A method for enzymatic production of rebaudioside m

Abstract

The present application belongs to the field of genetic engineering and enzyme engineering, and particularly relates to a method for producing rebaudioside M by enzyme method. The method comprises the following steps: S1, adding a recombinant cell crushing liquid mixture 1 to a buffer solution to obtain a pre-reaction liquid 1 (a mixture of recombinant cell crushing liquids of recombinant strains UGT11 (S158F) and AtSUS (P94N)), collecting the precipitate after reaction; S2, after the precipitate is dissolved, adding a recombinant cell crushing liquid mixture 2 (a mixture of recombinant cell crushing liquids of recombinant strains UGT76G1 (G83Q) and AtSUS (P94N)), adding a buffer solution to obtain a pre-reaction liquid 2, collecting the reaction liquid to obtain Reb M. The method can effectively solve the problems of low Reb M content and poor specificity in the prior extraction, and can realize a conversion rate of Reb A to Reb M up to 93.33%.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and enzyme engineering, and specifically relates to an enzymatic method for producing rebaudioside M. Background Technology

[0002] Rebaudioside M (Reb M for short) is a natural steviol glycoside extracted from stevia rebaudiana (STV) leaves. It belongs to the tetracyclic diterpenoid class of compounds and has the molecular formula C2. 56 H 90 O 33 Its sweetness is approximately 200-350 times that of sucrose, and it features zero calories, high solubility, high temperature resistance, and strong pH stability. As a novel natural sweetener, Reb M is widely used in the food, pharmaceutical, and other health-related industries. In the food and beverage sector, Reb M is mainly used as a sugar substitute in sugar-free beverages and low-calorie foods, meeting consumers' growing demand for "natural, low-calorie" sweeteners. Simultaneously, Reb M exhibits good acid and alkali resistance, heat resistance, and stability; it is not fermented by microorganisms and is not prone to Maillard reactions, thus Reb M products have good storage stability and are resistant to long-distance transportation. In the pharmaceutical field, Reb M has high medicinal value. Long-term use can promote glucose metabolism by stimulating insulin secretion, while simultaneously inhibiting glycogenolysis and glucose production in the liver to lower blood sugar; it can also reduce blood sugar by inhibiting angiotensin-converting enzyme activity and reducing sodium. + Reabsorption and inhibition of Ca 2+ It has effects such as lowering blood pressure by flowing into vascular smooth muscle cells, and also has pharmacological activities such as preventing tooth decay and anti-tumor activity.

[0003] Currently, the traditional production methods for Rebaudioside M rely on natural extraction and chemical preparation. Among naturally extracted steviol glycosides, steviol glycoside (STV) and Rebaudioside A (RA) account for a relatively high proportion. These components have limited applications due to their pronounced bitter aftertaste. Meanwhile, Rebaudioside D (RD) and Reb M, which have higher sweetness and weaker bitter aftertaste, are present in extremely low amounts in natural extracts.

[0004] Traditional extraction methods suffer from problems such as cumbersome processes, low extraction efficiency, and high costs. Chemical methods modify the structure of existing steviol glycosides to improve their physical properties and flavor. Common methods include Yu's glycosylation as the primary approach, supplemented by Schmidt glycosylation, PTC glycosylation, etc., to synthesize high-end steviol glycoside products such as Reb M and Reb S. However, chemical synthesis methods have drawbacks such as poor specificity and potential environmental pollution.

[0005] In recent years, with the rise and development of synthetic biology, biological methods for producing Reb M are gradually replacing traditional separation and extraction methods, becoming the mainstream approach for large-scale production. Biological production of Reb M has significant advantages such as mild reaction conditions, high specificity, and being environmentally friendly and pollution-free. Its core principle is to utilize specific glucosyltransferases to add glucose groups to the corresponding sites of steviol glycosides, thereby converting the high content of steviol glycosides in stevia leaves into Reb M, which is present in trace amounts but has higher economic value. Enzymatic catalysis, leveraging synthetic biology technology, utilizes glycosyltransferases produced by engineered bacteria fermentation to achieve efficient conversion. This process aligns better with the concept of green manufacturing, offering advantages such as mild reaction conditions, high specificity, and being environmentally friendly and pollution-free.

[0006] Patent CN114574460B describes a coupling reaction between the glycosyltransferase mutant UGT76G1-T284S / M88L / L200A and the Arabidopsis-derived sucrose synthase AtSuSy to achieve efficient catalytic synthesis of rebaudioside M using Reb D as a substrate. By adding Reb D as a substrate in a fed-batch manner, a reaction was carried out at 22.58 g / L (20 mM) of Reb D for 7 hours, resulting in the efficient synthesis of 23.37 g / L Reb M with a yield of 90.5%. This method relies on Reb D as the starting substrate, but the RD content in natural stevia is extremely low (typically <0.1%), requiring additional processing to convert it from the higher-content Reb A, increasing the cost and complexity of precursor preparation.

[0007] Therefore, providing a method for producing Reb M using an enzymatic process based on site-directed mutagenesis recombinase, which has high conversion rate, is green and controllable, and is easy to scale up, is a necessary trend to break through traditional production bottlenecks and meet the demand for natural low-calorie sweeteners in the food and pharmaceutical fields. Summary of the Invention

[0008] In view of the shortcomings of the prior art, the present invention aims to provide an enzymatic method for producing rebaudioside M.

[0009] The technical solution of the present invention includes: On one hand, the present invention provides a method for the enzymatic production of rebaudioside M, the method comprising the following steps: S1. Add recombinant cell lysis buffer mixture 1 to the substrate, add to the buffer solution to obtain pre-reaction solution 1, and collect the precipitate after the reaction. S2. After the precipitate is dissolved, add recombinant cell lysis buffer mixture 2, add buffer solution to obtain pre-reaction solution 2, collect the reaction solution to obtain lebodiin M; The recombinant cell lysate mixture 1 mentioned in step S1 is a mixture of recombinant cell lysate of recombinant strain UGT11 (S158F) and recombinant cell lysate of recombinant strain AtSUS (P94N). The recombinant cell lysate mixture 2 mentioned in step S2 is a mixture of recombinant cell lysate of recombinant strain UGT76G1 (G83Q) and recombinant cell lysate of recombinant strain AtSUS (P94N). The recombinant strain UGT11 (S158F) has the accession number CGMCC No. 34492; the recombinant strain UGT76G1 (G83Q) has the accession number CGMCC No. 34493; and the recombinant strain AtSUS (P94N) has the accession number CGMCC No. 34494.

[0010] Specifically, in step S1, the enzyme activity ratio of the recombinant cell lysate of recombinant strain UGT11 (S158F) and the recombinant cell lysate of recombinant strain AtSUS (P94N) in the recombinant cell lysate mixture 1 is 0.5-1.5:1. Preferably, the enzyme activity ratio of the recombinant cell lysate of recombinant strain UGT11 (S158F) and the recombinant cell lysate of recombinant strain AtSUS (P94N) in the recombinant cell lysate mixture 1 described in step S1 is 0.5-0.6:1, 0.6-0.7:1, 0.7-0.8:1, 0.8-0.9:1, 0.9-1.0:1, 1.0-1.1:1, 1.1-1.2:1, 1.2-1.3:1, 1.3-1.4:1 or 1.4-1.5:1.

[0011] More preferably, the enzyme activity ratio of the recombinant cell lysate of recombinant strain UGT11 (S158F) and the recombinant cell lysate of recombinant strain AtSUS (P94N) in the recombinant cell lysate mixture 1 described in step S1 is 1:1.

[0012] Specifically, in step S2, the enzyme activity ratio of the recombinant cell lysate of recombinant strain UGT76G1 (G83Q) to the recombinant strain AtSUS (P94N) in the recombinant cell lysate mixture 2 is 0.5-1.5:1.

[0013] Preferably, the enzyme activity ratio of the recombinant cell lysate of recombinant strain UGT76G1 (G83Q) and the recombinant strain AtSUS (P94N) in the recombinant cell lysate mixture 2 in step S2 is 0.5-0.6:1, 0.6-0.7:1, 0.7-0.8:1, 0.8-0.9:1, 0.9-1.0:1, 1.0-1.1:1, 1.1-1.2:1, 1.2-1.3:1, 1.3-1.4:1 or 1.4-1.5:1.

[0014] More preferably, in step S2, the ratio of the recombinant cell lysate of recombinant strain UGT76G1 (G83Q) to the enzyme activity of recombinant strain AtSUS (P94N) in the recombinant cell lysate mixture 2 is 1:1.

[0015] Specifically, the substrate mentioned in step S1 includes any one or more of uridine diphosphate, sucrose, and mixed sugar powder; Preferably, the total glycosides in the mixed sugar powder account for 90% by mass.

[0016] Preferably, the substrate in step S1 comprises 0.05-0.2 mmol / L uridine diphosphate, 50-150 mM sucrose, and 25-55 g / L mixed sugar powder.

[0017] More preferably, the substrate in step S1 contains 0.05-0.06 mmol / L, 0.06-0.07 mmol / L, 0.07-0.08 mmol / L, 0.08-0.09 mmol / L, 0.09-0.10 mmol / L, 0.10-0.11 mmol / L, 0.11-0.12 mmol / L, 0.12-0.13 mmol / L, 0.13-0.14 mmol / L, 0.14-0.15 mmol / L, 0.15-0.16 mmol / L, 0.16-0.17 mmol / L, 0.17-0.18 mmol / L, 0.18-0.19 mmol / L, or 0.19-0.20 mmol / L uridine diphosphate.

[0018] More preferably, the substrate described in step S1 contains 50-55mM, 55-60mM, 60-65mM, 65-70mM, 70-75mM, 75-80mM, 80-85mM, 85-90mM, 90-95mM, 95-100mM, 100-105mM, 105-110mM, 110-115mM, 115-120mM, 120-125mM, 125-130mM, 130-135mM, 135-140mM, 140-145mM, or 145-150mM of sucrose.

[0019] More preferably, the substrate mentioned in step S1 contains 25-26 g / L, 26-27 g / L, 27-28 g / L, 28-29 g / L, 29-30 g / L, 30-31 g / L, 31-32 g / L, 32-33 g / L, 33-34 g / L, 34-35 g / L, 35-36 g / L, 36-37 g / L, 37-38 g / L, 38-39 g / L, 3 Mixed sugar powder with concentrations of 9-40 g / L, 40-41 g / L, 41-42 g / L, 42-43 g / L, 43-44 g / L, 44-45 g / L, 45-46 g / L, 46-47 g / L, 47-48 g / L, 48-49 g / L, 49-50 g / L, 50-51 g / L, 51-52 g / L, 52-53 g / L, 53-54 g / L, or 54-55 g / L.

[0020] Specifically, the amount of recombinant cell disruption mixture 1 added in step S1 is 150-250 U / L of pre-reaction solution 1.

[0021] Preferably, the amount of recombinant cell lysis broth mixture 1 added in step S1 is 150-155 U / L, 155-160 U / L, 160-165 U / L, 165-170 U / L, 170-175 U / L, 175-180 U / L, 180-185 U / L, 185-190 U / L, 190-195 U / L, 195-200 U / L, 200-205 U / L, 205-210 U / L, 210-215 U / L, 215-220 U / L, 220-225 U / L, 225-230 U / L, 230-235 U / L, 235-240 U / L, 240-245 U / L, or 245-250 U / L of pre-reaction solution 1.

[0022] Specifically, the amount of recombinant cell lysis solution 2 added in step S2 is 150-250 U / L of pre-reaction solution 2.

[0023] Preferably, the amount of recombinant cell lysis broth mixture 2 added in step S2 is 150-155 U / L, 155-160 U / L, 160-165 U / L, 165-170 U / L, 170-175 U / L, 175-180 U / L, 180-185 U / L, 185-190 U / L, 190-195 U / L, 195-200 U / L, 200-205 U / L, 205-210 U / L, 210-215 U / L, 215-220 U / L, 220-225 U / L, 225-230 U / L, 230-235 U / L, 235-240 U / L, 240-245 U / L, or 245-250 U / L of pre-reaction solution 2.

[0024] Specifically, the buffer solution mentioned in step S1 or step S2 includes any one or more of Tris-HCl buffer, HEPES buffer, phosphate buffer, MES buffer, MOPS buffer, and PIPES buffer.

[0025] Preferably, the buffer solution described in step S1 or step S2 is a Tris-HCl buffer solution.

[0026] Specifically, the reaction described in step S1 or step S2 is carried out at 200-500 rpm for 12-36 hours.

[0027] Preferably, the reaction described in step S1 or step S2 is carried out at 220 rpm for 24 hours.

[0028] Specifically, the solvent used for dissolving the precipitate in step S2 includes any one or more of water, methanol, ethanol, acetone, and dimethyl sulfoxide.

[0029] Preferably, the solvent used for precipitate dissolution in step S2 is dimethyl sulfoxide.

[0030] Specifically, the preparation method of the recombinant cell lysis fluid includes the following steps: (1) After activating the recombinant strain UGT11 (S158F), recombinant strain UGT76G1 (G83Q) or recombinant strain AtSUS (P94N), an activated bacterial solution was obtained; (2) The activated strain was cultured in a seed culture to obtain a seed solution; (3) The seed liquid is inoculated into a fermenter for fed-batch fermentation to obtain fermentation liquid; (4) The fermentation broth was centrifuged and the precipitate was collected to obtain recombinant cells; (5) Resuspend the recombinant cells, break them up and centrifuge them to collect the supernatant and obtain the recombinant cell lysate of recombinant strain UGT11 (S158F), recombinant cell lysate of recombinant strain UGT76G1 (G83Q) or recombinant cell lysate of recombinant strain AtSUS (P94N).

[0031] Preferably, the recombinant strain UGT11(S158F) described in step (1) is a recombinant strain containing the UGT11(S158F) encoding gene.

[0032] More preferably, the nucleotide sequence of the UGT11(S158F) encoding gene is shown in SEQ ID NO.2.

[0033] Preferably, the recombinant strain UGT76G1(G83Q) described in step (1) is a recombinant strain containing the UGT76G1(G83Q) encoding gene.

[0034] More preferably, the nucleotide sequence of the UGT76G1 (G83Q) encoding gene is shown in SEQ ID NO.4.

[0035] Preferably, the recombinant strain AtSUS(P94N) described in step (1) is a recombinant strain containing the AtSUS(P94N) encoding gene.

[0036] More preferably, the nucleotide sequence of the AtSUS(P94N) encoding gene is shown in SEQ ID NO.6.

[0037] Preferably, the activation in step (1) includes: inoculating recombinant strain UGT76G1 (G83Q), recombinant strain UGT11 (S158F) or recombinant strain AtSUS (P94N) into a test tube containing liquid LB medium at an inoculation rate of 1%-5% v / v, and activating the culture by shaking for 12-16 hours until OD600=6-8.

[0038] Preferably, the expanded culture in step (2) includes: transferring the activated strain to a primary seed culture medium at an inoculation rate of 5%-10% v / v, culturing to obtain a primary seed solution, and then transferring the primary seed solution to a secondary seed culture medium at an inoculation rate of 5%-10% v / v, culturing to obtain a secondary seed solution.

[0039] More preferably, the primary or secondary seed culture medium comprises tryptone, yeast extract, and sodium chloride.

[0040] More preferably, the primary or secondary seed culture medium comprises 3.0-4.0 g / L tryptone, 1.5-2.0 g / L yeast extract and 3.0-4.0 g / L sodium chloride.

[0041] More preferably, the primary or secondary seed culture medium comprises 3.5 g / L tryptone, 1.75 g / L yeast extract and 3.5 g / L sodium chloride.

[0042] Preferably, the fermenter in step (3) contains a fermenter culture medium, which includes: glucose, yeast powder, dipotassium hydrogen phosphate, (NH4)H2PO4, (NH4)2SO4, citric acid, MgSO4, trace element mother liquor and kanamycin sulfate.

[0043] More preferably, the fermenter in step (3) is filled with a fermentation tank culture medium, which includes: 5-15 g / L glucose, 6-10 g / L yeast powder, 7-11 g / L dipotassium hydrogen phosphate, 1-3 g / L (NH4)H2PO4, 1-3 g / L (NH4)2SO4, 1.5-2.0 g / L citric acid, 0.3-0.9 g / L MgSO4, 0.5-1.5 mL / L trace element stock solution and 40-60 mg / L kanamycin sulfate.

[0044] More preferably, the fermenter in step (3) is filled with a fermenter culture medium, which includes: 10 g / L glucose, 8 g / L yeast powder, 9 g / L dipotassium hydrogen phosphate, 2 g / L (NH4)H2PO4, 2 g / L (NH4)2SO4, 1.7 g / L citric acid, 0.6 g / L MgSO4, 1 mL / L trace element stock solution and 50 mg / L kanamycin sulfate.

[0045] More preferably, the trace element mother liquor includes calcium chloride dihydrate, zinc sulfate heptahydrate, ferrous sulfate heptahydrate, boric acid, manganese chloride tetrahydrate, sodium molybdate dihydrate, cobalt chloride hexahydrate, copper sulfate pentahydrate, potassium iodide, and ethylenediaminetetraacetic acid.

[0046] More preferably, the trace element mother liquor comprises 4-5 g / L calcium chloride dihydrate, 4-5 g / L zinc sulfate heptahydrate, 2-4 g / L ferrous sulfate heptahydrate, 0.5-1.5 g / L boric acid, 0.5-1.5 g / L manganese chloride tetrahydrate, 0.2-0.6 g / L sodium molybdate dihydrate, 0.2-0.4 g / L cobalt chloride hexahydrate, 0.05-0.15 g / L copper sulfate pentahydrate, 0.05-0.15 g / L potassium iodide, and 10-20 g / L ethylenediaminetetraacetic acid.

[0047] More preferably, the trace element mother liquor comprises 4.5 g / L calcium chloride dihydrate, 4.5 g / L zinc sulfate heptahydrate, 3 g / L ferrous sulfate heptahydrate, 1 g / L boric acid, 1 g / L manganese chloride tetrahydrate, 0.4 g / L sodium molybdate dihydrate, 0.3 g / L cobalt chloride hexahydrate, 0.1 g / L copper sulfate pentahydrate, 0.1 g / L potassium iodide, and 15 g / L ethylenediaminetetraacetic acid.

[0048] Preferably, the fed-batch fermentation in step (3) includes: after 5 hours of fermentation, a feeding operation is performed at a feeding rate of 6.24-7.20 g / L / h; after 8-10 hours of fermentation, the feeding rate is reduced to 4.80 g / L / h, and the temperature is reduced to 25°C for induction; thereafter, the feeding rate is maintained at 4.80 g / L / h until the fermentation OD (dose-end value) is reached. 600 Upgrade to 65-75, then reduce the feeding rate to 3.84-4.80 g / L / h until OD...600 It no longer increases significantly.

[0049] More preferably, the culture medium used for feeding is a feeding medium containing glucose, tryptone and magnesium sulfate heptahydrate.

[0050] More preferably, the culture medium used for the feeding is a feeding medium containing 500-700 g / L glucose, 7-8 g / L tryptone and 1-3 g / L magnesium sulfate heptahydrate.

[0051] More preferably, the culture medium used for feeding is a feeding medium containing 600 g / L glucose, 7.5 g / L tryptone and 2 g / L magnesium sulfate heptahydrate.

[0052] More preferably, the inducing agent used is isopropyl-β-D-thiogalactoside with a final concentration of 0.2-0.5 mmol / L.

[0053] In another preferred embodiment, the inducing agent used is isopropyl-β-D-thiogalactoside with a final concentration of 0.2 mmol / L.

[0054] Preferably, the centrifugation conditions in step (4) are 5000-15000 rpm for 10-20 min.

[0055] Preferably, the resuspension in step (5) is to reselect to OD600=55-65.

[0056] More preferably, the resuspension in step (5) is to reselect to OD600=60.

[0057] Preferably, the crushing in step (5) is performed by a high-pressure homogenizer at a pressure of 1000-1500 Bar for 5-10 minutes. More preferably, the crushing in step (5) is performed by a high-pressure homogenizer at a pressure of 1200 Bar for 5 minutes.

[0058] The beneficial effects of this invention are: 1. This invention constructs three mutant recombinant strains, whose expressed mutant enzymes have catalytic activities far exceeding those of wild-type strains. Furthermore, the prepared recombinant cell lysis broth mixture 1 and recombinant cell lysis broth mixture 2 can efficiently and synergistically achieve glycosyl donor regeneration and glycosyl transfer, avoiding the problems of insufficient or excessive waste of single enzyme activity.

[0059] 2. This invention uses a mixed sugar powder containing a high proportion of Reb A as the starting substrate, which does not rely on Reb D, which has a very low natural content and needs to be prepared separately. This significantly reduces the substrate cost and overcomes the drawback of relying on Reb D substrate.

[0060] 3. This invention innovatively adopts a "two-step enzymatic method" process, which ultimately achieves a conversion rate of up to 93.33% for Reb A to Reb M, far exceeding the efficiency of non-mutated strain combination (66.3%), one-step enzymatic method (72.46%), and traditional natural extraction (low content) or chemical synthesis method (poor specificity and high pollution).

[0061] 4. The reaction conditions are mild, no toxic chemical reagents are required, it is green and environmentally friendly, and it is easy to scale up. It can be well adapted to the demand for natural low-calorie sweeteners in the food and pharmaceutical fields, and has significant economic and social benefits.

[0062] Preservation Instructions Preserved strain: R1; Classification and nomenclature: Escherichia coli ( Escherichia coli ); Accession number: CGMCC No. 34492; Preservation period: May 9, 2025; Preservation institution: China General Microbiological Culture Collection Center, China Committee on the Preservation and Management of Microbial Culture Collections; Abbreviation of depositary institution: CGMCC; Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0063] Preserved strain: R2; Classification and nomenclature: Escherichia coli; Accession number: CGMCC No. 34493; Preservation period: May 9, 2025; Preservation institution: China General Microbiological Culture Collection Center, China Committee on the Preservation and Management of Microbial Culture Collections; Abbreviation of depositary institution: CGMCC; Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0064] Preserved strain: R3; Classification and nomenclature: Escherichia coli; Accession number: CGMCC No. 34494; Preservation period: May 9, 2025; Preservation institution: China General Microbiological Culture Collection Center, China Committee on the Preservation and Management of Microbial Culture Collections; Abbreviation of depositary institution: CGMCC; Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0065] Figure 1 The conversion rate of Reb D catalyzed by enzymes with different substrate concentrations was determined.

[0066] Figure 2 The conversion rate of Reb M catalyzed by enzymes with different substrate concentrations was determined. Detailed Implementation

[0067] The following non-limiting embodiments are intended to enable those skilled in the art to gain a more comprehensive understanding of the present invention, but do not limit the invention in any way. The following content is merely an exemplary description of the scope of protection claimed by the present invention, and those skilled in the art can make various changes and modifications to the present invention based on the disclosed content, and such changes should also fall within the scope of protection claimed by the present invention.

[0068] The present invention will be further described below by way of specific embodiments. Unless otherwise specified, all instruments, devices, equipment, reagents, products, etc., used in the embodiments of the present invention are obtained through conventional commercial means.

[0069] Example 1 1. UGT76G1 mutant and its encoding gene The UGT76G1 mutant involves a mutation at position 83 of the UDP-glucosyltransferase (UGT76G1) gene, yielding UGT76G1(G83Q). The nucleotide sequence of the gene encoding UGT76G1 is shown in SEQ ID NO.1, and the nucleotide sequence of the gene encoding UGT76G1(G83Q) is shown in SEQ ID NO.2. Both were synthesized by Suzhou Genewiz Biotechnology Co., Ltd.

[0070] SEQ ID NO.1:

[0071] SEQ ID NO.2:

[0072] 2. UGT11 mutant and its encoding gene The UGT11 mutant involves a mutation at position 158 of the UGT11 gene, resulting in UGT11(S158F). The nucleotide sequence of the gene encoding UGT76G1 is shown in SEQ ID NO.3, and the nucleotide sequence of the gene encoding UGT11(S158F) is shown in SEQ ID NO.4. Both were synthesized by Suzhou Genewise Biotechnology Co., Ltd.

[0073] SEQ ID NO.3:

[0074] SEQ ID NO.4:

[0075] 3. AtSUS mutants and their encoding genes The AtSUS mutant is obtained by mutating position 94 of the sucrose synthase (AtSUS) gene in Arabidopsis thaliana, resulting in AtSUS(P94N). The nucleotide sequence encoding the AtSUS gene is shown in SEQ ID NO.5, and the nucleotide sequence encoding the AtSUS(P94N) gene is shown in SEQ ID NO.6. Both were synthesized by Suzhou Genewiz Biotechnology Co., Ltd.

[0076] SEQ ID NO.5

[0077] SEQ ID NO.6:

[0078] Example 2 1. Plasmid construction Escherichia coli BL21(DE3) (Catalog No.: B528414) and DH5α competent cells (Catalog No.: A338951) were purchased from Sangon Biotech (Shanghai) Co., Ltd.; plasmid pET-30a(+) (Catalog No.: B540185) was purchased from Sangon Biotech (Shanghai) Co., Ltd.; all gene and primer synthesis and sequencing services were provided by Suzhou Genewise Biotech Co., Ltd.; 2×Phanta Flash Master Mix high-fidelity DNA polymerase (Catalog No.: P510-01) was purchased from Nanjing Novizan Biotechnology Co., Ltd.; restriction endonucleases NdeI (Code No. 1621) and XhoI (Code No. 1635) were purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.

[0079] The primers used for PCR amplification of UGT76G1 (G83Q), UGT11 (S158F), and AtSUS (P94N) are shown in Table 1: Table 1

[0080] Note: In the table, "F" represents the forward primer; "R" represents the reverse primer; CATATG is the NdeI restriction site, and CTCGAG is the XhoI restriction site.

[0081] The PCR amplification program was to amplify the target fragment using 2×Phanta Flash Master Mix high-fidelity DNA polymerase. The specific reaction system and amplification program are shown in Table 2.

[0082] Table 2

[0083] The amplified DNA fragments or plasmids are digested with restriction endonucleases. Different restriction enzymes require different digestion times, and the appropriate digestion time must be selected according to the specific requirements of the restriction enzyme. This invention uses the Fastdigest series of restriction endonucleases, and the reaction system is shown in Table 3.

[0084] Table 3

[0085] After purification following enzyme digestion, the T4 DNA ligase, purified DNA fragment, and vector plasmid fragment were mixed and incubated in a metal bath at 22°C for 2.5 hours to complete the ligation reaction. The ligation reaction system is shown in Table 4.

[0086] Table 4

[0087] The above enzyme-linked products were transformed (using conventional chemical transformation) into E. coli DH5α competent cells and cultured overnight. Single colonies that grew in the selection plate (50 µg / mL kanamycin) were sent to Genewiz for sequencing. After successful sequencing, the positive plasmids pET30a(+)-UGT76G1, pET30a(+)-UGT11, and pET30a(+)-AtSUS were returned.

[0088] Based on the above plasmids, PCR amplification was performed using the amplification primers in Table 1. The PC products purified by gel excision were transformed (using conventional chemical transformation method) into E. coli DH5α competent cells and cultured overnight. Single colonies grown in the selection plate (50 µg / mL kanamycin) were sent to Genewiz for sequencing. After successful sequencing, the positive plasmids pET30a(+)-UGT76G1 (G83Q), pET30a(+)-UGT11 (S158F), and pET30a(+)-AtSUS (P94N) were returned.

[0089] 2. Construction of recombinant strains 2.1 Construction of mutant strains The constructed plasmid was transformed (using conventional chemical transformation) into competent Escherichia coli BL21(DE3) cells and cultured overnight. Validation primers were designed: upstream primer test-pET-F and downstream primer test-pET-R. Single colonies grown in the screening plate (50 µg / mL kanamycin) were validated by colony PCR, and the corresponding recombinant strains UGT76G1 (G83Q), UGT11 (S158F), and AtSUS (P94N) were constructed.

[0090] Upstream primer test-pET-F (SEQ ID NO.19): 5'-CATCGGTGATGTCGGCGATATAG -3'; Downstream primer test-pET-R (SEQ ID NO.20): 5'- CCGGATATAGTTCCTCCTTTCAGCA -3'.

[0091] Preserve the validated strains: The recombinant strain UGT11 (S158F), named R1, has the accession number CGMCC No. 34492; The recombinant strain UGT76G1 (G83Q), named R2, has the accession number CGMCC No. 34493; The recombinant strain AtSUS (P94N), named R3, has the accession number CGMCC No. 34494.

[0092] 2.2 Construction of non-mutant strains Positive plasmids pET30a(+)-UGT76G1, pET30a(+)-UGT11, and pET30a(+)-AtSUS were transformed (using conventional chemical transformation) into competent Escherichia coli BL21(DE3) cells and cultured overnight. Validation primers were designed: upstream primer test-pET-F and downstream primer test-pET-R. Single colonies grown in the screening plate (50 µg / mL kanamycin) were validated by colony PCR to construct the corresponding recombinant strains UGT76G1, UGT11, and AtSUS.

[0093] Example 3 1. Preparation of culture medium Primary seed culture medium: tryptone 3.5 g / L, yeast extract 1.75 g / L and sodium chloride 3.5 g / L, dissolved in pure water, autoclaved, and ready for use.

[0094] Secondary seed culture medium: tryptone 3.5 g / L, yeast extract 1.75 g / L and sodium chloride 3.5 g / L, dissolved in pure water, autoclaved, and ready for use.

[0095] Fermentation tank culture medium: glucose 10 g / L, yeast powder 8 g / L, dipotassium hydrogen phosphate 9 g / L, (NH4)H2PO4 2 g / L, (NH4)2SO4 2 g / L, citric acid 1.7 g / L, MgSO4 0.6 g / L, trace element stock solution 1 mL / L, kanamycin sulfate 50 mg / L, dissolved in pure water, autoclaved, and ready for use.

[0096] The trace element stock solution consists of: calcium chloride dihydrate 4.5 g / L, zinc sulfate heptahydrate 4.5 g / L, ferrous sulfate heptahydrate 3 g / L, boric acid 1 g / L, manganese chloride tetrahydrate 1 g / L, sodium molybdate dihydrate 0.4 g / L, cobalt chloride hexahydrate 0.3 g / L, copper sulfate pentahydrate 0.1 g / L, potassium iodide 0.1 g / L, and ethylenediaminetetraacetic acid 15 g / L, dissolved in pure water for later use.

[0097] Feeding medium: 600 g / L glucose, 7.5 g / L tryptone, 2 g / L magnesium sulfate heptahydrate, dissolved in pure water, autoclaved, cooled to 50℃ and kept warm for later use.

[0098] 2. Preparation of recombinant cells and recombinant cell lysates from recombinant strains UGT76G1 (G83Q), UGT11 (S158F), or AtSUS (P94N) Recombinant strains UGT76G1 (G83Q), UGT11 (S158F), or AtSUS (P94N), preserved at low temperature, were inoculated into test tubes containing 5 mL of liquid LB medium at a 1% v / v inoculation rate. After shaking and activation culture for 12-16 hours, when OD600 = 6-8, they were transferred to primary seed medium at a 5% v / v inoculation rate and shaken for 8 hours. When OD600 = 4, they were transferred to secondary seed medium at a 5% v / v inoculation rate and shaken for another 16 hours. Then, the secondary seed culture was flame-inoculated into a 15L fermenter with a 7.5L culture medium capacity at a 10% v / v inoculation rate for fed-batch fermentation. Feeding was done in stages. After approximately 5 hours of fermentation, the sugar in the bottom tank was consumed, and the strain entered the logarithmic growth phase. Dissolved oxygen and pH in the fermenter began to rise, at which point feeding began at a rate of 6.72 g / L / h. Fermentation continued for 10 hours. After 26 hours, the strain entered the late logarithmic phase. At this point, the feed rate was reduced to 4.80 g / L / h, the temperature was lowered to 25°C, and isopropyl-β-D-thiogalactoside (0.2 mmol / L) was added as an inducer. This feed rate was then maintained until the fermentation OD600 reached 70, after which the feed rate was reduced to 4.32 g / L / h until the OD600 no longer increased significantly. Throughout the fed-batch fermentation period, the glucose content in the fermenter was less than or equal to 1.0 g / L. Fermentation ended after 26 hours when the cell OD600 no longer increased significantly. After fermentation, the cells were collected by centrifugation (10,000 rpm, 10 min), yielding the recombinant cells used for the enzymatic conversion reaction.

[0099] The recombinant cells were resuspended to OD600=60 and homogenized at 1200 Bar for 5 min using a high-pressure homogenizer. Then, they were centrifuged at 10000 rpm and 4-6 ℃ for 1 hour. The centrifuged precipitate was discarded, and the supernatant was collected to obtain UGT76G1 (G83Q) recombinant cell lysate, UGT11 (S158F) recombinant cell lysate, or AtSUS (P94N) recombinant cell lysate, respectively.

[0100] 5. Preparation of recombinant cells and recombinant cell lysates from recombinant strains UGT76G1, UGT11, and AtSUS. Recombinant cells and recombinant cell lysates of recombinant strains UGT76G1, UGT11, or AtSUS were obtained using the methods described above.

[0101] Example 4 1. Preparation of mixed sugar powder The mixed sugar powder was purchased from Xinjiang Huijia Biotechnology Co., Ltd., batch number 25082312. The total glycoside content was 90%, of which Reb A accounted for 63.034% and STV accounted for 12.015%. The proportions of other glycosides are shown in Table 5.

[0102] Table 5

[0103] 2. Preparation of Recombinant Cell Disruption Mixture 1 UGT11 (S158F) recombinant cell lysate and AtSUS (P94N) recombinant cell lysate were mixed evenly at an enzyme activity ratio of 1:1 to obtain recombinant cell lysate mixture 1.

[0104] 3. Enzymatic synthesis of Reb D using mixed sugars of different concentrations as substrates. Add UDP to a final concentration of 0.1 mmol / L, sucrose to a final concentration of 100 mM, and mixed sugar powders of different final concentrations (25 g / L, 30 g / L, 45 g / L, or 55 g / L) to the reaction vessel in sequence. Add recombinant cell lysis buffer mixture 1 (200 U of UGT11 (S158F) and AtSUS (P94N) in total). Adjust the volume to 1 L with 50 mmol / L Tris-HCl buffer at pH 7.5 and stir at 220 rpm for 24 hours. After the reaction was complete, 100 μL of the reaction solution was diluted with 900 μL of anhydrous methanol. The solution was centrifuged at 10,000 rpm for 3 min at 4 °C. The supernatant was then filtered through a membrane and the Reb D conversion was determined by high-performance liquid chromatography (HPLC) (column: Agilent Eclipse SB-C18 4.6 × 150 mm; detection wavelength: 210 nm; mobile phase: methanol:water = 68%:32%; flow rate: 1.0 mL / min; column temperature: 30 °C). The results are shown in Table 6. Table 6

[0105] Example 5 1. Preparation of Reb D stock solution A Reb D stock solution with a concentration of 100 g / L was prepared using dimethyl sulfoxide and used as a subsequent substrate.

[0106] 2. Preparation of Recombinant Cell Disruption Mixture 2 UGT76G1 (G83Q) recombinant cell lysate and AtSUS (P94N) recombinant cell lysate were mixed evenly at an enzyme activity ratio of 1:1 to obtain recombinant cell lysate mixture 2.

[0107] 3. Reb D as a substrate for the enzyme synthesis of Reb M Add UDP to a final concentration of 0.1 mmol / L, sucrose to a final concentration of 100 mM, and Reb D at different final concentrations (17 g / L, 27 g / L, 37 g / L, or 47 g / L) to the reaction vessel in sequence. Add recombinant cell lysis buffer mixture 2 (200 U of UGT76G1 (G83Q) and AtSUS (P94N) in total). Adjust the volume to 1 L with 50 mmol / L Tris-HCl buffer at pH 7.5 and stir at 220 rpm for 24 hours. After the reaction was complete, 100 μL of the reaction solution was diluted with 900 μL of anhydrous methanol. After centrifugation at 10,000 rpm for 3 min at 4 °C, the supernatant was filtered through a membrane and the Reb M conversion was determined by high-performance liquid chromatography (HPLC) (column: Agilent Eclipse SB-C18 4.6 × 150 mm; detection wavelength: 210 nm; mobile phase: methanol:water = 68%:32%; flow rate: 1.0 mL / min; column temperature: 30 °C). The results are shown in Table 7. Table 7

[0108] Example 6 1. Preparation of mixed sugar powder The mixed sugar powder was purchased from Xinjiang Huijia Biotechnology Co., Ltd., batch number 25082312. The total glycoside content was 90%, of which Reb A accounted for 63.034% and STV accounted for 12.015%. The proportions of other glycosides are shown in Table 5.

[0109] 2. Preparation of Recombinant Cell Disruption Mixture 1 UGT11 (S158F) recombinant cell lysate and AtSUS (P94N) recombinant cell lysate were mixed evenly at an enzyme activity ratio of 1:1 to obtain recombinant cell lysate mixture 1.

[0110] 3. Preparation of Recombinant Cell Disruption Mixture 2 UGT76G1 (G83Q) recombinant cell lysate and AtSUS (P94N) recombinant cell lysate were mixed evenly at an enzyme activity ratio of 1:1 to obtain recombinant cell lysate mixture 2.

[0111] 4. Two-step enzymatic preparation of Reb M In a reaction vessel, UDP to a final concentration of 0.1 mmol / L, sucrose to a final concentration of 100 mM, and mixed sugar powder to a final concentration of 25 g / L were added sequentially. Recombinant cell lysis buffer mixture 1 (200 U of UGT11 (S158F) and AtSUS (P94N) added in total) was added, and the volume was adjusted to 1 L with 50 mmol / L Tris-HCl buffer (pH 7.5). The mixture was stirred at 220 rpm for 24 hours. A portion of the reaction solution was diluted 10-fold with anhydrous methanol, centrifuged at 10,000 rpm for 3 min, and the supernatant was collected, filtered through a membrane, and analyzed by high-performance liquid chromatography.

[0112] After the previous reaction was completed, the reaction solution was centrifuged to collect the precipitate, which was the Reb D obtained from the reaction. Dimethyl sulfoxide was added to redissolve the precipitate at a ratio of 1g:0.1L. Recombinant cell lysis buffer mixture 2 (200U of a total of UGT76G1 (G83Q) and AtSUS (P94N)) was added, and the volume was adjusted to 1L with 50mmol / L Tris-HCl buffer at pH 7.5. The mixture was stirred at 220rpm for 24 hours. A sample of the reaction solution was diluted 10-fold with anhydrous methanol, centrifuged at 10000rpm for 3min, and the supernatant was collected, filtered through a membrane, and analyzed by high-performance liquid chromatography.

[0113] The results showed that the conversion rate from Reb A to Reb D was 95%, and the conversion rate from Reb A to Reb M was 93.33%.

[0114] Comparative Example 1 The only difference between Comparative Example 1 and Example 6 is step "2. Preparation of Recombinant Cell Disruption Mixture 1". The specific steps are as follows: UGT11 recombinant cell lysate and AtSUS recombinant cell lysate were mixed evenly at an enzyme activity ratio of 1:1 to obtain recombinant cell lysate mixture 1.

[0115] The results showed that the conversion rate from Reb A to Reb D was 85%, and the conversion rate from Reb A to Reb M was 83.51%.

[0116] Comparative Example 2 The only difference between Comparative Example 2 and Example 6 is step "3. Preparation of Recombinant Cell Disruption Mixture 2". The specific steps are as follows: UGT76G1 recombinant cell lysate and AtSUS recombinant cell lysate were mixed evenly at a mass ratio of 1:1 to obtain recombinant cell lysate mixture 2.

[0117] The results showed that the conversion rate from Reb A to Reb D was 95%, and the conversion rate from Reb A to Reb M was 74.1%.

[0118] Comparative Example 3 The only difference between Comparative Example 3 and Example 6 is that steps "2. Preparation of Recombinant Cell Disruption Mixture 1" and "3. Preparation of Recombinant Cell Disruption Mixture 2" are different. The specific steps are as follows: 2. Preparation of Recombinant Cell Disruption Mixture 1 UGT11 recombinant cell lysate and AtSUS recombinant cell lysate were mixed evenly at a mass ratio of 1:1 to obtain recombinant cell lysate mixture 1.

[0119] 3. Preparation of Recombinant Cell Disruption Mixture 2 UGT76G1 recombinant cell lysate and AtSUS recombinant cell lysate were mixed evenly at a mass ratio of 1:1 to obtain recombinant cell lysate mixture 2.

[0120] The results showed that the conversion rate from Reb A to Reb D was 85%, and the conversion rate from Reb A to Reb M was 66.3%.

[0121] Comparative Example 4 1. Preparation of mixed sugar powder Same as Example 6.

[0122] 2. Preparation of recombinant cell lysate mixture UGT11 (S158F) recombinant cell lysate, UGT76G1 (G83Q) recombinant cell lysate, and AtSUS (P94N) recombinant cell lysate were mixed evenly at a mass ratio of 1:1:1 to obtain a recombinant cell lysate mixture.

[0123] 3. One-step enzymatic preparation of Reb M In a reaction vessel, UDP to a final concentration of 0.1 mmol / L, sucrose to a final concentration of 100 mM, and mixed sugar powder to a final concentration of 25 g / L were added sequentially. A mixture of recombinant cell lysis buffer (UGT11 (S158F), UGT76G1 (G83Q), and AtSUS (P94N) in total of 400 U) was added, and the volume was adjusted to 1 L with 50 mmol / L Tris-HCl buffer (pH 7.5). The mixture was stirred at 220 rpm for 48 hours. A portion of the reaction solution was diluted 10-fold with anhydrous methanol, centrifuged at 10,000 rpm for 3 min, and the supernatant was collected, filtered through a membrane, and analyzed by high-performance liquid chromatography (HPLC).

[0124] The reaction solution was sampled and diluted 10 times with anhydrous methanol. After high-speed centrifugation at 10,000 rpm for 3 min, the supernatant was collected, filtered through a membrane, and detected by high-performance liquid chromatography.

[0125] The results showed that the conversion rate of Reb A to Reb M was 72.46%.

[0126] The above detailed description is a specific illustration of one feasible embodiment of the present invention, and this embodiment is not intended to limit the patent scope of the present invention. It should be noted that all equivalent implementations or modifications made without departing from the present invention should be included within the scope of the technical solution of the present invention. Therefore, the protection scope of the present invention should be determined by the appended claims.

Claims

1. A method for the enzymatic production of rebaudioside M, characterized in that, The method includes the following steps: S1. Add recombinant cell lysis buffer mixture 1 to the substrate, add to the buffer solution to obtain pre-reaction solution 1, and collect the precipitate after the reaction. S2. After the precipitate is dissolved, add recombinant cell lysis buffer mixture 2, add buffer solution to obtain pre-reaction solution 2, collect the reaction solution to obtain lebodiin M; The recombinant cell lysate mixture 1 mentioned in step S1 is a mixture of recombinant cell lysate of recombinant strain UGT11 (S158F) and recombinant cell lysate of recombinant strain AtSUS (P94N). The substrate mentioned in step S1 includes 0.05-0.2 mmol / L uridine diphosphate, 50-150 mM sucrose, and 25-55 g / L mixed sugar powder; the mixed sugar powder is a mixed sugar powder containing rebaudioside A; The recombinant cell lysate mixture 2 mentioned in step S2 is a mixture of recombinant cell lysate of recombinant strain UGT76G1 (G83Q) and recombinant cell lysate of recombinant strain AtSUS (P94N). The recombinant strain UGT11 (S158F) has the accession number CGMCC No. 34492; the recombinant strain UGT76G1 (G83Q) has the accession number CGMCC No. 34493; and the recombinant strain AtSUS (P94N) has the accession number CGMCC No. 34494.

2. The method according to claim 1, characterized in that, In step S1, the enzyme activity ratio of the recombinant cell lysate of recombinant strain UGT11 (S158F) and the recombinant cell lysate of recombinant strain AtSUS (P94N) in the recombinant cell lysate mixture 1 is 0.5-1.5:

1. In step S2, the enzyme activity ratio of the recombinant cell lysate of recombinant strain UGT76G1 (G83Q) and the recombinant strain AtSUS (P94N) in the recombinant cell lysate mixture 2 is 0.5-1.5:

1.

3. The method according to claim 1, characterized in that, In step S1, the enzyme activity ratio of the recombinant cell lysate of recombinant strain UGT11 (S158F) and the recombinant cell lysate of recombinant strain AtSUS (P94N) in the recombinant cell lysate mixture 1 is 1:

1. In step S2, the enzyme activity ratio of the recombinant cell lysate of recombinant strain UGT76G1 (G83Q) to the enzyme activity ratio of recombinant strain AtSUS (P94N) in the recombinant cell lysate mixture 2 is 1:

1.

4. The method according to claim 1, characterized in that, The amount of recombinant cell lysis buffer mixture 1 added in step S1 is 150-250 U / L of pre-reaction solution 1; the amount of recombinant cell lysis buffer mixture 2 added in step S2 is 150-250 U / L of pre-reaction solution 2.

5. The method according to claim 1, characterized in that, The amount of recombinant cell lysis buffer mixture 1 added in step S1 is 200 U / L of pre-reaction solution 1; the amount of recombinant cell lysis buffer mixture 2 added in step S2 is 200 U / L of pre-reaction solution 2.

6. The method according to claim 1, characterized in that, The buffer solution mentioned in step S1 or step S2 includes any one or more of Tris-HCl buffer, HEPES buffer, phosphate buffer, MES buffer, MOPS buffer, and PIPES buffer.

7. The method according to claim 1, characterized in that, The reaction described in step S1 or step S2 is carried out at 200-500 rpm for 12-36 hours.

8. The method according to claim 1, characterized in that, The method for preparing the recombinant cell lysis buffer includes the following steps: (1) After activating the recombinant strain UGT11 (S158F), recombinant strain UGT76G1 (G83Q) or recombinant strain AtSUS (P94N), an activated bacterial solution was obtained; (2) The activated strain was cultured in a seed culture to obtain a seed solution; (3) The seed liquid is inoculated into a fermenter for fed-batch fermentation to obtain fermentation liquid; (4) The fermentation broth was centrifuged and the precipitate was collected to obtain recombinant cells; (5) Resuspend the recombinant cells, break them up and centrifuge them to collect the supernatant and obtain the recombinant cell lysate of recombinant strain UGT11 (S158F), recombinant cell lysate of recombinant strain UGT76G1 (G83Q) or recombinant cell lysate of recombinant strain AtSUS (P94N).

Images