A primer set, a kit for simultaneously detecting ailu virus and canine distemper virus type 6 of small panda and application thereof

By designing primer sets and fluorescent probes suitable for RAA technology, rapid and specific detection of red panda Aleutian virus and red panda canine distemper virus Asia 6 was achieved, solving the problem of low detection efficiency in existing technologies and making it suitable for rapid on-site diagnosis and disease monitoring.

CN121344273BActive Publication Date: 2026-07-07CHINA CONSERVATION & RES CENT FOR THE GIANT PANDA SICHUAN
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA CONSERVATION & RES CENT FOR THE GIANT PANDA SICHUAN
Filing Date
2025-12-18
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

Current technologies lack methods for simultaneously, rapidly, and efficiently detecting Aleutian virus and canine distemper virus Asia 6 in red pandas, resulting in high testing costs, long testing times, and low efficiency, making it difficult to meet the needs of rapid on-site diagnosis and disease monitoring.

Method used

A primer set, including ADV and CDV primer sets, was designed for recombinase-mediated isothermal nucleic acid amplification (RAA) under isothermal conditions at 39°C. This primer set can specifically recognize and amplify red panda Aleutian virus and red panda canine distemper virus Asia 6, and can be detected by combining with fluorescent probes.

Benefits of technology

Within 20 minutes, rapid and specific detection of Aleutian virus and Canine Distemper Virus Asia 6 in red pandas was achieved, avoiding cross-reactivity. It has high sensitivity and high specificity and is suitable for field application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121344273B_ABST
    Figure CN121344273B_ABST
Patent Text Reader

Abstract

This invention discloses a primer set, reagent kit, and their applications for the simultaneous detection of Aleutian virus and Canine Distemper Virus Asia 6 (Asia 6) in red pandas, belonging to the field of endangered wildlife virus detection technology. This invention provides a primer set and reagent kit that specifically identifies Aleutian virus and Canine Distemper Virus Asia 6 in red pandas. Detection can be completed within 20 minutes under constant temperature conditions of 39℃; it does not cross-react with other common pathogens and does not produce false positives due to primer dimer formation. In other words, it features rapid detection, high specificity, and high sensitivity. The implementation process is simple and easy to operate, requiring no specialized testing personnel for on-site testing. The detection is rapid and accurate, and initial applications have shown good results, providing a method for rapid diagnosis, virus tracing, wildlife disease monitoring, and early warning in zoos and wildlife rescue institutions.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of virus detection technology for endangered wild animals, and in particular to a primer set, reagent kit, and application for simultaneously detecting Aleutian virus and Canine Distemper Virus Asia 6 (AD6) in red pandas. Background Technology

[0002] As a rare and endangered wild animal, the red panda has extremely high ecological conservation and scientific research value. However, its captive and wild populations are facing serious threats from a variety of infectious diseases, among which diseases caused by red panda Aleutian virus and red panda canine distemper virus Asia 6 are particularly prominent.

[0003] Aleutian parvovirus in red pandas is a pathogen belonging to the Parvoviridae family. Infection can lead to viremia, immune complex deposition, glomerulonephritis, hepatitis, and systemic wasting disease, resulting in a high mortality rate and posing a persistent threat to the red panda population. However, this virus is easily confused with canine parvovirus and feline parvovirus, leading to erroneous detection information and misdiagnosis and mistreatment of infected animals. Canine distemper virus Asia-6 (Asia-6) in red pandas is a newly discovered genotype of canine distemper virus. Currently, only red pandas in my country have been found to carry this genotype. The average genetic distance between this virus and the 18 known major lineages (genotypes) is greater than 4.6%. Phylogenetic analysis based on the full-length genome and H gene sequence shows that the Asia-6 strain forms an independent evolutionary branch. Furthermore, 40 unique amino acid substitutions were found in multiple structural proteins (N, P, M, F, H, L), substitutions not reported in other known strains. This genotype of canine distemper virus exhibits high susceptibility and pathogenicity in red pandas. Infection can cause respiratory, digestive, and neurological symptoms. The disease has a rapid course and is highly contagious, often resulting in individual deaths and outbreaks of disease in red pandas.

[0004] Currently, laboratory testing methods for these two viruses mainly rely on traditional virus isolation, serological testing, and conventional polymerase chain reaction (PCR) technology. Virus isolation is considered the "gold standard," but it is extremely cumbersome and time-consuming (days to weeks), requires very high experimental conditions and biosafety levels, and its sensitivity is unstable, failing to meet the needs of rapid clinical diagnosis and on-site screening. Serological testing can detect antibodies, but it cannot provide effective diagnosis in the early stages of infection (window period) and cannot distinguish between past and current infections, with interpretation becoming even more complex in the context of vaccination. While conventional PCR technology offers significantly improved sensitivity and specificity compared to the former two methods, it relies on expensive and bulky thermal cyclers, the entire testing process is time-consuming (usually 2-3 hours), and requires specialized laboratory environments and operators, greatly limiting its application in field environments such as farms, zoos, and wildlife monitoring sites.

[0005] More importantly, there is currently a lack of non-diagnostic testing tools capable of simultaneously, rapidly, and efficiently detecting both of these important pathogens. In actual disease control work, red pandas may exhibit similar clinical symptoms, but the pathogens are different. If a single testing method is used, two independent testing procedures are required, which not only doubles the testing cost and time but also increases the consumption of samples and reagents, reducing testing efficiency.

[0006] Recombinase-mediated isothermal nucleic acid amplification (RTA) is an emerging rapid nucleic acid detection technology. Because the reaction occurs at a constant low temperature, eliminating the need for a thermal cycler, it offers significant advantages such as ease of operation, rapid reaction, and low equipment requirements, making it ideal for developing rapid on-site detection reagents. However, its application to the multiplex fluorescence detection of Aleutian virus in red pandas and canine distemper virus Asia 6 is currently lacking. The technical challenge lies in designing primer pairs that can efficiently and specifically amplify both pathogens under the same isothermal reaction conditions, along with compatible fluorescent probes, while avoiding primer dimers and cross-reactions to ensure that the sensitivity and specificity of multiplex detection are not affected.

[0007] In summary, there is an urgent need in this field to develop a primer-probe combination, reagent kit, and detection method based on RAA technology that can simultaneously, rapidly, sensitively, and specifically detect Aleutian virus and Canine Distemper Virus Asia 6 in red pandas, in order to fill the existing technological gap and provide strong technical support for disease monitoring, early warning, and precise prevention and control in red pandas. Summary of the Invention

[0008] The purpose of this invention is to provide a primer set, reagent kit, and application for the simultaneous detection of Aleutian virus and Canine Distemper Virus Asia 6 in red pandas, in order to solve the problems existing in the prior art. The primer set provided by this invention can complete the detection within 20 minutes under constant temperature conditions of 39℃, and has the characteristics of rapid detection, good specificity, and high sensitivity.

[0009] To achieve the above objectives, the present invention provides the following solution:

[0010] This invention provides a primer set for the simultaneous detection of Aleutian virus and Canine Distemper Virus Asia 6 in red pandas, including an ADV primer set and a CDV primer set.

[0011] The ADV primer set includes ADV-NS1-F1 with nucleotide sequence as shown in SEQ ID NO.3, ADV-NS1-R3 with nucleotide sequence as shown in SEQ ID NO.8, and ADV-NS1-Probe with nucleotide sequence as shown in SEQ ID NO.9.

[0012] The CDV primer set includes CDV-N-F1 with nucleotide sequence as shown in SEQ ID NO.10, CDV-N-R2 with nucleotide sequence as shown in SEQ ID NO.13, and CDV-N-Probe with nucleotide sequence as shown in SEQ ID NO.16.

[0013] Optionally, the ADV-NS1-Probe is labeled with a FAM fluorescent group at position 29 of the 5' end, a T-labeled THF tetrahydrofuran at position 31, and a BHQ1 fluorescence quencher group at position 33.

[0014] The CDV-N-Probe is labeled with a ROX fluorescent group at position 26 of the 5' end, a THF tetrahydrofuran group at position 30, and a BHQ2 fluorescence quencher group at position 32.

[0015] The present invention also provides the application of the primer set described herein in the preparation of a kit for simultaneous detection of red panda Aleutian virus and red panda canine distemper virus Asia 6.

[0016] The present invention also provides a kit for simultaneously detecting Aleutian virus and Canine Distemper Virus Asia 6 in red pandas, comprising the aforementioned primer set.

[0017] Optionally, the steps for simultaneously detecting red panda Aleutian virus and red panda canine distemper virus Asia 6 type using the kit are as follows:

[0018] Using the cDNA of the sample to be tested as a template, a RAA reaction is performed using the primer set described in claim 1 or 2, fluorescence signals are collected, and the Ct value of the sample to be tested is obtained.

[0019] Optionally, if the FAM channel shows a typical amplification curve and Ct≤35, the sample to be tested is determined to contain red panda Aleutian virus; if the ROX channel shows a typical amplification curve and Ct≤35, the sample to be tested is determined to contain red panda canine distemper virus Asia type 6.

[0020] If Ct>35, or no amplification curve appears, the sample is judged as negative, meaning that the sample to be tested does not contain red panda Aleutian virus or red panda canine distemper virus Asia 6.

[0021] Optionally, the reaction conditions for the RAA reaction are 39°C and 20 min.

[0022] Optionally, the reaction system for the RAA reaction consists of one tube of RAA dry powder, 25 μL of buffer A, 2.5 μL of buffer B, 2 μL of ADV-NS1-F1, 2 μL of ADV-NS1-R3, 0.5 μL of ADV-NS1-Probe, 2 μL of CDV-N-F1, 2 μL of CDV-N-R2, 0.5 μL of CDV-N-Probe, 5 μL of DNA template, and 8.5 μL of H2O.

[0023] Optionally, the final concentration of ADV-NS1-F1, ADV-NS1-R3, CDV-N-F1, and CDV-N-R2 is all 0.5 μM;

[0024] The final concentrations of both ADV-NS1-Probe and CDV-N-Probe were 0.2 μM.

[0025] The present invention discloses the following technical effects:

[0026] This invention provides a primer set and kit for specifically recognizing Aleutian parvovirus and Canine Distemper Virus Asia 6 in red pandas. Detection can be completed within 20 minutes under constant temperature conditions of 39°C. Furthermore, it does not cross-react with other common pathogens and will not produce false positives due to the formation of primer dimers.

[0027] The invention is simple and easy to implement, and can be tested on-site without the need for specialized testing personnel. The test is fast and accurate, and has achieved good results in preliminary applications. It is of great significance for the prevention and control of Aleutian parvovirus and Canine Distemper Virus Asia 6 in red pandas.

[0028] This invention can effectively distinguish between Aleutian parvovirus and canine parvovirus, and can also effectively distinguish between canine distemper virus Asia 6 and other genotypes of canine distemper virus. Since canine distemper virus Asia 6 has only been found to be carried by red pandas in my country, this invention can also play a role in tracing the source and specific detection.

[0029] The detection method provided by this invention has a limit of detection of 10 copies / μL for both Aleutian parvovirus and canine distemper virus Asia 6 (ALV) in red pandas, and the detection can be completed in 20 minutes. It features rapid detection, high specificity, and high sensitivity, providing a method for rapid diagnosis in zoos and wildlife conservation. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0031] Figure 1 Agarose gel electrophoresis images of amplification products of Aleutian virus in red pandas and canine distemper Asia 6;

[0032] Figure 2 A graph showing the screening results of fluorescence amplification of the Aleutian virus primer set for red pandas;

[0033] Figure 3 A graph showing the screening results of fluorescent amplification of the Asian type 6 primer set for canine distemper virus in red pandas.

[0034] Figure 4 A graph showing the sensitivity test results of the dual fluorescent RAA primer set for Aleutian virus in red pandas.

[0035] Figure 5 A graph showing the sensitivity test results of the dual fluorescent RAA primer set for canine distemper virus Asia 6 type in red pandas.

[0036] Figure 6 Curve diagram showing the results of specificity assays using dual fluorescent RAA primer sets for red panda Aleutian virus and red panda canine distemper virus Asia type 6;

[0037] Figure 7 A graph showing the repeatability test results of the dual fluorescent RAA primer set for red panda Aleutian virus and red panda canine distemper virus Asia 6 type;

[0038] Figure 8 The graph shows the repeatability test results of the dual fluorescent RAA primer set for red panda Aleutian virus and red panda canine distemper virus Asia type 6. Detailed Implementation

[0039] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0040] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0041] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0042] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0043] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0044] The dry powder reaction tubes, A Buffer, and B Buffer used in this invention were all purchased from Hangzhou Zhongce Biotechnology Co., Ltd.

[0045] Example 1: Design of Specific Primers and Probes

[0046] DNA of Aleutian virus in red pandas was extracted using the Tiangen Tissue Genomic DNA Extraction Kit and stored at -20℃.

[0047] A positive plasmid was constructed, and a recombinant plasmid DNA containing the target gene, the Aleutian virus NS1 fragment from red pandas, was generated. The recombinant plasmid was transformed into DH5α competent cells for amplification. The plasmid concentration was determined using the Plasmid Mini Kit I kit and stored at -20℃. The partial genomic sequence of the target gene ADV-NS1 is shown in SEQ ID NO.1.

[0048] SEQ ID NO.1:

[0049] TGTTAGCAGGGTTAATATGTAAAGCAACAGTAAACTATGGTGTAGTGACTACAAGCAACCCAAACTTTCCATGGACTGACTGTGGTAATAGAAACATTATCTGGGCTGAAGAGTGTGGTAACTTAGGTAACTGGGTTGAAGATTTTAAAGCCATCACCGGAGGTGGTGATGTGAAAGTAGA.

[0050] RNA was extracted from red panda canine distemper virus Asiatic type 6 using the RNA fast 200 total RNA extraction kit. PrimeScript ™ Prepare cDNA using the RT reagent kit and store at -20℃.

[0051] A positive plasmid was constructed, and a recombinant plasmid DNA containing the target gene fragment of the Asian 6 type N gene of red panda canine distemper virus was constructed. The recombinant plasmid was transformed into DH5α competent cells for amplification. The plasmid concentration was determined by extracting the plasmid using the Plasmid Mini Kit I kit and stored at -20℃. The partial genomic sequence of the target gene, the Asian 6 type N gene of red panda canine distemper virus, is shown in SEQ ID NO.2.

[0052] SEQ ID NO.2:

[0053] CAATATATTGCTAGCTTCCATCTTGGCTCAAATTTGGATCCTGCTCGCTAAAGCAGTGACTGCCCCTGATACCGCAGCCGACTCGGAAATGAGAAGGTGGATTAAGTATACCCAACAGAGACGTGTGGTCGGGGAATTTAGAATGAACAAAATCTGGCTTGATATTGT.

[0054] The amplification products of the above-mentioned red panda Aleutian virus and canine distemper Asia 6 were subjected to agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, the NS1 fragment of Aleutian virus from red pandas and the N gene fragment of canine distemper Asian type 6 were successfully amplified.

[0055] By comparing all red panda Aleutian virus NS1 gene sequences and all red panda canine distemper virus Asia 6 type N gene sequences published in the NCBI GenBank database, specific primers and probes were designed for conserved regions, as shown in Table 1. The primers and probes were all sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for synthesis and modification.

[0056] Table 1 Primer and probe sequences of Aleutian virus and canine distemper virus (Asiatic type 6) in red pandas

[0057]

[0058] The ADV-NS1-Probe probe is T-labeled with a FAM fluorescent group at position 29 of its 5' end, T-labeled with THF tetrahydrofuran at position 31, and T-labeled with a BHQ1 fluorescence quencher group at position 33.

[0059] The CDV-N-Probe probe is labeled with a ROX fluorescent group at position 26 (T) at the 5' end, a THF tetrahydrofuran group at position 30 (A), and a BHQ2 fluorescence quencher group at position 32 (T).

[0060] Example 2: Primer pair screening and optimization

[0061] Three pairs of primers for amplifying the upstream and downstream genes of the red panda Aleutian virus NS1 and the red panda canine distemper virus Asia 6 type N gene were combined in pairs to obtain nine primer-probe combinations, as shown in Table 2.

[0062] Table 2 Primer and probe combinations for red panda ADV and CDV

[0063]

[0064] Based on the reaction quantity, prepare a mixture containing water, A Bufer, upstream primer, downstream primer, and probe according to the reaction system (Table 3), mix thoroughly, and add it to the detection unit tube containing the reaction powder; then add 10 5 Using copies / μL of plasmid standard as a positive control template, add B Buffer to the cap of the detection unit tube, cap the tube, invert and shake gently to mix thoroughly 5-6 times, centrifuge at low speed for 10 seconds, place the detection unit tube in a Genchek fluorescence detector, and react at 39℃ for 20 min to obtain the amplification curve.

[0065] Table 3 RAA Reaction System

[0066]

[0067] The screening results for the optimal primer and probe combinations for red panda ADV are as follows: Figure 2 As shown, the results indicate that the ADV-F1R3 primer-probe combination curve shows the earliest peak and the highest amplification efficiency, making it more suitable for rapid and efficient amplification of Aleutian virus in red pandas. Therefore, the optimal RAA primer set was selected as the upstream primer ADV-NS1-F1, the downstream primer ADV-NS1-R3, and the probe ADV-NS1-Probe.

[0068] The screening results of the best primer and probe combinations for the Asian CDV type 6 red panda are as follows: Figure 3 As shown, the results indicate that the CDV-F1R2 primer-probe combination curve shows the earliest peak and the highest amplification efficiency, making it more suitable for rapid and efficient amplification of the Asian 6 type of CDV in red pandas. Therefore, the optimal RAA primer set was selected as the upstream primer CDV-N-F1, the downstream primer CDV-N-R2, and the probe CDV-N-Probe.

[0069] Example 3: Establishment and Optimization of the Reaction System

[0070] The total reaction system of 50 μL (Table 4) contained 5 μL of sterile water, 25 μL of Buffer A, 2.5 μL of Buffer B, and 2.5 μL each of the Aleutian red panda and canine distemper virus Asia 6 gene templates, totaling 5 μL. The probe concentration was set at 0.2 μM, and the upstream and downstream primer concentration gradients for Aleutian red panda and canine distemper virus Asia 6 were 0.4 μM, 0.5 μM, and 0.6 μM. Nine combinations of the two primer concentrations were formed by cross-reaction. The reaction was carried out at 39℃ for 20 min to obtain the amplification curve.

[0071] Table 4 Optimization of RAA Reaction System

[0072]

[0073] Table 5 Results of RAA primer-probe concentration combinations

[0074]

[0075] Analysis of the detection results (Table 5) shows that the optimal primer-to-probe concentration ratio confirmed in this embodiment is 5:2. Specifically, the upper and lower primer concentrations for red panda Aleutian virus are 0.5 μM, and the probe concentration is 0.2 μM. The lower primer concentration for red panda canine distemper virus Asia 6 is 0.5 μM, and the probe concentration is 0.2 μM.

[0076] Example 4: Dual-fluorescent RAA reaction system, kit, and detection method for red panda Aleutian virus and red panda canine distemper virus Asia 6 type.

[0077] Based on the optimized primer and probe ratios described above, the dual fluorescent RAA reaction systems for red panda Aleutian virus and red panda canine distemper virus Asia type 6 are shown in Table 6.

[0078] Table 6 RAA Dual Fluorescence Detection Reaction System

[0079] Reagent Name Use volume Final concentration RAA dry powder 1 tube - A buffer 25 μL - B buffer 2.5 μL - ADV-NS1-F1 (10 μM) 2 μL 0.5 M ADV-NS1-R3 (10μM) 2 μL 0.5 μM ADV-NS1-Probe 0.5 μL 0.2 μM CDV-N-F1 (10 μM) 2 μL 0.5 μM CDV-N-R2 (10 μM) 2 μL 0.5 μM CDV-N-Probe 0.5 μL 0.2 μM DNA template 5 μL - <![CDATA[H2O]]> 8.5 μL - Total volume 50 μL -

[0080] The specific steps are as follows:

[0081] cDNA was prepared using total RNA from the sample as a template and reverse transcription reagent.

[0082] Using the prepared cDNA as a template, the RAA reaction was carried out according to the reaction system in Table 6. The reaction time was 20 min at 39℃ to obtain the isothermal amplification curve. The FAM channel represents red panda Aleutian virus, and the ROX channel represents red panda canine distemper virus Asia 6.

[0083] Structural determination:

[0084] Isothermal amplification results for positive control: a typical amplification curve appears and Ct≤30; isothermal amplification results for negative control: no amplification curve appears, or Ct>40; both positive and negative controls are valid results and are used as reference standards to determine whether the sample to be tested contains red panda Aleutian virus and red panda canine distemper virus Asia 6.

[0085] Test sample: If the FAM channel or ROX channel shows a typical amplification curve Ct≤35, it means that the test sample contains red panda Aleutian virus or red panda canine distemper virus Asia 6 type.

[0086] Negative: If Ct>35, or no amplification curve appears, the sample is judged as negative, that is, the sample does not contain red panda Aleutian virus and red panda canine distemper virus Asia 6 or does not reach the detection threshold of red panda Aleutian virus and red panda canine distemper virus Asia 6.

[0087] Example 5: Validation of the sensitivity, repeatability, and specificity of the detection method.

[0088] 1. Method sensitivity verification

[0089] To investigate the sensitivity of the fluorescent RAA detection method, the concentration of the constructed positive plasmid was determined using a full-wavelength microplate reader (Thermo Fisher Scientific). The copy number was calculated using the following formula: Copy number (copies / μL) = [DNA concentration (ng / μL) / fragment size (bp)] × 9.12 × 10⁻⁶ 11 The positive plasmid was then serially diluted 10-fold to 10⁻⁶. 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 Copies / μL, using positive plasmids of different dilutions as templates, and employing the reaction system constructed in Example 4, a negative control (sterile water) was set up to determine the sensitivity of the fluorescent RAA detection method. Figure 4 and Figure 5As can be seen, at a concentration as low as 10 copies / μL, both the FAM and ROX channels exhibit obvious amplification curves. Therefore, the detection method provided by this invention has a limit of detection of 10 copies / μL for both Aleutian virus and Canine Distemper Virus Asia 6 type 6 in red pandas.

[0090] 2. Method specificity verification

[0091] To investigate whether the fluorescent RAA detection method would cross-react with other pathogens, cDNAs of feline calicivirus, canine parvovirus, canine distemper Asia type 1 virus, and porcine epidemic diarrhea virus were used as templates. CDNAs containing red panda Aleutian virus and red panda canine distemper Asia type 6 virus were used as templates to set up positive controls, and the specificity of the fluorescent RAA detection method was evaluated.

[0092] The different templates described above were tested using the reaction system constructed in Example 4.

[0093] from Figure 6 As can be seen, the cDNA of red panda Aleutian virus and red panda canine distemper virus Asia 6 showed obvious amplification curves. The negative control and feline calicivirus, canine parvovirus, canine distemper Asia 1 virus and porcine epidemic diarrhea virus as templates did not show curve characteristics.

[0094] The above results indicate that this detection method does not cross-react with other common pathogens, does not react nonspecifically with host RNA, and has high specificity.

[0095] 3. Method repeatability verification

[0096] To investigate the reproducibility of the fluorescent RAA detection method, the template concentration was set at 10. 4 copies / μL, 10 3 Three replicate experiments were performed in parallel using copies / μL, and the results are as follows: Figure 7 and Figure 8 As shown, in 10 4 copies / μL, 10 3 Typical amplification curves were observed at all copies / μL concentrations, demonstrating good reproducibility.

[0097] In summary, the dual-fluorescent RAA detection method for red panda Aleutian virus and red panda canine distemper virus Asia 6 provided by this invention can specifically detect red panda Aleutian virus and red panda canine distemper virus Asia 6 from a variety of pathogens. The detection limit for both viruses is 10 copies / μL, with good repeatability and detection can be completed in 20 minutes. It has good promotional value and application prospects, and can also provide effective technical support for the rapid detection and screening of red panda Aleutian virus and red panda canine distemper virus Asia 6, as well as for the tracing, early warning and comprehensive prevention and control of diseases caused by these two viruses.

[0098] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A primer set for simultaneously detecting red panda Aleutian virus and red panda canine distemper virus Asia 6, characterized in that, Including ADV primer set and CDV primer set; The ADV primer set includes ADV-NS1-F1 with nucleotide sequence as shown in SEQ ID NO.3, ADV-NS1-R3 with nucleotide sequence as shown in SEQ ID NO.8, and ADV-NS1-Probe with nucleotide sequence as shown in SEQ ID NO.9; The CDV primer set includes CDV-N-F1 with nucleotide sequence as shown in SEQ ID NO.10, CDV-N-R2 with nucleotide sequence as shown in SEQ ID NO.13, and CDV-N-Probe with nucleotide sequence as shown in SEQ ID NO.

16.

2. The primer set as described in claim 1, characterized in that, The ADV-NS1-Probe is T-labeled with a FAM fluorescent group at position 29 of its 5' end, T-labeled with THF tetrahydrofuran at position 31, and T-labeled with a BHQ1 fluorescence quencher group at position 33. The CDV-N-Probe is labeled with a ROX fluorescent group at position 26 of the 5' end, a THF tetrahydrofuran group at position 30, and a BHQ2 fluorescence quencher group at position 32.

3. The application of the primer set as described in claim 1 or 2 in the preparation of a kit for simultaneous detection of red panda Aleutian virus and red panda canine distemper virus Asia 6.

4. A kit for simultaneously detecting Aleutian virus and Canine Distemper Virus Asia 6 in red pandas, characterized in that, It includes the primer set as described in claim 1 or 2.

5. The kit according to claim 4, characterized in that, The steps for simultaneously detecting Aleutian virus and canine distemper virus Asia 6 in red pandas using the kit are as follows: Using the cDNA of the sample to be tested as a template, a RAA reaction is performed using the primer set described in claim 1 or 2, fluorescence signals are collected, and the Ct value of the sample to be tested is obtained.

6. The reagent kit as described in claim 5, characterized in that, If a typical amplification curve appears in the FAM channel and Ct≤35, the sample to be tested is determined to contain red panda Aleutian virus; if a typical amplification curve appears in the ROX channel and Ct≤35, the sample to be tested is determined to contain red panda canine distemper virus Asia type 6. If Ct>35, or no amplification curve appears, the sample is judged as negative, meaning that the sample to be tested does not contain red panda Aleutian virus or red panda canine distemper virus Asia 6.

7. The kit according to claim 5, characterized in that, The reaction conditions for the RAA reaction were 39°C for 20 min.

8. The reagent kit as described in claim 5, characterized in that, The reaction system for the RAA reaction consisted of one tube of RAA dry powder, 25 μL of Abuffer, 2.5 μL of B buffer, 2 μL of ADV-NS1-F1, 2 μL of ADV-NS1-R3, 0.5 μL of ADV-NS1-Probe, 2 μL of CDV-N-F1, 2 μL of CDV-N-R2, 0.5 μL of CDV-N-Probe, 5 μL of DNA template, and 8.5 μL of H2O.

9. The reagent kit as described in claim 8, characterized in that, The final concentrations of ADV-NS1-F1, ADV-NS1-R3, CDV-N-F1, and CDV-N-R2 were all 0.5 μM. The final concentrations of both ADV-NS1-Probe and CDV-N-Probe were 0.2 μM.

Citation Information

Patent Citations

  • Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method for panda parvovirus

    CN116024384A

  • Constant-temperature detection kit and detection method for detecting pathogens

    WO2024066083A1