Biomarker for detecting streptococcus suis pathogen and application thereof

Abstract

The invention relates to the field of pathogen detection, in particular to a biomarker for detecting streptococcus suis pathogens and application of the biomarker. According to the present invention, the chap gene of Streptococcus suis is researched to obtain the highly conservative DNA sequence represented by SEQ ID NO.1, the specific primer and the probe are designed according to the sequence, and the real-time fluorescence PCR detection method of Streptococcus suis is established by optimizing the reaction system and the amplification condition. The lowest sensitivity can be detected to be 100 copies / mu L. The method only has positive reaction on streptococcus suis nucleic acid, and has no cross reaction with other common pathogens; the variation rate of templates with different concentrations is lower than 5%, and good stability and repeatability are achieved.

Description

Technical Field

[0001] This invention relates to the field of pathogen detection, and more specifically to a biomarker for detecting Streptococcus suis pathogen and its application. Background Technology

[0002] Streptococcus suis (SS) is a Gram-positive, facultative anaerobic, opportunistic pathogen with a capsule, arranged in chains. It commonly causes systemic diseases in swine herds, such as meningitis, septicemia, and arthritis. Simultaneously, as an important zoonotic pathogen, it poses a potential threat to humans exposed to infected pigs and pork products, seriously affecting the development of the swine industry and public health safety. This bacterium has multiple serotypes; currently, 29 traditional serotypes have been reported, among which serotype 2 (SS2) is the most pathogenic, accounting for over 60% of isolated strains nationwide, followed by serotypes 14 and 9. The disease exhibits a clear regional distribution (e.g., SS2 and SS4 are predominant in Henan, while SS2, SS3, and SS9 are predominant in Central China).

[0003] In the context of large-scale porcine farming nationwide, streptococcal disease in pigs has become a common occurrence, often resulting in mixed infections with multiple pathogens such as porcine reproductive and respiratory syndrome virus (PRRSV), Haemophilus parasuis, and Pasteurella multocida. This leads to complex clinical symptoms, rapid onset, difficult prognosis, and increased challenges in prevention and control. Furthermore, the clinical symptoms of this disease are often similar to those of porcine pseudorabies and other infectious diseases, making differential diagnosis difficult and leading to frequent misdiagnosis. Failure to confirm the diagnosis early often results in poor prognosis even with later treatment, causing significant economic losses to the porcine farming industry. Therefore, establishing rapid, sensitive, and specific detection methods is crucial for the early diagnosis and control of streptococcal disease in pigs.

[0004] Currently, diagnostic methods for SS infection mainly include pathogen isolation and identification, serological testing, and molecular biological testing. Pathogen isolation and identification require culture in TSA plates supplemented with inactivated serum, a complex, time-consuming, and costly process. Serological testing methods vary in specificity, sensitivity, advantages, and disadvantages, requiring selection based on technical characteristics and the target organism. Conventional PCR offers advantages over traditional pathogen diagnosis, being faster and more convenient, and possessing higher specificity and sensitivity. Real-time quantitative PCR (qPCR) has even higher sensitivity than conventional PCR, and its quantitative nature allows it to be applied to the detection of various pathogens.

[0005] Traditional molecular biological detection of Streptococcus suis primarily uses primers designed targeting the gdh gene of Streptococcus suis. These primers effectively cover existing Streptococcus suis strains with 89.42%-100% homology. However, they also show high homology with some other streptococci (Streptococcus parasuis strain FZ2 90.86%, Streptococcus parasuis SUT-7 90.86%, Streptococcus parasuis strain FZ1 90.57%, etc., significantly higher than some Streptococcus suis strains; Streptococcus pneumoniae strain around 85%). Therefore, false positives may occur in clinical practice. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention provides a biomarker for detecting Streptococcus suis pathogens and its application. The biomarker of this invention, through research on the chap gene of Streptococcus suis, can effectively cover existing Streptococcus suis strains, effectively avoiding missed detections while improving specificity. In clinical diagnosis, combining chap gene detection can significantly reduce the false positive rate, improve diagnostic accuracy, and ensure accurate identification and effective control of Streptococcus suis infection.

[0007] Based on the chapter gene sequence of Streptococcus suis, this invention designs primers and probes to establish a TaqMan real-time quantitative PCR detection method for Streptococcus suis, providing technical support for preventing Streptococcus suis infection, clarifying its epidemic trend, and formulating scientific prevention and control strategies. The specific content of this invention is as follows: In a first aspect, the present invention provides a biomarker for detecting Streptococcus suis pathogens, said biomarker having a sequence as shown in SEQ ID NO.1 or having at least 95% homology with SEQ ID NO.1.

[0008] Optionally, the biomarker sequence has at least 95%, 95.2%, 95.4%, 95.6%, 95.8%, 96%, 96.2%, 96.4%, 96.6%, 96.8%, 97%, 97.2%, 97.4%, 97.6%, 97.8%, 98%, 98.2%, 98.4%, 98.6%, 98.8%, 99%, 99.2%, 99.4%, 99.6%, and 99.8% homology with SEQ ID NO.1.

[0009] Optionally, the sequence of the biomarker is obtained by inserting, deleting, or converting at least one nucleotide from the sequence described in SEQ ID NO.1.

[0010] Furthermore, the Streptococcus suis includes at least one of type 1 (SS1), type 2 (SS2), type 4 (SS4), type 5 (SS5), type 7 (SS7), type 9 (SS9), type 10 (SS10), type 24 (SS4), and type 31 (SS31).

[0011] Furthermore, the Streptococcus suis includes at least one of type 1 (SS1), type 2 (SS2), type 7 (SS7), and type 9 (SS9).

[0012] In a second aspect, the present invention provides primers or probes for detecting the said biomarkers.

[0013] Furthermore, the primers comprise the sequences shown in SEQ ID NO2-3; the probe comprises the sequence shown in SEQ ID NO.4.

[0014] Optionally, the primer or probe sequence is as follows:

[0015] In a third aspect, the present invention provides a kit comprising reagents for detecting the biomarkers.

[0016] Furthermore, the kit includes at least the primers or probes described above.

[0017] Furthermore, the kit also includes universal reagents for the quantitative fluorescence probe method (using GenStar's 2×RealStar Fast probe qPCR premix (UNG) reagent). Preferably, the universal reagents for the quantitative fluorescence probe method include the reagents required for the PCR amplification system.

[0018] Furthermore, the reagents required for the PCR amplification system include at least: GenStar's 2×RealStar Fast probe qPCR premix (UNG) consists of 10 μL of reagent, 10 μmol / L of primers, 5 μmol / L of probe, 2 μL of template, and ddH2O to bring the total volume to 20 μL; or the total volume can be increased proportionally to 20-200 μL.

[0019] In a fourth aspect, the present invention provides a method for detecting Streptococcus suis pathogen, the method comprising at least the step of performing PCR amplification of Streptococcus suis pathogen using the primers or probes or the kits described herein.

[0020] Furthermore, the PCR amplification system is as follows: GenStar's 2×RealStar Fast probe qPCR premix (UNG) consists of 10 μL of reagent, primers at a final concentration of 10 μmol / L, probes at a final concentration of 5 μmol / L, template at 2 μL, and ddH2O to a final volume of 20 μL.

[0021] Optionally, the PCR reaction solution includes at least one of DNA polymerase, deoxyribonucleoside triphosphate, and buffer.

[0022] It should be noted that this invention does not specifically limit the reagents in the PCR amplification system. Any PCR reaction solution conventionally selected by those skilled in the art is protected by this invention, such as commercially available 2×RealStar Fast probe qPCR premix.

[0023] Furthermore, the PCR amplification reaction conditions are as follows: 95℃ for 3 min, 95℃ for 15 s, 50~60℃ for 10 s, and 72℃ for 30 s.

[0024] In a fifth aspect, the present invention provides the application of the biomarker, primer, probe, kit, or method described herein in the detection of Streptococcus suis pathogen.

[0025] The beneficial effects of the present invention include, but are not limited to: This invention, through research on the chap gene of *Streptococcus suis*, obtained a highly conserved DNA sequence as shown in SEQ ID NO. 1. Specific primers and probes were designed targeting this sequence, and a real-time fluorescent PCR detection method for *Streptococcus suis* was established by optimizing the reaction system and amplification conditions. This method achieves an amplification efficiency of 94.528% and a sensitivity down to 100 copies / μL. The method is positive only for *Streptococcus suis* nucleic acid and shows no cross-reactivity with other common pathogens. The variation rate of templates at different concentrations is less than 5%, indicating good stability and reproducibility. In the detection of 59 clinical samples, the detection rate of this method was 88.14% (52 / 59), while the detection rate of conventional methods was only 79.66% (47 / 59). The method described in this invention can be used for early diagnosis, epidemiological monitoring, and quantitative analysis of *Streptococcus suis* infection, and has practical application value for biosecurity in the livestock industry and public health control. Attached Figure Description

[0026] The accompanying drawings, which are included to provide a further understanding of the invention and form part of this invention, illustrate exemplary embodiments of the invention and are used to explain the invention, but do not constitute an undue limitation of the invention. In the drawings: Figure 1This is a fluorescence quantitative PCR amplification curve of Streptococcus suis in an embodiment of the present invention, wherein the genomic DNA concentrations of 1-5 are 1×10⁻⁶. 7 ~1×10 3 copies / μL.

[0027] Figure 2 This is the standard curve for quantitative real-time PCR of Streptococcus suis in this embodiment of the invention.

[0028] Figure 3 The PCR-specific amplification curves of Streptococcus suis in this embodiment of the invention are shown. Streptococcus suis types 1, 2, 7, and 9 are positive; Pasteurella suis, Salmonella suis, Escherichia coli, Haemophilus parasuis, and Actinobacillus suis are all negative.

[0029] Figure 4 This is the PCR-specific amplification curve for the sensitivity detection of Streptococcus suis in this embodiment of the invention, with genomic DNA concentrations of 1×10⁶ for 1-6. 7 ~1×10 2 copies / μL.

[0030] Figure 5 In the embodiments of this invention, the PCR-specific amplification curves for repeatability detection of Streptococcus suis (Figures 1-4) show genomic DNA concentrations of 1×10⁻⁴. 7 ~1×10 4 copies / μL. Detailed Implementation

[0031] The present invention is described in detail below with reference to the embodiments, but the present invention is not limited to these embodiments. Unless otherwise specified, the raw materials and catalysts in the embodiments of the present invention are all purchased through commercial channels.

[0032] Example 1: Screening for biomarker gene sequences Eleven strains of Streptococcus suis serotypes 1, 2, 7, and 9 from our laboratory were sent to General Biotechnology for whole-genome sequencing. ORF reading frames were obtained from these 11 strains through translation. Using our laboratory's compiler, pairwise alignment was performed to screen for over 400 common proteins with homology exceeding 90%. BLAST analysis was then used to identify these common proteins, and their functions and cellular localization were investigated. A comprehensive analysis revealed 15 potentially highly conserved proteins. The CHAP protein corresponds to a 1257 bp gene sequence (SEQ ID NO. 2), with over 87% homology. The first 299 bp showed over 97% homology, and was therefore selected as the region for primer and probe design. This gene was used as the target gene for a general detection method for Streptococcus suis. The final selected DNA sequence of the CHAP gene fragment is shown in SEQ ID NO. 1.

[0033] Selected segment (SEQ ID NO.1): ATGAAGAAAAAAATCTTGGCTACAATTATGTTAAGTACAGTCGTTCTATCTAATGCTAATTATGTAGCTGTGATTAGTGCGAATGATGTAGATAGTCAGATTGCAACAAAAAATCAACAGATTAGTGAGTTGACAGCACAACAAGCAGA AGCTCAACAACAAGTTGATGCTATTCAAGGACAAGTTGATGCAATTGTTAGTGAACAGGCGAAATTAACAGAAGAAAATACTCGTTTGGAAGCAGAATCGCAGACATTGGCGCCAGATATTGAGCGTTTGTCAGCTGATATTGTGTCACG Example 2 Primer and probe design 2.1 Materials 2.1.1 Bacterial strains and samples All Streptococcus suis strains used in the experiments were preserved by the Binzhou Institute of Animal Husbandry and Veterinary Medicine, Shandong Province. Clinical samples were collected from ABC pig farm / slaughterhouse and preserved by the Binzhou Institute of Animal Husbandry and Veterinary Medicine, Shandong Province.

[0034] 2.1.2 Main Reagents 2×Multiplex Fast probe qPCR premix kit (containing UDG), Beijing Kangrun Chengye Biotechnology Co., Ltd.; Yeast extract and tryptone, Thermo Fisher Scientific; Sodium chloride, Beijing Solarbio Science & Technology Co., Ltd.; Agar powder, Lanjeco Technology Co., Ltd.; Horse serum, Tianjin Kangyuan Biotechnology Co., Ltd.

[0035] 2.1.3 Main Instruments Fully automated medical PCR analysis system, Xi'an Tianlong Technology Co., Ltd.; Ultra-micro spectrophotometer, Hangzhou Haipei Instrument Co., Ltd.; Electrothermal constant temperature incubator, Shanghai Senxin Experimental Instrument Co., Ltd.; SW-CJ-2F double-person double-sided clean bench, Zhejiang Fuxia Medical Technology Co., Ltd.

[0036] 2.2 Methods 2.2.1 Primer and probe design Primers and probes for Streptococcus suis were designed using Beacon Designer 7 software based on the gene sequence of Streptococcus suis in GenBank (Table 1). Both primers and probes were synthesized by General Biotechnology (Anhui) Co., Ltd.

[0037] Table 1

[0038] Example 3 Optimization of PCR reaction system 3.1 Preparation of Streptococcus suis DNA standard template The preserved freeze-dried Streptococcus suis (SS) culture was inoculated onto LB liquid medium and cultured overnight. Genomic DNA of SS was extracted from the bacterial culture according to the instructions of the viral genomic DNA / RNA extraction kit, and its concentration and purity were determined using a microspectrophotometer. The diluted DNA was then used as a standard and stored at -20°C for later use.

[0039] 3.2 Optimization of reaction conditions for quantitative real-time PCR of Streptococcus suis Keeping the template concentration constant, the primer concentration (2.5~10 μmol / L) and probe concentration (1.25~5 μmol / L) were optimized using a matrix method. After establishing the optimal reaction system, the annealing temperature gradient (50~60℃) was set for further optimization to determine the optimal annealing temperature. The composition of the real-time PCR reaction system (20 μL) was as follows: 10 μL of 2×RealStar Fast probe qPCR premix, final primer concentration of 10 μmol / L, final probe concentration of 5 μmol / L, 2 μL of template, and ddH2O to a final volume of 20 μL. Reaction conditions: 95℃ for 3 min, 95℃ for 15 s, 55.5℃ for 10 s, 72℃ for 30 s, for 40 cycles. The optimal reaction conditions were determined based on the Ct value and fluorescence intensity as follows: With 3.17×10 7 Genomic DNA copies / μL SS was used as a template for real-time PCR amplification. The optimal system was determined by optimizing primer and probe concentrations as follows: upstream primer F (10 μmol / L) 1 μL, downstream primer R (10 μmol / L) 1 μL, probe P (5 μmol / L) 1 μL, template 2 μL, and ddH2O to a final volume of 20 μL. The optimized reaction conditions were: 95℃ for 3 min, 95℃ for 15 s, 55.5℃ for 10 s, 72℃ for 30 s, for 40 cycles.

[0040] 3.3 Establishing a standard curve for quantitative real-time PCR of Streptococcus suis Based on the gene sequence of Streptococcus suis 05ZYH33, it was inserted into the pUC18 cloning vector at a ratio of 1×10⁻⁶. 7 ~1×10 3 Using plasmid DNA copies / μL as a template, the DNA was amplified using a fully automated medical PCR analysis system, with each dilution repeated three times.

[0041] 1×10 7 SS genome copies / μL were serially diluted 10-fold (1×10^6 copies / μL). 7 ~1×10 3 The samples were diluted to an equal volume (copies / μL) and used as templates for quantitative real-time PCR amplification. The amplification curves of the experimental group (Figure 1) and the standard curve (Figure 2) were obtained. The linear equation for the genome copy number (x) and Ct value (y) was y = -3.46x + 48.566, and the linear correlation coefficient R was 1 / μL. 2 The Ct value was 0.994, and the amplification efficiency was 94.528%. A good linear relationship was observed between the Ct value and concentration of the amplified product. In contrast, no amplification curve was obtained from the control group, indicating that the primers and probes used in the control group had poor amplification effects. Therefore, the primers and probes from the experimental group were selected for subsequent experiments.

[0042] Example 4: Validation of the detection method for Streptococcus suis pathogen 4.1 Specificity test Positive samples of Streptococcus suis (types 1, 2, 7, and 9), Pasteurella multocida, Salmonella suis, Escherichia coli, Haemophilus parasuis, and Actinobacillus suis were used as templates for fluorescent PCR amplification under optimal reaction conditions and annealing temperatures.

[0043] The results are as follows Figure 3 As shown in Figure 3, the established quantitative real-time PCR method was used to detect nucleic acid samples of Streptococcus suis (types 1, 2, 7, and 9), Pasteurella multocida, Salmonella suis, Escherichia coli, Haemophilus parasuis, and Actinobacillus suis. The results (Figure 3) show that only Streptococcus suis showed a fluorescent signal, indicating a positive result; the detection of the other five pathogens' nucleic acids did not reach the threshold, resulting in negative results. This demonstrates that the established quantitative real-time PCR detection method has high specificity.

[0044] 4.2 Sensitivity Test With 1×10 7 ~1×10 0 Using copies / μLSS genomic DNA as a template, its sensitivity was tested using a fully automated medical PCR analysis system.

[0045] The results showed that the lowest detection concentration of real-time PCR was 100 copies / μL, and no amplification was observed in the negative control. The detection method in this experiment had high sensitivity (Figure 4).

[0046] 4.3 Repeatability Test Select 3.17×10 7 copies / μL, 3.17×10 6 copies / μL, 3.17×105 copies / μL, 3.17×10 4 Four dilutions, such as copies / μL, were used as positive templates for quantitative real-time PCR. Repeatability tests were performed and the variability was analyzed.

[0047] The results are as follows Figure 5 As shown in Table 2, the results of quantitative real-time PCR showed that the C values ​​within and between groups were both less than 1% (Table 2), indicating that the method has good repeatability.

[0048] Table 2 Results of repeatability test of real-time PCR

[0049] Example 5 Clinical Sample Testing The established quantitative real-time PCR detection method and the conventional PCR detection method in the literature were used to detect and analyze 59 clinical samples (derived from pig lungs).

[0050] The results showed that the positive rate of quantitative real-time PCR (88.14%) was higher than that of conventional PCR (79.66%), with a positive concordance rate of 90.38% (47 / 52) and a negative concordance rate of 58.33% (7 / 12), for a total concordance rate of 91.53% (54 / 59). The results indicate that 7 samples that were negative by conventional PCR were positive by quantitative real-time PCR, demonstrating that the sensitivity of our method is higher than that of conventional PCR (Table 3).

[0051] Table 3 Clinical test results

[0052] This study successfully established a TaqMan real-time quantitative PCR method for detecting Streptococcus suis. This method exhibits higher sensitivity than conventional PCR, with a limit of detection of 100 copies / μL. Furthermore, it demonstrates good specificity, amplifying only Streptococcus suis nucleic acid and showing no cross-reactivity with Pasteurella multocida, Salmonella suis, Escherichia coli, Haemophilus parasuis, and Actinobacillus suis, indicating good specificity. In repeatability experiments, the coefficient of variation was less than 1%, indicating good reproducibility. Using this method to detect 59 clinical samples, the results showed that compared to conventional PCR, this method has higher clinical sensitivity and is suitable for the clinical detection of Streptococcus suis.

[0053] The above description is merely an embodiment of the present invention, and the scope of protection of the present invention is not limited to these specific embodiments, but is determined by the claims of the present invention. For those skilled in the art, the present invention can have various modifications and variations. Any modifications, equivalent substitutions, improvements, etc., made within the technical concept and principle of the present invention should be included within the scope of protection of the present invention.

Claims

1. A biomarker for detecting Streptococcus suis pathogen, characterized in that, The biomarker sequence is as shown in SEQ ID NO.1 or has at least 95% homology with SEQ ID NO.

1.

2. The biomarker according to claim 1, characterized in that, The streptococcus suis includes at least one of type 1 (SS1), type 2 (SS2), type 4 (SS4), type 5 (SS5), type 7 (SS7), type 9 (SS9), type 10 (SS10), type 24 (SS4), and type 31 (SS31).

3. Primers or probes for detecting the biomarkers described in claim 1.

4. The primer or probe according to claim 3, characterized in that, The primers comprise the sequences shown in SEQ ID NO2-3; the probe comprises the sequence shown in SEQ ID NO4.

5. A reagent kit, characterized in that, The kit includes reagents for detecting the biomarkers of claim 1.

6. The reagent kit according to claim 5, characterized in that, The kit includes at least the primers or probes as described in claim 3 or 4.

7. A method for detecting Streptococcus suis pathogen, characterized in that, The method includes at least the step of performing PCR amplification of Streptococcus suis pathogen using the primers or probes of claim 3 or 4 or the kit of claim 5 or 6.

8. The method according to claim 7, characterized in that, The PCR amplification system is as follows: PCR reaction solution 10 μL, final primer concentration 10 μmol / L, final probe concentration 5 μmol / L, template 2 μL, ddH2O added to bring the total to 20 μL.

9. The method according to claim 7, characterized in that, The PCR amplification reaction conditions are as follows: 95℃ for 3 min, 95℃ for 15 s, 50~60℃ for 10 s, and 72℃ for 30 s.

10. The use of the biomarker of claim 1 or 2, or the primer or probe of claim 3 or 4, or the kit of claim 5 or 6, or the method of any one of claims 7-9 in the detection of Streptococcus suis pathogen.

Images