normal colonic epithelial cell line (NCM460), the expression of piR-44078 was increased in various colorectal cancer cell lines (SW480, SW620, HT29, HCT116, LOVO) (p<0.01). Figure 1 B is a bar chart showing the relative expression levels of piR-44078 in colorectal cancer tissues (T) and adjacent normal tissues (N) detected by qPCR, with 30 samples from both adjacent normal tissues (N) and colorectal cancer tissues (T). Figure 1 As shown in Figure B, piR-44078 was significantly higher in tumor tissue than in adjacent normal tissue (P<0.001). Figure 1 C represents the expression of piR-44078 in the plasma of colorectal cancer patients and healthy volunteers detected by qPCR. The results showed that piR-44078 was significantly highly expressed in the plasma of colorectal cancer patients, indicating that it may be related to tumorigenesis. This suggests that piR-44078 can serve as a potential non-invasive biomarker for CRC detection.

[0063] Comparisons between multi-cell lines and controls were performed using one-way ANOVA with Dunnett's post-hoc test. When data did not conform to normal distribution or homogeneity of variance, the Kruskal-Wallis test was used with Dunn's multiple comparisons. Independent samples (tissue or plasma) were compared between groups using independent samples t-tests, with p < 0.05 considered statistically significant.

[0064] Example 2: Expression of piR-44078 in colorectal cancer tissues and their paired adjacent normal tissues

[0065] 1. Tissue sample pretreatment

[0066] Freshly collected colorectal cancer and paired adjacent normal tissues were immediately fixed in 4% paraformaldehyde solution for 24 hours. After fixation, the tissue blocks were sequentially dehydrated in a gradient of ethanol as follows: 50% ethanol for 1 hour → 75% ethanol for 1 hour → 80% ethanol for 1 hour → 90% ethanol for 1 hour → 95% ethanol for 1 hour → 100% ethanol (Ⅰ) for 1 hour → 100% ethanol (Ⅱ) for 1 hour. After dehydration, the tissues were cleared twice in turpentine oil, 1 hour each time. Finally, the tissues were immersed in molten paraffin overnight, then embedded in paraffin and sectioned.

[0067] 2. Section pretreatment and hybridization

[0068] The paraffin sections were baked in a 60°C oven for 1-2 hours. Then the sections were immersed in turpentine oil to dewax for 1 hour, followed by sequential immersion in 100% ethanol for 10 minutes, 90% ethanol for 10 minutes, 80% ethanol for 10 minutes, and 75% ethanol for 10 minutes. Finally, they were rinsed with distilled water.

[0069] Antigen retrieval: Place the slide in sodium citrate buffer, heat it in a microwave oven to boiling, then let it cool naturally, and rinse with running water for 5 minutes.

[0070] To eliminate interference from endogenous peroxidase, 3% hydrogen peroxide solution was added to the tissue and incubated at room temperature for 10 minutes, followed by washing with PBS buffer three times for 3 minutes each time.

[0071] 3. Hybridization and Signal Detection

[0072] Add digoxigenin-labeled piR-44078 specific probe hybridization solution to the slide, place in a humidified chamber, and incubate overnight at 4°C.

[0073] After hybridization, the slides were washed three times with PBS buffer for three minutes each time to remove unbound probes.

[0074] Add biotinylated mouse anti-digoxigenin antibody and incubate at 37°C for 20 minutes. Wash the sections three times with PBS buffer for 3 minutes each time. Then add streptavidin-biotin-horseradish peroxidase and incubate at room temperature for 40 minutes. After incubation, wash three times with PBS buffer for 3 minutes each time.

[0075] Add DAB substrate and develop in the dark for 3–10 minutes, controlling the degree of development under a microscope until the positive signal (brownish-yellow) is clear and the background is moderate.

[0076] 4. Counterstaining and mounting

[0077] Counterstain the cell nuclei with hematoxylin solution for 2-3 minutes, then rinse with running water for 10 minutes to restore blue color.

[0078] The sections were then subjected to a gradient of ethanol dehydration: 75% ethanol for 5 minutes → 80% ethanol for 5 minutes → 90% ethanol for 5 minutes → 95% ethanol for 5 minutes → 100% ethanol (Ⅰ) for 5 minutes → 100% ethanol (Ⅱ) for 5 minutes. After dehydration, the sections were cleared twice with xylene and finally mounted with neutral resin.

[0079] 5. Results Analysis

[0080] To verify the expression characteristics of piR-44078 in colorectal cancer, we first detected the expression level of piR-44078 in 15 pairs of paired colorectal cancer tissues and corresponding adjacent normal tissues using qRT-PCR. The results are as follows: Figure 2Figure A shows that the expression level of piR-44078 in cancerous tissue was significantly higher than that in adjacent normal tissue (P<0.001).

[0081] Further in situ hybridization experiments were conducted to analyze the precise localization and expression distribution of piR-44078 in tissues, and the results are as follows: Figure 2 Figure B shows the results; the results indicate that piR-44078 is mainly located in the cytoplasm of tumor cells; it shows strong positive expression in cancerous tissue, while it only shows weak positive or negative expression in paired adjacent normal tissue.

[0082] Semi-quantitative scoring was performed based on the staining intensity and the proportion of positive cells from in situ hybridization, and the samples were divided into high-expression and low-expression groups. Specific results are as follows: Figure 2 As shown in Figure C, statistical results show that the proportion of piR-44078 highly expressed in colorectal cancer tissue (80%) is significantly higher than that in adjacent normal tissue (13.3%).

[0083] In summary, qPCR, in situ hybridization localization, and semi-quantitative statistical results consistently indicate that piR-44078 is specifically and highly expressed in colorectal cancer tissues, further supporting the high expression trend of piR-44078 in CRC. Paired tissue statistical analysis was performed using paired t-tests, and ISH staining intensity and positive cell proportion scores were analyzed using chi-square tests. p < 0.05 was considered statistically significant.

[0084] Example 3: Evaluation of the effect of interfering with piR-44078 on inhibiting the proliferation of colorectal cancer cells

[0085] 1. Verification of cell transfection and knockdown efficiency

[0086] Human colorectal cancer cell lines HCT116, HT29, and SW620, in logarithmic growth phase, were digested and seeded in six-well plates. When the cell density reached approximately 70%, cells were transfected using liposome transfection with either a negative control sequence (NC) or an inhibitor targeting piR-44078. Forty-eight hours after transfection, cells were collected, and total RNA was extracted and reverse transcribed into cDNA as described in Example 1. The expression level of piR-44078 was detected by qRT-PCR to verify the interference efficiency.

[0087] 2. Plate colony formation experiment

[0088] To assess the long-term proliferative capacity of cells, a colony formation assay was performed. The specific steps were as follows: 12 hours after cell transfection, cells were washed twice with PBS, digested, resuspended, and counted. Cells were seeded into new six-well plates at a low cell density (1000 cells per well). The plates were incubated at 37°C with 5% CO2 for 7–14 days, with the culture medium changed periodically. Culture was terminated when visible cell clones appeared. After carefully washing the cells with PBS, they were fixed with 4% paraformaldehyde for 15 minutes and then stained with 1% crystal violet solution for 30 minutes. After rinsing with running water and air-drying, the six-well plates were photographed, and the number of clones with more than 50 cells per well was counted.

[0089] 3. CCK-8 cell viability assay

[0090] To assess cell proliferation, a CCK-8 assay was performed. The specific steps were as follows: Twelve hours after transfection, cells were digested, resuspended, and counted. Cells were then seeded evenly in 96-well plates at a density of 2000 cells per well. At 24, 48, 72, and 96 hours post-seeding, 10 μL of CCK-8 solution was added to each well. The 96-well plates were incubated for another 2 hours, and the absorbance (OD value) at 450 nm was then measured using a microplate reader.

[0091] 4. Results and Analysis

[0092] To clarify the function of piR-44078 in the proliferation of colorectal cancer cells, functional intervention was performed in HCT116, HT29, and SW620 cells using a piR-44078 inhibitor. The results are as follows: Figure 3 As shown.

[0093] The interference efficiency was verified using qRT-PCR. Figure 3 As shown in Figure A, compared with cells transfected with the negative control (NC), the expression level of piR-44078 was significantly decreased in all three groups of cells transfected with the piR-44078 inhibitor, indicating good inhibition efficiency.

[0094] Figure 3 B shows the results of the colony formation experiment. The results indicate that the number of cell clones formed in the groups transfected with the inhibitor was significantly less than that in the corresponding NC group. Quantitative statistics on the number of clones were performed. Figure 3 C) showed that the number of clones formed in the inhibitor group was significantly lower than that in the control group, proving that interfering with piR-44078 can effectively inhibit the clonogenic ability of colorectal cancer cells.

[0095] Figure 3Figures D, 3E, and 3F show the growth curves of cell viability at different time points (24, 48, 72, and 96 hours) in HCT116, HT29, and SW620 cells, as detected by the CCK-8 assay, respectively. The results showed that during the 96-hour monitoring period, the OD value growth curves of HCT116, HT29, and SW620 cells transfected with the inhibitor were significantly flatter than those of the NC group. This indicates that interference with piR-44078 significantly inhibited cell proliferation.

[0096] Conclusion: This embodiment, through three independent in vitro functional verifications—qRT-PCR, plate colony formation assay, and CCK-8 assay—confirmed that inhibiting the expression of piR-44078 can significantly weaken the proliferative capacity of colorectal cancer cells from two aspects: gene knockdown efficiency and proliferation capacity, providing solid experimental evidence for its potential as a therapeutic target.

[0097] Example 4: Effect of interfering with piR-44078 on the migration ability of colorectal cancer cells

[0098] 1. Cell preparation and transfection

[0099] Healthy HCT116, HT29, and SW620 cells were seeded into six-well plates. When the cell density reached approximately 70%, they were transfected with either NC or piR-44078 inhibitor, respectively. Twelve hours after transfection, the cells were digested and resuspended in serum-free medium, adjusting the cell density to approximately 2.4 × 10⁶ cells per 250 μL. 4 Each cell.

[0100] 2. Transwell transfer experiment

[0101] Before experiments, wash the Transwell chambers (8 μm pore size, Corning) with PBS and equilibrate at 37°C for 1–2 hours. Add 500 μL of 1640 complete culture medium containing 20% ​​FBS to the lower chamber and 250 μL of cell suspension to the upper chamber. Incubate the 24-well plates at 37°C in a 5% CO2 incubator for 18–36 hours, adjusting the incubation time according to the migration ability of different cell lines.

[0102] After incubation, remove any unmigrated cells from the upper cavity, wash 2-3 times with PBS, and fix with paraformaldehyde for 10 minutes. Then stain with 1% crystal violet for 10 minutes, remove excess dye, rinse 3 times with PBS, and air dry. Under an inverted microscope, randomly select 5 fields of view to observe and count the number of cells that have migrated across the membrane. Each experiment had 3 replicates, and the average values ​​were used for statistical analysis. Results are expressed as mean ± standard deviation, and t-tests were used for statistical analysis.

[0103] 3. Results and Analysis

[0104] like Figure 4 As shown in the Transwell migration assay, interfering with piR-44078 significantly inhibited the migration ability of colorectal cancer cells. Among them, Figure 4 Image A shows representative images of cells that crossed the Transwell chamber membrane after 24 hours of incubation in the negative control group (NC) and the piR-44078 inhibitor group. It is clearly visible that the number of cells crossing the membrane in the inhibitor group was significantly less than that in the NC group. Quantitative counting of migrating cells was performed. Figure 4 B) shows that in the HCT116, HT29, and SW620 cell lines, the number of migrating cells in the inhibitor group was significantly lower than that in the corresponding NC group (p<0.005). This result demonstrates that knocking down the expression of piR-44078 can effectively weaken the in vitro migration ability of colorectal cancer cells.

[0105] Example 5: Inhibitory effect of interfering with piR-44078 on tumor growth in vivo

[0106] 1. Construction of a subcutaneous tumor-bearing model in nude mice

[0107] To evaluate the function of piR-44078 in vivo, we constructed a subcutaneous xenograft model in nude mice. A brief overview of the process is as follows:

[0108] HCT116 cells with stable piR-44078 knockdown and their negative control (NC) cells were digested and collected, and resuspended in a 1:1 mixture of PBS and matrix gel. The cell suspension (1 × 10^6 cells per mouse, total volume 100 μL) was injected into the flank of BALB / c nude mice to form subcutaneous tumors. When the tumor diameter reached approximately 6 mm, the mice were randomly divided into two groups (NC group and piR-44078 inhibitor group), with at least 4 animals in each group, ensuring no significant difference in mean tumor volume between the two groups at the time of grouping.

[0109] 2. Dosing regimen and tumor monitoring

[0110] After grouping, treatment was administered via injection as close to the tumor as possible. The experimental group received an injection containing piR-44078 inhibitor (4 mg inhibitor equivalent per mouse per injection), while the control group received an equal volume of saline. Treatment was administered every two days for six consecutive days as one cycle. From the start of treatment, the long axis (a) and short axis (b) of the tumor were measured every three days, calculated using the formula V = a × b. 2 / 2 Calculate the tumor volume and plot the tumor growth curve.

[0111] 3. Tissue Sample Collection and Processing

[0112] At the end of the experiment, mice were euthanized, and the subcutaneous tumor tissue was completely dissected, washed with PBS, photographed, and weighed to record the tumor weight. Subsequently, each tumor tissue was divided into two parts: one part was immediately flash-frozen in liquid nitrogen and transferred to an ultra-low temperature freezer at -80°C for storage, for subsequent molecular biological detection; the other part was fixed in 4% paraformaldehyde solution for histological analysis.

[0113] 4. Histological analysis

[0114] HE staining analysis of tumor morphology: After fixation, tumor tissue was dehydrated with graded ethanol, embedded in paraffin, and then sectioned. After dewaxing and hydration, the sections were stained with HE staining solution for 10 minutes, followed by washing with water for 10 minutes, and then reigniting with hematoxylin for 2-3 minutes. After dehydration, the sections were mounted and observed under an upright microscope to observe changes in tissue morphology.

[0115] Ki-67 Immunohistochemical (IHC) staining: After antigen retrieval and endogenous peroxidase blockade, sections were incubated overnight at 4°C with anti-Ki-67 primary antibody. Subsequently, signal amplification and color development were performed using the corresponding HRP-labeled secondary antibody and DAB chromogenic kit. After hematoxylin counterstaining of cell nuclei, the sections were mounted with neutral resin.

[0116] 5. Results and Analysis:

[0117] This application further verified the inhibitory effect of interfering with piR-44078 on the growth of colorectal cancer through in vivo animal experiments, and the results are as follows: Figure 5 As shown. Among them, Figure 5 Image A shows tumor tissue images from the NC and inhibitor treatment groups. Figure 5 B shows the tumor volume growth curves of the NC group and the piR-44078 inhibitor group over time during the experiment. The tumor growth curves clearly show that, compared with the NC group, the tumor volume growth rate of the piR-44078 inhibitor group was significantly slower, and its volume was significantly smaller than that of the control group throughout the observation period. At the end of the experiment, the tumors were dissected and weighed. Figure 5 C is a bar chart showing the statistical weight of tumors separated from the NC group and the inhibitor group, which confirms that the tumor quality in the inhibitor group was significantly lower than that in the NC group (p<0.05), thus verifying the inhibitory effect of interfering with piR-44078 on tumor growth from the perspective of the endpoint.

[0118] Histological analysis of tumor tissue: Figure 5 D shows representative HE staining micrographs of tumor tissues from the NC group and the inhibitor group; Figure 5 E shows representative micrographs of Ki-67 immunohistochemical staining of tumor tissues from the NC group and the inhibitor group. Figure 5HE staining results for D showed that tumor cells in the NC group were densely packed, with large, deeply stained nuclei and significant atypia; while the tumor cell density in the inhibitor group was significantly reduced and the cells were relatively sparsely arranged, suggesting that their growth was inhibited. Figure 5 E showed that the proportion of Ki-67 positive cells in the tumor tissue of the inhibitor group was significantly lower than that of the NC group, indicating that interfering with piR-44078 can effectively reduce the proliferative activity of tumor cells.

[0119] Conclusion: The in vivo experimental data in this embodiment, from four dimensions of tumor volume, tumor weight, tissue morphology and cell proliferation level, jointly demonstrate that inhibiting the expression of piR-44078 can significantly inhibit the tumorigenicity and growth ability of colorectal cancer cells in vivo.

[0120] Example 6: Diagnostic value analysis of piR-44078 in differentiating colorectal cancer from adjacent non-cancerous tissue

[0121] To evaluate the potential of piR-44078 as a diagnostic biomarker for colorectal cancer, receiver operating characteristic (ROC) curve analysis was performed to assess its ability to distinguish cancerous tissue from adjacent normal tissue. The specific methods are as follows:

[0122] Sixty tissue samples were divided into a colorectal cancer group (n=30) and an adjacent normal tissue group (n=30) based on pathological results. The relative expression level of piR-44078 was detected and recorded in both groups. Tissue type (CRC=1, adjacent normal tissue=0) was used as the state variable, and the expression value of piR-44078 was used as the test variable. ROC analysis was performed using GraphPad Prism 9.0 or SPSS 26.0 software. The area under the curve (AUC) and its 95% confidence interval (CI) were calculated. The Youden index (calculated as: Youden index = sensitivity + specificity - 1) was used to determine the optimal cutoff value, and the corresponding sensitivity and specificity were obtained. The AUC value was used to evaluate the diagnostic efficacy of piR-44078 in distinguishing between CRC and adjacent normal tissue: AUC=0.5 indicated no diagnostic value; 0.7≤AUC<0.9 indicated good diagnostic value; and AUC≥0.9 indicated excellent diagnostic performance.

[0123] Figure 6The ROC curve for piR-44078 is presented, clearly depicting the relationship between its sensitivity and specificity in distinguishing colorectal cancer tissue from adjacent tissue at different judgment thresholds. The analysis shows that the area under the ROC curve (AUC) is 0.809. In diagnostics, the AUC value is typically judged as follows: 0.5 represents no diagnostic value, 0.7-0.9 represents good diagnostic accuracy, and ≥0.9 represents excellent diagnostic accuracy. In this case, the AUC value of 0.809 clearly falls within the "good" range. Furthermore, the 95% confidence interval (CI) for this AUC value is 0.710–0.909. The lower limit of this interval is higher than 0.7, and the entire interval is far from 0.5, indicating that the result of AUC=0.809 has high estimation accuracy and statistical significance.

[0124] Conclusion: This embodiment demonstrates through ROC curve analysis that the expression level of piR-44078 shows a sufficiently distinct difference between colorectal cancer tissue and adjacent non-cancerous tissue, with an AUC value of 0.809, indicating good diagnostic efficacy.

[0125] sequence list

[0126] The nucleic acid sequences involved in this application are shown in Table 3 below.

[0127] Table 3 Sequence List

[0128]

[0129] The above description is merely a specific embodiment of this application, but the scope of protection of this application is not limited thereto. Any person skilled in the art can easily conceive of various equivalent modifications or substitutions within the technical scope disclosed in this application, and these modifications or substitutions should all be covered within the scope of protection of this application. Therefore, the scope of protection of this application should be determined by the scope of the claims.

Claims

1. A biomarker for diagnosing colorectal cancer, characterized in that, The biomarker is piR-44078, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. A method for in vitro detection of piR-44078 for non-diagnostic purposes, characterized in that, The method includes: using a reagent capable of specifically detecting piR-44078 to detect the expression level of piR-44078 in a biological sample from a subject; wherein the nucleotide sequence of piR-44078 is shown in SEQ ID NO.

1.

3. The method as described in claim 2, characterized in that, The reagents that can specifically detect piR-44078 include: primer pairs that specifically amplify piR-44078 or probes that specifically hybridize with piR-44078; The primer pair includes the RT primer shown in SEQ ID NO.2, the F primer shown in SEQ ID NO.3, and the R primer shown in SEQ ID NO.4; the nucleotide sequence of the probe is shown in SEQ ID NO.

5.

4. The method as described in claim 3, characterized in that, The method is real-time quantitative PCR or in situ hybridization.

5. A preparation for the diagnosis of colorectal cancer, characterized in that, The formulation comprises a reagent capable of specifically detecting the expression level of piR-44078 in a sample; the nucleotide sequence of piR-44078 is shown in SEQ ID NO.

1.

6. The formulation as described in claim 5, characterized in that, The preparation is a real-time fluorescence quantitative PCR detection kit or an in situ hybridization detection kit; The real-time quantitative PCR detection kit contains primer pairs for detecting piR-44078; the primer pairs contain an RT primer as shown in SEQ ID NO.2, an F primer as shown in SEQ ID NO.3, and an R primer as shown in SEQ ID NO.4; the in situ hybridization detection kit contains a probe that specifically hybridizes with piR-44078; the nucleotide sequence of the probe is shown in SEQ ID NO.

5.

7. The use of an inhibitor of piR-44078 in the preparation of a medicament for treating colorectal cancer, characterized in that, The nucleotide sequence of piR-44078 is shown in SEQ ID NO.

1.

8. The application as described in claim 7, characterized in that, The inhibitor is an oligonucleotide molecule capable of knocking down piR-44078 expression; the reverse complementary sequence of the inhibitor is shown in SEQ ID NO.6.

Images