Kdm6a gene knock-in mouse model as well as construction method and application thereof
By inserting a multifunctional expression cassette at the H11 site in mice and combining it with CRISPR/Cas9 technology, we achieved precise integration and stable expression of the Kdm6a gene, solving the problem of unstable expression in traditional techniques and providing an ideal tool for Kdm6a functional studies and drug screening.
Patent Information
- Application Number
- CN202511495144.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-18
- Publication Date
- 2026-01-20
AI Technical Summary
In existing technologies, the Kdm6a gene is located on the X chromosome and its expression regulation is complex. Traditional gene knockout technology cannot accurately simulate its dynamic expression pattern, and random integration or traditional homologous recombination methods have problems such as unclear insertion sites, unstable expression, or affecting neighboring genes.
Through CRISPR/Cas9-mediated genome engineering, an expression cassette containing the CAG promoter, Kozak sequence, mouse Kdm6a CDS, P2A peptide, EGFP reporter gene, WPRE element, and BGH pA tail was inserted at the mouse H11 site, achieving precise integration and stable expression of the Kdm6a gene. The co-expression of Kdm6a and EGFP mediated by the P2A peptide was then visualized and tracked.
A stable, high-level Kdm6a gene expression mouse model was constructed, enabling the visual tracking of the Kdm6a protein. This model is suitable for studying its biological functions, and is particularly applicable to modeling Kabuki syndrome and screening drugs targeting the Kdm6a pathway.
Smart Images

Figure CN121362795A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic engineering and animal model, and particularly relates to a Kdm6a gene knock-in mouse model and a construction method and application thereof. BACKGROUND
[0002] Kdm6a (lysine demethylase 6A) is also known as UTX, which is a histone H3K27me2 / me3 demethylase involved in chromatin remodeling and gene expression regulation. It is a key epigenetic regulatory gene located on the X chromosome, which activates gene expression by removing inhibitory markers on histones, thereby playing a core role in embryonic development, cell differentiation and tumor suppression. Its mutation is closely related to Kabuki syndrome and various cancers.
[0003] In biological and medical research, genetically engineered mouse models are the core tools for analyzing gene function, studying disease mechanisms and screening drugs. In related technologies, animal models for studying Kdm6a function mostly use traditional gene knockout technology. However, due to the location of Kdm6a on the X chromosome, its expression regulation is complex, and the knockout model is difficult to accurately simulate its dynamic expression pattern.
[0004] Therefore, it is of great significance to develop a Kdm6a knock-in mouse model with efficient, stable expression and visual tracking for analyzing Kdm6a function and related disease mechanisms. SUMMARY
[0005] To solve or partially solve the problems in the related art, the present application provides a Kdm6a gene knock-in mouse model and a construction method and application thereof, which can be used for real-time observation of Kdm6a gene expression, and the Kdm6a gene expression in the model is stable, without endogenous gene interference, and can be widely used for preparing Kabuki syndrome and tumor models and screening targeted drugs.
[0006] The first aspect of the present application provides a Kdm6a gene knock-in mouse model, which inserts an expression frame containing a CAG promoter, a Kozak sequence, a mouse Kdm6a CDS, a P2A peptide, an EGFP reporter gene, a WPRE element and a BGH pA tail at a H11 site of the mouse.
[0007] In some embodiments, the H11 site is located intergenically between the Eif4enif1 and Drg1 genes on chromosome 11 of the mouse.
[0008] In some embodiments, the H11 site is located at 0.7 kb upstream of the Eif4enif1 gene and 4.5 kb downstream of the Drg1 gene on chromosome 11 of the mouse.
[0009] In some embodiments, the inserted expression cassette size is 7.7 kb.
[0010] The second aspect of the present application provides a method for constructing a Kdm6a gene knock-in mouse model, comprising the following steps: a) designing and synthesizing gRNA for mouse H11 site; b) constructing a donor vector comprising left and right homology arms and the expression cassette; c) co-injecting gRNA, Cas9 mRNA and the donor vector into mouse zygotes, culturing the zygotes and subculturing to construct a Kdm6a gene knock-in homozygous mouse model.
[0011] In some embodiments, the target sequence of the gRNA is GAACACTAGTGCACTTATCCTGG.
[0012] In some embodiments, in the process of culturing the zygotes and subculturing in step c), F0 positive mice are identified by PCR and sequencing; the primer pairs used for identification include: The primer pairs include: F1: 5'-GTACATCCACAGCATCTTCCAAG-3'; R1: 5'-AGATGTACTGCCAAGTAGGAAAGTC-3'; and / or, F2: 5'-ATCACTCTCGGCATGGACGAG-3'; R2: 5'-TGTGAGTCACCACGCTTGCTTG-3'.
[0013] The third aspect of the present application provides a use of the above-mentioned Kdm6a gene knock-in mouse model in Kdm6a gene expression research.
[0014] The fourth aspect of the present application provides a use of the Kdm6a gene knock-in mouse model in preparing a model for studying Kdm6a-related diseases.
[0015] In some embodiments, the Kdm6a-related diseases include but are not limited to Kabuki syndrome, bladder cancer, pancreatic cancer, medulloblastoma.
[0016] The technical scheme provided in the application can have the following beneficial effects: the Kdm6a gene is successfully integrated into the H11 site of a mouse by gene knock-in technology, random insertion damage to the endogenous gene and unpredictability are avoided, and a mouse model capable of stable and high-level expression and visual tracking of the Kdm6a gene is constructed. Further, the mouse model successfully realizes efficient and high-fidelity insertion of a large fragment of DNA.
[0017] The Kdm6a protein expressed by the mouse model has complete demethylase activity, and the EGFP fluorescence signal can accurately reflect the expression dynamics of the endogenous Kdm6a, thereby providing a highly reliable platform for studying the biological function thereof. The mouse model has good consistency and is an ideal tool for studying the function of Kdm6a in the fields of development, immunity, tumors and the like, and is particularly suitable for Kabuki syndrome disease modeling, high-throughput screening and efficacy evaluation of drugs targeting the Kdm6a pathway.
[0018] It should be understood that the foregoing general description and the following detailed description are only exemplary and explanatory, and are not limiting to the application. BRIEF DESCRIPTION OF DRAWINGS
[0019] The above and other objects, features and advantages of the present application will become more apparent from the following detailed description when taken in conjunction with the accompanying drawings in which like reference characters refer to like parts throughout the different views of the drawings.
[0020] Figure 1 is a design strategy diagram of the Kdm6a gene knock-in mouse model shown in the embodiments of the application; Figure 2 is a genotype identification result of the Kdm6a gene knock-in mouse model shown in the embodiments of the application. DETAILED DESCRIPTION
[0021] Embodiments of the present application will be described in more detail by making reference to the drawings. Although the embodiments of the present application are shown in the drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided in order to make the present application more thorough and complete, and to fully convey the scope of the present application to those skilled in the art.
[0022] The terms used in the present application are merely for the purpose of describing specific embodiments and are not intended to limit the present application. The singular forms "a", "an" and "the" used in the present application and the appended claims are also intended to include the plural forms, unless the context clearly indicates otherwise. It should also be understood that the term "and / or" used herein means and includes any or all possible combinations of one or more associated listed items.
[0023] It should be understood that although the terms "first," "second," "third," etc., may be used in this application to describe various information, this information should not be limited to these terms. These terms are only used to distinguish information of the same type from one another. For example, without departing from the scope of this application, first information may also be referred to as second information, and similarly, second information may also be referred to as first information. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of this application, "multiple" means two or more, unless otherwise explicitly specified.
[0024] In related technologies, animal models for studying Kdm6a function often employ traditional gene knockout techniques. However, because Kdm6a is located on the X chromosome, its expression regulation is complex, making it difficult for knockout models to accurately simulate its dynamic expression patterns. Furthermore, the random integration or traditional homologous recombination techniques used in related technologies are not suitable for directly constructing animal models of Kdm6a function. Random integration suffers from unclear insertion sites, unstable expression, or interference with neighboring genes, resulting in expression silencing or abnormally high expression. Traditional homologous recombination relies on embryonic stem cells, which has a long cycle and makes positive clone screening difficult.
[0025] To address the aforementioned issues, this application provides a Kdm6a gene knock-in mouse model, its construction method, and its applications. This model enables the efficient construction of highly specific mouse models with low off-target effects, and achieves stable expression and visual tracking of the mouse model. It has broad applicability in the fields of Kdm6a function research, rare disease mechanism analysis, cancer research, and drug screening.
[0026] The technical solutions of the embodiments of this application are described in detail below.
[0027] Figure 1 This is a diagram illustrating the design strategy of the Kdm6a gene knock-in mouse model as shown in the embodiments of this application.
[0028] See Figure 1 The H11 site in the genome of this mouse model integrates an exogenous expression cassette, which, from the 5' end to the 3' end, sequentially includes: the CAG promoter, the Kozak sequence, the mouse Kdm6a CDS, the P2A peptide, the EGFP reporter gene, the WPRE element, and the expression cassette of BGH pA.
[0029] The mouse Kdm6a gene described in this application is located on the mouse X chromosome (NCBI reference sequence: NM_009483.3). The mouse described in this application can be a C57BL / 6JCya mouse. A mouse Kdm6a gene knock-in model was created at the H11 site of C57BL / 6JCya mice using CRISPR / Cas-mediated genome engineering.
[0030] The H11 site (Hipp11) is a "safe harbor" region on chromosome 11 of the mouse, and the exogenous gene inserted therein can be stably expressed and does not interfere with the function of the genome itself. By inserting the expression frame containing the Kdm6a gene into the H11 site, not only can the Kdm6a gene be precisely knocked in to avoid the problem of uncontrollable expression and the influence on the expression of other genes caused by random integration, but also the sequence of the H11 site can precisely target the designed gRNA with high specificity to knock in the H11 site, reduce the misediting of other non-target regions, reduce the risk of off-target, and realize the stable and low-interference expression of the Kdm6a gene.
[0031] The "expression frame" described herein refers to a complete and independent gene expression unit, which usually contains a DNA fragment of multiple functional elements, and these elements can stably exist in the host cell genome and guide the transcription and expression of functional genes. The expression frame described in the embodiments of the present application integrates the elements of the promoter, the target gene, the reporter gene and the like, to ensure the stable expression of the Kdm6a protein and the tracking by the fluorescence signal.
[0032] The "CAG promoter" described herein is a strong constitutive promoter composed of a fusion of the early enhancer of cytomegalovirus (CMV) and the chicken beta-actin promoter, which can drive the exogenous gene to achieve extensive and efficient high-level constitutive expression in various tissues and cell types.
[0033] The "Kozak sequence" described herein is a conserved nucleotide sequence (the core is "GCCACCATGG") located around the start codon ATG of mRNA in eukaryotes. Its main function is to promote the accurate recognition and assembly of ribosomes, thereby efficiently initiating the translation process of proteins and improving the expression level of the target protein.
[0034] The "mouse Kdm6a CDS" described herein refers to the coding sequence of the mouse Kdm6a gene, which is a DNA fragment that is transcribed into mRNA and further translated into Kdm6a protein. It can specifically catalyze the demethylation of lysine at position 27 of histone H3, thereby playing a key role in epigenetic regulation, embryonic development and tumor occurrence.
[0035] The "P2A peptide" described herein is a "self-cleavage" polypeptide sequence derived from a virus, about 20 amino acids. When it is translated into a protein by a ribosome, it will break at its own C-terminal end, realizing the expression of one mRNA as two independent proteins. In the embodiments of the present application, Kdm6a and EGFP can be expressed as two independent proteins in a coordinated and equimolar manner under the drive of the same promoter.
[0036] The "EGFP" described herein is an enhanced green fluorescent protein, which encodes a protein that emits stable green fluorescence under blue light excitation. In the embodiments of the present application, it is connected in series with Kdm6a through a P2A peptide, and can be used as an intuitive and non-invasive marker for loss, for real-time positioning and enrichment of cells expressing Kdm6a.
[0037] The "WPRE (Woodchuck Hepatitis Virus Post-transcriptional Regulatory Element)" described herein is a woodchuck hepatitis virus post-transcriptional regulatory element, which functions to enhance the stability and nuclear export efficiency of mRNA, reduce the degradation of mRNA, and thus increase the expression amount of an exogenous gene.
[0038] The "BGH pA" described herein refers to a bovine growth hormone polyadenylation signal, which is a DNA sequence that guides the addition of a polyA tail to mRNA. The polyA tail can protect mRNA from degradation and promote its transport from the nucleus to the cytoplasm, ensuring proper termination of the transcription process and mRNA maturation.
[0039] The Kdm6a gene knock-in mouse model of the embodiments of the present application, by targeting the H11 safe harbor site, can enable the expression of an exogenous gene to be unaffected by the surrounding chromatin environment, i.e., to ensure stable expression of the expression frame comprising the Kdm6a and EGFP genes described in the embodiments of the present application, and also to avoid interference with the functions of endogenous genes such as Eif4enif1 and Drg1, and to avoid the unpredictability caused by random knock-in genes. Furthermore, Kdm6a and EGFP are co-expressed and functionally independent through the mediation of the P2A peptide, and the organization distribution and dynamic changes of Kdm6a can be directly observed by fluorescence microscopy, enabling real-time, in situ, and visualized tracking. This makes the model widely applicable in the fields of epigenetic regulation mechanism research of Kdm6a, construction of disease models such as Kabuki syndrome, and drug screening for diseases related to Kdm6a.
[0040] In the embodiments of the present application, the H11 site is located in the intergenic region between the Eif4enif1 and Drg1 genes on mouse chromosome 11, and more specifically is located (0.7±0.5) kb upstream of the Eif4enif1 gene and (4.5 kb±0.5) downstream of the Drg1 gene on mouse chromosome 11.
[0041] In the embodiments of the present application, the inserted expression frame is (7.7 ± 0.5) kb. In the embodiments of the present application, a complex expression frame with a length of about 7.7 kb (of which the Kdm6a CDS is about 4.3 kb) can be integrated into the mouse H11 site, realizing the coordinated stable expression of Kdm6a and EGFP.
[0042] In the embodiments of the present application, a Kdm6a gene knock-in model of the mouse H11 site of C57BL / 6JCya mice is created through CRISPR-Cas9-mediated genome engineering. Through the optimized CRISPR-Cas9 system and the homologous recombination repair strategy, a complex expression frame with a full length of about 7.7 kb and containing multiple functional elements can be precisely and efficiently integrated into the mouse H11 "safe harbor" site, solving the long-term problems of large fragment DNA in cloning stability, embryo delivery and integration efficiency, realizing an important breakthrough in technology. Through the "P2A peptide" mediated Kdm6a and EGFP coordinated expression, the non-invasive, real-time and high-resolution tracking and sorting of Kdm6a positive cells in vivo of mammals are realized for the first time, making it possible to directly observe the spatiotemporal dynamic changes of Kdm6a in embryonic development, tissue homeostasis and tumor microenvironment, and providing a brand new model for Kdm6a expression research. Using the characteristics of the mouse H11 site, the position effect and expression silencing caused by random transgenesis can be completely avoided, ensuring the stable and uniform high-level expression of exogenous genes in various tissues. Through sequencing and functional verification, the model has excellent reliability and repeatability. The model constructed in the present application provides an ideal platform closest to the physiological state for studying the function of Kdm6a in Kabuki syndrome, various cancers and immune diseases, and is not only suitable for basic mechanism exploration, but also can provide effective application value for high-throughput drug screening, drug efficacy evaluation and personalized treatment strategy development targeting Kdm6a pathway.
[0043] The embodiments of the present application also provide a method for constructing the above-mentioned mouse model, which comprises the following steps: a) designing and synthesizing a gRNA for the mouse H11 site; b) constructing a donor vector containing left and right homologous arms and the expression frame; c) co-injecting the gRNA, Cas9 mRNA and the donor vector into a mouse zygote, cultivating the zygote and performing subculture, to construct a homozygous mouse model of Kdm6a gene knock-in.
[0044] The target sequence of the designed gRNA is GAACACTAGTGCACTTATCCTGG.
[0045] The Cas9 mRNA refers to an mRNA molecule encoding a Cas9 protein, and its core function is to serve as a template for protein synthesis, which is recognized by ribosomes in cells and translated into a Cas9 protein with endonuclease activity. The Cas9 protein is a key component of the CRISPR-Cas9 gene editing system, which can accurately recognize and cut specific genomic sites through base complementary pairing between gRNA and target DNA sequence after forming a complex with gRNA, thereby achieving editing (such as knockout, insertion, or modification) of target genes. In the present application, the Cas9 mRNA is synthesized by in vitro transcription technology, which has the characteristics of clear sequence, efficient introduction into cells, and avoidance of DNA integration risk, etc. It cooperates with gRNA targeting specific sites to jointly mediate precise modification of the target genome, providing a core tool for efficient and specific gene editing. The Cas9 mRNA does not need to enter the nucleus, is rapidly translated and has a short half-life, can be transiently expressed in early embryos and rapidly degraded, thereby reducing the risk of off-target cutting and persistent toxicity, and is suitable for constructing a Kdm6a gene knockout homozygous mouse model.
[0046] The specific steps of step b) for constructing the donor vector are as follows: taking a BAC clone as a template, the homologous arms on both sides of the H11 site, i.e. the left and right homologous arms, are obtained by PCR amplification. Therefore, the constructed donor vector contains a 5' homologous arm-expressing frame-3' homologous arm, and the expressing frame is cloned between the two homologous arms. The 5' homologous arm is about 1.5 kb, and the 3' homologous arm is about 1.2 kb.
[0047] Step c) specifically includes: c-1) Fertilized egg injection and embryo transplantation: purified gRNA, Cas9 mRNA and donor vector are injected into mouse zygote pronuclei, and surviving zygotes are transplanted into pseudopregnant female mice for culture, and F0 generation mice are obtained after the female mice give birth.
[0048] c-2) Positive mouse screening and passage verification: extract F0 generation mouse DNA, PCR and sequencing verification to screen F0 generation positive mice; crossbreed with wild type mice, and again perform PCR and sequencing verification to screen F1 generation positive mice; crossbreed the heterozygotes to screen Kdm6a gene knockout homozygous mouse models.
[0049] In the above step c-2), mouse DNA can be extracted from the tail tip tissue and extracted by TaKaRa genome extraction kit.
[0050] In the above step c-2), 1 pair or 2 pairs of specific primers can be used to amplify the 5' and 3' integration boundaries to verify the F0 generation positive mice and the F1 generation positive mice. The positive PCR product is subjected to Sanger sequencing to verify that the expression frame is not mutated and is accurately integrated with the H11 site.
[0051] The specific primer pair therein includes F1 / R1 and / or F2 / R2. The Taq DNA polymerase used in the PCR amplification process can be Vazyme P520.
[0052] Forward primer F1: 5'-GTACATCCACAGCATCTTCCAAG-3' Reverse primer R1: 5'-AGATGTACTGCCAAGTAGGAAAGTC-3' Forward primer F2: 5'-ATCACTCTCGGCATGGACGAG-3' Reverse primer R2: 5'-TGTGAGTCACCACGCTTGCTTG-3' The annealing temperature of the F1 / R1 primer pair and the F2 / R2 primer pair described above is 60°C.
[0053] The sequencing primer pair used in Sanger sequencing can be F3 / R3.
[0054] Forward primer F3: 5'-CTCTACTGGAGGAGGACAAACTG-3' Reverse primer R3: 5'-GTCTTCCACCTTTCTTCAGTTAGC-3' The homozygous mouse verified in the step c-2) can be subjected to PCR amplification and sequencing screening using the following homozygous screening primer F4 / R4, and the homozygous target fragment (targeting allele 451bp).
[0055] Forward primer F4: 5'-ATCACTCTCGGCATGGACGAG-3' Reverse primer R4: 5'-AAGGAAAGGACGATGATTTCCC-3' The annealing temperature in the PCR process for verifying the homozygous mouse can also be 60°C.
[0056] The mouse model described above can be applied in the study of Kdm6a gene expression.
[0057] The mouse model described above can be applied in the preparation of a Kdm6a-related disease model for research. The Kdm6a-related diseases include but are not limited to Kabuki syndrome, bladder cancer, pancreatic cancer, medulloblastoma.
[0058] In the embodiments of the present application, a Kdm6a gene knock-in model is created at the H11 site of C57BL / 6J Cya mice through CRISPR-Cas9-mediated genome engineering. Through an optimized CRISPR-Cas9 system and a homologous recombination repair strategy, a complex expression frame with a full length of about 7.7 kb and containing multifunctional elements can be precisely and efficiently integrated into the mouse H11 "safe harbor" site, solving the long-term problems of large fragment DNA in cloning stability, embryo delivery and integration efficiency, and realizing an important breakthrough in technology. Through the synergistic expression of Kdm6a and EGFP mediated by "P2A peptide", the non-invasive, real-time and high-resolution tracking and sorting of Kdm6a positive cells are realized for the first time in vivo of mammals, making it possible to directly observe the spatiotemporal dynamic changes of Kdm6a in embryonic development, tissue homeostasis and tumor microenvironment, and providing a brand-new model for Kdm6a expression research. Using the characteristics of the mouse H11 site, the position effect and expression silencing caused by random transgenesis can be completely avoided, ensuring stable and uniform high-level expression of exogenous genes in various tissues. Sequencing and functional verification show that the model has excellent reliability and repeatability. The model constructed in the present application provides an ideal platform closest to the physiological state for studying the function of Kdm6a in Kabuki syndrome, various cancers and immune diseases, and is not only suitable for basic mechanism exploration, but also can provide effective application value for high-throughput drug screening, drug efficacy evaluation and personalized treatment strategy development targeting Kdm6a pathway.
[0059] Example 1 Construction of donor vector According to the sequence of the mouse H11 site, a gRNA with a target sequence of GAACACTAGTGCACTTATCCTGG (as shown in SEQ ID NO: 1) is designed and synthesized.
[0060] A BAC clone is used as a template to amplify the left homologous arm (about 1.0 kb) and the right homologous arm (about 1.0 kb) by PCR. The CAG-Kozak-Kdm6a CDS-P2A-EGFP-WPRE-BGH pA (the sequence is shown in the following table) is sequentially connected by Gibson assembly to form an expression frame, and then the expression frame is cloned between the two homologous arms to obtain a donor vector plasmid (the expression frame is about 7.7 kb).
[0061] The sequence table of the CAG promoter is shown in SEQ ID NO: 2 and Table 1: Table 1 Sequence table of CAG promoter
[0062] The sequence listing of the Kozak-mouse Kdm6a CDS (mouse Kdm6a CDS reference NCBI Reference Sequence: NM_009483.3) is shown in SEQ ID NO: 3 and Table 2: Table 2 Sequence listing of Kozak-mouse Kdm6a CDS
[0063] The sequence listing of the P2A is shown in SEQ ID NO: 4 and Table 3: Table 3 Sequence listing of P2A
[0064] The sequence listing of the EGFP is shown in SEQ ID NO: 5 and Table 4: Table 4 Sequence listing of EGFP
[0065] The sequence listing of the WPRE is shown in SEQ ID NO: 6 and Table 5: Table 5 Sequence listing of WPRE
[0066] The sequence listing of the BGH pA is shown in SEQ ID NO: 7 and Table 6: Table 6 Sequence listing of BGH pA
[0067] Example 2 Microinjection and embryo transfer 6-8 week old C57BL / 6J female mice were injected intraperitoneally with PMSG (10 IU), and 48 h later with hCG (10 IU), and were caged with male mice; the next day, the oviducts were taken, and the zygotes were flushed out with M2 medium, and 200 morphologically normal zygotes were selected.
[0068] gRNA (target sequence: GAACACTAGTGCACTTATCCTGG) and Cas9 mRNA were transcribed in vitro. 100 ng / μL Cas9 mRNA, 50 ng / μL gRNA and 20 ng / μL donor vector plasmid were mixed and microinjected into the pronuclei of 200 C57BL / 6J Cya mouse zygotes, and 160 survived. The surviving zygotes were transplanted into pseudopregnant ICR female mice, 20 zygotes were transplanted into each female mouse, and a total of 8 female mice were used, and finally 12 F0 mice were born.
[0069] 3-week-old F0 mice were cut tail tip, and DNA was extracted using a kit. In a microcentrifuge tube, 100 μL of tail digestion buffer was added to each tail tip (2-5 mm), and after incubation at 56°C overnight, the proteinase was denatured by incubation at 98°C for 13 min. After centrifugation of the tube in a microcentrifuge at 12000 rpm for 15 min, 2 μL of eluted genomic DNA was taken from the tube and quantified by electrophoresis or absorbance.
[0070] The tail digestion buffer therein includes: 50 mM potassium chloride, 10 mM Tris-HCl (pH 9.0), 0.1 % Triton X-100, 0.4 mg / mL proteinase K.
[0071] Example 3 Genotype identification PCR amplification was performed using primer pairs F1 / R1 and F2 / R2.
[0072] F1: 5'-GTACATCCACAGCATCTTCCAAG-3' R1: 5'-AGATGTACTGCCAAGTAGGAAAGTC-3' F2: 5'-ATCACTCTCGGCATGGACGAG-3' R2: 5'-TGTGAGTCACCACGCTTGCTTG-3' The mouse tail genomic DNA 1 μL, forward primer 1 μL, reverse primer 1 μL, and premixed TAq polymerase 12.5 μL, and double-distilled water 9.5 μL were added. The denaturation reaction was performed at 95°C for about 3 min, the annealing reaction was performed at 60°C for 15 s, and the extension reaction was performed at 72°C for about 5 min. The amplification product was obtained after 35 cycles. The amplification product was electrophoresed in a 1% agarose gel, and the verification results were as shown in Figure 2
[0073] According to the electrophoresis results, 3 kb and 3.1 kb positive bands were obtained by primer pair F1 / R1 and primer pair F2 / R2, respectively, and a total of 3 positive F0 (numbered F0-5, F0-10, F0-13) mice were obtained. The positive product was confirmed by sanger sequencing to be integrated with the H11 site without mutation or deletion, and the expression frame was not mutated or deleted.
[0074] Example 4 Inbred breeding The positive F0 mice were mated with C57BL / 6J wild-type mice, and 8 F1 mice were obtained. No mutation or deletion was found after PCR and sequencing reaction verification. PCR amplification was performed using F1 / R1 primer pairs and F2 / R2 primer pairs, and sequencing was performed using F3 / R3 primer pairs.
[0075] F1: 5'-GTACATCCACAGCATCTTCCAAG-3' R1: 5'-AGATGTACTGCCAAGTAGGAAAGTC-3' F2: 5'-ATCACTCTCGGCATGGACGAG-3' R2: 5'-TGTGAGTCACCACGCTTGCTTG-3' F3: 5'-CTCTACTGGAGGAGGACAAACTG-3' R3: 5'-GTCTTCCACCTTTCTTCAGTTAGC-3' The hybrid target F1 generation mice were crossed to produce homozygous targeted mice, and 15 F2 generation mice were obtained. PCR and sequencing by primer pairs showed that 4 homozygous mice were obtained, the birth rate was normal, there was no appearance deformity, and both males and females were fertile. F4 / R4 primer pairs were used: F4: 5'-ATCACTCTCGGCATGGACGAG-3' R4: 5'-AAGGAAAGGACGATGATTTCCC-3' Among them, the wild type is one band with a size of 519bp; Homozygote: one band, size 451bp; Heterozygote: two bands, sizes are 451bp and 519bp respectively.
[0076] In the embodiments of the application, the CAG-Kozak-Kdm6a CDS-P2A-EGFP-WPRE-BGH pA expression frame is targeted to the mouse H11 safe harbor site, so that the expression of the exogenous gene of the knock-in mouse is not affected by the surrounding chromatin environment, and the functions of endogenous genes such as Eif4enif1 and Drg1 are not interfered; and Kdm6a and EGFP can be co-expressed and functionally independent through P2A peptide mediation, thereby realizing the visualization and real-time tracking of Kdm6a gene expression. Moreover, in the construction of a mouse model, no embryonic stem cells are needed, and only 2-3 months after fertilized egg injection can homozygous mouse models be obtained, and the F1 generation of mice has a positive rate of ≥30%, which significantly shortens the construction period of the mouse model, is conducive to its application in Kdm6a gene expression research and the construction of Kdm6a-related disease models, and has a wide range of applications.
[0077] Having described various embodiments of the application, it is to be understood that the above description is meant not to limit and not to encompass all of the possible embodiments. Many modifications and variations of this application can be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. It is intended that the scope of the application be defined by the scope of the patent and by the claims as allowed by the patent office, which can include adaptations based on the description, equivalents, and / or substitutions of elements individually or collectively to the entire disclosure.
Claims
1. A Kdm6a knock-in mouse model, characterized in that, The H11 site in the mouse genome is integrated with an exogenous expression frame, which comprises from 5' end to 3' end: CAG promoter, Kozak sequence, mouse Kdm6a CDS, P2A peptide, EGFP reporter gene, WPRE element and BGH pA expression frame.
2. The mouse model of claim 1, wherein, The H11 site is located in the intergenic region between the Eif4enif1 and Drg1 genes on mouse chromosome 11.
3. The mouse model of claim 2, wherein the mouse model is a mouse model of Alzheimer's disease. The H11 site is located (0.7 ± 0.5) kb upstream of the Eif4enif1 gene and (4.5 kb ± 0.5) downstream of the Drg1 gene on mouse chromosome 11.
4. The mouse model of claim 1, wherein, The size of the inserted expression frame is (7.7 ± 0.5) kb.
5. A method for constructing a mouse model according to any one of claims 1 to 4, characterized in that, The method comprises the following steps: a) Design and synthesize gRNA targeting the mouse H11 site; b) Construct a donor vector comprising left and right homologous arms and the expression frame; c) Co-inject gRNA, Cas9 mRNA and donor vector into mouse zygotes, incubate the zygotes and pass them on to construct a Kdm6a gene knock-in homozygous mouse model.
6. The method of claim 5, wherein, The target sequence of the gRNA is GAACACTAGTGCACTTATCCTGG.
7. The method of claim 5, wherein, In the process of incubating the zygotes and passing them on in step c), F0 positive mice are identified by PCR and sequencing; the primer pairs used for identification include: F1: 5'-GTACATCCACAGCATCTTCCAAG-3'; R1: 5'-AGATGTACTGCCAAGTAGGAAAGTC-3'; and / or, F2: 5'-ATCACTCTCGGCATGGACGAG-3'; R2: 5'-TGTGAGTCACCACGCTTGCTTG-3'.
8. Use of the Kdm6a gene knock-in mouse model of any one of claims 1 to 4 in Kdm6a gene expression research.
9. Use of the Kdm6a gene knock-in mouse model of any one of claims 1 to 4 in the preparation of a Kdm6a-related disease model for research.
10. Use according to claim 9, characterized in that, The Kdm6a-related diseases include but are not limited to Kabuki syndrome, bladder cancer, pancreatic cancer, medulloblastoma.