Chloroplast gene ITS2 bar code sequence primer composition, identification kit and application
By designing a primer composition for the chloroplast gene ITS2 barcode sequence, combined with multiplex PCR and agarose gel electrophoresis, the problem of medicinal material identification was solved, enabling rapid and accurate identification of Patrinia scabiosifolia and Aristolochia debilis. This method is suitable for the identification of medicinal powders and has the advantages of wide applicability and low cost.
Patent Information
- Application Number
- CN202610013773.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-07
- Publication Date
- 2026-02-24
AI Technical Summary
Existing technologies make it difficult to quickly and accurately identify and distinguish between Patrinia scabiosifolia and the adulterant Aristolochia debilis, especially after the medicinal materials have been processed into slices or powders. The identification of the properties is complex, time-consuming and costly, and molecular marker technology has not been specifically studied.
A primer composition for the chloroplast gene ITS2 barcode sequence was designed and synthesized. Through multiplex PCR amplification and agarose gel electrophoresis analysis, the identification and differentiation of Patrinia scabiosifolia and Aristolochia debilis were achieved. The primer composition includes specific primer pairs and is suitable for the identification of medicinal powders.
This method enables rapid and accurate identification of Patrinia scabiosifolia and Astragalus membranaceus. It is simple, reliable, and highly objective, does not rely on subjective judgment, is applicable to the identification of medicinal powders, has wide applicability, and is inexpensive.
Smart Images
Figure CN121555685A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to plant barcode sequences, and more particularly to a primer composition, identification kit, and application of a chloroplast gene ITS2 barcode sequence. Background Technology
[0002] Patrinia scabiosifolia is a plant of the Caprifoliaceae family (Patrinia scabiosifolia). Patrinia scabiosifolia The dried whole herb of *Patrinia scabiosifolia* has the effects of clearing heat and detoxifying, eliminating carbuncles and draining pus, promoting blood circulation and relieving pain. It is mainly used to treat intestinal abscess, lung abscess, dysentery, postpartum abdominal pain due to blood stasis, and carbuncles and boils. A survey of *Patrinia scabiosifolia* herbs circulating in the market revealed that, in addition to *Patrinia scabiosifolia* var. *yellowflower*, there is also a counterfeit product, *Ipomoea aquatica* (also known as *Ipomoea aquatica* var. *yellowflower*). Thlaspi arvense It circulates in the market.
[0003] Currently, the main methods used to identify Patrinia scabiosifolia and its common adulterants in the market are morphological identification, microscopic identification, physicochemical identification, and some molecular marker techniques. However, morphological identification relies on whole medicinal materials; once the material is processed into slices or powder, identification becomes impossible. While microscopic identification can analyze fragmented samples, it is complex and time-consuming, has limited ability to distinguish subtle structural differences, is easily influenced by subjective experience, and is time-consuming and labor-intensive, making it difficult to meet the needs of large-scale testing. Molecular marker techniques have not been studied for the adulterants Patrinia scabiosifolia circulating in the market, and the related research and development costs are high.
[0004] Multiplex PCR, as a molecular identification technique, is unaffected by the shape of medicinal materials and can detect small amounts of adulteration. This technique relies on the presence or absence of bands, offering strong objectivity, independence from subjective judgment, and low cost, thus meeting the needs of large-scale testing. However, there is currently no research specifically on *Patrinia scabiosifolia* and its adulterant *Ipomoea aquatica*. Summary of the Invention
[0005] Purpose of the invention: The purpose of this invention is to provide a primer composition for identifying and / or differentiating the chloroplast gene ITS2 barcode sequence from *Patrinia scabra* and *Ipomoea aquatica*; the second purpose is to provide an identification kit and its application based on this primer composition.
[0006] Technical solution: The chloroplast gene ITS2 barcode sequence primer composition of the present invention contains at least one pair of primers derived from the nucleotide sequences shown in GenBank accession numbers PP277665.1 and / or PP906956.1.
[0007] Preferably, the primers derived from the nucleotide sequence shown in GenBank accession number PP277665.1 are primers capable of amplifying position 49 and / or position 176 of the sequence; and the primers derived from the nucleotide sequence shown in GenBank accession number PP906956.1 are primers capable of amplifying position 210 and / or position 423 of the sequence.
[0008] Preferably, the primer composition comprises: Primer pair A: upstream primer with nucleotide sequences as shown in SEQ ID NO: 1, and downstream primer with nucleotide sequences as shown in SEQ ID NO: 2. And / or primer pair B: upstream primer as shown in SEQ ID NO: 3, and downstream primer as shown in SEQ ID NO: 4.
[0009] The identification kit of the present invention is characterized in that the identification kit contains the primer composition of the chloroplast gene ITS2 barcode sequence as described in claim 1 or 2.
[0010] The application of the chloroplast gene ITS2 barcode sequence primer composition or identification kit described in this invention in the identification and / or differentiation of medicinal plants.
[0011] Preferably, the medicinal plants include: *Patrinia scabiosifolia* (family Caprifoliaceae) and *Iris tectorum* (family Brassicaceae).
[0012] Preferably, the application steps include: (1) Extract genomic DNA from the sample to be tested; (2) PCR amplification was performed using the aforementioned primer combination or identification kit for the chloroplast gene ITS2 barcode sequence; (3) Analyze the PCR products to determine the sample type.
[0013] Preferably, the primer composition or identification kit described in step 2 contains: an upstream primer with nucleotide sequences as shown in SEQ ID NO: 3, 5, and a downstream primer as shown in SEQ ID NO: 4, 6.
[0014] Preferably, the PCR amplification method in step 2 is singleton PCR amplification or multiplex PCR amplification.
[0015] Preferably, the method for analyzing PCR products in step 3 is agarose gel electrophoresis.
[0016] Preferably, when analyzing PCR products by agarose gel electrophoresis, If a 255bp band appears, the sample to be tested is *Vallisneria natans*, belonging to the genus *Vallisneria* of the family Caprifoliaceae. If a 163bp band appears, the sample to be tested is Iris genus of Brassicaceae. If both 255bp and 163bp bands are present, the sample to be tested is a mixture of *Vallisneria natans* (family Caprifoliaceae) and *Iris* (family Brassicaceae).
[0017] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The primer composition of the chloroplast gene ITS2 barcode sequence can effectively identify and / or distinguish between Patrinia scabiosifolia, Astragalus membranaceus and mixtures thereof in the sample to be tested; 2. The identification method is simple and reliable, highly objective, does not rely on subjective judgment, is compatible with a variety of instruments and reaction systems, is not easily affected by the characteristics of the sample, and can accurately identify medicinal powder. Attached Figure Description
[0018] Figure 1 Figure 1 shows the results of agarose gel electrophoresis for single PCR detection at different annealing temperatures. Figure 2 Figure 1 shows the results of agarose gel electrophoresis for multiplex PCR detection using different polymerase systems. Figure 3 Figure 1 shows the results of agarose gel electrophoresis for multiplex PCR detection with different cycle numbers. Figure 4 Figure 1 shows the results of agarose gel electrophoresis for multiplex PCR detection with different template amounts. Figure 5 Figures showing the results of agarose gel electrophoresis for multiplex PCR detection using different PCR instruments; Figure 6 The image shows the results of multiplex PCR detection and agarose gel electrophoresis of all samples under optimal conditions. Figure 7 The image shows the results of multiplex PCR detection and agarose gel electrophoresis of samples of *Patrinia scabiosifolia* and *Ipomoea aquatica* with different mixing ratios under optimal conditions. Detailed Implementation
[0019] The technical solution of the present invention will be further described below.
[0020] Example 1: Design and synthesis of primer composition for chloroplast gene ITS2 barcode sequence 1. According to the GenBank accession number PP277665.1, the yellow flower patrinia ( Patrinia scabiosifolia The chloroplast gene ITS2 fragment and the *Ipomoea aquatica* (GenBank accession number PP906956.1) shown in the image are examples of this gene. Thlaspi arvense Primers for the chloroplast gene ITS2 fragment were designed as shown in Table 1 below. Table 1 Primer Information
[0021] The product sequence obtained by amplification using the specific primer pair of Patrinia scabiosifolia is shown in SEQ ID NO: 5, with a length of 163 bp, and is as follows: TTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCAAACCCGCTTCCAAAGAAGTCGGCGCAGCGGGGGGAGCGGACAATGGCCTCCCGGGTCCCCGGGCTCGGCTGGCCTAAAATCGAGT; The product sequence obtained by amplification using the specific primer pair for *Ilex chinensis* is shown in SEQ ID NO: 6, with a length of 255 bp, and is as follows: GTTTGATCATGCGTGTAGCTTCCGGTTATCACAAAACCCCGGCACGAAAAGTGTCAAAGAACATGCAACTAAACAGCCAGCGTTTGCCTTCCCGGAGACGGTGTTTGCGTGAACGCTTTGCTGCAATT TAAAGTCTAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGC.
[0022] 2. The aforementioned primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., to obtain the primer composition for the chloroplast gene ITS2 barcode sequence.
[0023] Example 2: Sample acquisition and genomic DNA preparation of Lycopodiaceae plants 1. Samples were purchased from markets nationwide. Among them, *Patrinia scabiosifolia* met the requirements of the 1977 edition of the *Chinese Pharmacopoeia*. *Illicium verum* was purchased, and its total DNA was extracted and sequenced by Shanghai Sangon Biotech Co., Ltd. The results were compared with the sequence shown in NCBI Taxonomy ID 73621, confirming it as *Illicium verum*, and used as a sample. Medicinal material information is shown in Table 2. Figure 6 The mixing ratio of *Lycopodium clavatum* to *Hemiberlesia javanica* was 199:1.
[0024] Table 2 Sample Information
[0025] 2. Wipe the surface of the samples in Table 2 with 75% ethanol and sterilize them by irradiating them under a UV lamp for 30 minutes. Then, extract DNA using a plant genomic DNA extraction kit (Tiangen Biochemical, DP305-03).
[0026] Example 3: Primer composition for identifying Patrinia scabra and Iris tectorum using chloroplast gene ITS2 barcode sequence. 1. Selection of annealing temperature for singleton PCR Using an ABI VERITI96 PCR instrument, the PCR reaction system (25 μL) included: 12.5 μL of 2×M5 HiPer plus TaqHiFi PCR mix (with blue dye) (Juhemei, MF002-plus-10), 0.25 μL each of upstream and downstream primers, 1 μL of the sample to be tested (DNA content 30 ng), and sterile water to bring the volume to 25 μL. For the *Patrinia scabra* sample, a *Patrinia scabra*-specific primer pair was used; for the *Ipomoea aquatica* sample, an *Ipomoea aquatica*-specific primer pair was used; for the sterile water sample, both primer pairs were used simultaneously, with each primer having a final concentration of 0.1 μM. The reaction procedure is shown in Table 3 below; numbers 1, 2, and 3 represent *Patrinia scabra* BJC01, BJC02, and BJC03, respectively; numbers 4 and 5 represent *Ipomoea aquatica* XM01 and XM02, respectively; N represents sterile water; and M represents 2000 bp plus DNA. Marker (Juhemei, MF025-1).
[0027] Table 3 Singleton PCR reaction conditions
[0028] The results are as follows Figure 1 As shown, for the primers for *Patrinia scabiosifolia*, a false positive band appeared for XM02 at 54℃, no band was observed for BJC03 at 56℃, and a specific 163bp band was amplified for both 52℃ and 58℃. Therefore, 52℃ and 58℃ can be used as annealing temperatures for the primers. For the primers for *Iris tectorum*, a band was observed at the 255bp position at 52℃, 54℃, 56℃, and 58℃, which can be used as its annealing temperature.
[0029] 2. Determination of multiplex PCR reaction conditions 2.1 Screening of Multiplex PCR Reaction Systems ExTaq DNA Polymerase (Baori Medical, RR53A), 2×M5 HiPer plus Taq HiFiPCR mix (with blue dye), rTaq DNA Polymerase (Baori Medical, R001A), and Taq HS DNA Polymerase (Baori Medical, R007A) were selected as polymerases for multiplex PCR polymerase assays.
[0030] Using an ABI VERITI96 PCR instrument, the PCR reaction systems based on different polymerases are shown in Tables 4-7 below. The primers include all primers shown in SEQ ID NO: 1-4. The PCR reaction program is shown in Table 8 below. The samples of *Patrinia scabra* and *Ilex cornuta* obtained in Example 2 were tested. The numbers 1, 2, and 3 are *Patrinia scabra* BJC01, BJC02, and BJC03, respectively, and 4 and 5 are *Ilex cornuta* XM01 and XM02, respectively. N is sterile water, and M is 2000 bp plus DNA Marker.
[0031] Table 4 ExTaq DNA Polymerase Reaction System
[0032] Table 5. Reaction system of 2×M5 HiPer plus Taq HiFi PCR mix
[0033] Table 6 rTaq DNA Polymerase Reaction System
[0034] Table 7 Taq HS DNA Polymerase Reaction System
[0035] Table 8 Multiplex PCR reaction conditions
[0036] The results are as follows Figure 2 As shown, the amplification bands of Patrinia scabiosifolia by rTaq DNA polymerase were all dark; the samples of Aristolochia scabiosifolia amplified by Taq HS DNA Polymerase showed no bands; therefore, 2×M5 HiPer plus Taq HiFi PCR mix (with blue dye) and ExTaq DNA Polymerase can both be used as the most suitable polymerases for this method.
[0037] 2.2 Screening of Multiplex PCR Cycle Numbers The number of multiplex PCR reaction cycles was screened using a 2×M5 HiPer plus Taq HiFi PCR mix (with blue dye) system.
[0038] The PCR reaction system was prepared using an ABI VERITI96 PCR instrument, as shown in Table 5. The PCR reaction procedure was shown in Table 9. The samples of Patrinia scabiosifolia and Astragalus membranaceus obtained in Example 2 were tested. The samples were numbered 1, 2, and 3 as Patrinia scabiosifolia BJC01, BJC02, and BJC03, respectively, and 4 and 5 as Astragalus membranaceus XM01 and XM02, respectively. N was sterile water, and M was a 2000bp plus DNA Marker.
[0039] Table 9 Screening conditions for multiplex PCR cycle count
[0040] The results are as follows Figure 3 As shown, when the number of cycles is 29, BJC02 has no band; when the number of cycles is 32, 35 or 39, *Patrinia scabiosifolia* and *Ipomoea aquatica* both amplify specific bands at the corresponding positions, so they can be used as the optimal number of cycles.
[0041] 2.3 Determination of DNA template amount in multiplex PCR reaction The amount of DNA template for multiplex PCR reactions was screened using a 2×M5 HiPer plus Taq HiFi PCR mix (with blue dye) system.
[0042] The PCR reaction system was performed using an ABI VERITI96 PCR instrument, as shown in Table 10. The primers included all primers shown in SEQ ID NO: 1-4. The PCR reaction procedure was shown in Table 8. The samples of Patrinia scabiosifolia and Astragalus membranaceus obtained in Example 2 were tested. The samples were numbered 1, 2, and 3 as Patrinia scabiosifolia BJC01, BJC02, and BJC03, respectively, and 4 and 5 as Astragalus membranaceus XM01 and XM02, respectively. N was sterile water, and M was a 2000bp plus DNA Marker.
[0043] Table 10 Screening conditions for DNA template amount in multiplex PCR reactions
[0044] The results are as follows Figure 4 As shown, when the DNA template concentration was 30 and 100 ng / μL, specific bands were amplified at the corresponding positions for both Patrinia scabiosifolia and Aristolochia debilis. However, no bands or faint bands were observed at 3 and 10 ng / μL. Therefore, it is recommended that the template amount be 30-100 ng for amplification.
[0045] 2.4 Assessment of the suitability of the PCR instrument The suitability of the PCR instrument was evaluated using a 2×M5 HiPer plus Taq HiFi PCR mix (with blue dye) system.
[0046] The PCR reaction system is shown in Table 5, and the PCR reaction procedure is shown in Table 8. The samples of *Patrinia scabra* and *Ixora chinensis* obtained in Example 2 were tested. Samples numbered 1, 2, and 3 were *Patrinia scabra* BJC01, BJC02, and BJC03, respectively; samples 4 and 5 were *Ixora chinensis* XM01 and XM02, respectively. N was sterile water, and M was a 2000bp plus DNA marker. Multiplex PCR reactions were performed using an ABI VERITI96 PCR instrument or a BIO-RAD T100 PCR instrument.
[0047] The results are as follows Figure 5 As shown, all samples could amplify specific bands at the corresponding positions, indicating that the primer composition of the chloroplast gene ITS2 barcode sequence has good PCR instrument compatibility.
[0048] 2.5 Assessment of the adaptability of multiplex PCR The fitness of multiplex PCR was evaluated using a 2×M5 HiPer plus Taq HiFi PCR mix (with blue dye) system.
[0049] Using an ABI VERITI96 PCR instrument, the PCR reaction system is shown in Table 5, and the PCR reaction program is shown in Table 8. The DNA of the samples of Patrinia scabiosifolia and Astragalus membranaceus obtained in Example 2 was detected. The samples numbered 1-11 are Patrinia scabiosifolia BJC01-BJC011 corresponding to Table 2, and 12-22 are Astragalus membranaceus XM01-XM011 corresponding to Table 1. N is sterile water, and M is 2000bp plus DNA Marker.
[0050] The results are as follows Figure 6 As shown, specific bands can be amplified at 163 bp for Patrinia scabra and at 255 bp for Astragalus membranaceus.
[0051] Meanwhile, the adaptability of the mixing ratio was investigated. The PCR reaction system is shown in Table 5, and the PCR reaction procedure is shown in Table 8. The DNA extracted from the mixed samples of Patrinia scabiosifolia and Astragalus membranaceus obtained in Example 2 was detected. Among them, numbers 1-9 are all DNA mixtures of Patrinia scabiosifolia BJC01 and Astragalus membranaceus XM01, with mixing mass ratios of 1:399, 1:199, 1:39, 1:9, 1:1, 9:1, 39:1, 199:1, and 399:1, respectively; numbers 10-18 are DNA mixtures of Patrinia scabiosifolia BJC02 and Astragalus membranaceus XM02, with ratios of 1:399, 1:19, and 1:19, respectively. 9, 1:39, 1:9, 1:1, 9:1, 39:1, 199:1, 399:1. Numbers 19-27 all contain *Patrinia scabra* BJC10 and *Ilex chinensis* XM10, with mass ratios of 1:399, 1:199, 1:39, 1:9, 1:1, 9:1, 39:1, 199:1, 399:1 respectively. Numbers 28-37 all contain *Patrinia scabra* BJC11 and *Ilex chinensis* XM11, with ratios of 1:399, 1:199, 1:39, 1:9, 1:1, 9:1, 39:1, 199:1, 399:1 respectively. N represents sterile water, and M represents a 2000bp plus DNA marker.
[0052] The results are as follows Figure 7 As shown, in all mixed samples, bands could be amplified at the corresponding 163 bp and 255 bp.
Claims
1. A primer composition for the chloroplast gene ITS2 barcode sequence, characterized in that, The primer composition contains at least one pair of primers derived from the nucleotide sequences shown in GenBank accessions PP277665.1 and / or PP906956.
1.
2. The primer composition for the chloroplast gene ITS2 barcode sequence according to claim 1, characterized in that, The primer composition includes: Primer pair A: upstream primer with nucleotide sequences as shown in SEQ ID NO: 1, and downstream primer with nucleotide sequences as shown in SEQ ID NO:
2. And / or primer pair B: upstream primer as shown in SEQ ID NO: 3, and downstream primer as shown in SEQ ID NO:
4.
3. An identification kit, characterized in that, The identification kit contains the primer composition for the chloroplast gene ITS2 barcode sequence as described in claim 1 or 2.
4. The use of a primer composition for the chloroplast gene ITS2 barcode sequence as described in claim 1 or 2, or the identification kit as described in claim 3, in the identification and / or differentiation of medicinal plants.
5. The application according to claim 4, characterized in that, The medicinal plants mentioned include: *Patrinia scabiosifolia* (family Caprifoliaceae) and *Iris tectorum* (family Brassicaceae).
6. The application according to claim 4, characterized in that, The steps of the application include: (1) Extract genomic DNA from the sample to be tested; (2) PCR amplification was performed using the aforementioned primer combination or identification kit for the chloroplast gene ITS2 barcode sequence; (3) Analyze the PCR products to determine the sample type.
7. The application according to claim 6, characterized in that, The primer composition or identification kit described in step 2 contains: an upstream primer with nucleotide sequences as shown in SEQ ID NO: 3 and 5, and a downstream primer as shown in SEQ ID NO: 4 and 6.
8. The application according to claim 6, characterized in that, The PCR amplification method described in step 2 is either singleton PCR amplification or multiplex PCR amplification.
9. The application according to claim 6, characterized in that, The method for analyzing PCR products in step 3 is agarose gel electrophoresis.
10. The application according to claim 9, characterized in that, When analyzing PCR products by agarose gel electrophoresis, If a 255bp band appears, the sample to be tested is *Vallisneria natans*, belonging to the genus *Vallisneria* of the family Caprifoliaceae. If a 163bp band appears, the sample to be tested is Iris genus of Brassicaceae. If both 255bp and 163bp bands are present, the sample to be tested is a mixture of *Vallisneria natans* (family Caprifoliaceae) and *Iris* (family Brassicaceae).