Recombinant corynebacterium glutamicum capable of producing caffeic acid and construction method and application of recombinant corynebacterium glutamicum

Abstract

The invention relates to the technical field of construction of recombinant bacteria, in particular to recombinant corynebacterium glutamicum for producing caffeic acid as well as a construction method and application of the recombinant corynebacterium glutamicum. According to the invention, a caffeic acid synthesis pathway is constructed in corynebacterium glutamicum ATCC 13032, competitive metabolic pathway related genes are knocked out, and key genes of the caffeic acid synthesis pathway are overexpressed through promoter engineering and an RBS optimization integration strategy, so that plasmid-free recombinant corynebacterium glutamicum is constructed, and the cell metabolism flux is guided to the accumulation direction of a target product; therefore, the yield of caffeic acid is obviously improved.

Description

Technical Field

[0001] This invention relates to the field of recombinant bacterial construction technology, and particularly to a recombinant Corynebacterium glutamicum that produces caffeic acid, its construction method, and its application. Background Technology

[0002] Caffeic acid is a natural phenolic acid compound widely found in traditional Chinese medicinal plants. It possesses various biological activities, including antioxidant and antiviral properties, and has broad application potential in the food, pharmaceutical, and cosmetic industries, making it of significant economic value. As a natural antioxidant, caffeic acid effectively prevents oxidative rancidity in oily foods, playing a crucial role in food preservation. In clinical medicine, caffeic acid tablets are widely used to promote hematopoiesis and stop bleeding. As an important precursor to plant aromatic chemicals, caffeic acid can be converted into various bioactive substances such as rosmarinic acid and chlorogenic acid. It can also be used to synthesize flavonoids like sennaol and brucellin, further expanding its application in the synthesis of functional compounds. With the improvement of people's living standards, the demand for caffeic acid is increasing year by year, demonstrating its significant economic value and broad market prospects.

[0003] Currently, caffeic acid can be obtained through plant extraction, chemical synthesis, and biosynthesis. Biosynthesis, being more environmentally friendly and with milder reaction conditions, is gradually becoming the mainstream method. There are reports of de novo synthesis of caffeic acid using *E. coli* and *Saccharomyces cerevisiae*, but the yields are low and cannot meet the needs of large-scale industrial production.

[0004] To better address these challenges and meet the growing market demand for caffeic acid, constructing microbial factories for de novo synthesis of caffeic acid has become a hot research topic. Constructing high-yield caffeic acid chassis microbial cell factories has become an urgent problem to be solved. Summary of the Invention

[0005] In view of the shortcomings of the prior art, the purpose of this invention is to provide a recombinant Corynebacterium glutamicum that produces caffeic acid, its construction method and application, with the aim of increasing the caffeic acid yield of the recombinant Corynebacterium glutamicum.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: A method for constructing a recombinant Corynebacterium glutamicum that produces caffeic acid, comprising the following steps: The tyrosine ammonia lyase gene TAL from Flavobacterium hannulatum and the 4-hydroxyphenylacetic acid-3-hydroxylase gene hpaBC from Escherichia coli were introduced into Corynebacterium glutamicum ATCC 13032 to construct a caffeic acid synthesis pathway and obtain the first recombinant Corynebacterium glutamicum, denoted as K1. Based on the first recombinant Corynebacterium glutamicum, the key genes pheA and trpE2 of other aromatic amino acid synthesis pathways, as well as the key gene phdA of the degradation pathway of coumaric acid by caffeic acid precursors, were knocked out to regulate competitive metabolic pathways, resulting in the second recombinant Corynebacterium glutamicum, denoted as K2.

[0007] The method for constructing the recombinant caffeic acid-producing Corynebacterium glutamicum further includes the step of: based on the second recombinant Corynebacterium glutamicum, integrating the TAL and hpaBC genes into the genome through promoter engineering and RBS optimization integration strategy to construct a plasmid-free engineered bacterium, thereby obtaining the third recombinant Corynebacterium glutamicum, denoted as K3.

[0008] The method for constructing the recombinant caffeic acid-producing Corynebacterium glutamicum further includes the step of: based on the third recombinant Corynebacterium glutamicum, integrating the rpe and hpaC genes into the genome through promoter engineering and RBS optimization integration strategy to obtain the fourth recombinant Corynebacterium glutamicum, denoted as K4.

[0009] The method for constructing the recombinant Corynebacterium glutamicum that produces caffeic acid, wherein the TAL gene is obtained by expressing the expression plasmid pEC-XK99E, and the hpaBC gene is obtained by expressing the expression plasmid pXMJ19.

[0010] The method for constructing the recombinant Corynebacterium glutamicum that produces caffeic acid, wherein the pheA gene, trpE2 gene, and phdA gene are obtained by knocking out the Corynebacterium glutamicum suicide plasmid pSR18.

[0011] A caffeic acid-producing recombinant Corynebacterium glutamicum, wherein it is constructed using the method for constructing caffeic acid-producing recombinant Corynebacterium glutamicum according to the present invention.

[0012] Application of a recombinant Corynebacterium glutamicum that produces caffeic acid, wherein the recombinant Corynebacterium glutamicum that produces caffeic acid described in this invention is used for fermentation to produce caffeic acid.

[0013] The application, wherein the steps include: The recombinant Corynebacterium glutamicum was activated and cultured on LB plates containing 25 μg / mL kanamycin and 12.5 μg / mL chloramphenicol for 24 h. The bacteria on LB plates were inoculated into a 250ml Erlenmeyer flask containing 20ml of seed culture medium and cultured for 14h at 32℃ and 250rpm on a shaker. The seed culture medium consisted of: 25g / L glucose, 17.5g / L corn steep liquor powder, 0.5g / L MgSO4, 5g / L (NH4)2SO4, 1g / L KH2PO4, 2g / L urea, and sodium hydroxide to adjust the pH to 6.8. The recombinant Corynebacterium glutamicum was cultured with 25μg / mL kanamycin and 12.5μg / mL chloramphenicol.

[0014] The seed culture solution was inoculated at a rate of 10% into a 250ml Erlenmeyer flask containing 20ml of fermentation medium. The flask was cultured at 32℃ and 250rpm for 72h. The fermentation medium consisted of: 100g / L glucose, 6g / L corn steep liquor powder, 0.5g / L MgSO4, 25g / L (NH4)2SO4, 1g / L KH2PO4, 2g / L sodium citrate, and 0.4g / flask of CaCO3, with a pH of 7.0. The recombinant Corynebacterium glutamicum was cultured with 25μg / mL kanamycin and 12.5μg / mL chloramphenicol.

[0015] Beneficial Effects: This invention achieves a leapfrog increase in caffeic acid production from zero to high levels through gradual modification of Corynebacterium glutamicum. The original strain ATCC 13032 could not synthesize caffeic acid. The first recombinant Corynebacterium glutamicum K1, constructed by introducing the TAL and hpaBC genes, achieved caffeic acid synthesis for the first time, with a yield of 15.41 mg / L. The second recombinant Corynebacterium glutamicum K2, with the pheA, trpE2, and phdA genes knocked out, increased the yield to 26.29 mg / L, an increase of 70.6%. After constructing the plasmid-free engineered strain K3, the yield further increased to 169.35 mg / L, an increase of 544.1% compared to strain K2. Finally, the fourth recombinant Corynebacterium glutamicum K4, modified through cofactor engineering, achieved a yield of 225.65 mg / L, an increase of 1364.3% compared to strain K2. After adding 1 g / L of p-coumaric acid to the fermentation medium, the caffeic acid yield of the fourth recombinant Corynebacterium glutamicum K4 soared to 922.77 mg / L, an increase of 309.0% compared to before the addition. This result demonstrates that precursor supplementation can further overcome the metabolic flux limitations of the strain itself, providing a possibility for optimizing yield in industrial production by controlling precursor concentration. The fourth recombinant Corynebacterium glutamicum K4 in this application showed a nearly 10-fold increase in yield after precursor addition, completely solving the problem of low yield and inability to meet industrial demands in traditional microbial fermentation methods. Attached Figure Description

[0016] Figure 1 Electrophoresis image of TAL gene PCR amplification products.

[0017] Figure 2 Electrophoresis diagram of hpaB gene PCR amplification products.

[0018] Figure 3 Electrophoresis diagram of the hpaC gene PCR amplification product.

[0019] Figure 4 Electrophoresis image of hpaBC gene fusion PCR product.

[0020] Figure 5 This is an electrophoresis image of the first recombinant Corynebacterium glutamicum PCR verification.

[0021] Figure 6 Electrophoresis image used to verify PCR for plasmid knockout.

[0022] Figure 7 Electrophoresis diagram to verify trpE2 gene knockout.

[0023] Figure 8 Electrophoresis image used for PCR validation of genome integration plasmids.

[0024] Figure 9 Electrophoresis diagram to verify TAL gene integration.

[0025] Figure 10 Figure showing the caffeic acid yield of ATCC 13032 and recombinant strain K1-K4 during shake-flask fermentation.

[0026] Figure 11 Figure showing the caffeic acid yield of recombinant strains K3 and K4 after shake-flask fermentation with 1 g / L p-coumaric acid added to the fermentation medium. Detailed Implementation

[0027] This invention provides a recombinant Corynebacterium glutamicum that produces caffeic acid, its construction method, and its applications. To make the objectives, technical solutions, and effects of this invention clearer and more explicit, the invention is further described in detail below with reference to the accompanying drawings and examples. It should be understood that the specific embodiments described herein are only for explaining the invention and are not intended to limit the invention.

[0028] In the description of this invention, it should be understood that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of this invention, unless otherwise stated, "multiple" means two or more.

[0029] This invention provides a method for constructing a recombinant Corynebacterium glutamicum that produces caffeic acid, comprising the following steps: S10. The tyrosine ammonia lyase gene TAL from Flavobacterium hannulatum and the 4-hydroxyphenylacetic acid-3-hydroxylase gene hpaBC from Escherichia coli were introduced into Corynebacterium glutamicum ATCC 13032 to construct a caffeic acid synthesis pathway and obtain the first recombinant Corynebacterium glutamicum, denoted as K1. In step S10, this embodiment introduces the tyrosine ammonia lyase gene (TAL) from *Flavobacterium hannulatum* and the 4-hydroxyphenylacetic acid-3-hydroxylase gene (hpaBC) from *Escherichia coli* into *Corynebacterium glutamicum*. The expression of the TAL gene catalyzes the conversion of tyrosine into p-coumaric acid, a precursor of caffeic acid. The expression of the hpaBC gene further hydroxylates p-coumaric acid to generate caffeic acid. These two steps precisely construct a complete caffeic acid synthesis pathway. Unlike existing single-gene introduction strategies, this embodiment avoids the bottleneck of single enzymatic reactions that lead to precursor accumulation or product synthesis obstruction, achieving highly efficient tandem expression of the synthetic pathway.

[0030] S20. Based on the first recombinant Corynebacterium glutamicum, key genes pheA and trpE2 in other aromatic amino acid synthesis pathways, as well as key gene phdA in the degradation pathway of coumaric acid by caffeic acid precursors, were knocked out to regulate competitive metabolic pathways and obtain the second recombinant Corynebacterium glutamicum, denoted as K2.

[0031] In step S20, this embodiment specifically knocks out the key genes pheA and trpE2 in the aromatic amino acid synthesis pathway and the key gene phdA in the p-coumaric acid degradation pathway. The pheA gene controls phenylalanine synthesis, and the trpE2 gene controls tryptophan synthesis; both share intermediates from the upstream shikimic acid pathway with the caffeic acid synthesis pathway. The phdA gene encodes an enzyme that degrades the caffeic acid precursor p-coumaric acid. By knocking out these three types of genes, on the one hand, the diversion of shikimic acid pathway intermediates to phenylalanine and tryptophan is reduced, directing more metabolic flux towards the synthesis of tyrosine → p-coumaric acid → caffeic acid; on the other hand, the degradation of coumaric acid by precursor substances is prevented, avoiding intermediate product loss, thus optimizing the metabolic network from both an increase-increasing and decrease-reducing perspective.

[0032] In some implementations, based on the second recombinant Corynebacterium glutamicum, the TAL and hpaBC genes are integrated into the genome through promoter engineering and RBS optimization integration strategy to construct a plasmid-free engineered bacterium, thus obtaining the third recombinant Corynebacterium glutamicum, denoted as K3.

[0033] In this embodiment, the tyrosine ammonia lyase gene (TAL) from *Flavobacterium hannulatum* and the 4-hydroxyphenylacetic acid-3-hydroxylase gene (hpaBC) from *Escherichia coli* are jointly introduced into *Corynebacterium glutamicum*. The TAL gene catalyzes the conversion of tyrosine into p-coumaric acid, a precursor of caffeic acid, while the hpaBC gene further hydroxylates p-coumaric acid to generate caffeic acid. This two-step reaction precisely constructs a complete caffeic acid synthesis pathway. Unlike existing single-gene introduction strategies, this application avoids the bottleneck problems of precursor accumulation or product synthesis caused by single enzymatic reactions through dual-gene synergistic expression, achieving highly efficient tandem expression of the synthetic pathway.

[0034] In some implementations, based on the third recombinant Corynebacterium glutamicum, the rpe and hpaC genes are integrated into the genome through promoter engineering and RBS optimization integration strategy to obtain the fourth recombinant Corynebacterium glutamicum, denoted as K4.

[0035] Specifically, this embodiment identified a critical issue: the excessive consumption of the cofactor FADH2 during caffeic acid synthesis. Therefore, it specifically modified the key genes rpe (for FADH2 synthesis) and hpaC (for transformation). The rpe gene encodes an enzyme involved in the synthesis of FADH2 precursors, while the hpaC gene promotes FADH2 regeneration and utilization. Through promoter engineering (e.g., using strong promoters Ptuf and Psod) and RBS optimization (e.g., RBS1 and RBS2), the expression intensity of rpe and hpaC genes was enhanced, improving the intracellular supply of FADH2. As an essential cofactor for the hpaBC enzyme catalytic reaction, insufficient FADH2 directly leads to decreased hpaBC enzyme activity, limiting caffeic acid synthesis efficiency. This embodiment, through cofactor engineering, overcomes the cofactor limitation bottleneck in enzymatic reactions, achieving a significant increase in product synthesis efficiency.

[0036] In some embodiments, an application of recombinant Corynebacterium glutamicum producing caffeic acid is also provided. The recombinant Corynebacterium glutamicum producing caffeic acid described in this invention is used for fermentation to produce caffeic acid, specifically including the following steps: S100. Recombinant Corynebacterium glutamicum was activated and cultured on LB plates containing 25 μg / mL kanamycin and 12.5 μg / mL chloramphenicol for 24 h. S200. Inoculate the bacteria from the LB plate into a 250ml Erlenmeyer flask containing 20ml of seed culture medium and incubate for 14h at 32℃ and 250rpm on a shaker. The seed culture medium consists of: 25g / L glucose, 17.5g / L corn steep liquor powder, 0.5g / L MgSO4, 5g / L (NH4)2SO4, 1g / L KH2PO4, 2g / L urea, and sodium hydroxide to adjust the pH to 6.8. The recombinant Corynebacterium glutamicum is cultured with 25μg / mL kanamycin and 12.5μg / mL chloramphenicol.

[0037] Specifically, steps S100-S200 are mainly used for the activation and seed culture of recombinant Corynebacterium glutamicum. The purpose of strain activation is to restore the activity of dormant recombinant Corynebacterium glutamicum, ensuring normal growth and metabolism. Cultivation on LB solid medium allows for the screening of single colonies with high purity and good activity, avoiding contamination from other microorganisms that could affect subsequent fermentation. Seed culture aims to provide a sufficient quantity of highly active seed bacteria for the fermentation process. The seed culture medium contains abundant nutrients (such as glucose and corn steep liquor powder) to meet the growth and reproduction needs of the strain. Suitable temperature and rotation speed provide the optimal growth environment for the strain, promoting rapid growth and entry into the logarithmic growth phase. Strains in the logarithmic growth phase exhibit strong metabolic activity and reproductive capacity, enabling them to quickly adapt to the fermentation environment and rapidly utilize the nutrients in the fermentation medium for growth and caffeic acid synthesis, thereby improving fermentation efficiency and caffeic acid yield. Simultaneously, the seed culture process also allows for preliminary verification of the strain's growth performance and caffeic acid production capacity, ensuring the reliability of the seed bacteria used for fermentation.

[0038] S300. The seed culture solution was inoculated into a 250ml Erlenmeyer flask containing 20ml of fermentation medium at an inoculation rate of 10%. The flask was cultured at 32℃ and 250rpm for 72h. The fermentation medium consisted of: 100g / L glucose, 6g / L corn steep liquor powder, 0.5g / L MgSO4, 25g / L (NH4)2SO4, 1g / L KH2PO4, 2g / L sodium citrate, 0.4g / flask CaCO3, and pH 7.0. 25μg / mL kanamycin and 12.5μg / mL chloramphenicol were added to the recombinant Corynebacterium glutamicum during the culture.

[0039] In step S400, the fermentation medium contains various nutrients required for the growth and caffeic acid synthesis of recombinant Corynebacterium glutamicum. Glucose, as the main carbon source, provides energy for the growth and metabolism of the strain, and is also the source of the carbon skeleton for the synthesis of caffeic acid; (NH4)2SO4, as the nitrogen source, provides nitrogen for the strain to synthesize biomolecules such as proteins and nucleic acids; CaCO3 can neutralize the organic acids produced by the strain's metabolism during fermentation, maintain the stability of the pH value of the fermentation broth, and avoid the inhibitory effect of excessively low pH value on the growth of the strain and the synthesis of caffeic acid.

[0040] In this embodiment, 32°C is the optimal growth temperature for Corynebacterium glutamicum, at which the growth rate and enzyme activity of the strain are at their peak. The specific activity of TAL enzyme reaches 120 U / mg at 32°C, and the specific activity of hpaBC enzyme reaches 80 U / mg, ensuring efficient enzymatic reactions.

[0041] A fermentation speed of 250 rpm ensures sufficient dissolved oxygen in the fermentation broth. Recombinant Corynebacterium glutamicum is an aerobic microorganism, and its growth and metabolism require a large amount of oxygen. A sufficient oxygen supply meets the strain's aerobic respiration needs, providing enough energy for strain growth and caffeic acid synthesis. At the same time, oxygen is also an important participant in certain metabolic reactions, such as some oxidation reactions in tyrosine synthesis. If the fermentation speed is too low, insufficient dissolved oxygen in the fermentation broth will inhibit aerobic respiration, leading to insufficient energy supply and affecting strain growth and caffeic acid synthesis. In severe cases, it can even cause anaerobic respiration, producing byproducts such as alcohol and organic acids, which not only waste nutrients but also inhibit strain growth and caffeic acid synthesis.

[0042] Caffeic acid synthesis involves three stages: cell growth, precursor accumulation, and product synthesis. A fermentation time of 72 hours ensures sufficient product accumulation. The early stage of fermentation (0-24 hours) is the cell growth stage, the middle stage (24-48 hours) is the precursor tyrosine accumulation stage, and the late stage (48-72 hours) is the caffeic acid synthesis stage. Extending the fermentation time can allow the product concentration to reach its peak.

[0043] In some embodiments, the fermentation medium may also contain p-coumaric acid, which can directly provide a precursor for caffeic acid synthesis, bypassing the step of TAL enzyme catalyzing the production of p-coumaric acid from tyrosine, thus solving the bottleneck problem that may exist in TAL enzyme activity.

[0044] The present invention will be further explained and illustrated below through specific embodiments: Example 1 Construction of the first recombinant Corynebacterium glutamicum K1 The TAL gene was obtained by expression using the expression plasmid pEC-XK99E, and the hpaBC gene was obtained by expression using the expression plasmid pXMJ19. Specifically: Using TAL from Flavobacterium johnsonii as a template, a 1700 bp TAL gene fragment was obtained by PCR using TAL-F and TAL-R primers. The results are as follows: Figure 1 As shown, lane M is the DNA molecular weight standard (marker), and lane 1 is the TAL gene amplification fragment, showing a single bright band of approximately 1700 bp, consistent with the expected TAL gene length, confirming successful amplification of the TAL gene; using *E. coli* as a template, PCR was performed using two primer pairs, hpaB-F / R and hpaC-F / R, to obtain a 2000 bp hapB gene fragment (e.g., ...). Figure 2 As shown, lane M is the marker, lane 1 is the amplified fragment of the hpaB gene (the band size is approximately 2000 bp, which is consistent with the expected length of the hpaB gene, indicating that the hpaB gene amplification was successful), and a 500 bp fragment of the hpaC gene (such as...). Figure 3 As shown, lane M is the marker, and lane 1 is the amplified fragment of the hpaC gene, with a band size of approximately 500 bp, matching the expected length of the hpaC gene, proving that the hpaC gene amplification was successful. Using hapB and hpaC genes as templates, PCR was performed using hpaB-F and hpaC-R primers to obtain a 2300 bp fragment of the hpaBC gene (e.g., ...). Figure 4As shown, lane M is the marker, and lane 1 is the hpaBC fusion gene fragment. The band size is approximately 2300bp (2000bp hpaB + 500bp hpaC - 200bp overlapping region), which is consistent with the expected fusion gene length, indicating that the hpaB and hpaC genes have successfully fused into the hpaBC gene. Purification was performed using a PCR product purification and recovery kit (TransGold). The Corynebacterium glutamicum expression plasmid pEC-XK99E was double-digested with BamHI and SalI, and the TAL gene was ligated into the pEC-XK99E plasmid using a one-step cloning kit (Novizan). The Corynebacterium glutamicum-Escherichia coli shuttle plasmid pXMJ19 was double-digested with HindIII and XbaI, and the hpaBC gene was ligated into the pXMJ19 plasmid using a one-step cloning kit (Novizan). The resulting recombinant plasmids were transformed into Escherichia coli DH5α by heat shock and screened on LB agar plates containing 50 mg / L kanamycin and 25 mg / L chloramphenicol, respectively. PCR positive clones were verified using primer pairs pEC-XK99E-F and pEC XK99E-R, and primer pairs pXMJ19-F and pXMJ19-R, respectively. After successful sequencing, the recombinant expression plasmids were named pEC-XK99E-TAL and pXMJ19-hpaBC, respectively.

[0045] The pEC-XK99E-TAL recombinant plasmid was electroporated into *Corynebacterium glutamicum* ATCC 13032 using an electroporator (Bio-Rad). The electroporation cup width was 2 mm, the electroporation voltage was 3000 V, and the electroporation time was 4 ms. Recombinant bacteria were screened on LBHIS plates containing 25 mg / L kanamycin. Single colonies were selected and colony PCR was performed using pEC-check-F and pEC-check-R primers. A band of approximately 1700 bp was considered a successful transformation of the pEC-XK99E-TAL plasmid into *Corynebacterium glutamicum*. The pXMJ19-hpaBC recombinant plasmid was also electroporated into the above recombinant *Corynebacterium glutamicum* using an electroporator (Bio-Rad). Recombinant bacteria were screened on LBHIS plates containing 25 mg / L kanamycin and 25 mg / L chloramphenicol. Single colonies were selected and colony PCR was performed using pXMJ19-F and pXMJ19-R primers. Figure 5 If a band of approximately 2300 bp is amplified, the first recombinant Corynebacterium glutamicum 13032-TAL-hpaBC (CCA2) is considered to have been successfully constructed, and is also denoted as K1.

[0046] Primer sequences used in this embodiment: TAL-F:TTCGAGCTCGGTACCCGGGGATCCATGGAATTCAAGAGGACGGACC TAL-R: GCATGCCTGCAGGTCGACTCTAGCTCCTTGGTTAATTGTTGATGAGATGA hpaB-F: GAAACAGAATTAATTAAGCTTAGAGGAGCTATAGATGAAACCAGAAGATTTCCG hpaB-R:GATATCTCCTTGGTTATTTCAGCAGCTTATCCAGC hpaC-F: AGCTGCTGAAATAACCAAGGAGATATCTAATGCAATTAGATGAACAACGC hpaC-R: CTCGGTACCCGGGGATCCTCTAGATTAAATCGCAGCTTCCATTTC pEC-check-F:CAAGGCGCACTCCCGTTCTGGATAAT pEC-check-R: CTACTGCCGCCAGGCAAATTCTGTT pXMJ19-F:GCACTCCCGTTCTGGATAATG pXMJ19-R:GTCTTTCGACTGAGCCTTTCG.

[0047] The Corynebacterium glutamicum ATCC 13032 strain used in this embodiment was purchased from Beijing BioBio Biotechnology Co., Ltd.

[0048] Example 2 Construction of the second recombinant Corynebacterium glutamicum K2 The pheA, trpE2, and phdA genes were obtained by knocking out the suicide plasmid pSR18 of Corynebacterium glutamicum. Specifically, using the gene of Corynebacterium glutamicum ATCC13032 as a template, PCR was performed using primers pheA-up-F and pheA-up-R, pheA-down-F and pheA-down-R, trpE2-up-F and trpE2-up-R, trpE2-down-F and trpE2-down-R, phdA-up-F and phdA-up-R, and phdA-down-F and phdA-down-R, respectively. This yielded approximately 800 bp homologous arms of the pheA, trpE2, and phdA genes: pheA-up, pheA-down, trpE2-up, trpE2-down, phdA-up, and phdA-down. The PCR products were purified using a purification and recovery kit (TransGold). Using pheA-up and pheA-down fragments as templates, fusion PCR amplification was performed with pheA-up-F and pheA-down-R primers to obtain the pheA-up&down gene fragment; using trpE2-up and trpE2-down fragments as templates, fusion PCR amplification was performed with trpE2-up-F and trpE2-down-R primers to obtain the trpE2-up&down gene fragment; using phdA-up and phdA-down fragments as templates, fusion PCR amplification was performed with phdA-up-F and phdA-down-R primers to obtain the phdA-up&down gene fragment, and the products were purified using a PCR product recovery kit (TransGold). The Corynebacterium glutamicum suicide plasmid pSR18 was double-digested with PstI and XbaI. Using a one-step cloning kit (Novizan), the pheA-up&down, trpE2-up&down, and phdA-up&down gene fragments were ligated into the pSR18 plasmid to obtain recombinant plasmids. These plasmids were then transformed into E. coli DH5α by heat shock and screened on LB agar plates containing 100 mg / L spectinomycin. Positive clones were verified by PCR using the M13 universal primer (results are shown in the figure). Figure 6As shown, lane M is the marker, and lanes 1-3 are the PCR products of the recombinant plasmids pSR18-ΔpheA, pSR18-ΔtrpE2, and pSR18-ΔphdA, respectively. The band sizes are approximately 1600bp (fusion of upstream and downstream homologous arms of 800bp pheA), 1600bp (fusion of upstream and downstream homologous arms of 800bp trpE2), and 1600bp (fusion of upstream and downstream homologous arms of 800bp phdA), which are consistent with the expected knockout fragment length, proving that the knockout plasmid was successfully constructed. The above recombinant plasmids are named pSR18-ΔpheA, pSR18-ΔtrpE2, and pSR18-ΔphdA.

[0049] The pSR18-trpE2 recombinant plasmid was electroporated into the first recombinant Corynebacterium glutamicum K1 using an electroporator (Bio-Rayet), under the same electroporation conditions as above. The recombinant bacteria were screened on LB HIS plates containing 12.5 mg / L chloramphenicol, 25 mg / L kanamycin, and 100 mg / L spectinomycin. Single colonies were selected and cultured in 50 μL of liquid LB agar for 4 h, then plated on LB agar plates containing 100 g / L sucrose for secondary screening. Single colonies were selected and verified by colony PCR using the trpE2-check-F and trpE2-down-R primer pairs, as shown below. Figure 7 As shown, lane M is the marker, lane 1 is the PCR product of the original strain ATCC 13032 (containing the trpE2 gene), showing a band of approximately 1100bp; lanes 2-5 are the PCR products of the CCA6 strain (trpE2 gene knocked out), with no 1100bp band, proving that the trpE2 gene was successfully knocked out, and the CCA6 strain was successfully constructed, obtaining the recombinant strain 13032-ΔtrpE2 (CCA6). Using the same method, the pheA gene and phdA gene were knocked out on the basis of CCA6 to obtain the second recombinant Corynebacterium glutamicum K2, which can also be recorded as ATCC13032-ΔtrpE2-ΔpheA-ΔphdA.

[0050] The primers used in this embodiment are as follows: pheA-up-F:AGTGCCAAGCTTGCATGCCTGAAAACCATCTTGTAATGGGGGCTA pheA-up-R: TCATCTGACCGCCCGTCGACCTGCAGGATATCTCTAGAGGTGCGTCGCTCATGGTTACA pheA-down-F: TGCAGGTCGACGGGCGGTCAGATGATCGCCCTTTTTTATCGCCACAAGAAGCTGTCGA pheA-down-R: CGGTACCCGGGGATCCTCTAGTGTAGCTTAGCTAGTTGGTC trpE2-up-F:AGTGCCAAGCTTGCATGCCTGCAACCATGTCCTGATGCATTCGC trpE2-up-R: TCATCTGACCGCCCGTCGACAAGCTTGATATCTCTAGAAGAACAACGTGTGTCATCGGA trpE2-down-F: AGCTTGTCGACGGGCGGTCAGATGATCGCCCTTTTTTGTGCACGGTGTTCCCGCAATAC trpE2-down-R:CGGTACCCGGGGATCCTCTAGCCGGCAATATCAGCGAACTG phdA-up-F:AGTGCCAAGCTTGCATGCCTGCCGCCAGTTCACATGGAGCCACT phdA-up-R: TCATCTGACCGCCCGTCGACCTGCAGGATATCTCTAGAGCTTCCTATTCCGAGGTTCAC phdA-down-F: TGCAGGTCGACGGGCGGTCAGATGATCGCCCTTTTTTATGTACACCTCCGGAACCACT phdA-down-R: CGGTACCCGGGGATCCTCTACGATGACTGCGGCATCAAGGA pheA-check-F:CTTCACCGAAGAAGCCCTCTA trpE2-check-F:TTTTGTCTACAACCTGGTGGA phdA-check-F:AGGGCAACTGTTCGACCAGAG The primer sequences used in this embodiment are existing technologies.

[0051] Example 3 Constructing the third recombinant Corynebacterium glutamicum K3 and the fourth recombinant Corynebacterium glutamicum K4 The specific method for integrating heterologous genes into the genome, using the P-TAL (RBS4) gene as an example, is as follows: using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification is performed using PF (trpE2) and PR as primers to obtain a strong promoter P. Then, overlap extension PCR is used to fuse it with the TAL gene fragment. Using P and TAL genes as templates, primer pairs for RBS are designed and optimized. Overlap extension PCR is used to optimize and fuse promoter P with the corresponding RBS of TAL.

[0052] The pSR18-ΔtrpE2 constructed in Example 2 above was used as an expression vector. It was digested with Xba I, and then P-TAL(RBS4) was ligated to the pSR18-ΔtrpE2 recombinant plasmid using a seamless cloning method. The recombinant plasmid was transformed into *E. coli* DH5α by heat shock, and screening was performed on LB plates containing 100 mg / L spectinomycin resistance. Positive clones were detected by PCR using the M13 universal primer. Figure 8 As shown, a bright band appears at around 3300bp, proving that the recombinant plasmid pSR18-ΔtrpE2-P-TAL (RBS4) was successfully constructed; similarly, the recombinant plasmid pSR18-ΔpheA-Psod-hpaBC (RBS2) was constructed.

[0053] In this embodiment, the TAL and hpaBC genes are integrated into the genome, replacing the original trpE2 and pheA gene loci. On the one hand, this achieves stable gene expression and avoids yield fluctuations caused by plasmid loss. On the other hand, the gene expression intensity is enhanced by strong promoters P and Psod and optimized RBS sequence, resulting in an enzyme activity increase of more than 40%, further promoting yield growth.

[0054] The pSR18-ΔtrpE2-P-TAL(RBS4) recombinant plasmid was electroporated into recombinant Corynebacterium glutamicum ATCC13032-ΔtrpE2-ΔpheA-ΔphdA using an electroporator (Bio-Radex), under the same electroporation conditions as above. The recombinant bacteria were screened on LB HIS plates containing 100 mg / L spectinomycin. Single colonies were selected and cultured in 50 μL of liquid LB for 4 h, then plated on LB plates containing 100 g / L sucrose for secondary screening. Single colonies were selected and verified by colony PCR using the TAL-F(RBS4) and TAL(trpE2)-R primer pairs, as shown below. Figure 9As shown, lane M is the marker, and lane 1 is the PCR product of strain CCA15-6, showing a band of approximately 1700 bp (TAL gene), confirming that the TAL gene was successfully integrated into the genome of strain CCA15-6. Based on the above recombinant strain, the Psod-hpaBC(RBS4) gene was integrated into the pheA site using the same method to obtain the third recombinant Corynebacterium glutamicum 13032ΔtrpE2-P-TAL(RBS4)-ΔpheA-Psod-hpaBC(RBS2)-ΔphdA (CCA15-6), denoted as K3.

[0055] Based on the third recombinant Corynebacterium glutamicum K3, the Psod-hpaC(RBS1) gene was integrated into the phdA site using the same method, and the Ptuf-rpe(RBS3) gene was integrated into the genome to obtain the fourth recombinant Corynebacterium glutamicum 13032ΔtrpE2-P-TAL(RBS4)-ΔpheA-Psod-hpaBC(RBS2)-ΔphdA-Psod-hpaC(RBS1)-Ptuf-rpe(RBS3), denoted as K4.

[0056] This embodiment addresses the FADH2 supply shortage by modifying the key FADH2 synthesis gene *rpe* and the transformation pathway gene *hpaC*. First, a recombinant plasmid *pSR18-Ptuf-rpe* (RBS3) containing the strong promoters *Ptuf*, *RBS3*, and the *rpe* gene was constructed; then, a recombinant plasmid *pSR18-ΔphdA-Psod-hpaC* (RBS1) containing the strong promoters *Psod*, *RBS1*, and the *hpaC* gene was constructed. These two recombinant plasmids were then sequentially transformed into a third recombinant *Corynebacterium glutamicum* K3, integrating the *rpe* gene into a genomic blank site and the *hpaC* gene into the *phdA* gene site, resulting in a fourth recombinant *Corynebacterium glutamicum* K4. In this embodiment, the *rpe* gene encodes D-ribulose-5-phosphate-3-epimerase, which participates in the pentose phosphate pathway and can promote the synthesis of FADH2 precursors (such as riboflavin). Optimization with the Ptuf strong promoter and RBS3 increased rpe gene expression by 50% and riboflavin concentration by 40%, providing sufficient precursors for FADH2 synthesis. The enzyme encoded by the hpaC gene catalyzes the regeneration of FADH2, converting oxidized FAD to reduced FADH2. The reaction of coumaric acid to caffeic acid catalyzed by the hpaBC enzyme consumes FADH2; efficient expression of the hpaC gene can replenish the consumed FADH2 in a timely manner, preventing a decrease in hpaBC enzyme activity due to insufficient FADH2. Optimization with the Psod strong promoter and RBS1 increased hpaC enzyme activity by 60% and maintained a high intracellular FADH2 concentration, ensuring the continuous and efficient enzymatic reaction and increasing caffeic acid production from 169.35 mg / L (CCA15-6) to 225.65 mg / L (CCA28-1).

[0057] This embodiment selects differentiated strong promoters based on the functional characteristics of different genes. For example, the specific strong promoter P is used for TAL gene expression, the Psod promoter is used for hpaBC gene expression, and the Ptuf promoter is used for rpe gene expression. Different promoters have different transcriptional activities. For example, the Ptuf promoter has sustained high transcriptional activity in Corynebacterium glutamicum, which is suitable for maintaining stable rpe gene expression to continuously supply FADH2; the Psod promoter is responsive to environmental stress and can dynamically regulate hpaBC gene expression according to intracellular metabolic state during fermentation. Through precise promoter matching, the synergistic expression of key genes in time and space is achieved.

[0058] For different genes such as TAL, hpaBC, hpaC, and rpe, optimal RBS sequences (such as RBS1, RBS2, RBS3, and RBS4) were designed and screened. As ribosome binding sites, the sequence structure of RBS directly affects the translation initiation efficiency of mRNA. For example, matching the RBS4 sequence to the TAL gene increased the expression level of the TAL enzyme by more than 30%; matching the RBS1 sequence to the hpaC gene significantly enhanced the activity of the hpaC enzyme. Through RBS optimization, the problem of uneven translation efficiency caused by codon bias and differences in mRNA secondary structure among different genes was solved, achieving synergistic optimization at the transcription and translation levels and ensuring efficient connection of each enzymatic reaction step.

[0059] The primers used in this embodiment are as follows: PF (trpE2):GATGACACACGTTGTTCTTCTAGAAACTGTGCCACTAATACGGATAG PR(trpE2):GGTCCGTCCTCTTGAACGACTCTAGATTACCAATTTCGCCTGCTTC CGATT TAL-F(RBS4):CACACAATCATTACAAGAAGGAGGTAGCAATCATGAACACCATCAACGAATATCTG TAL(trpE2)-R:GTCGACAAGCTTGATATCTCTAGACTCCTTGGTTAATTGTTGATGAGATGA P sod -F(pheA):AACCATGAGCGACGCACCTCTAGATGCCAATTATTCCGGGCTTG P sod -R: GGTCCGTCCTCTTGAACGACTCTAGATTACTCCGCACCGAGCATATACATCTT hpaBC-F(RBS2):ATTTAGACAATTATTACATAAGAGGACGGACCATCATGAAACCAGAAGATTTCCG hpaBC-R(pheA): ATCTGACCGCCCGTCGACCTGCAGTTAAATCGCAGCTTCCATTTC hpaC-F(RBS1):AGTCCACCCCAATAAACAGAACGGAGGAACAAGATGCAATTAGATGA ACAACGC hpaC-R(phdA): ATCTGACCGCCCGTCGACCTGCAGTTAAATCGCAGCTTCCATTTC P tuf -F: CGTTCACAGGGTAGCTGGTAGTTTG rpe-up-F:AGTGCCAAGCTTGCATGCCTGCATGGTGACGAGGGCAAGTATTC rpe-up-R:CAAACTACCAGCTACCCTGTGAACGCCCTAAATCATAGCCCTCTTG rpe-down-F(RBS2):ATTTAGACAATTATTACATAAGAGGACGGACCATCATGGCACAACGTACTCCACTAAT.

[0060] Example 4 Shake-flask fermentation of Corynebacterium glutamicum and recombinant Corynebacterium glutamicum Recombinant Corynebacterium glutamicum K1-K4 was activated and cultured for 24 h on LB agar plates containing 25 μg / mL kanamycin and 12.5 μg / mL chloramphenicol, while Corynebacterium glutamicum ATCC13032 was cultured for 24 h on antibiotic-free LB agar plates.

[0061] The bacteria from the agar plates were inoculated into 250ml Erlenmeyer flasks containing 20ml of seed culture medium and cultured for 14h at 32℃ and 250rpm on a shaker. The seed culture medium consisted of: 25g / L glucose, 17.5g / L corn steep liquor powder, 0.5g / L MgSO4, 5g / L (NH4)2SO4, 1g / L KH2PO4, 2g / L urea, and sodium hydroxide to adjust the pH to 6.8. The recombinant Corynebacterium glutamicum was cultured with 25μg / mL kanamycin and 12.5μg / mL chloramphenicol.

[0062] The seed culture was inoculated at a 10% inoculation rate into 250ml Erlenmeyer flasks containing 20ml of fermentation medium. The flasks were cultured at 32℃ and 250rpm for 72h. The fermentation medium consisted of: 100g / L glucose, 6g / L corn steep liquor powder, 0.5g / L MgSO4, 25g / L (NH4)2SO4, 1g / L KH2PO4, 2g / L sodium citrate, and 0.4g / flask of CaCO3, pH 7.0. The recombinant strain was cultured with 25μg / mL kanamycin and 12.5μg / mL chloramphenicol.

[0063] After fermentation, the caffeine content was measured. The results are as follows: Figure 10 As shown: The first recombinant Corynebacterium glutamicum K1 successfully constructed a caffeic acid synthesis pathway with a caffeic acid yield of 15.41 mg / L; after knocking out the pheA, trpE2, and phdA genes, the caffeic acid yield of the second recombinant Corynebacterium glutamicum K2 increased to 26.29 mg / L; the caffeic acid yield of the third recombinant Corynebacterium glutamicum K3 increased to 169.35 mg / L; and the caffeic acid yield of the fourth recombinant Corynebacterium glutamicum K4 increased to 225.65 mg / L.

[0064] Furthermore, no p-coumaric acid was detected in the fermentation samples of the third and fourth recombinant Corynebacterium glutamicum K3 and K4, suggesting an insufficient supply of p-coumaric acid. Therefore, an additional 1 g / L of p-coumaric acid was added to the fermentation medium, and fermentation was carried out again. As a result, the production of caffeic acid by the third and fourth recombinant Corynebacterium glutamicum K3 and K4 increased significantly. Figure 11 As shown, the final caffeic acid yield of the third recombinant Corynebacterium glutamicum K3 reached 447.7 mg / L, and the final caffeic acid yield of the fourth recombinant Corynebacterium glutamicum K4 reached 922.77 mg / L.

[0065] In summary, this application constructs a plasmid-free recombinant Corynebacterium glutamicum by constructing a caffeic acid synthesis pathway in Corynebacterium glutamicum ATCC13032, knocking out genes related to competing metabolic pathways, and overexpressing key genes of the caffeic acid synthesis pathway through promoter engineering and RBS optimization integration strategies. This guides cellular metabolic flux toward the accumulation of the target product, thereby significantly increasing the yield of caffeic acid.

[0066] It is understood that those skilled in the art can make equivalent substitutions or modifications to the technical solution and inventive concept of the present invention, and all such substitutions or modifications should fall within the protection scope of the appended claims.

Claims

1. A method for constructing a recombinant Corynebacterium glutamicum producing caffeic acid, characterized by, Comprising the following steps: Introducing tyrosine ammonia-lyase gene TAL from Flavobacterium heparinum and 4-hydroxyphenylacetate-3-hydroxylase gene hpaBC from Escherichia coli into Corynebacterium glutamicum ATCC 13032 to construct a caffeic acid synthesis pathway, and obtaining a first recombinant Corynebacterium glutamicum, denoted as K1; Knocking out key genes pheA, trpE2 of other aromatic amino acid synthesis pathways and phdA of caffeic acid precursor p-coumaric acid degradation pathway in the first recombinant Corynebacterium glutamicum to regulate competitive metabolic pathways, and obtaining a second recombinant Corynebacterium glutamicum, denoted as K2.

2. The method for constructing a recombinant Corynebacterium glutamicum producing caffeic acid according to claim 1, characterized by, Further comprising the step of: integrating TAL and hpaBC genes into the genome of the second recombinant Corynebacterium glutamicum through promoter engineering and RBS optimization integration strategy to construct a plasmid-free engineering strain, and obtaining a third recombinant Corynebacterium glutamicum, denoted as K3.

3. The method of constructing a recombinant Corynebacterium glutamicum producing caffeic acid according to claim 2, characterized in that, Further comprising the step of: integrating rpe and hpaC genes into the genome of the third recombinant Corynebacterium glutamicum to obtain a fourth recombinant Corynebacterium glutamicum, denoted as K4.

4. The method of constructing a recombinant Corynebacterium glutamicum producing caffeic acid according to claim 1, wherein, The TAL gene is obtained by expression of expression plasmid pEC-XK99E, and the hpaBC gene is obtained by expression of expression plasmid pXMJ19.

5. The method of constructing a recombinant Corynebacterium glutamicum producing caffeic acid according to claim 1, wherein, The pheA gene, the trpE2 gene and the phdA gene are obtained by knocking out of Corynebacterium glutamicum suicide plasmid pSR18.

6. A recombinant Corynebacterium glutamicum producing caffeic acid, characterized in that, The method for constructing the caffeic acid-producing recombinant Corynebacterium glutamicum is constructed by using the method for constructing the caffeic acid-producing recombinant Corynebacterium glutamicum according to any one of claims 1-7.

7. Use of a recombinant Corynebacterium glutamicum producing caffeic acid, characterized in that The caffeic acid-producing recombinant Corynebacterium glutamicum of claim 6 is used for fermentation production of caffeic acid.

8. Use according to claim 7, characterized in that, Comprising the following steps: The recombinant Corynebacterium glutamicum is activated and cultured on an LB plate containing 25 μg / mL kanamycin and 12.5 μg / mL chloramphenicol for 24 h; The bacteria on the LB plate are inoculated into a 250 ml conical flask containing 20 ml of seed culture medium, and cultured at a temperature of 32℃ and a shaking speed of 250 rpm for 14 h, wherein the seed culture medium comprises: glucose 25 g / L, corn syrup dry powder 17.5 g / L, MgSO4 0.5 g / L, (NH4)2SO4 5 g / L, KH2PO4 1 g / L, urea 2 g / L, and sodium hydroxide is used to adjust the pH to 6.8, and the recombinant Corynebacterium glutamicum is added with 25 μg / mL kanamycin and 12.5 μg / mL chloramphenicol during the culture; The recombinant Corynebacterium glutamicum is activated and cultured on an LB plate containing 25 μg / mL kanamycin and 12.5 μg / mL chloramphenicol for 24 h; The seed culture solution was inoculated into 250 ml conical flask containing 20 ml fermentation medium at inoculation amount of 10%, and cultured for 72 h at temperature of 32℃ and shaking speed of 250 rpm. The fermentation medium included glucose 100 g / L, corn syrup dry powder 6 g / L, MgSO4 0.5 g / L, (NH4)2SO4 25 g / L, KH2PO4 1 g / L, sodium citrate 2 g / L, CaCO3 0.4 g / flask, and PH 7.

0. The recombinant C. glutamicum was added with 25 μg / mL kanamycin and 12.5 μg / mL chloramphenicol during the culture.

Images