Glutamine transpeptidase mutants and uses thereof

By directing the evolution and efficient expression of gamma-glutamyl transpeptidase, the problem of its low activity under acidic conditions was solved, and the synthesis of γ-glutamyl peptide was achieved under acidic conditions with high efficiency, which is suitable for food processing.

CN121343952BActive Publication Date: 2026-05-08ANGEL YEAST CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511939141.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-22
Publication Date
2026-05-08
Estimated Expiration
2045-12-22

AI Technical Summary

Technical Problem

Existing gamma-glutamyl transferases exhibit low activity under acidic conditions, failing to meet the needs of food processing, and also have shortcomings in substrate specificity and thermal stability.

Method used

By directing the evolution of wild-type gamma-glutamyl transpeptidase, mutants were designed, including mutations at specific amino acid sites such as H87Y, Q89R, D190S, T193K, E197R, M323I, T412Y, Q430E, E548T, and S552R, to improve its activity under acidic conditions. The enzyme was then efficiently expressed in Bacillus subtilis using the pBE-SDNA plasmid and the aprE promoter.

Benefits of technology

This study achieved efficient catalysis of γ-glutamyl peptide synthesis by gamma-glutamyl transpeptidase under acidic conditions, improving enzyme activity and yield. It is suitable for food processing and meets the acidic conditions required for food processing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121343952B_ABST
    Figure CN121343952B_ABST
Patent Text Reader

Abstract

The application provides a glutamyl transpeptidase mutant and application thereof. The glutamyl transpeptidase mutant comprises: (a) a protein which is mutated based on wild-type glutamyl transpeptidase shown in SEQ ID NO: 1, and the mutation comprises mutation at any one or more of the following positions: H87, Q89, D190, T193, E197, M323, T412, Q430, E548 or S552; or (b) a protein which has more than 70% homology with the amino acid sequence defined in (a) and has glutamyl transpeptidase activity. The application can solve the problem of low activity of glutamyl transpeptidase under acidic conditions in the prior art and is suitable for the technical field of microorganisms.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and more specifically, to a glutamyl transpeptidase mutant and its applications. Background Technology

[0002] Gamma-glutamyl transpeptidase (GGT) is a bifunctional enzyme widely found in mammals and bacteria. It catalyzes the transfer of gamma-glutamyl molecules from gamma-glutamyl compounds to other amino acids, short peptides, or water molecules (transpeptidation). This enzyme has broad application prospects in food processing, where it can be used to catalyze the synthesis of amino acid derivatives and drug precursors, such as theanine and glutathione, and also to improve the flavor of certain bitter amino acids.

[0003] However, the application of gamma-glutamyl transferase (GGT) in the food industry still faces many challenges. Since most food processing occurs under acidic conditions, and wild-type GGT exhibits lower activity under acidic conditions, its effectiveness is limited. Furthermore, existing GGTs fail to meet the requirements of various food processing substrates and processes in terms of substrate specificity and thermostability. These problems severely restrict the application scope of GGT in food processing and affect its potential value in improving food quality and flavor. Summary of the Invention

[0004] The main objective of this invention is to provide a glutamyl transpeptidase mutant to solve the problem of low activity of glutamyl transpeptidase under acidic conditions in the prior art.

[0005] To achieve the above objectives, according to a first aspect of the present invention, a glutamyl transpeptidase mutant is provided, comprising: (a) a protein mutated based on the wild-type glutamyl transpeptidase shown in SEQ ID NO: 1, wherein the mutation includes mutations occurring at any one or more of the following sites: H87, Q89, D190, T193, E197, M323, T412, Q430, E548, or S552; or (b) a protein having more than 70% homology to the amino acid sequence defined in (a) and having glutamyl transpeptidase activity.

[0006] Further, in (a) above, the above mutation is selected from any one or more of the following mutations: H87Y, Q89R, D190S, T193K, E197R, M323I, T412Y, Q430E, E548T or S552R, wherein the letter before the number represents the original amino acid and the letter after the number represents the mutated amino acid.

[0007] Furthermore, the above mutations include any one of the following amino acid mutations: H87Y, Q89R, D190S, T193K, E197R, M323I, T412Y, Q430E, E548T, S552R, H87Y+E548T, Q89R+T193K, Q430E+S552R, H87Y+T193K+E548T, Q89R+T193K+Q430E, H87Y+Q89R+T193K+E548T, H87Y+Q89R+T193K+Q430E+E548T, H87Y+Q89R+T193K+Q430E+E548T+S552R.

[0008] To achieve the above objectives, according to a second aspect of the present invention, a DNA molecule is provided that encodes the above-described gamma-glutamyl transpeptidase mutant.

[0009] To achieve the above objectives, according to a third aspect of the present invention, a recombinant plasmid is provided, the recombinant plasmid containing the aforementioned DNA molecule.

[0010] Furthermore, the aforementioned recombinant plasmids include the pBE-SDNA plasmid.

[0011] Furthermore, the sequence of the above-mentioned pBE-SDNA plasmid includes the nucleic acid sequence shown in SEQ ID NO: 2.

[0012] Furthermore, the recombinant plasmids mentioned above include the apre promoter.

[0013] Furthermore, the sequence of apre includes the nucleic acid sequence shown in SEQ ID NO: 2.

[0014] To achieve the above objectives, according to a fourth aspect of the present invention, a host cell is provided, wherein the host cell contains the aforementioned DNA molecule or the aforementioned recombinant plasmid.

[0015] Furthermore, the host cells mentioned above include prokaryotic cells or eukaryotic cells.

[0016] Furthermore, the aforementioned prokaryotic cells include Escherichia coli or Bacillus subtilis.

[0017] To achieve the above objectives, according to a fifth aspect of the present invention, a method for preparing a gamma-glutamyl transferase mutant is provided, the method comprising: culturing the host cells described above, and obtaining the gamma-glutamyl transferase mutant described above.

[0018] To achieve the above objective, according to a sixth aspect of the present invention, a method for preparing γ-glutamyl peptide is provided, the method comprising: using the above-mentioned gamma-glutamyl transpeptidase mutant to catalyze the reaction of γ-glutamine with an amino acid substrate to obtain the above-mentioned γ-glutamyl peptide, wherein the amino acid substrate includes a polypeptide or an amino acid.

[0019] Furthermore, the pH of the reaction system in the above preparation method is 4.5-10.

[0020] By applying the technical solution of this invention and utilizing the above-mentioned gamma-glutamyl transferase mutant, the activity of wild-type gamma-glutamyl transferase under acidic conditions can be improved, thereby preparing γ-glutamyl peptide. Compared with the wild-type enzyme, the above-mentioned gamma-glutamyl transferase mutant exhibits better activity under acidic conditions, resulting in higher efficiency in the preparation of γ-glutamyl peptide. It is suitable for acidic conditions in food processing and can efficiently prepare the target product γ-glutamyl peptide. Attached Figure Description

[0021] The accompanying drawings, which form part of this application, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:

[0022] Figure 1 A schematic diagram of the screening results of recombinant strains according to Example 3 of the present invention is shown.

[0023] Figure 2 The graph shows the relative enzyme activities of the mutant glutamyl transpeptidase and the wild-type glutamyl transpeptidase according to Example 4 of the present invention at pH=5.0. Detailed Implementation

[0024] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to the embodiments.

[0025] As mentioned in the background section, wild-type gamma-glutamyl transferase exhibits low activity under acidic conditions, making it difficult to meet the requirements of various food processing substrates and processes. Therefore, in this application, the inventors attempted to develop a gamma-glutamyl transferase mutant with higher enzyme activity under acidic conditions. Through directed evolution, a gamma-glutamyl transferase mutant was obtained, which can efficiently prepare the target product γ-glutamyl peptide. Based on this, a series of protection schemes for this application are proposed.

[0026] In a first typical embodiment of this application, a glutamyl transpeptidase mutant is provided, comprising: (a) a protein mutated based on the wild-type glutamyl transpeptidase shown in SEQ ID NO: 1, wherein the mutation includes mutations occurring at any one or more of the following sites: H87, Q89, D190, T193, E197, M323, T412, Q430, E548, or S552; or (b) a protein having more than 70% homology to the amino acid sequence defined in (a) and having glutamyl transpeptidase activity.

[0027] SEQ ID NO: 1:

[0028] .

[0029] In a preferred embodiment, in (a) above, the mutation is selected from any one or more of the following mutations: H87Y, Q89R, D190S, T193K, E197R, M323I, T412Y, Q430E, E548T or S552R, wherein the letter before the number represents the original amino acid and the letter after the number represents the mutated amino acid.

[0030] By performing any one or more of the above mutations on the wild-type gamma-glutamyl transferase, gamma-glutamyl transferase mutants can be obtained. These mutants enhance the activity of the wild-type gamma-glutamyl transferase under acidic conditions and enable the preparation of γ-glutamyl peptides. Acidic conditions include, but are not limited to, pH < 7 and pH ≥ 4.5 (including, but not limited to, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, or 7.0). Furthermore, the activity of the above-mentioned gamma-glutamyl transferase mutants under neutral and alkaline conditions is not affected by the mutation, and they also exhibit normal enzyme activity under reaction conditions of pH 7-10 (including, but not limited to, 7, 7.5, 8, 8.5, 9, 9.5, and 10).

[0031] In a preferred embodiment, the above mutation includes any one of the following amino acid mutations: H87Y, Q89R, D190S, T193K, E197R, M323I, T412Y, Q430E, E548T, S552R, H87Y+E548T, Q89R+T193K, Q430E+S552R, H87Y+T193K+E548T, Q89R+T193K+Q430E, H87Y+Q89R+T193K+E548T, H87Y+Q89R+T193K+Q430E+E548T, H87Y+Q89R+T193K+Q430E+E548T+S552R.

[0032] In this application, "+" means "and", for example, "H87Y+E548T" means that the wild-type gamma-glutamyl transpeptidase shown in SEQ ID NO: 1 is simultaneously modified by H87Y mutation and E548T mutation.

[0033] In a preferred embodiment, the gamma-glutamyl transferase mutant comprises a protein having 80% or more, 85% or more, more preferably 95% or more, and even more preferably 99% or more homology with the amino acid sequence defined in (a) and having gamma-glutamyl transferase activity.

[0034] All the above-mentioned amino acid mutations were experimentally investigated in the embodiments of this application. Compared with the parent protein having the amino acid sequence shown in SEQ ID NO: 1, they all improved the activity under acidic conditions and the ability to prepare γ-glutamyl peptide. All the above mutation sites were mutations performed around the active amino acid site. This type of mutation can improve the binding ability of the mutant to the substrate and / or its catalytic activity. Mutations far from the active site have less impact on the enzyme's catalytic activity; therefore, proteins with 80% or more homology to the above-mentioned amino acid sequence and the same catalytic activity can be obtained.

[0035] In this specification, homology refers to the "homology" between amino acid sequences, that is, the total ratio of the same type of amino acid residues in the amino acid sequence. The homology of amino acid sequences can be determined using alignment programs such as BLAST (Basic Local Alignment Search Tool) and FASTA.

[0036] Proteins with 70%, 75%, 80%, 85%, 90%, 95%, or more than 99% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, or even more than 99.9%) homology and the same function have an active site, active pocket, active mechanism, protein structure, etc. that are highly likely to be the same as the protein provided by sequence (a), and are homologous proteins obtained through amino acid mutation.

[0037] As used in this article, the amino acid residues are abbreviated as follows: aspartic acid (Asp; D), glutamic acid (Glu; E), glutamine (Gln; Q), histidine (His; H), methionine (Met; M), serine (Ser; S), and threonine (Thr; T).

[0038] Substitution and replacement rules generally apply to amino acids with similar properties; the effects of substituting one another are similar. For example, conserved amino acid substitutions can occur in the aforementioned homologous proteins. "Conserved amino acid substitutions" include, but are not limited to:

[0039] The hydrophobic amino acid (Met) is replaced by other hydrophobic amino acids;

[0040] The hydrophobic amino acid with a large side chain (Tyr) was replaced by other hydrophobic amino acids with large side chains;

[0041] The positively charged amino acid (His) on the side chain is replaced by other positively charged amino acids on the side chain;

[0042] Amino acids with polar, uncharged side chains (Ser, Thr, Gln) are replaced by other amino acids with polar, uncharged side chains.

[0043] Those skilled in the art can also perform conservative substitutions of amino acids based on amino acid substitution rules well known to them, such as the "blosum62 score matrix" in the prior art.

[0044] The "AlphaFold2" used in this application is a publicly available artificial intelligence model capable of predicting the conformation of protein complexes. Its predictions of protein three-dimensional structures are very close to those observed in real-world experiments using equipment such as cryo-electron microscopy. This allows for the acquisition of relatively realistic protein structures, thereby guiding the investigation of protein structure and activity.

[0045] In a second typical embodiment of this application, a DNA molecule is provided that encodes the above-mentioned gamma-glutamyl transpeptidase mutant.

[0046] In a third typical embodiment of this application, a recombinant plasmid is provided, which contains the aforementioned DNA molecule. The DNA encodes the aforementioned gamma-glutamyl transferase mutant and can be linked to the recombinant plasmid to form a circular DNA. Both the DNA and the recombinant plasmid can be transcribed and translated under the action of RNA polymerase, ribosomes, tRNA, etc., to obtain the aforementioned gamma-glutamyl transferase mutant.

[0047] In a preferred embodiment, the recombinant plasmid includes the pBE-SDNA plasmid.

[0048] In a preferred embodiment, the recombinant plasmid includes the apre promoter.

[0049] The inventors discovered that by using, but not limited to, the pBE-SDNA plasmid shown in SEQ ID NO: 2 and the apre promoter combination shown in SEQ ID NO: 3, they achieved efficient expression of transpeptidase mutants in Bacillus subtilis, thereby increasing enzyme yield and activity.

[0050] SEQ ID NO: 2:

[0051]

[0052] SEQ ID NO: 3:

[0053] gttcttttctgtatgaaaaatagttatttcgagtctctacggaaatagcgagagatgatatacctaaatagagataaaatcatctcaaaaaatgggtctactaaaatattattccatctattacaataaattcacagaatagtcttttaagtaagtctactctgaacttaagcaaaaggagaggg.

[0054] In a fourth typical embodiment of this application, a host cell is provided, which contains the aforementioned DNA molecule or the aforementioned recombinant plasmid.

[0055] Using the aforementioned host cells, recombinant plasmids can be replicated within the host cells, and the DNA molecules carried on the recombinant plasmids can be transcribed and translated to obtain a large number of gamma-glutamyl transferase mutants. Using existing technologies, gamma-glutamyl transferase mutants can be obtained by disrupting and purifying the host cells, followed by crude enzyme catalysis or other methods, and then used for subsequent catalysis of substrate nucleosides. The host cells used are not of plant origin.

[0056] In a preferred embodiment, the host cell includes a prokaryotic cell or a eukaryotic cell.

[0057] In a preferred embodiment, the prokaryotic cells mentioned above include Escherichia coli or Bacillus subtilis.

[0058] In a fifth typical embodiment of this application, a method for preparing a gamma-glutamyl transferase mutant is provided. The preparation method includes: culturing the host cells and obtaining the gamma-glutamyl transferase mutant.

[0059] The methods for preparing the above-mentioned gamma-glutamyl transferase mutants include, but are not limited to: mutating wild-type gamma-glutamyl transferase using the aforementioned host cells to prepare gamma-glutamyl transferase mutants. Further, the prepared gamma-glutamyl transferase mutants are used for the production of γ-glutamyl peptides.

[0060] In a sixth typical embodiment of this application, a method for preparing γ-glutamyl peptide is provided. The method includes: using the above-mentioned glutamyl transpeptidase mutant to catalyze the reaction of γ-glutamine with an amino acid substrate to obtain the above-mentioned γ-glutamyl peptide, wherein the amino acid substrate includes a polypeptide or an amino acid.

[0061] The aforementioned polypeptides include, but are not limited to, oligopeptides composed of 2-50 amino acids (including but not limited to 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50) linked by peptide bonds. These amino acids include, but are not limited to, natural or non-natural amino acids with the general formula H2N-CHR-COOH. The inventors have discovered that the aforementioned gamma-glutamyl transferase mutant can be well applied in the preparation of γ-glutamyl peptide. The gamma-glutamyl transferase mutant can efficiently catalyze the reaction of γ-glutamine with amino acid substrates to prepare the target product γ-glutamyl peptide.

[0062] In a preferred embodiment, the pH of the reaction system in the above preparation method is 4.5-10.

[0063] The inventors discovered that in the above-mentioned method for preparing γ-glutamyl peptide, when the pH of the reaction system is between 4.5 and 10 (including but not limited to 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10), the yield of γ-glutamyl peptide prepared using the above-mentioned gamma-glutamyl transpeptidase mutant is higher, and the efficiency of obtaining the target product γ-glutamyl peptide is also higher. Acidic conditions include, but are not limited to, pH < 7 and pH ≥ 4.5 (including but not limited to 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, or 7.0). Furthermore, the activity of the above-mentioned gamma-glutamyl transpeptidase mutants under neutral and alkaline conditions is not affected by the mutation, and they can also have normal enzyme activity under reaction conditions of pH 7-10 (including but not limited to 7, 7.5, 8, 8.5, 9, 9.5, 10).

[0064] The beneficial effects of this application will be explained in more detail below with reference to specific embodiments.

[0065] Example 1: Structural simulation and molecular docking: Precisely locating key mutation sites

[0066] Principle and Purpose: The catalytic activity of an enzyme depends on the precise conformation of its active site in its three-dimensional structure. Acidic conditions (low pH) can alter the charge state of amino acid residues through protonation, leading to fold instability of the active site. Through structural simulation and molecular docking, the conformational defects of wild-type gamma-glutamyl transpeptidase under acidic conditions can be resolved at the atomic level, identifying key sites related to the stability of the active site and substrate binding ability.

[0067] Specific operations:

[0068] The three-dimensional structure of wild-type gamma-glutamyl transpeptidase was predicted using AlphaFold2; the conformational changes of the enzyme under an acidic environment (pH=5) were simulated by molecular dynamics simulation (GROMACS software), and the phenomena such as unfolding and breaking of key hydrogen bonds in the active site (such as the catalytic triplet and substrate binding pocket) were observed.

[0069] The binding energy between the substrate (L-glutamyl-p-nitroaniline, i.e., GPNA) and the active site was analyzed using molecular docking (AutoDock Vina) to screen out amino acid residues that affect the binding efficiency (such as sites that form hydrogen bonds or hydrophobic interactions with the substrate).

[0070] Results: Ten sites, including H87, Q89, and D190, were identified as "important sites for interaction with the active site." The amino acid residues at these sites are prone to charge imbalance or conformational fluctuations under acidic conditions, which are key reasons for decreased activity. The ten selected sites were modified by site-directed mutagenesis, employing three strategies: charge adjustment, enhanced hydrophobic interaction, and hydrogen bond network optimization. This allowed the mutants to maintain the integrity of the active site at low pH, thereby improving catalytic efficiency. Ten single-point mutations were ultimately designed, including H87Y, Q89R, D190S, T193K, E197R, M323I, T412Y, Q430E, E548T, and S552R. Based on the wild-type gamma-glutamyl transferase gene sequence and the ten mutation sites, overlapping extension PCR primers containing the mutant sequences were designed, as shown in Table 1.

[0071] Table 1

[0072]

[0073] Example 2: Construction of plasmid vectors

[0074] Vector selection (pBE-SDNA plasmid): pBE-SDNA is a commonly used shuttle expression vector for Bacillus subtilis, with the following advantages: ① It contains the Bacillus subtilis origin of replication (such as pUB110), which can stably replicate in the host; ② It carries antibiotic resistance genes, which facilitates subsequent screening; ③ It has flexible multiple cloning sites, which are suitable for inserting foreign genes.

[0075] Promoter selection (aprE promoter): aprE is a natural alkaline protease gene promoter of Bacillus subtilis, belonging to the "mid-to-late stage strong promoter" category. It efficiently initiates transcription from the late logarithmic growth phase to the stationary phase, matching the secretion and expression sequence of gamma-glutamyl transferase (avoiding premature expression that would burden host growth). Its high initiation efficiency can significantly increase the expression level of mutants.

[0076] Signal peptide selection (cotC signal peptide): cotC is the signal peptide of Bacillus subtilis spore coat protein C, which has two main functions: ① guiding recombinant gamma-glutamyl transferase to the extracellular space via the Sec secretion pathway (avoiding folding errors caused by intracellular accumulation); ② the signal peptide is cleaved by proteases during secretion, releasing the mature active enzyme. This characteristic simplifies subsequent purification steps (direct extraction from fermentation broth supernatant) and reduces the degradation of the target enzyme by intracellular proteases.

[0077] Target gene acquisition: Primers were designed based on the mutated transpeptidase gene sequence, and the target fragment (containing restriction sites and matching the pBE-SDNA vector) was amplified by PCR.

[0078] Vector linearization: pBE-SDNA plasmid was double-digested with the same restriction enzyme, and the linearized vector fragment was recovered by agarose gel electrophoresis.

[0079] Ligation reaction: The target gene and the linearized pBE-SDNA vector were ligated overnight at 16°C using T4 DNA ligase (molar ratio of approximately 3:1 to improve ligation efficiency).

[0080] Transformation and screening: Take 100 μL of Top10 competent cells, add 5-10 μL of ligation product, and incubate on ice for 30 minutes; heat shock at 42℃ for 90 seconds, then immediately incubate on ice for 2 minutes; add 800 μL of LB medium, and revive at 37℃ and 200 rpm for 1 hour; take 100 μL of the revived bacterial solution and spread it on LB solid plates containing ampicillin (final concentration 50 μg / mL), and incubate at 37℃ for 12-16 hours; pick a single colony and inoculate it on LB liquid medium containing ampicillin (final concentration 50 μg / mL), and incubate at 37℃ with shaking until turbidity.

[0081] Colony PCR initial screening: Using a single colony as a template, amplification is performed using primers specific to the target gene, and electrophoresis is used to detect whether a band of the target fragment size is present.

[0082] Sequencing verification: Recombinant plasmids were extracted using a plasmid extraction kit, and positive clones were sent for sequencing to confirm that the target gene sequence was correct and that the vector backbone had no reverse linkages or frameshift mutations.

[0083] Example 3: Construction and Screening of Recombinant Strains

[0084] The recombinant pBE-SDNA plasmid was transformed into Bacillus subtilis SCK6, and positive strains were obtained by screening with kanamycin. Bacillus subtilis can achieve the introduction of exogenous plasmids through electroporation.

[0085] An expression vector containing a mutant transpeptidase gene was constructed: the apre promoter, cot C signal peptide sequence, target gene sequence, and vector sequence were assembled and ligated, transformed into *E. coli* top10, and screened to obtain positive transformants. The transformants were cultured, and plasmids were extracted to obtain recombinant plasmids. The recombinant plasmids were transformed into *Bacillus subtilis* SCK6 competent cells, and recombinant strains were obtained through antibiotic resistance plate screening. The results of the recombinant strain screening are shown below. Figure 1 As shown.

[0086] Example 4: Fermentation verification and enzyme activity assay

[0087] The obtained recombinant strain was cultured in TB medium at 30-37℃ with shaking for 48 h. The supernatant of the fermentation broth was extracted, and the transpeptidase activity was measured. Recombinant gamma-glutamyl transpeptidase was extracted from the supernatant of the fermentation broth, and the transpeptidase activity under acidic conditions was measured by an indirect method. Specifically, L-glutamyl-p-nitroaniline and diglycinate were used as substrates, and the generation rate of nitroaniline at 405 nm was detected as the total activity. L-glutamyl-p-nitroaniline alone was used as substrate, and the generation rate of nitroaniline at 405 nm was detected as the hydrolysis activity. Transpeptidase activity = total activity - hydrolysis activity. Experimental results showed that the mutant H87Y+Q89R+T193K+Q430E+E548T+S552R exhibited a transpeptidase activity of 5580 U / mL at pH 5.0, while the wild-type gamma-glutamyl transferase showed an activity of 1886 U / mL. The mutant activity was approximately three times higher than the wild-type, demonstrating its excellent acid tolerance. The relative enzyme activities of the mutant and wild-type gamma-glutamyl transferase at pH 5.0 are shown below. Figure 2 As shown in Table 2, the transpeptidation activities of mutant gamma-glutamyl transferase and wild-type gamma-glutamyl transferase at pH 5.0 are as follows.

[0088] Table 2

[0089]

[0090] As can be seen from the above description, the embodiments of the present invention achieve the following technical effects: By optimizing the structure of gamma-glutamyl transpeptidase through molecular modification, the activity of the mutant under acidic conditions is significantly improved, overcoming the problem of low activity of the wild-type enzyme under acidic conditions and expanding its application range in the food processing field. The mutant of the present invention can more efficiently transfer free peptides or amino acids to γ-glutamine through transpeptidation to form γ-glutamyl peptides, significantly improving transpeptidation activity and meeting the needs of different food processing conditions. Furthermore, by using the combination of pBE-SDNA plasmid and apre promoter, the present invention achieves efficient expression of the transpeptidase mutant in Bacillus subtilis, improving enzyme yield and activity. The mutant of the present invention has a strong flavor, effectively improving the taste and flavor of food, providing a new technical solution for the food industry. Finally, the molecular modification method used in the present invention is simple, feasible, and easy to operate, which is conducive to industrial production and can quickly screen mutants with excellent performance.

[0091] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A gamma-glutamyl transpeptidase mutant, characterized in that, The gamma-glutamyl transpeptidase mutant is: A protein mutated based on the wild-type gamma-glutamyl transpeptidase shown in SEQ ID NO: 1, wherein the mutation is any one of the following amino acid mutations: H87Y, H87Y+E548T, H87Y+T193K+E548T, H87Y+Q89R+T193K+E548T, H87Y+Q89R+T193K+Q430E+E548T or H87Y+Q89R+T193K+Q430E+E548T+S552R; where the letter before the number represents the original amino acid, and the letter after the number represents the mutated amino acid.

2. A DNA molecule, characterized in that, The DNA molecule encodes the glutamyl transpeptidase mutant of claim 1.

3. A recombinant plasmid, characterized in that, The recombinant plasmid contains the DNA molecule as described in claim 2.

4. The recombinant plasmid according to claim 3, characterized in that, The recombinant plasmid includes the pBE-SDNA plasmid.

5. The recombinant plasmid according to claim 3 or 4, characterized in that, The recombinant plasmid includes the apre promoter.

6. A host cell, characterized in that, The host cell contains the DNA molecule of claim 2 or the recombinant plasmid of any one of claims 3 to 5.

7. The host cell according to claim 6, characterized in that, The host cells include prokaryotic cells or eukaryotic cells.

8. The host cell according to claim 7, characterized in that, The prokaryotic cells include Escherichia coli or Bacillus subtilis.

9. A method for preparing a gamma-glutamyl transpeptidase mutant, characterized in that, The preparation method includes: culturing the host cells according to any one of claims 6 to 8, and obtaining the gamma-glutamyl transpeptidase mutant.

10. A method for preparing γ-glutamyl peptide, characterized in that, The preparation method includes: using the glutamyl transpeptidase mutant of claim 1 to catalyze the reaction of γ-glutamine with an amino acid substrate to obtain the γ-glutamyl peptide, wherein the amino acid substrate includes a polypeptide or an amino acid.

11. The preparation method according to claim 10, characterized in that, The pH of the reaction system in the preparation method is 4.5-10.

Citation Information

Patent Citations

  • Mutant gamma-glutamyltransferase, and a method for producing gamma-glutamylvalylglycine or a salt thereof

    US20140212920A1

  • Microorganism that produces useful substance and method for producing useful substance

    US20230304061A1