Polypeptides with alkaline phosphatase activity for animal feed

By providing alkaline phosphatase peptides from bacteria or fungi that are stable in the stomach or pepsin, the stability problem of existing alkaline phosphatases in animal feed additives is solved, thereby improving animal health and growth performance.

CN121569031APending Publication Date: 2026-02-24NOVOZYMES AS
View PDF 35 Cites 0 Cited by

Patent Information

Application Number
CN202480048883.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-08-15
Filing Date
2024-08-15
Publication Date
2026-02-24

AI Technical Summary

Technical Problem

Existing alkaline phosphatases, such as calf intestinal alkaline phosphatase (CIAP), are insufficient in terms of gastric or pepsin stability, making them unsuitable for use as animal feed additives. Furthermore, existing bacterial alkaline phosphatases still have room for improvement in terms of heat stability and gastric stability.

Method used

Provides peptides with alkaline phosphatase activity, including peptides or variants of those derived from bacteria or fungi, ensuring at least 70% sequence identity of the peptides, and optimized by substitution, deletion or addition of amino acids to ensure stability in the stomach or pepsin environment, for use in the preparation of animal feed additives.

Benefits of technology

It improves the stability and effectiveness of alkaline phosphatase in animal feed, promotes animal weight gain, improves feed conversion rate, maintains intestinal health, prevents infection and inflammation, reduces the colonization of harmful bacteria, supports the growth of symbiotic bacteria, maintains intestinal microecological balance, and reduces immune response and inflammatory response.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_5
    Figure SMS_5
  • Figure SMS_6
    Figure SMS_6
Patent Text Reader

Abstract

The present invention relates to animal feed additives comprising polypeptides that have alkaline phosphatase activity and are pH or gastric stable. The invention further relates to an animal feed additive for preserving or maintaining the health of an animal, typically poultry or pig, including the intestinal health of the animal.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] References to sequence lists This application contains a sequence list in a computer-readable form, which is incorporated herein by reference. Technical Field

[0002] This invention relates to polypeptides with alkaline phosphatase activity, polynucleotides encoding these polypeptides, nucleic acid constructs containing these polynucleotides, vectors, and host cells, along with methods for producing and using these polypeptides. Background Technology

[0003] ALP is an enzyme that removes phosphate from a variety of substrates. ALP is active in various biological processes. It is present in all tissues of the human body, but is primarily concentrated in bones, kidneys, liver, intestines, and placenta. Intestinal alkaline phosphatase (IAP) has been the most studied to date.

[0004] Calf intestinal alkaline phosphatase (CIAP) is a well-known and commercially available alkaline phosphatase. WO 2022196538 discloses variants of calf intestinal alkaline phosphatase (CIAP) with improved thermal stability. However, CIAP has low or no gastric or pepsin stability. Therefore, CIAP is unsuitable for use as an animal feed additive. Therefore, there is a need in the art for novel alkaline phosphatases.

[0005] Elanco (US 20180326020) describes the use of Bacillus repens (… Paenibacillus slow Methods and compositions for reducing the environmental impact of animal waste by using alkaline phosphatase. The alkaline phosphatase described in US 20180326020 corresponds to SEQ ID NO:50 of this invention. WO 2023 / 102002 describes a variant of a slow-release Bacillus alkaline phosphatase with improved thermostability. SEQ ID NO:1 of WO 2023 / 102002 corresponds to SEQ ID NO:107 referenced herein. Summary of the Invention

[0006] This invention provides polypeptides with alkaline phosphatase activity and polynucleotides encoding these polypeptides.

[0007] The present invention also relates to a polypeptide having alkaline phosphatase activity, wherein the polypeptide is of bacterial or fungal origin, or a variant of a bacterial or fungal-derived polypeptide, typically wherein the polypeptide is stable to the stomach or pepsin. The polypeptide according to the invention is selected based on its pH and / or gastric stability.

[0008] This invention also relates to polypeptides selected from the group consisting of those having alkaline phosphatase activity: (a) With SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO:5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ IDNO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ IDNO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ IDNO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ IDNO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ IDNO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ IDNO:73, SEQ IDNO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88. SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105. A polypeptide having at least 70% sequence identity with SEQ ID NO:106; (b) A polypeptide that has at least 70% sequence identity with the mature polypeptide of (a); (c) A polypeptide encoded by a polynucleotide that has at least 70% sequence identity with the mature polypeptide encoding sequence of the polypeptide of (a) or (b); (d) A polypeptide derived from a polypeptide of (a) or (c) or a mature polypeptide of (b) by substitution, deletion or addition of 1 to 120 amino acids, such as 1 to 100, 1 to 80, 1 to 60 or 1 to 40 amino acids. (e) A polypeptide derived from (a), (b), (c), or (d), wherein the N-terminus and / or C-terminus have been extended by adding 1 to 50 amino acids, such as 1 to 40, 1 to 30, or 1 to 20 amino acids; and (f) Fragments of the polypeptides described in (a), (b), (c), (d) or (e); The polypeptides in (a), (b), (c), (d), or (e) or the fragment in (f) have alkaline phosphatase activity.

[0009] This invention also relates to a composition comprising the polypeptides of the present invention. This invention also relates to an animal feed additive comprising the polypeptides of the present invention, preferably pH- and / or stomach-stabilizing polypeptides having alkaline phosphatase activity. This invention also relates to an animal feed comprising the polypeptides, compositions, or animal feed additives of the present invention. This invention also relates to an animal technical additive comprising the polypeptides, compositions, or animal feed additives of the present invention.

[0010] Another aspect of the present invention relates to a method for preparing animal feed additives, animal technology additives, or feeds, the method comprising adding the polypeptides of the present invention. Another aspect of the present invention relates to the use of the polypeptides of the present invention in the preparation of feed additives, feed compositions, or animal technology additives.

[0011] Another aspect of the invention relates to a method for increasing weight gain in animals, the method comprising feeding the animals polypeptides, compositions, or animal feed additives of the present invention. Another aspect of the invention relates to a method for improving feed conversion ratio in animals, the method comprising feeding the animals polypeptides, compositions, or animal feed additives of the present invention. One aspect of the invention relates to a method for preventing weight loss in infected animals, the method comprising feeding the animals polypeptides, compositions, or animal feed additives of the present invention. Another aspect of the invention relates to a method for preventing low birth weight, such as low birth weight induced by perinatal malnutrition, the method comprising feeding the animals polypeptides, compositions, or animal feed additives of the present invention. Another aspect of the invention relates to a method for improving weight gain in animals with below-average birth weight, the method comprising feeding the animals polypeptides, compositions, or animal feed additives of the present invention.

[0012] Another aspect of the invention relates to a method for maintaining or supporting intestinal health, or improving intestinal health in animals to promote the growth of symbiotic bacteria, the method comprising feeding the animal a polypeptide, composition, or animal feed additive of the invention. Another aspect of the invention relates to a method for maintaining an effective intestinal barrier, the method comprising feeding the animal a polypeptide, composition, or animal feed additive of the invention. Another aspect of the invention relates to a method for preventing colitis or inflammation of the colonic lining in animals, the method comprising feeding the animal a polypeptide, composition, or animal feed additive of the invention. Another aspect of the invention relates to a method for preventing infection from Salmonella spp. Salmonella (such as Salmonella typhimurium) Salmonella entericaserovar Typhimurium )) St. Typhimurium ) and / or Clostridium ( Clostridium (such as Clostridium difficile) Clostridium difficileA method for treating antibiotic-associated infections, comprising feeding the animal the polypeptide, composition, or animal feed additive of the present invention. Another aspect of the invention relates to a method for preventing or reducing intestinal colonization or systemic translocation of harmful bacteria, or for treating "dysbiosis," i.e., for altering the bacterial and / or archaea balance of the intestinal microecology (e.g., reducing Escherichia coli). E.coli Salmonella typhimurium ( Salmonella Typhimurium (such as Salmonella typhimurium), Bacillus fragilis ( Fragile Bacillus ), Streptococcus thermophilus ( S thermophilic A method comprising feeding the animal the polypeptide, composition, or animal feed additive of the present invention (or a relative amount of Clostridium difficile).

[0013] Another aspect of the present invention relates to a method for detoxifying lipopolysaccharides in animals, the method comprising feeding the animals a polypeptide, composition, or animal feed additive of the present invention. Another aspect of the present invention relates to a method for reducing immune responses in animals, the method comprising feeding the animals a polypeptide, composition, or animal feed additive of the present invention. Another aspect of the present invention relates to a method for reducing inflammation in animals, the method comprising feeding the animals a polypeptide, composition, or animal feed additive of the present invention. Another aspect of the present invention relates to a method for reducing interleukin (IL) or tumor necrosis factor (TNF) responses in animals, the method comprising feeding the animals a polypeptide, composition, or animal feed additive of the present invention.

[0014] Another aspect of the invention relates to a method for regulating fat absorption or neutralizing acidic digestive material entering the small intestine by stimulating bicarbonate secretion and surface pH, the method comprising feeding the animal the polypeptide, composition, or animal feed additive of the invention.

[0015] Another aspect of the invention relates to a method for maintaining or restoring (healthy) gut microbiota in animals treated with antibiotics, the method comprising feeding the animals the polypeptides, compositions, or animal feed additives of the invention.

[0016] One aspect of the invention relates to the detoxification of LPS and / or ATP via ALP-mediated dephosphorylation, wherein the ALP is the ALP of the present invention. Another aspect of the invention relates to a method for detoxifying lipopolysaccharides in animals, the method comprising feeding the animals the polypeptides, compositions, animal feed additives, or animal technology additives of the present invention.

[0017] One aspect of the present invention relates to a method for reducing an immune response in an animal, the method comprising feeding the animal the polypeptide, composition, animal feed additive, or animal technology additive of the present invention.

[0018] One aspect of the present invention relates to a method for reducing inflammation in animals, the method comprising feeding the animals the polypeptides, compositions, animal feed additives, or animal technology additives of the present invention.

[0019] One aspect of the present invention relates to a method for mitigating IL or TNF responses in animals, the method comprising feeding the animals the polypeptides, compositions, animal feed additives, or animal technology additives of the present invention.

[0020] One aspect of the present invention relates to a method for maintaining or supporting gut health in animals, or for improving gut health thereby promoting the growth of symbiotic bacteria, the method comprising feeding the animals the polypeptides, compositions, animal feed additives, or animal technology additives of the present invention.

[0021] One aspect of the invention relates to a method for maintaining an effective intestinal barrier, the method comprising feeding the animal the polypeptide, composition, animal feed additive, or animal technology additive of the invention.

[0022] One aspect of the present invention relates to a method for preventing colitis or inflammation of the colonic wall in animals, the method comprising feeding the animals the polypeptides, compositions, animal feed additives, or animal technology additives of the present invention.

[0023] One aspect of the present invention is a method for preventing or reducing intestinal colonization or systemic translocation of harmful bacteria, or for "dysbiosis," i.e., for altering the bacterial and / or archaea balance of the intestinal microecology, the method comprising feeding the animal the polypeptide, composition, animal feed additive, or animal technology additive of the present invention.

[0024] Brief description of the sequence SEQ ID NO: 1 is a strain of *Bacillus parageli* obtained by pyrolysis of xylose (… Parageobacillus caldoxylosis lytic ( ) is a polypeptide with alkaline phosphatase activity.

[0025] SEQ ID NO: 2 is obtained from Bacillus thermophilus ( Geobacillus thermoleovorans ( ) is a polypeptide with alkaline phosphatase activity.

[0026] SEQ ID NO: 3 is a species obtained from the genus *Lactobacillus* ( Sporolactobacillus sp. ) -63357 A polypeptide with alkaline phosphatase activity.

[0027] SEQ ID NO: 4 is a biodegradable pyrolytic protein-aerobic Bacillus (Bacillus pyrolyticus) Anoxybacillus caldiproteolytic ( ) is a polypeptide with alkaline phosphatase activity.

[0028] SEQ ID NO: 5 is a polypeptide with alkaline phosphatase activity obtained from Bacillus thermophilus.

[0029] SEQ ID NO: 6 is a xylose-producing Bacillus (Bacillus oryzae) Paenibacillus xylanexedens ( ) is a polypeptide with alkaline phosphatase activity.

[0030] SEQ ID NO: 7 is derived from a species of the genus *Lactobacillus*. -63357 A polypeptide with alkaline phosphatase activity.

[0031] SEQ ID NO: 8 is derived from *Bacillus ginseng* (…). Paenibacillus panacisoli ( ) is a polypeptide with alkaline phosphatase activity.

[0032] SEQ ID NO: 9 is derived from *Syntrophus mesenteroides* (Syntrophus mesenteroides). Collimonas pratensis ( ) is a polypeptide with alkaline phosphatase activity.

[0033] SEQ ID NO: 10 is derived from Bacillus ileus (Illinois) Paenibacillus illinoisensis ( ) is a polypeptide with alkaline phosphatase activity.

[0034] SEQ ID NO: 11 is derived from Neosporus baadavia (Neo Batavian bacillus ( ) is a polypeptide with alkaline phosphatase activity.

[0035] SEQ ID NO: 12 is the acquired *Aeromonas salmonicidae* subsp. *salmonic* (a type of bacteria). Aeromonas salmonicida subsp. salmonicida ( ) is a polypeptide with alkaline phosphatase activity.

[0036] SEQ ID NO: 13 is a self-degrading amylolytic bacillus ( Paenibacillus amylolyticus ( ) is a polypeptide with alkaline phosphatase activity.

[0037] SEQ ID NO: 14 is derived from Serratia plymouthii (Serratia marcescens). Serratia plymouthica ( ) is a polypeptide with alkaline phosphatase activity.

[0038] SEQ ID NO: 15 is obtained from *Cytobacter fibrosis* (Cytobacter fibrosis). strong bacillus ( ) is a polypeptide with alkaline phosphatase activity.

[0039] SEQ ID NO: 16 is derived from *Priscilla megaterium* (… Priestia megatherium ( ) is a polypeptide with alkaline phosphatase activity.

[0040] SEQ ID NO: 17 is obtained from Trichoderma viride ( Serratia plymouthica ( ) is a polypeptide with alkaline phosphatase activity.

[0041] SEQ ID NO: 18 is obtained from *Polytrichum stenoptera* (S. stenoptera). Narrow-necked truncatella ( ) is a polypeptide with alkaline phosphatase activity.

[0042] SEQ ID NO: 19 is obtained from *Morchella esculenta* (half-open morel). Morel semi-free ( ) is a polypeptide with alkaline phosphatase activity.

[0043] SEQ ID NO: 20 is obtained from Serratia figo ( Serratia ficaria ( ) is a polypeptide with alkaline phosphatase activity.

[0044] SEQ ID NO: 21 is a polypeptide with alkaline phosphatase activity obtained from metagenomics.

[0045] SEQ ID NO: 22 is a polypeptide with alkaline phosphatase activity obtained from metagenomics.

[0046] SEQ ID NO: 23 is a polypeptide with alkaline phosphatase activity obtained from metagenomics.

[0047] SEQ ID NO: 24 is a polypeptide with alkaline phosphatase activity obtained from metagenomics.

[0048] SEQ ID NO: 25 is a polypeptide with alkaline phosphatase activity obtained from metagenomics.

[0049] SEQ ID NO: 26 is a polypeptide with alkaline phosphatase activity obtained from metagenomics.

[0050] SEQ ID NO: 27 is obtained from Bacillus subtilis (… Sporormia fimetaria ( ) is a polypeptide with alkaline phosphatase activity.

[0051] SEQ ID NO: 28 is obtained from *Thermophilus brittle* ( Thermoascus crustacean ( ) is a polypeptide with alkaline phosphatase activity.

[0052] SEQ ID NO: 29 is obtained from Australian fusiform shells ( Thielavia australiensis ( ) is a polypeptide with alkaline phosphatase activity.

[0053] SEQ ID NO: 30 is derived from the thermophilic variety of Chaetomium thermophilum ( Chaetomium thermophilum var. thermophilic ( ) is a polypeptide with alkaline phosphatase activity.

[0054] SEQ ID NO: 31 is a polypeptide with alkaline phosphatase activity obtained from Aspergillus sp. XZ2669.

[0055] SEQ ID NO: 32 is a polypeptide with alkaline phosphatase activity obtained from a species of the genus *Colletotrichum*-53045.

[0056] SEQ ID NO: 33 is a polypeptide with alkaline phosphatase activity obtained from metagenomics.

[0057] SEQ ID NO: 34 is a polypeptide with alkaline phosphatase activity obtained from metagenomics.

[0058] SEQ ID NO: 35 is derived from a species of the genus *Stenocephalum* ( Caulobacter sp. ) -63731 A polypeptide with alkaline phosphatase activity.

[0059] SEQ ID NO: 36 is a polypeptide with alkaline phosphatase activity obtained from Caulobacter vibrioides.

[0060] SEQ ID NO: 37 is obtained from Serratia marcescens (a type of nematode). Serratia nematodiphila ( ) is a polypeptide with alkaline phosphatase activity.

[0061] SEQ ID NO: 38 is derived from *Rhodotorula salina* (Salt Lake). Loktanella salsilacus ( ) is a polypeptide with alkaline phosphatase activity.

[0062] SEQ ID NO: 39 is a polypeptide with alkaline phosphatase activity obtained from Sphingopyxis chilensis.

[0063] SEQ ID NO: 40 is a species obtained from the genus *Cyclophorus* ( Tolypocladium sp. ) XZ2657 A polypeptide with alkaline phosphatase activity.

[0064] SEQ ID NO: 41 is derived from Penicillium Basque ( Penicillium vasconiae ( ) is a polypeptide with alkaline phosphatase activity.

[0065] SEQ ID NO: 42 is a species obtained from the genus *Botrytis* (…). Cladobotryum sp. ( ) is a polypeptide with alkaline phosphatase activity.

[0066] SEQ ID NO: 43 is a species obtained from the genus *Dystomum* ( Taifanglania sp.) ZY039 A polypeptide with alkaline phosphatase activity.

[0067] SEQ ID NO: 44 is derived from a species of the genus Chaetomium ( Achaetomium sp. ) ZY150 A polypeptide with alkaline phosphatase activity.

[0068] SEQ ID NO: 45 is derived from a species of the genus *Chaetoceros* ( Chaetomium sp. ) ZY474 A polypeptide with alkaline phosphatase activity.

[0069] SEQ ID NO: 46 is obtained from Bacillus aquaticus ( Fontibacillus aquaticus ( ) is a polypeptide with alkaline phosphatase activity.

[0070] SEQ ID NO: 47 is derived from a species of the genus Bacillus ( Paenibacillus sp. ) -19179 A polypeptide with alkaline phosphatase activity.

[0071] SEQ ID NO: 48 is derived from a species of the genus Bacillus. -62606 A polypeptide with alkaline phosphatase activity.

[0072] SEQ ID NO: 49 is obtained from Bacillus wusongii ( Paenibacillus woosongensis ( ) is a polypeptide with alkaline phosphatase activity.

[0073] SEQ ID NO: 50 is obtained from Bacillus tarda ( Bacillus lentus ) / Ledbergia is very difficult ( Lederbergia lenta ( ) is a polypeptide with alkaline phosphatase activity, and is a polypeptide described in US 20180326020.

[0074] SEQ ID NO: 51 is a polypeptide with alkaline phosphatase activity obtained from metagenomics.

[0075] SEQ ID NO: 52 is derived from a species of the genus Bacillus. -62603 A polypeptide with alkaline phosphatase activity.

[0076] SEQ ID NO: 53 is a polypeptide with alkaline phosphatase activity obtained from Bacillus neoplasm of Batavia.

[0077] SEQ ID NO: 54 is derived from Bacillus pyrifolia (Bacillus pyrifolia). Paenibacillus taohuashanense ( ) is a polypeptide with alkaline phosphatase activity.

[0078] SEQ ID NO: 55 is obtained from *Herpes simplex* (…). Hyphomonas hirschiana ( ) is a polypeptide with alkaline phosphatase activity.

[0079] SEQ ID NO: 56 is derived from Marine Fibromonas ( Hyphomonas oceanitis ( ) is a polypeptide with alkaline phosphatase activity.

[0080] SEQ ID NO: 57 is derived from *Radiation-resistant Coccidia* (…). Deinococcus radiodurans ( ) is a polypeptide with alkaline phosphatase activity.

[0081] SEQ ID NO: 58 was obtained from *Coccidia humilis* (Gobi *Coccidia*). Deinococcus gobiensis ( ) is a polypeptide with alkaline phosphatase activity.

[0082] SEQ ID NO: 59 is obtained from *Trichophyton spp.* ( Deinococcus pimensis ( ) is a polypeptide with alkaline phosphatase activity.

[0083] SEQ ID NO: 60 is a polypeptide with alkaline phosphatase activity obtained from Deinococcus sp.-17890.

[0084] SEQ ID NO: 61 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0085] SEQ ID NO: 62 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0086] SEQ ID NO: 63 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0087] SEQ ID NO: 64 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0088] SEQ ID NO: 65 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0089] SEQ ID NO: 66 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0090] SEQ ID NO: 67 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0091] SEQ ID NO: 68 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0092] SEQ ID NO: 69 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0093] SEQ ID NO: 70 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0094] SEQ ID NO: 71 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0095] SEQ ID NO: 72 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0096] SEQ ID NO: 73 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0097] SEQ ID NO: 74 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0098] SEQ ID NO: 75 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0099] SEQ ID NO: 76 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0100] SEQ ID NO: 77 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0101] SEQ ID NO: 78 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0102] SEQ ID NO: 79 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0103] SEQ ID NO: 80 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0104] SEQ ID NO: 81 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0105] SEQ ID NO: 82 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0106] SEQ ID NO: 83 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0107] SEQ ID NO: 84 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0108] SEQ ID NO: 85 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0109] SEQ ID NO: 86 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0110] SEQ ID NO: 87 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0111] SEQ ID NO: 88 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0112] SEQ ID NO: 89 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0113] SEQ ID NO: 90 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0114] SEQ ID NO: 91 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0115] SEQ ID NO: 92 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0116] SEQ ID NO: 93 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0117] SEQ ID NO: 94 is a variant of SEQ ID NO: 21 that has alkaline phosphatase activity.

[0118] SEQ ID NO: 95 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0119] SEQ ID NO: 96 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0120] SEQ ID NO: 97 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0121] SEQ ID NO: 98 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0122] SEQ ID NO: 99 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0123] SEQ ID NO: 100 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0124] SEQ ID NO: 101 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0125] SEQ ID NO: 102 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0126] SEQ ID NO: 103 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0127] SEQ ID NO: 104 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0128] SEQ ID NO: 105 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0129] SEQ ID NO: 106 is a variant of SEQ ID NO: 11 that has alkaline phosphatase activity.

[0130] SEQ ID NO: 107 is the polypeptide described as SEQ ID NO: 1 in WO 2023 / 102002, and is a variant of SEQ ID NO: 50. Detailed Implementation

[0131] In one aspect, the present invention relates to an animal feed additive comprising a polypeptide having alkaline phosphatase activity, the polypeptide being selected from the group consisting of: (a) With SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO:5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ IDNO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ IDNO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ IDNO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ IDNO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ IDNO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ IDNO:73, SEQ IDNO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88. SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105. A polypeptide having at least 70% sequence identity with SEQ ID NO:106.

[0132] (b) A polypeptide that has at least 70% sequence identity with the mature polypeptide of (a); (c) A polypeptide encoded by a polynucleotide that has at least 70% sequence identity with the mature polypeptide encoding sequence of the polypeptide of (a) or (b); (d) A polypeptide derived from a polypeptide of (a) or (c) or a mature polypeptide of (b) by substitution, deletion or addition of 1 to 120 amino acids, such as 1 to 100, 1 to 80, 1 to 60 or 1 to 40 amino acids. (e) A polypeptide derived from (a), (b), (c), or (d), wherein the N-terminus and / or C-terminus have been extended by adding 1 to 50 amino acids, such as 1 to 40, 1 to 30, or 1 to 20 amino acids; and (f) Fragments of the polypeptides described in (a), (b), (c), (d) or (e); The polypeptides in (a), (b), (c), (d), or (e) or the fragment in (f) have alkaline phosphatase activity.

[0133] In a preferred embodiment, the polypeptide having alkaline phosphatase activity is of bacterial or fungal origin, or a variant of a bacterial or fungal polypeptide, more preferably a bacterial polypeptide or a variant of a bacterial polypeptide, having alkaline phosphatase activity.

[0134] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 1. The polypeptide preferably comprises, substantially comprises, or comprises the amino acid sequence of SEQ ID NO: 1 or its mature polypeptide.

[0135] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 2. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 2 or its mature polypeptide.

[0136] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 3. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 3 or its mature polypeptide.

[0137] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 4. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 4 or its mature polypeptide.

[0138] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 5. The polypeptide preferably comprises, substantially comprises, or comprises the amino acid sequence of SEQ ID NO: 5 or its mature polypeptide.

[0139] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 6. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 6 or its mature polypeptide.

[0140] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 7. The polypeptide preferably comprises, substantially comprises, or comprises the amino acid sequence of SEQ ID NO: 7 or its mature polypeptide.

[0141] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 8. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 8 or its mature polypeptide.

[0142] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 9. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 9 or its mature polypeptide.

[0143] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 10. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 10 or its mature polypeptide.

[0144] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 11. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 11 or its mature polypeptide.

[0145] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 12. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 12 or its mature polypeptide.

[0146] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 13. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 13 or its mature polypeptide.

[0147] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 14. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 14 or its mature polypeptide.

[0148] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 15. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 15 or its mature polypeptide.

[0149] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 16. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 16 or its mature polypeptide.

[0150] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 17. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 17 or its mature polypeptide.

[0151] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 18. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 18 or its mature polypeptide.

[0152] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 19. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 19 or its mature polypeptide.

[0153] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 20. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 20 or its mature polypeptide.

[0154] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 21. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 21 or its mature polypeptide.

[0155] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 22. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 22 or its mature polypeptide.

[0156] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 23. The polypeptide preferably comprises, substantially comprises, or comprises the amino acid sequence of SEQ ID NO: 23 or its mature polypeptide.

[0157] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 24. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 24 or its mature polypeptide.

[0158] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 25. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 25 or its mature polypeptide.

[0159] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with ID NO: 26. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 26 or its mature polypeptide.

[0160] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 27. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 27 or its mature polypeptide.

[0161] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 28. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 28 or its mature polypeptide.

[0162] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 29. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 29 or its mature polypeptide.

[0163] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 30. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 30 or its mature polypeptide.

[0164] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 31. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 31 or its mature polypeptide.

[0165] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 32. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 32 or its mature polypeptide.

[0166] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 33. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 33 or its mature polypeptide.

[0167] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 34. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 34 or its mature polypeptide.

[0168] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 35. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 35 or its mature polypeptide.

[0169] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 36. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 36 or its mature polypeptide.

[0170] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 37. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 37 or its mature polypeptide.

[0171] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 38. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 38 or its mature polypeptide.

[0172] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 39. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 39 or its mature polypeptide.

[0173] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 40. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 40 or its mature polypeptide.

[0174] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 41. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 41 or its mature polypeptide.

[0175] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 42. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 42 or its mature polypeptide.

[0176] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 43. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 43 or its mature polypeptide.

[0177] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 44. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 44 or its mature polypeptide.

[0178] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 45. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 45 or its mature polypeptide.

[0179] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 46. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 46 or its mature polypeptide.

[0180] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 47. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 47 or its mature polypeptide.

[0181] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 48. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 48 or its mature polypeptide.

[0182] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 49. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 49 or its mature polypeptide.

[0183] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 51. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 51 or its mature polypeptide.

[0184] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 52. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 52 or its mature polypeptide.

[0185] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 53. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 53 or its mature polypeptide.

[0186] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 54. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 54 or its mature polypeptide.

[0187] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 55. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 55 or its mature polypeptide.

[0188] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 56. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 56 or its mature polypeptide.

[0189] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 57. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 57 or its mature polypeptide.

[0190] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 58. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 58 or its mature polypeptide.

[0191] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 59. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 59 or its mature polypeptide.

[0192] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 60. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 60 or its mature polypeptide.

[0193] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 61. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 61 or its mature polypeptide.

[0194] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 62. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 62 or its mature polypeptide.

[0195] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 63. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 63 or its mature polypeptide.

[0196] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 64. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 64 or its mature polypeptide.

[0197] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 65. The polypeptide preferably comprises, substantially comprises, or comprises the amino acid sequence of SEQ ID NO: 65 or its mature polypeptide.

[0198] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 66. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 66 or its mature polypeptide.

[0199] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 67. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 67 or its mature polypeptide.

[0200] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 68. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 68 or its mature polypeptide.

[0201] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 69. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 69 or its mature polypeptide.

[0202] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 70. The polypeptide preferably comprises, substantially comprises, or comprises the amino acid sequence of SEQ ID NO: 70 or its mature polypeptide.

[0203] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 71. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 71 or its mature polypeptide.

[0204] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 72. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 72 or its mature polypeptide.

[0205] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 73. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 73 or its mature polypeptide.

[0206] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 74. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 74 or its mature polypeptide.

[0207] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 75. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 75 or its mature polypeptide.

[0208] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 76. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 76 or its mature polypeptide.

[0209] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 77. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 77 or its mature polypeptide.

[0210] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 78. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 78 or its mature polypeptide.

[0211] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 79. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 79 or its mature polypeptide.

[0212] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 80. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 80 or its mature polypeptide.

[0213] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 81. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 81 or its mature polypeptide.

[0214] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 82. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 82 or its mature polypeptide.

[0215] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 83. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 83 or its mature polypeptide.

[0216] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 84. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 84 or its mature polypeptide.

[0217] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 85. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 85 or its mature polypeptide.

[0218] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 86. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 86 or its mature polypeptide.

[0219] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 87. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 87 or its mature polypeptide.

[0220] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 88. The polypeptide preferably comprises, substantially comprises, or comprises the amino acid sequence of SEQ ID NO: 88 or its mature polypeptide.

[0221] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 89. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 89 or its mature polypeptide.

[0222] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 90. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 90 or its mature polypeptide.

[0223] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 91. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 91 or its mature polypeptide.

[0224] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 92. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 92 or its mature polypeptide.

[0225] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 93. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 93 or its mature polypeptide.

[0226] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 94. The polypeptide preferably comprises, substantially comprises, or comprises the amino acid sequence of SEQ ID NO: 94 or its mature polypeptide.

[0227] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 95. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 95 or its mature polypeptide.

[0228] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 96. The polypeptide preferably comprises, substantially comprises, or comprises the amino acid sequence of SEQ ID NO: 96 or its mature polypeptide.

[0229] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 97. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 97 or its mature polypeptide.

[0230] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 98. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 98 or its mature polypeptide.

[0231] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 99. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 99 or its mature polypeptide.

[0232] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 100. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 100 or its mature polypeptide.

[0233] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 101. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 101 or its mature polypeptide.

[0234] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 102. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 102 or its mature polypeptide.

[0235] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 103. The polypeptide preferably comprises, substantially comprises, or comprises the amino acid sequence of SEQ ID NO: 103 or its mature polypeptide.

[0236] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 104. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 104 or its mature polypeptide.

[0237] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 105. The polypeptide preferably comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 105 or its mature polypeptide.

[0238] In one respect, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 106. The polypeptide preferably comprises, substantially comprises, or comprises the amino acid sequence of SEQ ID NO: 106 or its mature polypeptide.

[0239] On the other hand, the polypeptide is derived from a polypeptide selected from the group consisting of one or more amino acids by substitution, deletion, or addition: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 25, SEQ ID NO: 25, SEQ ID NO: 27. SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40. SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54. SEQ ID NO: 55. SEQ ID NO: 56. SEQ ID NO: 57. SEQ ID NO: 58. SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ IDNO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, and SEQ ID NO: 106. In some embodiments, the polypeptide is a variant of a polypeptide selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 25, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ IDNO: 31、SEQ ID NO: 32、SEQ ID NO: 33、SEQ ID NO: 34、SEQ ID NO: 35、SEQ ID NO: 36、SEQ ID NO: 37、SEQ ID NO: 38、SEQ ID NO: 39、SEQ ID NO: 40、SEQ IDNO: 41、SEQ ID NO: 42、SEQ ID NO: 43、SEQ ID NO: 44、SEQ ID NO: 45、SEQ ID NO: 46、SEQ ID NO: 47、SEQ ID NO: 48、SEQ ID NO: 49、SEQ ID NO: 51、SEQ ID NO: 52、SEQ IDNO: 53、SEQ ID NO: 54、SEQ ID NO: 55、SEQ ID NO: 56、SEQ ID NO: 57、SEQ ID NO: 58、SEQ ID NO: 59、SEQ ID NO: 60、SEQ ID NO: 61、SEQ ID NO: 62、SEQ ID NO: 63、SEQ IDNO: 64、SEQ ID NO: 65、SEQ ID NO: 66、SEQ ID NO: 67、SEQ ID NO: 68、SEQ ID NO: 69、SEQ ID NO: 70、SEQ ID NO: 71、SEQ ID NO: 72、SEQ ID NO: 73、SEQ ID NO: 74、SEQ IDNO: 75、SEQ ID NO: 76、SEQ ID NO: 77、SEQ ID NO: 78、SEQ ID NO: 79、SEQ ID NO: 80、SEQ ID NO: 81、SEQ ID NO: 82、SEQ ID NO: 83、SEQ ID NO: 84、SEQ ID NO: 85、SEQ IDNO: 86、SEQ ID NO: 87、SEQ ID NO: 88、SEQ ID NO: 89、SEQ ID NO: 90、SEQ ID NO: 91、SEQ ID NO: 92、SEQ ID NO: 93、SEQ ID NO: 94、SEQ ID NO: 95、SEQ ID NO: 96、SEQ IDNO: 97、SEQ ID NO: 98、SEQ ID NO: 99、SEQ ID NO: 100、SEQ ID NO: 101、SEQ ID NO:102、SEQ ID NO:103, SEQ ID NO: 104, SEQ ID NO: 105, and SEQ ID NO: 106, which contain substitutions, deletions, and / or insertions at one or more locations, wherein the variant has alkaline phosphatase activity. On one hand, the number of amino acid substitutions, deletions, and / or insertions introduced into the polypeptide selected from the group consisting of up to 120, such as up to 100, up to 80, up to 60, up to 50, up to 40, up to 30, up to 20, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17. SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 25, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29. SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42. SEQ ID NO: 43. SEQ ID NO: 44. SEQ ID NO: 45. SEQ ID NO: 46. SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO:55. SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68. SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81. SEQ ID NO: 82. SEQ ID NO: 83. SEQ ID NO: 84. SEQ ID NO: 85. SEQ ID SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, and SEQ ID NO: 106, wherein variants of the polypeptide possess alkaline phosphatase activity. Amino acid alterations can be minor, i.e., conserved amino acid substitutions or insertions that do not significantly affect protein folding and / or activity; typically small deletions of 1–30 amino acids; small N-terminal or C-terminal extensions, such as methionine residues at the N-terminus; small linker peptides of up to 20–25 residues; or small extensions that facilitate purification by altering net charge or another function (such as polyhistidine fragments, antigenic epitopes, or binding modules).

[0240] In a preferred embodiment, the polypeptide is derived from SEQ ID NO: 11 by substitution, deletion, or addition of one or more amino acids, wherein the polypeptide has alkaline phosphatase activity. In some embodiments, the polypeptide is a variant of SEQ ID NO: 11 comprising substitution, deletion, and / or insertion at one or more positions, wherein the variant of the polypeptide has alkaline phosphatase activity. In one aspect, the number of amino acid substitutions, deletions, and / or insertions introduced into the polypeptide of SEQ ID NO: 11 is up to 120, such as up to 100, up to 80, up to 60, up to 50, up to 40, up to 30, up to 20, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, wherein the variant of the polypeptide has alkaline phosphatase activity. Amino acid alterations can be minor, i.e., conserved amino acid substitutions or insertions that do not significantly affect protein folding and / or activity; typically small deletions of 1–60 amino acids; small N-terminal or C-terminal extensions, such as methionine residues at the N-terminus; small linker peptides of up to 20–25 residues; or small extensions that facilitate purification by altering net charge or another function (such as polyhistidine fragments, antigenic epitopes, or binding modules).

[0241] In a preferred embodiment, the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 11 through substitution, deletion, or addition of one or more amino acids, or is a variant of SEQ ID NO: 11, wherein the variant has alkaline phosphatase activity and has at least 70% sequence identity with a polypeptide selected from the group consisting of, for example,At least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity: SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79. SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92. SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, and SEQ ID NO: 106. ,

[0242] In one aspect, the present invention relates to polypeptides having alkaline phosphatase activity, wherein the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with polypeptides selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 ... NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30. SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43. SEQ ID NO: 44. SEQ ID NO: 45. SEQ ID NO: 46. SEQ ID NO: 47. SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO:SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, and SEQ ID NO: 106.

[0243] In a preferred embodiment, the polypeptide having alkaline phosphatase activity is a polypeptide that has at least 80% sequence identity with a polypeptide selected from the group consisting of SEQ ID NO: 11 and its variants. Therefore, the polypeptide is preferably selected from polypeptides having at least 80% sequence identity with polypeptides selected from the group consisting of, such as at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or at least 96%, 97%, 98%, or 99% sequence identity: SEQ ID NO: 11, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 68, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105 and SEQ ID NO: 106.

[0244] In a preferred embodiment, the polypeptide having alkaline phosphatase activity is a polypeptide that has at least 80% sequence identity with a polypeptide selected from SEQ ID NO:21 and its variants. Therefore, the polypeptide is preferably selected from polypeptides having at least 80% sequence identity with polypeptides selected from the group consisting of, such as at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96%, 97%, 98%, or 99% sequence identity: SEQ ID NO: 21, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, and SEQ ID NO: 94.

[0245] Procedures known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, 1989), can be used. Science [Science] 244: 1081-1085) to identify essential amino acids in polypeptides. In the latter technique, a single alanine mutation is introduced at each residue in the molecule, and the alkaline phosphatase activity of the resulting molecule is tested to identify the amino acid residues critical to the molecule's activity. See also Hilton et al., 1996. J. Biol. Chem. [Journal of Biochemistry] 271: 4699-4708. The active sites of enzymes or other biological interactions can also be determined by physical analysis of the structure, such as by techniques like nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, along with mutagenesis of the amino acids at the presumed contact sites. See, for example, de Vos et al., 1992. Science [Science] 255: 306-312; Smith et al., 1992, J. Mol. Biol. [Journal of Molecular Biology] 224: 899-904; Wlodaver et al., 1992, FEBS Lett.[Circular of the Federation of European Biochemical Societies] 309: 59-64. The identity of essential amino acids can also be inferred from alignment with related peptides, and / or from sequence homology and conserved catalytic mechanisms with related peptides or peptide / protein families from a common ancestor (typically possessing similar three-dimensional structures, functions, and significant sequence similarity). Alternatively or additionally, protein structure prediction tools can be used for protein structure modeling to identify essential amino acids and / or active sites of peptides. See, for example, Jumper et al., 2021, “Highly accurate protein structure prediction with AlphaFold”. Nature [Nature] 596: 583-589.

[0246] Using known mutagenesis, recombination, and / or shuffling methods, followed by relevant screening procedures, single or multiple amino acid substitutions, deletions, and / or insertions can be identified and tested. These screening procedures are exemplified by those developed by Reidhaar-Olson and Sauer, 1988. Science [Science] 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences] 86: 2152-2156; WO 95 / 17413; or those disclosed in WO95 / 22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991, Biochemistry [Biochemistry] 30: 10832-10837; US 5,223,409; WO 92 / 06204) and regional directed mutagenesis (Derbyshire et al., 1986, Gene [Gene] 46: 145; Ner et al., 1988, DNA 7: 127).

[0247] Mutagenesis / recombination methods can be combined with high-throughput, automated screening methods to detect the activity of cloned, mutagenic peptides expressed by host cells (Ness et al., 1999). Nature Biotechnology [Nature Biotechnology] 17:893-896). Mutagenic DNA molecules encoding active peptides can be recovered from host cells and rapidly sequenced using standard methods in the art. These methods allow for the rapid determination of the importance of individual amino acid residues in the peptide.

[0248] definition Based on this detailed description, the following definitions apply. Note that the singular forms “a / an” and “the” include plural indicators unless the context explicitly indicates otherwise.

[0249] Unless otherwise defined or explicitly indicated by the context, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0250] Animals: The term "animal" refers to all animals other than humans. Examples of animals are non-ruminants and ruminants. Ruminants include, for example, sheep, goats, cattle (e.g., beef cattle, dairy cattle, and young calves), deer, yaks, camels, llamas, and kangaroos. Non-ruminants include monogastric animals such as pigs or swine (including but not limited to piglets, growing pigs, and sows); poultry such as turkeys, ducks, and chickens (including but not limited to broilers and laying hens); horses (including but not limited to hot-blooded horses, cold-blooded horses, and warm-blooded horses), young calves; fish (including but not limited to amberjack, arapaima, flounder, bass, bluefish, scorpionfish, cyprinid fish, catfish, catfish, carp, catfish, flounder, flounder, cichlid, cod, sunfish, golden snapper, croaker, eel, goby, etc.). Goldfish, gudgeon, grouper, guapot fish, halibut, Java fish, mullet, loach, mudskipper, milkfish, silver perch, mudfish, mullet, Pagoda fish, pearl spotted fish, Pager fish, perch, pike, pomfret, bream, salmon, shrimp, Canadian yellowtail, black perch, sea bream, glowfish, sleeper shark, snakehead, sea bream, shad, halibut, sashimi, sturgeon, sunfish, sweetfish, tuna, trout, trolley, tilapia, trout, tuna, turbot, white trout, whitebait and whitefish); and crustaceans (including but not limited to shrimp and prawns).

[0251] Animal feed: The term "animal feed" refers to any compound, preparation, or mixture suitable for or intended for use by animals. Animal feed for monogastric animals typically contains concentrates along with vitamins, minerals, enzymes, direct fed microbial, amino acids, and / or other feed ingredients (as in premixes), while animal feed for ruminants typically contains forage (including roughage and silage) and may further contain concentrates along with vitamins, minerals, enzymes, direct fed microbial, amino acids, and / or other feed ingredients (as in premixes).

[0252] Weight gain: The term “weight gain” refers to the increase in the live weight of an animal during a given period of time, such as the weight gain from day 1 to day 21.

[0253] Composition: The term "composition" refers to a composition comprising a carrier and at least one bacterial strain / enzyme of the present invention. The compositions described herein may be mixed with animal feed and may be referred to as "powdered feed".

[0254] Concentrates: The term “concentrate” refers to feeds with high protein and energy concentrations, such as fishmeal, molasses, oligosaccharides, sorghum, seeds and grains (e.g., whole or from corn, oats, rye, barley, wheat, or prepared by crushing, milling, etc.), oilseed filter cake (e.g., from cottonseed, safflower, sunflower, soybean, rapeseed / canola, peanut or peanut kernel), palm kernel cake, yeast-derived materials and distillers' grains (e.g., wet distillers' grains (WDS) and dry distillers' grains with solubles (DDGS)).

[0255] Direct feeding microorganisms: The term "direct feeding microorganisms" refers to live microorganisms, including spores, that, when applied in appropriate amounts, can have beneficial effects on the host, such as improving digestion or health.

[0256] Effective Amount / Effective Concentration / Effective Dosage: The terms "effective amount," "effective concentration," or "effective dose" are defined as the amount, concentration, or dose of one or more bacterial strains / enzymes sufficient to improve digestion or yield in an animal. The absolute number of the actual effective dose depends on factors including the health condition of the animal in question and the presence of other components. The "effective amount," "effective concentration," or "effective dose" of the one or more bacterial strains / enzymes can be determined by routine assays known to those skilled in the art.

[0257] Feed conversion ratio: The term "feed conversion ratio" refers to the amount of feed given to an animal to gain a specified weight. Improved feed conversion ratio means a lower feed conversion ratio. A "lower feed conversion ratio" or "improved feed conversion ratio" means that the use of the feed additive composition in the feed results in a reduction in the amount of feed given to the animal to gain the same weight compared to the amount of feed given to the animal without the feed additive composition.

[0258] Feed efficiency: The term "feed efficiency" refers to the amount of weight gain per unit of feed when an animal is fed arbitrarily or in a specified amount of food over a period of time. "Increased feed efficiency" means that the use of the feed additive composition according to the invention in feed results in an increase in weight gain per unit of feed intake compared to animals fed a diet without said feed additive composition.

[0259] Forage: As defined herein, the term “forage” also includes coarse grains. Forage is fresh plant material such as hay and silage derived from forage plants (grasses) and other forage plants (seagrass, germinated cereals, and legumes) or any combination thereof. Examples of forage plants are alfalfa (lucerne), birdsfoot, brassica (e.g., kale, rapeseed (canola), turnip (Swedish turnip), radish), clover (e.g., mixed clover, red clover, ground clover, white clover), grasses (e.g., Bermuda grass, bromegrass, false oat grass, fescue, heath grass, Kentucky bluegrass, orchard grass, ryegrass, Timothy-grass), corn, millet, barley, oats, rye, sorghum, soybeans, and wheat, and vegetables (e.g., sugar beets). Forage further includes crop residues from grain production (such as corn stalks; straw from wheat, barley, oats, rye and other grains); residues from vegetables such as beet tops; residues from oilseed production such as stems and leaves from soybeans, rapeseed and other legumes; and portions from grain refining for animal or human consumption or from fuel production or other industries.

[0260] Nutrient digestibility: The term “nutrient digestibility” refers to the fraction of nutrients that disappear from the gastrointestinal tract or a designated segment of the gastrointestinal tract (e.g., the small intestine). Nutrient digestibility can be measured as the difference between the nutrients administered to a subject and the nutrients excreted in the subject’s feces, or the difference between the nutrients administered to a subject and the nutrients retained in the digestate in a designated segment of the gastrointestinal tract (e.g., the ileum).

[0261] Nutrient digestibility, as used herein, can be measured by the difference between nutrient intake over a period of time and the amount of nutrients excreted as obtained from the total collection of excrement; or by using an inert marker that is not absorbed by the animal and allows researchers to calculate the amount of nutrients lost throughout or in segments of the gastrointestinal tract. Such an inert marker can be titanium dioxide, chromium oxide, or acid-insoluble ash. Digestibility can be expressed as a percentage of the nutrient in the feed or as a ratio of digestible nutrient units to nutrient units in the feed. Nutrient digestibility, as used herein, encompasses starch digestibility, fat digestibility, protein digestibility, and amino acid digestibility.

[0262] As used herein, energy digestibility means the total energy of the feed consumed minus the total energy of the feces, or the total energy of the feed consumed minus the total energy of the remaining digested matter in a specified segment of the animal's gastrointestinal tract (e.g., the ileum). Metabolizable energy, as used herein, means apparent metabolizable energy and refers to the total energy of the feed consumed minus the total energy contained in feces, urine, and digested gaseous products. Energy digestibility and metabolizable energy can be measured as the difference between total energy intake and the total energy excreted in feces or present in a specified segment of the gastrointestinal tract, using the same methods as for nutrient digestibility, with appropriate correction for nitrogen excretion to calculate the metabolizable energy of the feed.

[0263] Pellet: The terms “pellet” and / or “pelleting” refer to solid round, spherical and / or cylindrical flakes or pellets, and the processes used to form such solid shapes, particularly feed pellets and solid extruded animal feed. As used herein, the term “extrusion” (or extruding) is a well-known term in the art and refers to the process of passing a composition through an orifice under pressure, as described herein.

[0264] Poultry: The term "poultry" refers to domesticated birds raised by humans in relation to their eggs and / or their meat and / or their feathers. Poultry includes broiler chickens and laying hens. Poultry includes members of the superorder Galliformes (birds), particularly the order Galliformes (which includes chickens, guinea fowl, quails, and turkeys) and the family Anatidae, which, within Anatidae, is often referred to as "waterfowl" and includes domestic ducks and geese. Poultry also includes other birds killed for their meat, such as young pigeons. Examples of poultry include chickens (including laying hens, broiler chickens, and chicks), ducks, geese, pigeons, turkeys, and quails.

[0265] Whole grains: The term "whole grains" refers to dry plant materials with a high level of fiber, such as fiber, bran, and husks from seeds and grains, as well as crop residues (such as straw, copra, rice straw, husks, sugar beet waste).

[0266] Ruminants: The term "ruminant" refers to mammals that primarily digest plant-based food by fermenting / degrading it first in the first compartment of the stomach through bacterial action, then ruminating on the semi-digested clump (now called "ruminant food (cud)") and chewing it again. The process of further chewing ruminant food to break down plant matter and stimulate digestion is called rumination. Examples of ruminants include cattle, dairy cows, beef cattle, young calves, goats, sheep, lambs, deer, yaks, camels, and llamas.

[0267] Silage: The term "silage" refers to a fermented, high-moisture stored feed that can be fed to ruminants (cud-chewing animals, such as cattle and sheep) or used as a biofuel feedstock for anaerobic digesters. It is fermented and stored in a process called silage (ensilage, ensiling, or silaging) and is typically made from whole green plants (not just grains) of grasses or cereal crops (such as corn, sorghum, oats, rye, timothy, etc.) or legume crops (such as clover, trefoils, alfalfa, peas). Silage can be made from many field crops and, depending on the type, may use specific terms (oatlage for oats, haylage for alfalfa). Silage is made by placing cut green vegetation in silage pits, by piling it in large heaps covered with plastic sheets, or by wrapping large bales in plastic film.

[0268] Spore: The terms “spore” and “endospore” are used interchangeably and have their general meanings well known and understood by those skilled in the art. As used herein, the term spore refers to a microorganism in its dormant, protected state.

[0269] Stable: The term “stable” is a term known in the art, and in a preferred aspect, stable is intended to describe the ability of a microorganism to retain its spore form until it is given to an animal to improve the animal’s health.

[0270] Pig: The term "pig" or "pig" refers to a domesticated pig raised by humans for food, such as its meat. Pigs include members of the genus Sus, such as the domestic pig (Sus scrofa domesticus) or Sus domesticus, and include piglets, growing pigs, and sows.

[0271] Plant protein: The term “plant protein” means any compound, preparation or mixture that includes at least one protein derived from or derived from a plant, including modified proteins and protein derivatives.

[0272] The term "alkaline phosphatase" refers to an enzyme with EC number 3.1.3.1. cDNA: The term "cDNA" refers to a DNA molecule that can be prepared by reverse transcription from mature, spliced ​​mRNA molecules obtained from eukaryotic or prokaryotic cells. cDNA lacks intron sequences that can be present in the corresponding genomic DNA. The initial primary RNA transcript is the precursor of mRNA, which is processed through a series of steps (including splicing) to become mature, spliced ​​mRNA.

[0273] Coding sequence: The term "coding sequence" refers to a polynucleotide that directly specifies the amino acid sequence of a polypeptide. The boundaries of a coding sequence are typically defined by an open reading frame (OPG), which begins with a start codon (such as ATG, GTG, or TTG) and ends with a stop codon (such as TAA, TAG, or TGA). Coding sequences can be genomic DNA, cDNA, synthetic DNA, or a combination thereof.

[0274] Control Sequences: The term "control sequence" refers to a nucleic acid sequence involved in regulating the expression of polynucleotides in a particular organism, either in vivo or in vitro. Each control sequence can be native (i.e., from the same gene) or heterologous (i.e., from different genes) for the polynucleotide encoding a polypeptide, and is native or heterologous relative to each other. Such control sequences include, but are not limited to, leader sequences, polyadenylation sequences, propeptides, propeptides, signal peptides, promoters, terminators, enhancers, and transcription or translation initiator and terminator sequences. At a minimum, control sequences include promoters and transcription and translation termination signals. These control sequences may be provided with multiple linkers for the purpose of introducing specific restriction sites that facilitate the linking of control sequences to the coding regions of polynucleotides encoding polypeptides.

[0275] Expression: The term “expression” refers to any step involved in polypeptide production, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0276] Expression vector: An expression vector is a linear or circular DNA construct containing a DNA sequence encoding a polypeptide, with the coding sequence operatively linked to a suitable control sequence that can influence the expression of the DNA in a suitable host. Such control sequences may include promoters that influence transcription, optional operon sequences that control transcription, sequences encoding suitable ribosome binding sites on mRNA, enhancers, and sequences that control the termination of transcription and translation.

[0277] Extension: The term "extension" refers to the addition of one or more amino acids to the amino and / or carboxyl terminus of a polypeptide, wherein the "extended" polypeptide has alkaline phosphatase activity.

[0278] Fragment: The term "fragment" refers to a polypeptide that has one or more amino acids missing from the amino and / or carboxyl termini of a mature polypeptide, wherein the fragment has alkaline phosphatase activity.

[0279] Fusion polypeptide: The term "fusion polypeptide" is a polypeptide in which one of the polypeptides of the present invention is fused to the N-terminus and / or C-terminus. Fusion polypeptides are generated by fusing a polynucleotide encoding another polypeptide with a polynucleotide of the present invention, or by fusing two or more polynucleotides of the present invention together. Techniques for generating fusion polypeptides are known in the art and include linking the coding sequences of the polypeptides such that they conform to reading frames, and that the expression of the fusion polypeptide is under the control of the same promoter and terminator. Fusion polypeptides can also be constructed using intronomer technology, wherein the fusion polypeptide is generated post-translational (Cooper et al., 1993, ). EMBO J. [Journal of the European Society for Molecular Biology] 12: 2575-2583; Dawson et al., 1994, Science [Science] 266: 776-779). Fusion peptides may further include a cleavage site between the two peptides. This site is cleaved upon secretion of the fusion protein, thereby releasing both peptides. Examples of cleavage sites include, but are not limited to, those disclosed in the following literature: Martin et al., 2003. J. Ind. Microbiol. Biotechnol. [Journal of Industrial Microbiology and Biotechnology] 3: 568-576; Svetina et al., 2000, J. Biotechnol [Journal of Biotechnology] 76: 245-251; Rasmussen-Wilson et al., 1997, Appl. Environ. Microbiol. [Applied and Environmental Microbiology] 63: 3488-3493; Ward et al., 1995, Biotechnology [Biotechnology] 13: 498-503; and Contreras et al., 1991, Biotechnology [Biotechnology] 9: 378-381; Eaton et al., 1986, Biochemistry [Biochemistry] 25: 505-512; Collins-Racie et al., 1995, Biotechnology [Biotechnology] 13: 982-987; Carter et al., 1989, Proteins : Structure, Function, and Genetics [Proteins: Structure, Function, and Genetics] 6:240-248; and Stevens, 2003, Drug Discovery World [Drug Discovery World] 4: 35-48.

[0280] Heterogeneous: For host cells, the term "heterogeneous" means that the polypeptide or nucleic acid is not naturally present in the host cell. For polypeptides or nucleic acids, the term "heterogeneous" means that the control sequence (e.g., promoter) of the polypeptide or nucleic acid is not naturally associated with that polypeptide or nucleic acid; that is, the control sequence comes from a gene other than the gene encoding the mature polypeptide.

[0281] Host strain or host cell: A “host strain” or “host cell” refers to an organism in which an expression vector, bacteriophage, virus, or other DNA construct (including a polynucleotide encoding a target polypeptide, such as an amylase) has been introduced. An exemplary host strain is a microbial cell (e.g., bacteria, filamentous fungi, and yeast) capable of expressing a target polypeptide and / or fermenting sugars. The term “host cell” includes protoplasts produced by cells.

[0282] Introduction: In the context of inserting a nucleic acid sequence into a cell, the term “introduction” means “transfection,” “conversion,” or “transduction,” as is known in the art.

[0283] Isolated: The term "isolated" means a polypeptide, nucleic acid, cell, or other specific material or component that has been separated from at least one other material or component (including, but not limited to, other proteins, nucleic acids, cells, etc.). Therefore, the isolated polypeptide, nucleic acid, cell, or other material exists in a form not found in nature. Isolated polypeptides include, but are not limited to, culture media containing secreted polypeptides expressed in host cells.

[0284] Mature peptide: The term “mature peptide” refers to a peptide that has been processed at its N-terminus and / or C-terminus (e.g., removal of the signal peptide) to be in its mature form.

[0285] Natural: The term "natural" refers to nucleic acids or polypeptides that are naturally present in host cells.

[0286] Nucleic acid: The term "nucleic acid" encompasses DNA, RNA, heteroduplexes, and synthetic molecules capable of encoding polypeptides. Nucleic acids can be single-stranded or double-stranded and can be chemically modified. The terms "nucleic acid" and "polynucleotide" are used interchangeably. Because the genetic code is degenerate, more than one codon can be used to encode a specific amino acid, and the compositions and methods of the present invention cover nucleotide sequences encoding specific amino acid sequences. Unless otherwise stated, nucleic acid sequences are presented in a 5' to 3' orientation.

[0287] Nucleic acid constructs: The term “nucleic acid construct” refers to a single-stranded or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene or modified in a way that does not originally exist in nature to contain a segment of nucleic acid or is synthesized and contains one or more control sequences that are operatively linked to the nucleic acid sequence.

[0288] Operationally linked: The term "operationally linked" means that specified components are in a relationship that allows them to function in the intended manner (including, but not limited to, juxtaposition). For example, a regulatory sequence is operationally linked to a coding sequence such that the expression of the coding sequence is under the control of the regulatory sequence.

[0289] Purified: The term "purified" means nucleic acids, peptides, or cells that are substantially free of other components, as determined by analytical techniques well known in the art (e.g., in electrophoretic gels, chromatographic eluates, and / or media subjected to density gradient centrifugation, where purified peptides or nucleic acids form discrete bands). Purified nucleic acids or peptides are at least about 50% pure, and typically at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5%, about 99.6%, about 99.7%, about 99.8%, or more pure (e.g., weight percentage or molar percentage). In a relevant sense, a composition is enriched with the molecule when the concentration of the molecule increases significantly after the application of purification or enrichment techniques. The term “enrichment” refers to the presence of compounds, peptides, cells, nucleic acids, amino acids, or other specified materials or components in a composition at a relative or absolute concentration higher than that of the starting composition.

[0290] In one respect, the term "purified," as used herein, means that the polypeptide or cell is substantially free of components (especially insoluble components) from the producing organism. In another respect, the term "purified" means that the polypeptide is substantially free of insoluble components (especially insoluble components) from the natural organism from which it was obtained. In one respect, the polypeptide is separated from some soluble components of the organism from which it was recovered and the culture medium. The polypeptide can be purified (i.e., separated) by one or more of the following methods: unit operation filtration, precipitation, or chromatography.

[0291] Accordingly, peptides can be purified so that only small amounts of other proteins, particularly other peptides, are present. The term "purified" as used herein can refer to the removal of other components, particularly other proteins and most particularly other enzymes, present in the cells from which the peptide originates. A peptide can be "substantially pure," meaning it is free from other components from the organism that produced it (e.g., the host organism used to recombinantly produce the peptide). In one aspect, the peptide is at least 40% pure by weight of the total peptide material present in the formulation. In another aspect, the peptide is at least 50%, 60%, 70%, 80%, or 90% pure by weight of the total peptide material present in the formulation. As used herein, "substantially pure peptide" can mean a peptide formulation containing, by weight, at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% of the peptide and other peptide material associated with it, either naturally or recombinantly.

[0292] Therefore, it is preferred that the substantially pure polypeptide, based on the weight of the total polypeptide material present in the formulation, is at least 92% pure, preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, even more preferably at least 99% pure, and most preferably at least 99.5% pure. The polypeptides of the present invention are preferably in a substantially pure form (i.e., the formulation is substantially free of other polypeptide materials associated with it, either naturally or recombinantly). This can be achieved, for example, by preparing the polypeptide using well-known recombinant methods or classical purification methods.

[0293] Recombination: The term "recombination," used in its conventional sense, refers to the manipulation (e.g., cutting and rejoining) of nucleic acid sequences to form a sequence group different from that found in nature. The term recombination refers to cells, nucleic acids, polypeptides, or vectors that have been modified from their natural state. Thus, for example, recombinant cells express genes not found in their natural (non-recombinant) forms, or express natural genes at different levels or under different conditions compared to those found in nature. The term "recombination" is synonymous with "genetically modified" and "transgenic."

[0294] Recovery: The term "recovery" refers to the removal of peptides from at least one fermentation broth component selected from a list of cells, nucleic acids, or other specified materials, for example, by methods such as: harvesting peptides by peptide crystallization, by filtration (e.g., deep filtration (using filter aids or packed filter media, cloth filtration in a box filter, rotary drum filtration, drum filtration, rotary vacuum drum filtration, candle filter, horizontal leaf filter, or the like, using sheet or pad filtration in a frame or modular device) or membrane filtration (using plate filtration, modular filtration, candle filtration, microfiltration, crossflow, dynamic crossflow, or ultrafiltration in dead-end operation)), or by centrifugation (using a sedimentation centrifuge, disc stack centrifuge, hyrdo cyclone, or the like), or by precipitation of peptides and using relevant solid-liquid separation methods to harvest peptides from broth media by particle size fractionation. Recovery encompasses the isolation and / or purification of peptides.

[0295] Sequence identity: The degree of association between two amino acid sequences or two nucleotide sequences is described by the parameter "sequence identity".

[0296] For the purposes of this invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970) is used. J. Mol. Biol. [Journal of Molecular Biology] 48: 443-453) determines the sequence identity between two amino acid sequences as the output of "longest identity," an algorithm such as the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000). Trends Genet. The method is implemented in the Niedel procedure of [Trends in Genetics] 16: 276-277 (preferably version 6.6.0 or later). The parameters used are a vacancy opening penalty of 10, a vacancy extension penalty of 0.5, and an EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. For the Niedel procedure to report the longest identity, the non-brief (-nobrief) option must be specified on the command line. The Niedel-marked "Longest Identity" output is calculated as follows: (Identical residues × 100) / (Alignment length - Total number of vacancies in the alignment) For the purposes of this invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, ibid.) is used to determine the sequence identity between two polynucleotide sequences as the output of "longest identity," as implemented in the Niedel program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, ibid.) (preferably version 6.6.0 or later). The parameters used are a vacancy opening penalty of 10, a vacancy extension penalty of 0.5, and an EDNAFULL substitution matrix (EMBOSS version of NCBI NUC4.4). For the Niedel program to report the longest identity, the non-simplified option must be specified in the command line. The Niedel-marked "longest identity" output is calculated as follows: (Identical deoxyribonucleotides × 100) / (Alignment length - Total number of vacancies in the alignment) Signal peptide: A signal peptide is an amino acid sequence that attaches to the N-terminal portion of a protein and promotes its secretion outside the cell. The mature form of extracellular proteins lacks a signal peptide, which is cleaved during the secretion process.

[0297] Subsequence: The term "subsequence" refers to a polynucleotide in which one or more nucleotides are deleted from the 5' and / or 3' end of the coding sequence of a mature polypeptide; wherein the subsequence encodes a fragment having alkaline phosphatase activity.

[0298] Variant: The term "variant" refers to a polypeptide that has alkaline phosphatase activity and contains artificial mutations (i.e., substitutions, insertions (including extensions), and / or deletions (e.g., truncations)) at one or more positions. Substitution means replacing an amino acid occupying a position with a different amino acid; deletion means removing an amino acid occupying a position; and insertion means adding 1-5 amino acids (e.g., 1-3 amino acids, especially 1 amino acid) adjacent to and immediately following the amino acid occupying a position.

[0299] Wild-type: When referring to an amino acid or nucleic acid sequence, the term "wild-type" means that the amino acid or nucleic acid sequence is natural or naturally occurring. As used herein, the term "naturally occurring" refers to any substance found in nature (e.g., protein, amino acid, or nucleic acid sequences). Conversely, the term "non-naturally occurring" refers to any substance not found in nature (e.g., recombinant nucleic acid and protein sequences produced in a laboratory, or modifications of wild-type sequences).

[0300] Peptides with alkaline phosphatase activity This invention relates to polypeptides with alkaline phosphatase activity.

[0301] As can be seen from Table 1, in the preferred embodiments, the polypeptide of the present invention has alkaline phosphatase activity (measured as relative activity) that is greater than or equal to the activity of the positive control (i.e., the alkaline phosphatase of US 20180326020, which corresponds to SEQ ID NO:50). Therefore, in one embodiment of the present invention, the alkaline phosphatase activity of the polypeptide of the present invention is greater than or equal to the activity of SEQ ID NO:50.

[0302] Table 1 In a preferred embodiment, the polypeptide having alkaline phosphatase activity is of bacterial or fungal origin, or a variant of a bacterial or fungal polypeptide, wherein the activity is greater than or equal to the activity of SEQ ID NO:50, more preferably a bacterial polypeptide or a variant of a bacterial polypeptide, having alkaline phosphatase activity, wherein the activity is greater than or equal to the activity of SEQ ID NO:50. Therefore, preferred embodiments of the present invention relate to polypeptides having alkaline phosphatase activity, these polypeptides being selected from the group consisting of: (a) A polypeptide having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of SEQ ID NO: 11; (b) A polypeptide having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of SEQ ID NO: 13; (c) A polypeptide having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of SEQ ID NO: 19; (d) The polypeptide having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of SEQ ID NO: 20; (e) having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as in SEQ ID NO: 29; (f) The polypeptide having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of SEQ ID NO: 36; (g) having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as expressed in SEQ ID NO: 61; (h) having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as in SEQ ID NO: 63; (i) A polypeptide having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of SEQ ID NO: 65; (j) having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as in SEQ ID NO: 82; (k) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide with SEQ ID NO: 85; (l) having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as expressed in SEQ ID NO: 86; (m) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as expressed in SEQ ID NO: 99; (n) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as in SEQ ID NO: 79; (o) having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide with SEQ ID NO: 80; (p) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as specified in SEQ ID NO: 116; (q) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as specified in SEQ ID NO: 14; (r) having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as specified in SEQ ID NO: 16; (s) having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as specified in SEQ ID NO: 21; (t) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as specified in SEQ ID NO: 37; (u) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as specified in SEQ ID NO: 39; (v) having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide with SEQ ID NO: 82; (w) having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide with SEQ ID NO: 83; (x) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as specified in SEQ ID NO:84; (y) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as specified in SEQ ID NO: 85; (z) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as expressed in SEQ ID NO: 86; (dd) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide with SEQ ID NO: 96; (ee) and SEQ ID NO: 96 have at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide; (ff) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as specified in SEQ ID NO: 97; (gg) and SEQ ID NO: 98 have at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide; (hh) and SEQ ID NO: 99 have at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide; (ii) A polypeptide having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of SEQ ID NO: 100; (jj) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as specified in SEQ ID NO:101; (kk) and SEQ ID NO: 102 have at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide; (ll) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide with SEQ ID NO: 103; (mm) and SEQ ID NO: 104 having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide; and (nn) and SEQ ID NO: 105 have at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide; and (oo) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as specified in SEQ ID NO: 106.

[0303] In a preferred aspect, the polypeptide has alkaline phosphatase activity, wherein the polypeptide is of fungal or bacterial origin, and wherein the polypeptide has alkaline phosphatase activity greater than or equal to that of calf intestinal alkaline phosphatase (CIAP). Therefore, in this aspect of the invention, these polypeptides have alkaline phosphatase activity, wherein the polypeptide is of fungal or bacterial origin, and wherein the polypeptide is selected from the group consisting of: (a) A polypeptide having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of SEQ ID NO: 14; (b) A polypeptide having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of SEQ ID NO: 16; (c) A polypeptide having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of SEQ ID NO: 21; (d) A polypeptide having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of SEQ ID NO: 37; (e) having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as in SEQ ID NO: 39; (f) The polypeptide having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of SEQ ID NO: 82; (g) having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as defined in SEQ ID NO: 83; (h) having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as in SEQ ID NO: 84; (i) A polypeptide having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of SEQ ID NO: 85; (j) having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as in SEQ ID NO: 86; (dd) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide with SEQ ID NO: 95; (ee) and SEQ ID NO: 96 have at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide; (ff) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as specified in SEQ ID NO: 97; (gg) and SEQ ID NO: 98 have at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide; (hh) and SEQ ID NO: 99 have at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide; (ii) A polypeptide having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of SEQ ID NO: 100; (jj) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide with SEQ ID NO: 101; (kk) and SEQ ID NO: 102 have at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide; (ll) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide with SEQ ID NO: 103; (mm) and SEQ ID NO: 104 having at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide; and (nn) has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the polypeptide as specified in SEQ ID NO: 106.

[0304] The polypeptide preferably comprises, consists essentially of, or consists of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ IDNO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84 and SEQ ID NO:85, preferably SEQ ID NO:61, SEQ ID NO: 62. SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID The amino acid sequences are SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, and SEQ ID NO:106. The polypeptide may have an N-terminal and / or C-terminal extension of one or more amino acids (e.g., 1-5 amino acids).

[0305] Gastric stability As described, one aspect of the invention relates to polypeptides having alkaline phosphatase activity. In one aspect of the invention, these polypeptides have alkaline phosphatase activity and are gastric stable, that is, stable at low pH or stable at low pH in the presence of pepsin (hereinafter referred to as pepsin-stable). In a preferred embodiment, the polypeptides having alkaline phosphatase activity are stable at pH below 5 and are pepsin-stable.

[0306] As can be seen from Table 2, neither CIAP nor SEQ ID NO: 50 is pepsin-stable. Pepsin stability is defined as the peptide retaining at least 1% of its activity after gastric conditioned conditions, such as at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, or at least 35% of its activity after gastric stimulation, under alkaline or acidic pH conditions.

[0307] Therefore, in one aspect of the invention, the polypeptide has alkaline phosphatase activity, is of bacterial or fungal origin, or is a variant of a bacterial or fungal-derived polypeptide, wherein the activity is greater than that of SEQ ID NO:50, and wherein the polypeptide is gastric stable or pepsin stable.

[0308] The activity assay used to determine the residual activity of alkaline phosphatase after gastric challenge included incubating the polypeptide of the present invention in simulated gastric juice (AGJ) at 38°C for 15 min to simulate gastric challenge, and is described in detail in Example 8. The residual activity (%) of ALP after gastric challenge was determined using Equation 4. Equation 4 in ALP was obtained after incubating in AGJ for 15 minutes. EC 50 ,and The alkaline phosphatase was obtained after incubation in the assay solution for 15 minutes. EC 50 .

[0309] Table 2 In a preferred embodiment, the polypeptide has alkaline phosphatase activity, is of bacterial or fungal origin, or is a variant of a bacterial or fungal polypeptide, and wherein the polypeptide is pepsin-stable, retaining at least 20%, more preferably at least 25%, such as at least 30%, at least 40%, or at least 50% of its alkaline phosphatase activity after gastric stimulation. In a preferred embodiment, the polypeptide has alkaline phosphatase activity, is of bacterial or fungal origin, or is a variant of a bacterial or fungal polypeptide, wherein the polypeptide has at least 70% sequence identity with a polypeptide selected from the group consisting of, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity: SEQ ID NO:18, SEQ ID NO:30, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:80, SEQ ID NO:84, SEQ ID NO:86, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, and SEQ ID NO:106. In a more preferred embodiment, the polypeptide has alkaline phosphatase activity, is of bacterial or fungal origin, or is a variant of a bacterial or fungal polypeptide, wherein the polypeptide has at least 70% sequence identity with a polypeptide selected from the group consisting of, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity: SEQ ID NO:18, SEQ ID NO:30, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, and SEQ ID NO:106.

[0310] As can be seen from Table 2, the variant of SEQ ID NO:11 exhibits high pepsin or gastric stability. That is, the variant of SEQ ID NO:11 is stable at low pH and is stable at low pH in the presence of pepsin. Therefore, in one embodiment of the invention, the polypeptide having alkaline phosphatase activity is a variant of SEQ ID NO:11 that has at least 70% but less than 100% sequence identity with SEQ ID NO:11. In one embodiment of the invention, the polypeptide has alkaline phosphatase activity and gastric stability and is selected from the group consisting of: a) A polypeptide having at least 70% but less than 100% sequence identity with SEQ ID NO:11; b) A polypeptide having at least 70% sequence identity with SEQ ID NO:61, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; c) A polypeptide having at least 70% sequence identity with SEQ ID NO:62, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; d) A polypeptide having at least 70% sequence identity with SEQ ID NO:63, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; e) A polypeptide having at least 70% sequence identity with SEQ ID NO:64, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; f) A polypeptide having at least 70% sequence identity with SEQ ID NO:65, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; g) A polypeptide having at least 70% sequence identity with SEQ ID NO:79, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; h) A polypeptide having at least 70% sequence identity with SEQ ID NO:80, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; i) A polypeptide having at least 70% sequence identity with SEQ ID NO:81, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; j) A polypeptide having at least 70% sequence identity with SEQ ID NO:82, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; k) A polypeptide having at least 70% sequence identity with SEQ ID NO:83, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; l) A polypeptide having at least 70% sequence identity with SEQ ID NO:84, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; m) A polypeptide having at least 70% sequence identity with SEQ ID NO:85, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; n) A polypeptide having at least 70% sequence identity with SEQ ID NO:86, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; o) A polypeptide having at least 70% sequence identity with SEQ ID NO:95, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; p) A polypeptide having at least 70% sequence identity with SEQ ID NO:96, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; q) A polypeptide having at least 70% sequence identity with SEQ ID NO:97, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; r) A polypeptide having at least 70% sequence identity with SEQ ID NO:98, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; s) A polypeptide having at least 70% sequence identity with SEQ ID NO:99, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; t) a polypeptide having at least 70% sequence identity with SEQ ID NO:100, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; u) A polypeptide having at least 70% sequence identity with SEQ ID NO:101, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; v) A polypeptide having at least 70% sequence identity with SEQ ID NO:102, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; x) A polypeptide having at least 70% sequence identity with SEQ ID NO:103, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; y) A polypeptide having at least 70% sequence identity with SEQ ID NO:104, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; z) A polypeptide having at least 70% sequence identity with SEQ ID NO:105, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; and aa) A polypeptide having at least 70% sequence identity with SEQ ID NO:106, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity.

[0311] In one embodiment of the invention, the polypeptide has alkaline phosphatase activity and is selected from the group consisting of: a) A polypeptide having at least 70% sequence identity with SEQ ID NO:61, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; b) A polypeptide having at least 70% sequence identity with SEQ ID NO:62, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; c) A polypeptide having at least 70% sequence identity with SEQ ID NO:63, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; d) A polypeptide having at least 70% sequence identity with SEQ ID NO:64, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; e) A polypeptide having at least 70% sequence identity with SEQ ID NO:65, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; f) A polypeptide having at least 70% sequence identity with SEQ ID NO:79, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; g) A polypeptide having at least 70% sequence identity with SEQ ID NO:80, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; h) A polypeptide having at least 70% sequence identity with SEQ ID NO:81, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; i) A polypeptide having at least 70% sequence identity with SEQ ID NO:82, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; j) A polypeptide having at least 70% sequence identity with SEQ ID NO:83, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; k) A polypeptide having at least 70% sequence identity with SEQ ID NO 84, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; l) A polypeptide having at least 70% sequence identity with SEQ ID NO:85, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; m) A polypeptide having at least 70% sequence identity with SEQ ID NO:86, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; n) A polypeptide having at least 70% sequence identity with SEQ ID NO:95, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; o) A polypeptide having at least 70% sequence identity with SEQ ID NO:96, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; p) A polypeptide having at least 70% sequence identity with SEQ ID NO:97, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; q) A polypeptide having at least 70% sequence identity with SEQ ID NO:98, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; r) A polypeptide having at least 70% sequence identity with SEQ ID NO:99, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; s) A polypeptide having at least 70% sequence identity with SEQ ID NO:100, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; t) a polypeptide having at least 70% sequence identity with SEQ ID NO:101, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; u) A polypeptide having at least 70% sequence identity with SEQ ID NO:102, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; v) A polypeptide having at least 70% sequence identity with SEQ ID NO103, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; x) A polypeptide having at least 70% sequence identity with SEQ ID NO:104, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; y) A polypeptide having at least 70% sequence identity with SEQ ID NO:105, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; and z) A polypeptide having at least 70% sequence identity with SEQ ID NO:106, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity.

[0312] In the most preferred embodiment, the polypeptide has at least 70% sequence identity with SEQ ID NO:104, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity.

[0313] For its use in animal hosts or bodies, gastric stability is important, and alkaline phosphatase activity at physiological pH is most relevant to the enzyme in animal feed. Therefore, for use in animal feed, it is important that the peptide with alkaline phosphatase activity exhibits activity at physiological pH (i.e., approximately pH 7 or 8). In applications outside animal feed, activity at pH 7 to 11 is relevant, as with compositions containing alkaline components. In one embodiment of the invention, according to the method described in Example 8, the peptide with alkaline phosphatase activity exhibits an activity at least equal to CIAP at pH 7, 8, 9, 10, or 11, preferably at pH 7, 8, or 9. The value given for each pH in the range of 7.0–11.0 is the absorbance at 405 nm (A405) divided by the phosphatase concentration in ppm (determined by the A280 of the purified sample and the calculated extinction coefficient of the phosphatase).

[0314] Table 3 - Absorbance at 405 nm (A405) divided by phosphatase concentration in ppm (determined by A280 of purified sample and calculated extinction coefficient of phosphatase). As can be seen from Table 3, the polypeptides of the present invention exhibit significant alkaline phosphatase activity at physiological pH.

[0315] As can be seen from Examples 8 and Table 10, wild-type SEQ ID NO:50 and SEQ ID NO:11 showed no activity after treatment with high gastric stress. However, the prior art variant SEQ ID NO:107 (with a C-terminal histidine or when concentrated and HEAL1115_Ct_His) retained some of its activity after treatment with gastric stress. SEQ ID NO:103 showed comparable activity after treatment with gastric stress, but SEQ ID NO:104 showed higher activity (73 OD / min / ppm) and a higher percentage of residual activity (12%) compared to SEQ ID NO:107 (21 OD / min / ppm and 6%, respectively). As can be seen from Table 10, variants of SEQ ID NO:11 and SEQ ID NO:11 have higher activity compared to SEQ ID NO:50 and SEQ ID NO:107. Furthermore, this higher residual activity (in percentage) is higher than that of SEQ ID NO:50 and SEQ ID NO:10. This means that even at comparable residual activity levels, the variants of SEQ ID NO: 11 and SEQ ID NO: 11 exhibit significantly higher activity after gastric stimulation. In one embodiment of the invention, the peptide has an activity of at least 250 OD / min / ppm and a residual activity percentage of at least 5% (e.g., at least 7%, or at least 10%) after gastric stress treatment.

[0316] thermal stability In a preferred aspect of the invention, the polypeptide having alkaline phosphatase activity is thermally stable.

[0317] SEQ ID NO:50 has a Tm of approximately 48°C at pH 7, as determined by the method according to Example 10. Preferably, the polypeptide having alkaline phosphatase activity has a Tm of at least 50°C at pH 7 or at a pH less than 7. More preferably, the polypeptide having alkaline phosphatase activity has a Tm of at least 50°C at pH 7, and further has a Tm of at least 50°C at pH 4. In the most preferred embodiment, the polypeptide having alkaline phosphatase activity has a Tm of at least 60°C at pH 7, and further has a Tm of at least 60°C at pH 4. In another embodiment, the polypeptide having alkaline phosphatase activity has a Tm of at least 70°C at pH 7. The table below demonstrates that, using the nDSF method of Example 10, the polypeptide of the present invention has a Tm of at least 70°C at pH 7.

[0318] Table 4 Table 5 As can be seen from Example 11, the polypeptide of the present invention has thermal stability similar to or superior to that of the thermally stable alkaline phosphatase reported in SEQ ID NO:1 of WO 2023 / 102002, as measured by thermal conversion assay.

[0319] Sources of peptides with alkaline phosphatase activity The polypeptides of the present invention having alkaline phosphatase activity can be obtained from any genus of microorganisms. For the purposes of this invention, the term "obtained from" as used herein in conjunction with a given source should mean that the polypeptide encoded by the polynucleotide is produced by that source or by a strain that has inserted the polynucleotide of the present invention. In one aspect, the polypeptide obtained from a given source is secreted extracellularly. In one aspect, polypeptides obtained from genera selected from the group consisting of Bacillus, Neobacillus, Collimonas, Aeromonas, Serratia, Stylobacter, Loktanella, Sphingopyxis, Hyphomonas, and Deinococcus, typically selected from the group consisting of Bacillus paragenomicum (… Parageobacillus ), Bacillus spp. Geobacillus ), Bacillus spp., Anaerobic Bacillus spp. Anoxybacillus ), Bacillus spp., *Serratia spp.*, *Neoplasmosis spp.*, *Aeromonas spp.*, *Serratia spp.*, *Bacillus fibrosporum* spp. Cytobacillus ), Priestella spp. Priestia ), *Bacillus* spp., *Rhodotorula* spp., *Sphingosine Box* spp., *Bacillus* spp. ( Fontibacillus ), Bacillus, Lederbergia ( Lederbergia The polypeptide comprises *Pseudomonas*, *Gnaphalium*, and *Coccidia*, more preferably *Bacillus*, *Bacillus*, *Pseudomonas*, *Gnaphalium*, *Lactobacillus*, *Anaerobic Bacillus*, and *Bacillus-like* species. In a preferred embodiment, the polypeptide yields microorganisms selected from the group consisting of *Pseudomonas xylose-pyrolyticus*, *Gnaphalium thermophilum*, and *Lactobacillus* species. -63357 Species of the genera *Bacillus*, *Bacillus thermophilus*, *Bacillus xylose*, and *Lactobacillus*. -63357*Bacillus ginseng*, *Bacillus meadowii*, *Bacillus ileus*, *Bacillus batavia*, *Aeromonas salmonidae*, *Bacillus amyloliquefaciens*, *Serratia plymouthii*, *Bacillus fibrousa*, *Priestella megaterium*, *Serratia figo*, and *Stenobacterium* species. -63731 *Serratia curvaturei*, *Serratia nematodes*, *Rhodotorula salina*, *Sphingosine sphingolipidae*, *Bacillus aquaticus*, and *Bacillus* species. -19179 Bacillus species -62606 Bacillus wusongii, Bacillus tarda (difficult to find in Ledbergia), and species of the genus Bacillus. - 62603 Bacillus spp. (chestnut) Paenibacillus castaneae ), Bacillus pyrenoidosa, Herxomonas huxleyi, Herxomonas marinei, Radiation-resistant Cocci, Gobi Cocci, Trichophyton spp., and species of the genus Cocci. 17890 .

[0320] It should be understood that, for the aforementioned species, this invention covers complete and incomplete stages, as well as other taxonomic equivalents, such as asexual forms, regardless of their known species names. Those skilled in the art will readily identify the appropriate equivalents.

[0321] The probes mentioned above can be used to identify and obtain polypeptides from other sources, including microorganisms isolated from nature (e.g., soil, compost, water, etc.) or DNA samples obtained directly from natural materials (e.g., soil, compost, water, etc.). Techniques for directly isolating microorganisms and DNA from natural habitats are well known in the art. The polynucleotide encoding the polypeptide can then be obtained by similarly screening a library of genomic DNA or cDNA from another microorganism or a mixed DNA sample. Once the polynucleotide encoding the polypeptide has been detected with the probe, it can be isolated or cloned using techniques known to those skilled in the art (see, for example, Davis et al., 2012, Basic Methods in Molecular Biology, Elsevier).

[0322] Generation method The present invention also relates to methods for producing the polypeptides of the invention, the methods comprising (a) culturing cells under conditions conducive to the production of the polypeptide, the cells producing the polypeptide in their wild-type form; and optionally (b) recovering the polypeptide. In one aspect, the cells are Bacillus cells. In another aspect, the cells are Bacillus subtilus or Bacillus clausii cells.

[0323] In one embodiment of the invention, the generation method is performed according to Example 1, 2, or 3. In one embodiment of the invention, the synthetic fragment is directionally assembled into a Bacillus expression vector using standard Kinmen cloning methods, as described in WO 12 / 025577. In one embodiment, the mature peptide encoding the gene is cloned in-frame into a Bacillus clausii secretion signal (BcSP; having the following amino acid sequence: MKKPLGKIVASTALLISVAFSSSIASA). In one embodiment, the final expression plasmid (BcSP-His-tag-alkaline phosphatase) is transformed into a Bacillus subtilis expression host.

[0324] The present invention also relates to methods for generating the polypeptides of the invention, the methods comprising (a) culturing the recombinant host cells of the invention under conditions conducive to the generation of the polypeptide; and optionally (b) recovering the polypeptide.

[0325] The host cells are cultured in a nutrient medium suitable for producing peptides using methods known in the art. For example, cells can be cultured in a suitable medium and under conditions that allow for peptide expression and / or isolation by shake-flask culture or by small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid-state and / or microcarrier-based fermentation) in a laboratory or industrial fermenter. Suitable media are available from commercial suppliers or can be prepared according to publicly available compositions (e.g., in the catalogue of the U.S. Center for Type Culture Collection). If the peptide is secreted into the nutrient medium, it can be recovered directly from that medium. If the peptide is not secreted, it can be recovered from cell lysates.

[0326] Peptides can be detected using methods known in the art that are specific to peptides, including but not limited to the use of specific antibodies, enzyme product formation, enzyme substrate disappearance, or assays to determine the relative or specific activity of the peptide. Peptides can be recovered from culture media using methods known in the art, including but not limited to collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation. On one hand, whole fermentation broth containing peptides is recovered. On the other hand, cell-free fermentation broth containing peptides is recovered. Peptides can be purified using a variety of procedures known in the art to obtain substantially pure peptides and / or peptide fragments (see, for example, Wingfield, 2015). Current Protocols in Protein Science [The latest approach in protein science]; 80(1): 6.1.1-6.1.35; Labrou, 2014, Protein Downstream Processing [Downstream protein processing], 1129: 3-10). In alternatives, peptides are not recycled.

[0327] ALP targets for improving gut health: lipopolysaccharide (LPS), ATP, and cellular activity The intestinal activity of alkaline phosphatase (ALP) is associated with intestinal inflammation. ALP plays a role in limiting intestinal inflammation through the detoxification of MAMP (lipopolysaccharide (LPS) and flagellin). IAP exerts its effect through the dephosphorylation of pro-inflammatory molecules, including LPS, flagellin, and adenosine triphosphate (ATP), which are released from cells during stress events. ALP dephosphorylates bacterial LPS, leading to LPS detoxification, thereby preventing downstream activation of immune cells and subsequent inflammatory responses.

[0328] Intestinal alkaline phosphatase (IAP) is one of the most abundant human proteins in feces, and its activity is hypothesized to be negatively correlated with type 2 diabetes and intestinal inflammation. IAP has been shown to have many roles in limiting intestinal inflammation: 1) detoxification of MAMP (LPS, flagellin), 2) dephosphorylation of extracellular ATP, 3) induction of autophagy, and 4) inhibition of bacterial growth.

[0329] Unbound by any particular theory, gut health depends on the microbiome and its coexistence with the host. Introducing pathogenic bacteria into the microbiome can lead to dysbiosis, potentially causing barrier leakage and immune cell activation. Free LPS from gut bacteria can impose health risks on the host by activating immune cells. Especially under conditions of already compromised health, LPS can more freely enter tissues and cause damage. ATP is produced by some bacteria and has a growth-inhibiting effect on some others. Literature suggests that ATP secretion may be more typical for Gram-negative species, while growth inhibition is characteristic of Gram-positive bacteria. ATP is produced by immune cells during their activation and by dead cells, and acts as an alarm molecule to warn the surrounding environment of potential infection, for example. This leads to the activation of other immune cells, exacerbating ongoing inflammation. In particular, ATP activates inflammasomes, leading to the release of the pro-inflammatory cytokine IL-1β. During a chronic state of mild intestinal inflammation (which may be the case in livestock), elevated levels of both free LPS and gut ATP will exacerbate the inflammatory process and increase disease risk.

[0330] One aspect of this invention relates to the detoxification of LPS and / or ATP via ALP-mediated dephosphorylation. This leads to a reduction in ongoing intestinal inflammation by limiting health risk factors. Potential health benefits include a reduction in infectious diseases, resulting in higher survival rates.

[0331] Based on cellular data using the peptides of the present invention, one aspect of the present invention relates to a method for detoxifying lipopolysaccharides in animals, the method comprising feeding the animals the peptides, compositions, animal feed additives, or animal technology additives of the present invention.

[0332] Based on cellular data using the peptides of the present invention, one aspect of the present invention relates to a method for reducing an immune response in an animal, the method comprising feeding the animal the peptides, compositions, animal feed additives, or animal technology additives of the present invention.

[0333] Based on cellular data using the peptides of the present invention, one aspect of the present invention relates to a method for reducing inflammation in animals, the method comprising feeding the animals the peptides, compositions, animal feed additives, or animal technology additives of the present invention.

[0334] Based on cellular data using the peptides of the present invention, one aspect of the present invention relates to a method for mitigating IL or TNF responses in animals, the method comprising feeding the animals the peptides, compositions, animal feed additives, or animal technology additives of the present invention.

[0335] Based on cellular data using the peptides of the present invention, one aspect of the present invention relates to a method for maintaining or supporting gut health in animals, or improving gut health to promote the growth of symbiotic bacteria, the method comprising feeding the animals the peptides, compositions, animal feed additives, or animal technology additives of the present invention.

[0336] Based on cellular data using the peptides of the present invention, one aspect of the present invention relates to a method for maintaining an effective intestinal barrier, the method comprising feeding the animal the peptides, compositions, animal feed additives, or animal technology additives of the present invention.

[0337] Based on cellular data using the peptides of the present invention, one aspect of the present invention relates to a method for preventing colitis or inflammation of the colonic wall in animals, the method comprising feeding the animals the peptides, compositions, animal feed additives, or animal technology additives of the present invention.

[0338] Based on cellular data using the peptides of the present invention, one aspect of the present invention relates to a method for preventing or reducing intestinal colonization or systemic translocation of harmful bacteria, or for "dysbiosis," i.e., for altering the bacterial and / or archaea balance of the intestinal microecology, the method comprising feeding the animal the peptides, compositions, animal feed additives, or animal technology additives of the present invention.

[0339] Therefore, one aspect of the present invention relates to the use of the alkaline phosphatase of the present invention, which typically maintains intestinal health through ATP dephosphorylation, including but not limited to maintaining intestinal barrier function, reducing intestinal leakage, and reducing or preventing intestinal inflammation.

[0340] Lipopolysaccharide as the target of the alkaline phosphatase of the present invention The intestinal activity of alkaline phosphatase is associated with intestinal inflammation. ALP plays a role in limiting intestinal inflammation through the detoxification of MAMP (lipopolysaccharide (LPS), flagellin). IAP exerts its effect through the dephosphorylation of pro-inflammatory molecules, including LPS, flagellin, and adenosine triphosphate (ATP) released from cells during stress events.

[0341] Increased LPS stimulation of intestinal tissue increases inflammation and impairs overall health. Lipopolysaccharide (LPS) contains a lipid A structure with two attached PO4 groups. These are essential for binding to TLR4 and MD2 during cell stimulation. In this invention, LPS dephosphorylation was measured using a malachite green phosphate assay kit to detect free PO4. E. coli LPS was treated with ALP titration, followed by detection of released PO4. The results showed LPS-dephosphorylation of the peptides of this invention containing alkaline phosphatase.

[0342] One aspect of the invention relates to the dephosphorylation of bacterial LPS by the ALP of the invention, which leads to LPS detoxification, thereby preventing downstream activation of immune cells and subsequent inflammatory responses. Therefore, the invention relates to a method of dephosphorylating bacterial LPS using the ALP of the invention. The invention also relates to a method of detoxifying LPS by dephosphorylation using the ALP of the invention. Another aspect of the invention relates to reducing the activation of immune cells, including the uptake of the ALP of the invention. Yet another aspect of the invention relates to reducing or preventing inflammatory responses in animals, or reducing or preventing inflammation, including the uptake of the ALP of the invention.

[0343] One aspect of this invention relates to detoxifying LPS via ALP-mediated dephosphorylation. This leads to a reduction in ongoing intestinal inflammation by limiting health risk factors. Potential health benefits include a reduction in infectious diseases, resulting in higher survival rates.

[0344] Adenosine triphosphate (ATP) as a target of alkaline phosphatase Cellular activity as a target of the alkaline phosphatase of the present invention ATP can inhibit the growth of Gram-positive bacteria. The ALP of this invention can eliminate this effect. Inhibition of intestinal Gram-positive bacteria favors the growth of pathogenic Gram-negative bacteria. Therefore, the ALP of this invention eliminates the inhibitory effect of ATP on Gram-positive bacteria.

[0345] ALP dephosphorylates ATP, thereby promoting the growth of symbiotic bacteria. Another aspect of the invention relates to maintaining or promoting the growth of symbiotic bacteria in animals.

[0346] Another aspect of the invention relates to the use of the ALP of the invention for promoting the growth of favorable Gram-positive bacteria and / or inhibiting the growth of pathogenic Gram-negative bacteria. Example 12 shows the growth of Gram-negative and Gram-positive bacteria in the presence of ATP, ADP, AMP, or adenosine.

[0347] ALP inhibits ATP-induced LPS activity in response to IL-1β secretion. ATP also plays a role in the activity of LPS in the formation of Pro-IL-1β. Increased LPS stimulation of intestinal tissue increases inflammation and impairs overall health. In one aspect of the invention, the ALP of the invention reduces ATP-induced LPS activity for IL-1β secretion.

[0348] ALP inhibits ATP-induced IL-1β secretion; ALP inhibits inflammation. ATP is also involved in the activation of inflammasomes, leading to the secretion of IL-1β. This is a rapid warning sign of increased inflammation, which is useful during infection but can be harmful in chronic conditions. In Example 14, it was demonstrated that treatment with the ALP of the present invention inhibited ATP-induced inflammasome activation.

[0349] ALP dephosphorylates ATP, promoting the growth of symbiotic bacteria. Therefore, one aspect of the invention relates to supporting or promoting the growth of symbiotic bacteria in livestock, including feeding animals the polypeptides of the invention.

[0350] Similarly, another aspect of the invention relates to a method for inhibiting, reducing, or preventing inflammation in animals, the method comprising administering an ALP as defined herein. Thus, one aspect of the invention relates to a method for inhibiting, reducing, or preventing inflammation by lowering IL-1β levels in animals, the method comprising administering an ALP as defined herein. Another aspect of the invention relates to an ALP as defined herein for use in inhibiting, reducing, or preventing inflammation in animals. Another aspect of the invention relates to the use of the ALP of the invention for inhibiting, preventing, or reducing ALP in animals. Preferably, the inflammation is chronic or associated with a chronic condition.

[0351] ALP inhibits TNF-α; ALP inhibits inflammation. The inflammasome activation of ATP is not maintained by its dephosphorylation products ADP, AMP, or adenosine. In fact, the inventors have discovered that adenosine has immunosuppressive potential. The inventors have discovered that ALP inhibits, reduces, or prevents inflammation by converting ATP to ADP, AMP, or adenosine. The inventors have discovered that the ALP of this invention inhibits IL-8 secretion by inhibiting IL-8 secretion through adenosine.

[0352] Increased levels of adenosine (a dephosphorylation product of ATP) lead to decreased levels of TNF-α. Therefore, one aspect of the invention relates to a method for inhibiting, reducing, or preventing inflammation in animals by lowering TNF-α levels, the method comprising administering an ALP as defined herein. Another aspect of the invention relates to an ALP as defined herein for use in inhibiting, reducing, or preventing inflammation in animals. Yet another aspect of the invention relates to the use of the ALP of the invention for inhibiting, preventing, or reducing ALP in animals.

[0353] Uses in animal feed The polypeptides with alkaline phosphatase activity of the present invention can also be used in animal feed. In one embodiment, the present invention provides a method for preparing an animal feed composition, the method comprising adding one or more polypeptides with alkaline phosphatase activity of the present invention to one or more animal feed ingredients.

[0354] According to WO 00 / 21381 and WO 04 / 026334, the polypeptides of the present invention having alkaline phosphatase activity can also be used in animal feed as feed-enhancing enzymes to improve feed digestibility and increase its utilization efficiency. In another embodiment, according to WO 00 / 21381 and WO 04 / 026334, the polypeptides of the present invention having alkaline phosphatase activity can also be used in animal feed as feed-enhancing enzymes to improve feed digestibility and increase its utilization efficiency.

[0355] One aspect of this invention relates to the use of the polypeptide of this invention in the preparation of feed additives, feed compositions, or animal technology additives. According to any method of the invention, the polypeptide can be administered to animals (e.g., sows) during one or more of the initial, growth, and / or finishing stages. According to any method of the invention, the polypeptide can be formulated into animal feed (e.g., feed for young animals, growing feed, or finishing feed for animals (e.g., sows).

[0356] According to any method of the invention, the polypeptide can be provided in compositions suitable for oral administration to animals, these compositions containing an effective amount of an enzyme that reduces the amount of harmful compounds present in or released from animal waste. The composition may contain an orally acceptable carrier of the enzyme.

[0357] In another embodiment, the polypeptide of the present invention having alkaline phosphatase activity can be used as a feed additive, wherein it can have a positive effect on the animal's digestive tract and thereby improve animal production performance, or improve animal health, such as reduced mortality, based on weight gain, feed conversion ratio (FCR). FCR is calculated as feed intake per animal relative to weight gain per animal (g / animal).

[0358] One or more polypeptides of the present invention having alkaline phosphatase activity can, for example, be used to stabilize healthy microbial colonies in animals (such as ruminants and non-ruminants), particularly livestock such as, but not limited to, sheep, goats, cattle (including but not limited to beef cattle, dairy cattle, and young calves), deer, pigs or pigs (including but not limited to piglets, growing pigs, and sows), poultry (including but not limited to geese, turkeys, ducks, and chickens (such as broilers, chicks, and laying hens)); horses (including but not limited to warm-blooded, cold-blooded, and lukewarm-blooded), moose, and rabbits, but also found in fish (including but not limited to salmon, trout, tilapia, catfish, and carp); and crustaceans (including but not limited to shrimp and prawns), by inhibiting viruses (such as those from the Coronaviridae family (…)). Coronaviridae ), porcine reproductive and respiratory syndrome virus (PRRSV), and the genus of porcine swine fever virus that causes bovine viral diarrhea (PfV). Persivirus (etc.), parasitic pathogens (coccidia, Eimeria giantis (etc.) Eimeria maxima ), Eimeria coccidia ( Eimeria mitis )) or bacterial pathogens (such as Clostridium perfringens) Clostridium perfringens ), Escherichia coli, Campylobacter coli ( Campylobacter coli Campylobacter suis ( ) C. hyointestinalis ) and Campylobacter jejuni ( C. jejuni Yersinia spp. Yersinia ssp. ), Porcine spirochetes ( Treponema suis ), Swine dysentery short spirochetes ( Brachyspira hyodysenteriae Lawsonia intracellularis ( Lawsonia intracellularis ) and Salmonella (such as enteric Salmonella ( Salmonella enterica Salmonella typhimurium and Salmonella Mbandaka ( SalmonellaThe growth / intestinal colonization of *Mbandaka*. A preferred embodiment relates to a method for preventing antibiotic-associated infections from *S. typhimurium* and / or *Clostridium difficile*, the method comprising feeding the animal the polypeptide of the invention, the composition of the invention, or the animal feed additive of the invention. In a preferred embodiment, the polypeptide having alkaline phosphatase activity is applied to chickens and has activity against *Clostridium perfringens*. In another embodiment, the polypeptide of the invention having alkaline phosphatase activity is used as a feed additive, wherein it can have a positive effect on the microbial balance of the chicken's digestive tract and thereby improve animal production performance. The term animal typically refers to livestock, such as pigs (e.g., hogs or fattening pigs), sheep, poultry or poultry (e.g., chickens, ducks, turkeys, and geese), dairy cows and other ruminants, buffalo, horses, and aquaculture animals (e.g., fish and shrimp, and eels). In any method according to the invention, the animal is typically a poultry or pig animal.

[0359] One aspect of the invention relates to a method for maintaining or restoring (healthy) gut microbiota in animals treated with antibiotics, the method comprising feeding the animals polypeptides, compositions, animal feed additives, or animal technology additives of the invention. Another aspect of the invention relates to a method for maintaining or supporting gut health, or improving gut health in animals thereby promoting the growth of symbiotic bacteria, the method comprising feeding the animals polypeptides, compositions, animal feed additives, or animal technology additives of the invention.

[0360] One aspect of the invention relates to a method for preventing antibiotic-associated infections from *Escherichia coli*, *Salmonella Typhimurium*, and / or *Clostridium difficile*, the method comprising feeding the animal the polypeptides, compositions, animal feed additives, or animal technology additives of the invention. Another aspect of the invention relates to a method for preventing or reducing intestinal colonization or systemic translocation of harmful bacteria, or for "dysbiosis," i.e., for altering the bacterial and / or archaea balance of the intestinal microecology, the method comprising feeding the animal the polypeptides, compositions, animal feed additives, or animal technology additives of the invention.

[0361] According to WO 00 / 21381 and WO 04 / 026334, the polypeptides of the present invention having alkaline phosphatase activity can also be used in animal feed as feed enhancers to improve feed digestibility and increase its utilization efficiency.

[0362] In another embodiment, the polypeptide of the present invention having alkaline phosphatase activity can be used as a feed additive, wherein it can have a positive effect on the animal's digestive tract and thereby improve animal production performance or improve animal health, such as reduced mortality, based on weight gain, feed conversion ratio (FCR). FCR is calculated as feed intake per animal relative to weight gain per g. One aspect of the invention relates to a method for increasing animal weight gain, the method comprising feeding the animal the polypeptide, composition, animal feed additive, or animal technology additive of the present invention. Another aspect of the invention relates to a method for improving animal feed conversion ratio (FCR), the method comprising feeding the animal the polypeptide, composition, animal feed additive, or animal technology additive of the present invention.

[0363] One aspect of the invention relates to a method for preventing weight loss in infected animals, the method comprising feeding the animals polypeptides, compositions, animal feed additives, or animal technology additives of the present invention. Another aspect of the invention relates to a method for preventing low birth weight, such as low birth weight induced by perinatal malnutrition, the method comprising feeding the animals polypeptides, compositions, animal feed additives, or animal technology additives of the present invention. Another aspect of the invention relates to a method for improving weight gain in animals with below-average birth weight, the method comprising feeding the animals polypeptides, compositions, animal feed additives, or animal technology additives of the present invention. A third aspect of the invention relates to a method for regulating fat absorption or neutralizing acidic digestive products entering the small intestine by stimulating bicarbonate secretion and surface pH regulation, the method comprising feeding the animals polypeptides, compositions, animal feed additives, or animal technology additives of the present invention.

[0364] One aspect of this invention relates to a method for detoxifying lipopolysaccharides in animals, the method comprising feeding the animals polypeptides, compositions, animal feed additives, or animal technology additives of the present invention. Another aspect of this invention relates to a method for reducing immune responses in animals, the method comprising feeding the animals polypeptides, compositions, animal feed additives, or animal technology additives of the present invention.

[0365] An interesting aspect of the present invention relates to a method for reducing inflammation in animals, the method comprising feeding the animals the polypeptides, compositions, animal feed additives, or animal technology additives of the present invention.

[0366] One aspect of the invention relates to reducing IL or TNF responses in animals, including feeding said animals the polypeptides, compositions, animal feed additives, or animal technology additives of the invention. Another aspect of the invention relates to a method for maintaining an effective intestinal barrier, the method comprising feeding said animals the polypeptides, compositions, animal feed additives, or animal technology additives of the invention.

[0367] One aspect of the present invention relates to a method for preventing colitis or inflammation of the colonic wall in animals, the method comprising feeding the animals the polypeptides, compositions, animal feed additives or animal technology additives of the present invention.

[0368] In the uses or methods according to the invention, the polypeptides, compositions, animal feed additives, or animal technology additives of the invention may be given to animals before, after, or simultaneously with their diet. The latter is preferred.

[0369] However, for use in animal feed, a polypeptide with alkaline phosphatase activity does not have to be pure; it may include other enzymes, in which case it may be referred to as a polypeptide preparation with alkaline phosphatase activity.

[0370] Peptide compositions with alkaline phosphatase activity can (a) be added directly to feed, or (b) can be used to produce one or more intermediate compositions (such as feed additives or premixes) which are then added to feed (or used in processing). Regardless of whether they are used according to (a) or (b) above, the purity mentioned above refers to the purity of the original peptide formulation with alkaline phosphatase activity.

[0371] This invention further provides methods for reducing the environmental impact of animal waste. Specifically, the invention provides methods including administering an enzyme to animals that effectively reduces the amount of harmful compounds present in or released from animal waste, and compositions suitable for use in such methods. A method for increasing phosphorus digestion in animals is also provided. Animal waste may contain or release one or more compounds that have harmful effects, such as on animals, other animals, humans, or the environment. One such compound is ammonia (NH3). Another such compound is phosphorus (P). Ammonia in the atmosphere can have adverse effects on the environment, as well as on animal production performance, health, and welfare. For example, ammonia production and emissions in poultry houses are primarily caused by the microbial decomposition of poultry waste. Ammonia levels as low as 50 ppm can be harmful to poultry, and such low levels may go unnoticed. Exposure to 50 ppm of ammonia can lead to 5%–10% stunted growth in poultry and may be associated with a loss of 0.5 pounds of meat per bird and / or an 8-point loss in feed conversion ratio. Therefore, there is a need for methods to reduce the amount of harmful compounds present in or released from animal waste, such as methods for reducing the ammonia and / or phosphorus content of animal waste. According to some embodiments, methods for reducing the environmental impact of animal waste are provided, including administering an effective amount of an enzyme to the animal that reduces the amount of harmful compounds present in or released from the animal waste. According to some embodiments, methods for reducing the amount of ammonia in animal waste are provided, including administering an effective amount of an enzyme to the animal that reduces the amount of ammonia present in or released from the animal waste. According to some embodiments, methods for reducing the amount of phosphorus in animal waste are provided, including administering an effective amount of an enzyme to the animal that reduces the amount of phosphorus present in or released from the animal waste. A method for increasing phosphorus digestion in animals is also provided, including administering an effective amount of alkaline phosphatase to the animal.

[0372] One aspect of the invention relates to a method of administering an alkaline phosphatase to animals, which effectively reduces the amount of harmful compounds (such as ammonia (NH3) or phosphorus (P)) present in or released from animal waste, and compositions suitable for use in such methods. These methods offer numerous advantages in the context of animal production, including poultry and pig production. In one embodiment, these methods can provide advantages selected from the group consisting of: reduced phosphate input into animal production systems, reduced ammonia in animal manure, reduced ventilation air requirements (and associated energy savings) for diluting indoor ammonia concentrations in animal housing, and reduced requirements for further exhaust treatment. While not wishing to be bound by any theory, the methods described herein can help animals (such as young broilers) utilize and digest phosphorus present in their diet, which in turn can lead to better growth rates and less nutrient loss through excretion. Additionally or alternatively, the methods described herein can reduce NH3 emissions because enzymatic treatment can increase the metabolism and growth of a beneficial bacterial community in the gut, resulting in more excess nitrogen in the diet being retained in the manure as bacterial protein rather than uric acid (which is typically degraded and emitted as NH3). Furthermore, the lower pH and lower nitrogen content in treated animal manure can inhibit and prevent the formation of gaseous NH3 in the manure and reduce NH3 emissions. The relationship between pH and uric acid (the main nitrogen source in poultry manure) degradation has been reported, suggesting that a sharp increase in pH may be associated with a decrease in uric acid content in poultry manure. Elliot and Collins, 1982, Transactions of ASAE [Journal of the American Society of Agricultural Engineers] 25: 413-24 It is pointed out that the high pH in stored manure will cause most of the nitrogen to be lost as NH3. In addition, reducing the phosphorus content of animal waste may affect other properties of manure, such as bacterial flora.

[0373] One aspect of the invention relates to a method for maintaining or protecting the intestinal or intestinal integrity of livestock animals (such as pigs and poultry), or reducing intestinal permeability, the method comprising feeding the animal an animal feed additive containing the polypeptides of the invention. As discussed, one aspect of the invention relates to a method for preventing or reducing gastrointestinal inflammation in animals. Similarly, one aspect of the invention relates to a method for preventing or reducing inflammatory bowel disease or diarrhea in livestock animals (preferably pigs and poultry).

[0374] One related aspect of the present invention relates to a method for maintaining or improving the intestinal health of livestock animals (such as pigs and poultry), the method comprising feeding the animal an animal feed additive containing the polypeptides of the present invention.

[0375] Another aspect of the invention relates to improving the immunity of newborn livestock, including feeding the animals an animal feed additive containing the polypeptides of the present invention. Alkaline phosphatase (ALP) is abundant in raw milk. For livestock separated from their mothers, feeding young animals with alkaline phosphatase can be used to improve the immune system of piglets or other young animals. Therefore, one aspect of the invention relates to improving the immunity of newborn, weaned, or post-weaned livestock, including feeding the animals an animal feed additive containing the polypeptides of the present invention. Similarly, one aspect of the invention relates to reducing or preventing allergic immunity in livestock, including feeding the animals an animal feed additive containing the polypeptides of the present invention.

[0376] Animal feed and animal feed additives The present invention also relates to animal feed compositions and animal feed additives comprising the polypeptides of the present invention having alkaline phosphatase activity. In one embodiment, the animal feed or animal feed additive comprises a formulation and the polypeptides of the present invention having alkaline phosphatase activity. In another embodiment, the formulation comprises one or more of the following compounds: glycerol, ethylene glycol, 1,2-propanediol or 1,3-propanediol, sodium chloride, sodium benzoate, potassium sorbate, sodium sulfate, potassium sulfate, magnesium sulfate, sodium thiosulfate, calcium carbonate, sodium citrate, dextrin, glucose, sucrose, sorbitol, lactose, starch, kaolin, and cellulose.

[0377] Animal feed compositions or diets have a relatively high protein content. Poultry and pig diets can be characterized as indicated in columns 2-3 of Table B in WO 01 / 58275. Fish diets can be characterized as shown in column 4 of Table B. Furthermore, such fish diets typically have a crude fat content of 200-310 g / kg.

[0378] The animal feed composition according to the invention has a crude protein content of 50-800 g / kg, and further contains at least one polypeptide with alkaline phosphatase activity as required herein.

[0379] In a particular embodiment, the contents of metabolizable energy, crude protein, calcium, phosphorus, methionine, methionine plus cysteine, and / or lysine fall within any one of ranges 2, 3, 4, or 5 (R. 2-5) in Table B of WO 01 / 58275.

[0380] Crude protein was calculated by multiplying nitrogen (N) by a factor of 6.25, i.e., crude protein (g / kg) = N (g / kg) x 6.25. Nitrogen content was determined by the Kjeldahl method (AOAC, 1984, Official Methods of Analysis, 14th edition, Association of Official Analytical Chemists, Washington, D.C.).

[0381] In one particular embodiment, the animal feed composition of the present invention comprises at least one plant protein as defined above.

[0382] The animal feed compositions of the present invention may also contain animal protein, such as meat and bone meal, feather meal and / or fish meal, typically in an amount of 0%-25%. The animal feed compositions of the present invention may also contain dried distillers grains with solubles (DDGS), typically in an amount of 0%-30%.

[0383] In yet another particular embodiment, the animal feed composition of the present invention contains 0%-80% corn; and / or 0%-80% sorghum; and / or 0%-70% wheat; and / or 0%-70% barley; and / or 0%-30% oats; and / or 0%-40% soybean meal; and / or 0%-25% fish meal; and / or 0%-25% meat and bone meal; and / or 0%-20% whey.

[0384] Animal feed may contain plant protein. In specific embodiments, the plant protein content is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% (w / w). The plant protein may be derived from plant protein sources such as legumes and cereals, for example, materials from plants of the Fabaceae, Brassicaceae, Chenopodiaceae, and Poaceae families, such as soybean meal, lupin meal, rapeseed meal, and combinations thereof.

[0385] In one specific embodiment, the plant protein source is material from one or more legumes, such as soybeans, lupins, peas, or common beans. In another specific embodiment, the plant protein source is material from one or more lambsquarters, such as beets, sugar beets, spinach, or quinoa. Other examples of plant protein sources are rapeseed and cabbage. In yet another specific embodiment, soybeans are a preferred plant protein source. Other examples of plant protein sources are cereals, such as barley, wheat, rye, oats, corn, rice, and sorghum.

[0386] Animal diets can be formulated, for example, into powdered (non-pelletized) or pelleted feed. Typically, the milled feed is mixed and supplemented with adequate amounts of essential vitamins and minerals according to the instructions for the type discussed. Enzymes are added as solid or liquid enzyme formulations. For example, for powdered feeds, solid or liquid enzyme formulations can be added before or during the ingredient mixing step. For pelleted feeds, a (liquid or solid) polypeptide / enzyme preparation with alkaline phosphatase activity can also be added before or during the feed ingredient step. Typically, the liquid polypeptide or enzyme preparation with alkaline phosphatase activity comprises the polypeptide of the present invention with alkaline phosphatase activity, optionally accompanied by a polyol (such as glycerol, ethylene glycol, or propylene glycol), and is added after the pelleting step, such as by spraying the liquid formulation onto pellets. The enzyme can also be incorporated into feed additives or premixes.

[0387] Alternatively, peptides with alkaline phosphatase activity can be prepared by freezing a mixture of liquid enzyme solution and filler (such as ground soybean meal) and then freeze-drying the mixture.

[0388] In one embodiment, the animal feed or animal feed additive contains one or more additional enzymes. In one embodiment, the animal feed contains one or more microorganisms. In one embodiment, the animal feed contains one or more vitamins. In one embodiment, the animal feed contains one or more minerals. In one embodiment, the animal feed contains one or more amino acids. In one embodiment, the animal feed contains one or more other feed ingredients.

[0389] In another embodiment, the animal feed or animal feed additive comprises the polypeptides of the present invention, one or more formulations, and one or more additional enzymes. In one embodiment, the animal feed or animal feed additive comprises the polypeptides of the present invention, one or more formulations, and one or more microorganisms. In one embodiment, the animal feed comprises the polypeptides of the present invention, one or more formulations, and one or more vitamins. In one embodiment, the animal feed or animal feed additive comprises one or more minerals. In one embodiment, the animal feed or animal feed additive comprises the polypeptides of the present invention, one or more formulations, and one or more amino acids. In one embodiment, the animal feed or animal feed additive comprises the polypeptides of the present invention, one or more formulations, and one or more other feed ingredients.

[0390] In another embodiment, the animal feed or animal feed additive comprises the polypeptides of the present invention, one or more formulations, and one or more components selected from the list of the following: one or more additional enzymes; one or more microorganisms; one or more vitamins; one or more minerals; one or more amino acids; and one or more other feed ingredients.

[0391] The final enzyme concentration in the diet is in the range of 0.01-200 mg enzyme protein / kg diet, preferably between 0.05-100 mg / kg diet, more preferably 0.1-50 mg, and even more preferably 0.2-20 mg enzyme protein / kg animal diet.

[0392] In one particular embodiment, the animal feed additive of the present invention is intended to be included (or specified as required to be included) in animal diets or feed at the following levels: 0.01% to 10.0%; more particularly 0.05% to 5.0%; or 0.2% to 1.0% (% means g additive / 100 g feed). This is also true for premixes.

[0393] alkaline phosphatase granules The present invention also relates to enzyme particles / granules comprising the polypeptides of the present invention. In embodiments, the particles comprise a core and optionally one or more coatings (outer layers) surrounding the core.

[0394] The diameter of the core (measured as equivalent sphere diameter (volume-average particle size)) can be 20–2000 µm, particularly 50–1500 µm, 100–1500 µm, or 250–1200 µm. The core diameter as an equivalent sphere diameter can be determined using laser diffraction, such as with the Malvern Mastersizer, and / or the methods described under ISO 13320 (2020).

[0395] In one embodiment, the core comprises a polypeptide of the present invention having alkaline phosphatase activity.

[0396] The core may include additional materials such as fillers, fibrous materials (cellulose or synthetic fibers), stabilizers, solubilizers, suspending agents, viscosity modifiers, light spheres, plasticizers, salts, lubricants, and fragrances.

[0397] The core may include binders such as synthetic polymers, waxes, fats, or carbohydrates.

[0398] The core, typically as a homogeneous blend, may include salts of polyvalent cations, reducing agents, antioxidants, peroxide decomposition catalysts, and / or acidic buffer components.

[0399] The core may contain inert particles into which the polypeptide is adsorbed or applied (e.g., by fluidized bed coating) to the surface of the inert particles.

[0400] The diameter of the core can be 20-2000 µm, particularly 50-1500 µm, 100-1500 µm or 250-1200 µm.

[0401] The core may be surrounded by at least one coating, for example, to improve storage stability, reduce dust formation during handling, or to color the particles. Optionally, one or more coatings may include salt coatings or other suitable coating materials such as polyethylene glycol (PEG), methyl hydroxypropyl cellulose (MHPC), and polyvinyl alcohol (PVA).

[0402] The coating can be applied at a rate of at least 0.1% (e.g., at least 0.5%, at least 1%, at least 5%, at least 10%, or at least 15%) based on the weight of the core. This rate can be up to 100%, 70%, 50%, 40%, or 30%.

[0403] The coating is preferably at least 0.1 µm thick, particularly at least 0.5 µm, at least 1 µm, or at least 5 µm thick. In some embodiments, the coating thickness is less than 100 µm, such as less than 60 µm or less than 40 µm.

[0404] The coating should seal the core unit by forming a substantially continuous layer. A substantially continuous layer should be understood as a coating with very few or no pores, such that the core unit has very few or no uncoated areas. The layer or coating should in particular be uniform in thickness.

[0405] The coating may further contain other materials as known in the art, such as fillers, anti-sticking agents, pigments, dyes, plasticizers and / or adhesives, such as titanium dioxide, kaolin, calcium carbonate or talc.

[0406] Salt coatings may contain at least 60% salt by weight, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% salt by weight.

[0407] To provide acceptable protection, the salt coating is preferably at least 0.1 µm thick, such as at least 0.5 µm, at least 1 µm, at least 2 µm, at least 4 µm, at least 5 µm, or at least 8 µm. In a particular embodiment, the salt coating thickness is less than 100 µm, such as less than 60 µm or less than 40 µm.

[0408] Salt can be added from a salt solution (where the salt is completely dissolved) or from a salt suspension (where the fine particles are less than 50 µm, such as less than 10 µm or less than 5 μm).

[0409] Salt coatings may contain a single salt or a mixture of two or more salts. The salts may be water-soluble, particularly having a solubility of at least 0.1 g in 100 g of water at 20°C, preferably at least 0.5 g / 100 g of water, for example at least 1 g / 100 g of water, or for example at least 5 g / 100 g of water.

[0410] Salts can be inorganic salts, such as sulfates, sulfites, phosphates, phosphonates, nitrates, chlorides, or carbonates, or salts of simple organic acids (less than 10 carbon atoms, such as 6 or fewer carbon atoms), such as citrates, malonates, or acetates. Examples of cations in these salts are alkali or alkaline earth metal ions, ammonium ions, or first transition metal ions, such as sodium, potassium, magnesium, calcium, zinc, or aluminum. Examples of anions include chloride, bromine, iodine, sulfate, sulfite, bisulfite, thiosulfate, phosphate, dihydrogen phosphate, dibasic phosphate, hypophosphite, dihydrogen pyrophosphate, tetraborate, borate, carbonate, bicarbonate, metasilicate, citrate, malate, maleate, malonic acid, succinate, lactate, formate, acetate, butyrate, propionate, benzoate, tartrate, ascorbate, or gluconate. In particular, alkali or alkaline earth metal salts of sulfate, sulfite, phosphate, phosphonate, nitrate, chloride or carbonate, or salts of simple organic acids such as citrate, malonate or acetate can be used.

[0411] The salt in the coating may have a constant humidity of 60% or more, particularly 70%, 80% or more or 85% or more at 20°C, or it may be another hydrated form of such salt (e.g., anhydrous form). Salt coatings may be as described in WO 00 / 01793 or WO 2006 / 034710.

[0412] A specific example of a suitable salt is NaCl (CH4). 20℃ = 76%), Na2CO3 (CH 20℃ = 92%), NaNO3 (CH 20℃ =73%), Na2HPO4 (CH 20℃ = 95%), Na3PO4 (CH 25℃ = 92%), NH4Cl (CH 20℃ = 79.5%), (NH4)2HPO4 (CH 20℃ =93.0%), NH4H2PO4 (CH 20℃ = 93.1%), (NH4)2SO4 (CH 20℃ = 81.1%), KCl (CH 20℃ = 85%), K2HPO4 (CH 20℃ = 92%), KH2PO4 (CH20℃ = 96.5%), KNO3 (CH 20℃ = 93.5%), Na2SO4 (CH 20℃ = 93%), K2SO4 (CH 20℃ =98%), KHSO4 (CH 20℃ = 86%), MgSO4 (CH 20℃ = 90%), ZnSO4 (CH 20℃ = 90%) and sodium citrate (CH 25℃ = 86%). Other examples include NaH2PO4, (NH4)H2PO4, CuSO4, Mg(NO3)2, and magnesium acetate.

[0413] Salts can be in anhydrous form, or they can be hydrated salts, i.e., crystalline salt hydrates with one or more bound water crystals, as described in WO 99 / 32595. Specific examples include anhydrous sodium sulfate (Na₂SO₄), anhydrous magnesium sulfate (MgSO₄), magnesium sulfate heptahydrate (MgSO₄·7H₂O), zinc sulfate heptahydrate (ZnSO₄·7H₂O), disodium hydrogen phosphate heptahydrate (Na₂HPO₄·7H₂O), magnesium nitrate hexahydrate (Mg(NO₃)₂(6H₂O)), sodium citrate dihydrate, and magnesium acetate tetrahydrate.

[0414] Preferably, the salt is used as a salt solution, for example, in a fluidized bed.

[0415] Coating materials can be waxy coating materials and film-forming coating materials. Examples of waxy coating materials are poly(ethylene oxide) products (polyethylene glycol, PEG) with an average molecular weight of 1,000 to 20,000; ethoxylated nonylphenol having 16 to 50 ethylene oxide units; ethoxylated fatty alcohols containing 12 to 20 carbon atoms and having 15 to 80 ethylene oxide units; fatty alcohols; fatty acids; and monoglycerides, diglycerides, and triglycerides of fatty acids. Examples of film-forming coating materials suitable for application via fluidized bed technology are given in GB 1483591.

[0416] The particles may optionally have one or more additional coatings. Examples of suitable coating materials are polyethylene glycol (PEG), methyl hydroxypropyl cellulose (MHPC), and polyvinyl alcohol (PVA). Examples of enzyme particles with multiple coatings are described in WO 93 / 07263 and WO 97 / 23606.

[0417] The core can be prepared by blends of granulated components, for example by methods including granulation techniques such as crystallization, precipitation, pan-coating, fluidized bed coating, fluidized bed agglomeration, rotary atomization, extrusion, granulation, spheronization, particle size reduction, drum granulation, and / or high-shear granulation.

[0418] Methods for preparing the core can be found in *Handbook of Powder Technology*; CE Capes, *Particle Size Enlargement*; Volume 1; 1980; Elsevier. Preparation methods include known feed and pellet formulation techniques, such as: (a) Spray-dried products, wherein a liquid peptide-containing solution is atomized in a spray drying tower to form small droplets, which are dried as they descend along the drying tower to form peptide-containing particulate material. This method can produce very small particles (Michael S. Showell (ed.)). Powdered detergents [Powdered Detergent]; SurfactantScience Series; 1998; Volume 71; pp. 140-142; Marcel Dekker.

[0419] (b) Layered products, wherein a polypeptide is coated in layers around a pre-formed inert core particle, wherein the polypeptide-containing solution is typically atomized in a fluidized bed apparatus, in which the pre-formed core particle is fluidized and the polypeptide-containing solution adheres to the core particle and is dried until a dry polypeptide layer remains on the surface of the core particle. If useful core particles of the desired size can be found, particles of the desired size can be obtained in this manner. This type of product is described, for example, in WO 97 / 23606.

[0420] (c) Absorbed core particles, wherein instead of coating the polypeptide in layers around the core, the polypeptide is absorbed onto and / or into the surface of the core. Such a method is described in WO 97 / 39116.

[0421] (d) Extruded or pelletized products, wherein a peptide-containing paste is compressed into pellets or extruded under pressure through small openings and cut into particles, followed by drying of these pellets. Such particles typically have a fairly large size because the material with the extrusion openings (usually a plate with perforations) limits the pressure drop allowed through the extrusion openings. Furthermore, when using small openings, the very high extrusion pressure increases the heat generated in the peptide paste, which is detrimental to the peptide (Michael S. Showell (edited);). Powdered detergents [Powdered Detergents]; Surfactant Science Series; 1998; Volume 71; pp. 140-142; Marcel Dekker.

[0422] (e) Spray-granulated products, wherein peptide-containing powder is suspended in molten wax and the suspension is sprayed (e.g., via a rotary sprayer) into a cooling chamber where the droplets rapidly solidify (Michael S. Showell (ed.); Powdered detergents [Powdered Detergent]; Surfactant Science Series; 1998; Vol. 71; pp. 140-142; Marcel Dekker. The resulting product is one in which the polypeptide is uniformly distributed throughout the inert material rather than concentrated on its surface. This technique is described in US 4,016,040 and US 4,713,245.

[0423] (f) A mixer-granulated product in which a polypeptide-containing liquid is added to a dry powder composition of conventional granulation components. The liquid and powder are mixed in a suitable ratio, and as the moisture from the liquid is absorbed into the dry powder, the components of the dry powder begin to adhere and aggregate, and the particles accumulate to form polypeptide-containing granules. Such methods are described in US4,106,991, EP 170360, EP 304332, EP 304331, WO 90 / 09440, and WO 90 / 09428. In certain aspects of this process, various high-shear mixers can be used as granulators. Granules composed of polypeptides, fillers, and binders are mixed with cellulose fibers to reinforce the granules, thereby producing so-called T-granules. The reinforced granules are more robust and release less enzyme dust.

[0424] (g) Particle size reduction, in which a core is generated by grinding or crushing larger particles, pellets, flat sheets, briquettes, etc., containing polypeptides. The desired core particle fraction is obtained by sieving the ground or crushed product. Oversized and undersized particles can be recovered. Particle size reduction is described in Martin Rhodes (ed.); Principles of Powder Technology; 1990; Chapter 10; John Wiley & Sons.

[0425] (h) Fluidized bed granulation. Fluidized bed granulation involves suspending microparticles in an airflow and spraying liquid through a nozzle onto the fluidized particles. The particles hit by the sprayed droplets become wetted and sticky. The sticky particles collide with and adhere to other particles to form granules.

[0426] (i) These cores can be dried, such as in a fluidized bed dryer. Those skilled in the art can use other known methods for drying particles in the feed or enzyme industries. Drying is preferably carried out at a product temperature of 25°C to 90°C. For some peptides, it is important that the core containing the peptide contains a small amount of water before salt coating. If water-sensitive peptides are salt-coated before removing excess water, the excess water will be trapped in the core and may negatively affect the activity of the peptide. After drying, these cores preferably contain 0.1%–10% w / w water.

[0427] Dust-free particulate matter can be generated, for example, as disclosed in US 4,106,991 and US 4,661,452, and can optionally be coated by methods known in the art.

[0428] The particles may further contain one or more additional enzymes, such as hydrolases, isomerases, ligases, lyases, oxidoreductases, and transferases. One or more additional enzymes are preferably selected from the group consisting of: acetylxylan esterase, acylglycerol lipase, amylase, α-amylase, β-amylase, arabinofuranylase, cellobiase, cellulase, ferulic acid esterase, galactanase, α-galactosidase, β-galactosidase, β-glucanase, β-glucosidase, lysophospholipase, lysozyme, α-mannosidase, β-mannosidase (mannanase), phytase, phospholipase A1, phospholipase A2, phospholipase D, protease, pullulanase, pectin esterase, triacylglycerol lipase, xylanase, β-xylosidase, or any combination thereof. Each enzyme will then be present in more particles, ensuring a more uniform distribution of the enzymes and also reducing the physical separation of different enzymes due to the varying particle sizes. The method for generating multi-enzyme coparticles is disclosed in IP.com disclosure IPCOM000200739D.

[0429] Another example of peptide formulation using co-particulate matter is disclosed in WO 2013 / 188331.

[0430] The present invention also relates to protected polypeptides prepared according to the method disclosed in EP 238216.

[0431] Liquid preparations The present invention also relates to liquid compositions comprising the polypeptides of the present invention. The compositions may comprise enzyme stabilizers (examples of which include polyols (such as propylene glycol or glycerol), sugars or sugar alcohols, lactic acid, reversible protease inhibitors, boric acid or boric acid derivatives such as aromatic borate esters, or phenyl boric acid derivatives such as 4-formylphenylboronic acid).

[0432] In some embodiments, one or more fillers or one or more carrier materials are included to increase the volume of such compositions. Suitable fillers or carrier materials include, but are not limited to, various salts of sulfate, carbonate, and silicate, as well as talc, clay, etc. Suitable fillers or carrier materials for liquid compositions include, but are not limited to, water or low molecular weight primary and secondary alcohols (including polyols and diols). Examples of such alcohols include, but are not limited to, methanol, ethanol, propanol, and isopropanol. In some embodiments, these compositions contain about 5% to about 90% of such materials.

[0433] In one aspect, the liquid formulation contains 20%-80% w / w polyol. In one embodiment, the liquid formulation contains 0.001%-2% w / w preservative.

[0434] In another embodiment, the present invention relates to a liquid preparation comprising: (A) 0.001%-25% w / w of the polypeptide of the present invention having alkaline phosphatase activity; (B) 20%-80% w / w polyols; (C) Optional 0.001%-2% w / w preservative; and (D) Water.

[0435] In another embodiment, the present invention relates to a liquid preparation comprising: (A) 0.001%-25% w / w of the polypeptide of the present invention having alkaline phosphatase activity; (B) 0.001%-2% w / w preservative; (C) Optional 20%-80% w / w polyols; and (D) Water.

[0436] In another embodiment, the liquid formulation comprises one or more formulations, such as formulations selected from the group consisting of: polyols, sodium chloride, sodium benzoate, potassium sorbate, sodium sulfate, potassium sulfate, magnesium sulfate, sodium thiosulfate, calcium carbonate, sodium citrate, dextrin, glucose, sucrose, sorbitol, lactose, starch, PVA, acetate, and phosphate, preferably formulations selected from the group consisting of: sodium sulfate, dextrin, cellulose, sodium thiosulfate, kaolin, and calcium carbonate. In one embodiment, the polyol is selected from the group consisting of: glycerol, sorbitol, propylene glycol (MPG), ethylene glycol, diethylene glycol, triethylene glycol, 1,2-propanediol or 1,3-propanediol, dipropylene glycol, polyethylene glycol (PEG) with an average molecular weight of less than about 600, and polypropylene glycol (PPG) with an average molecular weight of less than about 600, more preferably selected from the group consisting of: glycerol, sorbitol, and propylene glycol (MPG), or any combination thereof.

[0437] In another embodiment, the liquid formulation comprises 20%-80% polyols (i.e., the total amount of polyols), such as 25%-75% polyols, 30%-70% polyols, 35%-65% polyols, or 40%-60% polyols. In one embodiment, the liquid formulation comprises 20%-80% polyols, such as 25%-75% polyols, 30%-70% polyols, 35%-65% polyols, or 40%-60% polyols, wherein the polyols are selected from the group consisting of: glycerol, sorbitol, propylene glycol (MPG), ethylene glycol, diethylene glycol, triethylene glycol, 1,2-propanediol or 1,3-propanediol, dipropylene glycol, polyethylene glycol (PEG) with an average molecular weight of less than about 600, and polypropylene glycol (PPG) with an average molecular weight of less than about 600. In one embodiment, the liquid formulation comprises 20%-80% polyols (i.e., the total amount of polyols), such as 25%-75% polyols, 30%-70% polyols, 35%-65% polyols, or 40%-60% polyols, wherein the polyols are selected from the group consisting of glycerol, sorbitol, and propylene glycol (MPG).

[0438] In another embodiment, the preservative is selected from the group consisting of sodium sorbate, potassium sorbate, sodium benzoate, and potassium benzoate, or any combination thereof. In one embodiment, the liquid formulation contains 0.02%-1.5% w / w preservative, such as 0.05%-1% w / w or 0.1%-0.5% w / w preservative. In one embodiment, the liquid formulation contains 0.001%-2% w / w preservative (i.e., the total amount of preservative), such as 0.02%-1.5% w / w, 0.05%-1% w / w, or 0.1%-0.5% w / w preservative, wherein the preservative is selected from the group consisting of sodium sorbate, potassium sorbate, sodium benzoate, and potassium benzoate, or any combination thereof.

[0439] In another embodiment, the liquid formulation further comprises one or more additional enzymes, such as hydrolases, isomerases, ligases, lyases, oxidoreductases, and transferases. The one or more additional enzymes are preferably selected from the group consisting of: acetylxylan esterase, acylglycerol lipase, amylase, α-amylase, β-amylase, arabinofuranoside, cellobiase, cellulase, ferulic acid esterase, galactanase, α-galactosidase, β-galactosidase, β-glucanase, β-glucosidase, lysophospholipase, lysozyme, α-mannoside, β-mannoside (mannanase), phytase, phospholipase A1, phospholipase A2, phospholipase D, protease, pullulanase, pectin esterase, triacylglycerol lipase, xylanase, β-xylosidase, or any combination thereof.

[0440] Preferred embodiments 1. An animal feed additive comprising a polypeptide, said polypeptide having alkaline phosphatase activity, selected from the group consisting of: (a) With SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ IDNO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ IDNO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ IDNO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, and SEQ ID NO:106 is a polypeptide with at least 70% sequence identity.

[0441] (b) A polypeptide that has at least 70% sequence identity with the mature polypeptide of (a); (c) A polypeptide encoded by a polynucleotide that has at least 70% sequence identity with the mature polypeptide encoding sequence of the polypeptide of (a) or (b); (d) A polypeptide derived from a polypeptide of (a) or (c) or a mature polypeptide of (b) by substitution, deletion or addition of 1 to 120 amino acids, such as 1 to 100, 1 to 80, 1 to 60 or 1 to 40 amino acids. (e) A polypeptide derived from (a), (b), (c), or (d), wherein the N-terminus and / or C-terminus have been extended by adding 1 to 50 amino acids, such as 1 to 40, 1 to 30, or 1 to 20 amino acids; and (f) Fragments of the polypeptides described in (a), (b), (c), (d) or (e); The polypeptides in (a), (b), (c), (d), or (e) or the fragment in (f) have alkaline phosphatase activity.

[0442] 2. An animal feed additive comprising a polypeptide having alkaline phosphatase activity as described in paragraph 1, wherein the polypeptide has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with polypeptides selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 ... NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46. ​​SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO:58. SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, and SEQ ID NO:106.

[0443] 3. An animal feed additive according to any one of paragraphs 1 or 2, wherein the polypeptide is gastric stable or pepsin stable.

[0444] 4. The animal feed additive according to any one of paragraphs 1 to 3, wherein the polypeptide has a relative activity greater than that of calf intestinal alkaline phosphatase.

[0445] 5. An animal feed additive according to any one of paragraphs 1 to 4, wherein the polypeptide is heat-stable, such that the polypeptide has a Tm of at least 70°C at a pH of 7.

[0446] 6. The animal feed additive according to any one of paragraphs 1 to 5, wherein the polypeptide has an activity at a pH of 7, 8, 9, 10 or 11, preferably at a pH of 7, 8 or 9, more preferably at pH 7, at an activity at least equal to that of calf intestinal alkaline phosphatase.

[0447] 7. The animal feed additives according to paragraphs 1 to 6, which are, as an aqueous solution containing a polypeptide as defined in any one of paragraphs 1 or 2, or as a suspension containing a polypeptide as defined in any one of paragraphs 1 or 2, or as particles containing a polypeptide as defined in any one of paragraphs 1 or 2.

[0448] 8. The animal feed additive according to paragraphs 1 to 6, further comprising: At least one fat-soluble vitamin, and / or At least one water-soluble vitamin, and / or At least one trace mineral.

[0449] 9. A method for increasing the weight gain of an animal, the method comprising feeding the animal an animal feed additive as described in paragraphs 1 to 8.

[0450] 10. A method for improving the food conversion rate of an animal, the method comprising feeding the animal an animal feed additive as described in paragraphs 1 to 8.

[0451] 11. A method for detoxifying lipopolysaccharides in animals, the method comprising feeding the animals animal feed additives as described in paragraphs 1 to 8.

[0452] 12. A method for reducing an immune response in an animal, the method comprising feeding the animal an animal feed additive as described in paragraphs 1 to 8.

[0453] 13. A method for reducing inflammation in an animal, the method comprising feeding the animal an animal feed additive as described in paragraphs 1 to 8.

[0454] 14. A method for mitigating IL or TNF response in an animal, the method comprising feeding the animal an animal feed additive as described in paragraphs 1 to 8.

[0455] 15. A method for maintaining or supporting gut health in animals, or improving gut health to promote the growth of symbiotic bacteria, the method comprising feeding said animal feed additives as described in paragraphs 1 to 8.

[0456] 16. A method for maintaining an effective intestinal barrier, the method comprising feeding the animal an animal feed additive as described in paragraphs 1 to 8.

[0457] 17. A method for preventing colitis or inflammation of the colonic wall in an animal, the method comprising feeding the animal an animal feed additive as described in paragraphs 1 to 8.

[0458] 18. A method for preventing low birth weight, such as low birth weight induced by perinatal malnutrition, the method comprising feeding said animal an animal feed additives as described in paragraphs 1 to 8.

[0459] 19. A method for improving weight gain in animals with below-average birth weight, the method comprising feeding said animals animal feed additives as described in paragraphs 1 to 8.

[0460] 20. A method for regulating fat absorption or neutralizing acidic digestate entering the small intestine by stimulating bicarbonate secretion and surface pH regulation, the method comprising feeding the animal an animal feed additive as described in paragraphs 1 to 8.

[0461] 21. A method for preventing infection from Salmonella or Clostridium species (such as Salmonella typhimurium). S. Typhimurium A method for treating antibiotic-associated infections of *Clostridium difficile* and / or *Clostridium difficile*, the method comprising feeding the animal feed additives as described in paragraphs 1 to 8.

[0462] 22. One aspect of the invention relates to a method for preventing weight loss in infected animals, the method comprising feeding said animals animal feed additives as described in paragraphs 1 to 8.

[0463] 23. A method for maintaining or restoring (healthy) gut microbiota in animals treated with antibiotics, the method comprising feeding said animal a polypeptide as defined in any one of paragraphs 1 to 10, a composition according to any one of paragraphs 11 to 13, or an animal feed additive as described in the paragraphs. 24. A method for preventing or reducing intestinal colonization or systemic translocation of harmful bacteria, or for "dysbiosis," i.e., for altering the bacterial and / or archaea balance of the intestinal microecology, the method comprising feeding the animal with animal feed additives as described in paragraphs 1 to 8.

[0464] 25. A particle comprising: (a) Contains a core of a polypeptide as defined by any one of paragraphs 1 through 7, and optionally, (b) A coating consisting of one or more layers surrounding the core.

[0465] 26. A particle comprising: (a) core, and (b) A coating consisting of one or more layers surrounding the core, wherein the coating contains a polypeptide as defined in any of paragraphs 1 to 7.

[0466] 27. A liquid composition comprising a polypeptide as defined in any one of paragraphs 1-7, and an enzyme stabilizer, such as a polyol like propylene glycol or glycerol, a sugar or sugar alcohol, lactic acid, a reversible protease inhibitor, boric acid or a boric acid derivative, such as an aromatic borate ester or a phenyl boric acid derivative like 4-formylphenylboronic acid.

[0467] The invention is further described by the following examples, which should not be construed as limiting the scope of the invention.

[0468] Example Example 1: Cloning, expression, and fermentation of fungal ALP Materials and Methods strain The expression vector used in this study was propagated using Escherichia coli Top-10 strain purchased from TIANGEN (TIANGEN Biotech Co. Ltd., Beijing, China).

[0469] Aspergillus oryzae ( Aspergillus oryzae The strain MT3568 (described in WO 2015040159) was used for heterologous expression of the genes described in Table 6.

[0470] Aspergillus oryzae strain DAU785 (described in WO 2018 / 113745) was used for heterologous expression of the genes described in Table 7.

[0471] culture medium Dap4C medium consists of the following: 11 g MgSO4·7H2O, 1 g KH2PO4, 2.2 g citric acid·H2O, 20 g glucose, 10 g maltose, 5.2 g K3PO4·H2O, 0.5 g yeast extract, 1.25 g CaCO3, 0.5 ml AMG trace element solution, and deionized water to a final volume of 1 liter. After autoclaving, add 3.3 ml of 20% lactic acid (autoclaved) and 9.3 ml of 50% (NH4)2HPO4 (sterilely filtered) to every 400 ml of the above medium. The AMG trace element solution consists of the following: 6.8 g ZnCl2, 2.5 g CuSO4·5H2O, 0.24 g NiCl2·5H2O, 13.9 g FeSO4·7H2O, 13.6 g MnSO4·5H2O, 3 g citric acid·H2O, and deionized water to a final volume of 1000 ml.

[0472] LB plates consist of: 10 g of bacterial tryptone, 5 g of yeast extract, 5 g of sodium chloride, 15 g of bacterial agar, and 1000 ml of deionized water. LB medium consists of: 10 g of bacterial tryptone, 5 g of yeast extract, 5 g of sodium chloride, and 1000 ml of deionized water. COVE sucrose plates consist of: 342 g of sucrose, 20 g of agar powder, 20 ml of COVE salt solution, and 1 liter of deionized water. The medium is autoclaved at 15 psi for 15 minutes. For transformation of MT3568, 10 mM acetamide is added when the medium cools to 60°C. For transformation of Dau785, simply add 10 ml of 1 M NaNO3 instead of acetamide. The top agar consisted of 6 g SeaKem GTG agarose, 20 ml COVE salt solution, and 342 g sucrose, with the final volume brought to 1 L using ddH2O. After autoclaving, 10 ml of 1M acetamide was added for conversion selection of MT3568, or 10 ml of 1M NaNO3 was added for conversion selection of Dau785.

[0473] The COVE-2 plate / tube for separation consists of: 30 g / L sucrose, 20 ml / L COVE salt solution, 10 mM acetamide (for conversion of MT3568) or 10 mM NaNO3 (for conversion of Dau785), and 30 g / L noble agar (Difco, catalog number 214220). The COVE salt solution is composed of: 26 g MgSO4·7H2O, 26 g KCl, 76 g KH2PO4, 50 ml COVE trace metal solution, and topping up to 1000 ml of deionized water. The COVE trace metal solution consists of the following: 0.04 g Na₂B₄O₇·10H₂O, 0.4 g CuSO₄·5H₂O, 0.8 g FeSO₄·7H₂O, 0.8 g MnSO₄·H₂O, 0.8 g Na₂MoO₄·2H₂O, 8 g ZnSO₄·7H₂O, and deionized water to a final volume of 1000 ml.

[0474] The alkaline phosphatase (ALP) gene was derived from fungal strains isolated from environmental samples using standard microbial isolation techniques. The strains were identified, and DNA sequencing based on the ITS was used to assign classification (Tables 6 and 7).

[0475] Table 6: Table 7: via DNeasy ® Chromosomal DNA from various strains was isolated using a plant extraction kit (Qiagen, Hilden, Germany) (Tables 6 and 7). 5 µg of chromosomal DNA was sent for whole-genome sequencing using Illumina technology. Genome sequencing, subsequent read assembly, and gene discovery (i.e., gene function annotation) are known to those skilled in the art and this service is commercially available. The putative ALP genome sequence from the PFAM database family PF00245 was analyzed. This analysis identified genes encoding the putative ALP, which were subsequently cloned and recombinantly expressed in *Aspergillus oryzae*.

[0476] The ALP gene was amplified from the isolated genomic DNA by PCR. Purified PCR products were cloned into previously digested pCaHj505 (for genes listed in Table 1) or pDAU724 (for genes listed in Example 2) using the IN-FUSION™ CF Dehydrated Cloning Kit (Clontech Laboratories, Inc., Mountain View, California, USA), according to the manufacturer's instructions. The ligation mixture was used to transform *E. coli* TOP10 chemocompetent cells (described in *Strains*). Colonies containing the corresponding ALP gene were selected and verified by DNA sequencing (performed by SinoGenoMax Company Limited, Beijing, China). Colonies containing the correct ALP were cultured overnight in 3 ml of LB medium supplemented with 100 µg ampicillin per ml. Purify plasmid DNA using the SpinMiniprep kit (catalog 27106) from QIAGEN GmbH, Hilden, Germany, according to the manufacturer’s instructions.

[0477] Protoplasts of *Aspergillus oryzae* MT3568 were prepared according to WO 95 / 002043. Protoplasts of *Aspergillus oryzae* DAU785 were prepared according to WO2018 / 113745. 100 µl of protoplasts were mixed with 2.5–10 µg of the *Aspergillus* expression vector containing the ALP gene (the extracted plasmid described above) and 250 µl of 60% PEG 4000, 10 mM CaCl2, and 10 mM Tris-HCl (pH 7.5), and gently mixed. The mixture was incubated at 37°C for 30 minutes, and the protoplasts were plated onto COVE sucrose plates for selection. After incubation at 37°C for 4–7 days, spores from four transformants were inoculated into 3 ml of Dap4C medium.

[0478] After 3 days of incubation at 30°C, the culture medium was analyzed by SDS-PAGE using Novex® 4%–20% Tris-glycine gel (Invitrogen Corporation, Carlsbad, California, USA) to identify the transformants that produced the largest amount of recombinant ALP with their respective estimated mature peptide sizes. Based on these two selection criteria, spores from the best-expressing transformants were plated onto COVE-2 plates for re-isolation to isolate single colonies. Single colonies were then plated onto COVE-2 tubes until spore formation. Spores from the best-expressing transformants were cultured in 1600–2400 ml of Dap4C medium in shake flasks over 3 days at 30°C with stirring at 80 rpm. The culture was harvested by filtration using a 0.22 µm filter. The filtered fermentation broth was used for enzyme characterization.

[0479] Example 2: Cloning and expression of bacterial alkaline phosphatase peptides Examples of peptides containing bacterial alkaline phosphatase identified from bacterial strains or metagenomic samples that have undergone whole-genome next-generation sequencing or from public databases (Table 9), annotated with the IPR001952 domain as defined in the InterPro database (Blum et al., 2021; Nucleic Acids Research, D344-D354).

[0480] Table 9: The DNA coding sequence of the mature peptide of alkaline phosphatase was ordered as a synthetic gene from Twist Bioscience. The synthesized DNA fragment was directionally assembled into a Bacillus expression vector as described in WO 12 / 025577 using the standard Golden Gate cloning method with BsaI and T4 DNA ligases. In short, the DNA frame encoding the mature peptide of the gene was cloned into the Bacillus clauri secretory signal (BcSP; having the following amino acid sequence: MKKPLGKIVASTALLISVAFSSSIASA (SEQ ID NO: E)). BcSP replaces the native secretory signal in this gene. Downstream of the BcSP sequence, an affinity tag sequence is introduced to facilitate the purification process (His tag; having the following amino acid sequence: HHHHHHPR (SEQ ID NO: F). Therefore, the expressed gene comprises the BcSP sequence, followed by the His-tag sequence, and then the mature wild-type alkaline phosphatase gene sequence. The final expression plasmid (BcSP-His-tag-alkaline phosphatase) is transformed into a Bacillus subtilis expression host. During transformation, the alkaline phosphatase BcSP-fusion gene is integrated into the Bacillus subtilis host cell genome via homologous recombination. The gene construct is expressed under the control of a triple promoter system (as described in WO99 / 43835). The gene encoding chloramphenicol acetyltransferase is used as a marker (e.g., Diderichsen et al., 1993, ). Plasmid [Plasmids] 30: 312-315 (as described in the original text). Transformants were selected on LB agar supplemented with 6 mg chloramphenicol per ml. A recombinant Bacillus subtilis clone containing the alkaline phosphatase expression construct was selected and cultured on a rotary shaker in 500 ml baffled Erlenmeyer flasks, each containing 100 ml of yeast extract-based medium. After a 3-day culture period at 30°C, the supernatant containing the enzymes was harvested by centrifugation, and the enzymes were purified using His-tag purification.

[0481] Example 3: Cloning and Expression of Fungal ALP sequence SEQ ID NO:17 from Trichoderma citrinum SEQ ID NO: 18 from *Polytrichum stenoptera* SEQ ID NO: 19 Half-open morel mushroom Cloning and expression of Trichoderma citrinum SEQ ID NO:17 strain The *E. coli* Top-10 strain purchased from Life Technologies (Carlsbad, California, USA) was used to propagate the expression vector encoding the alkaline phosphatase peptide. The *Aspergillus oryzae* strain MT3568 was used for heterologous expression of the alkaline phosphatase peptide coding sequence. *Aspergillus oryzae* MT3568 is a derivative of *Aspergillus oryzae* JaL355. amdS (Acetamipridase) disrupted gene derivatives (WO 2002 / 40694), in which Aspergillus oryzae acetamonamipridase is disrupted by the pyrG gene. amdS Genes to restore pyrG Nutritional deficiency type.

[0482] culture medium The DAP4C-1 medium consists of the following: 0.5 g yeast extract, 15 g maltodextrin, 15 g glucose, 11 g magnesium sulfate heptahydrate, 1 g dipotassium hydrogen phosphate, 2 g citric acid monohydrate, 5.2 g potassium phosphate ternary monohydrate, 1 mL Dowfax 63N10 (antifoaming agent), 2.5 g calcium carbonate, supplemented with 1 mL KU6 metal solution and brought to a total of 1000 mL deionized water.

[0483] The KU6 metal solution consists of the following: 6.8 g ZnCl2, 2.5 g CuSO4·5H2O, 0.13 g NiCl2, 13.9 g FeSO4·7H2O, 8.45 g MnSO4·H2O, 3 g C6H8O7·H2O, and deionized water to a final volume of 1000 mL.

[0484] YP 2% glucose medium consists of the following: 10 g yeast extract, 20 g bacterial peptone, 20 g glucose, and deionized water to a final volume of 1000 mL.

[0485] LB plates consist of: 10 g of bacterial tryptone, 5 g of yeast extract, 10 g of sodium chloride, 15 g of bacterial agar, and deionized water to a final volume of 1000 mL. LB medium consists of: 10 g of bacterial tryptone, 5 g of yeast extract, 10 g of sodium chloride, and deionized water to a final volume of 1000 mL. COVE-sucrose-T plates consist of: 342 g of sucrose, 20 g of agar powder, 20 mL of COVE salt solution, and deionized water to a final volume of 1000 mL. The medium was sterilized by autoclaving at 15 psi for 15 minutes (Bacteriological Analytical Manual, 8th Edition, Revision A, 1998). The medium was cooled to 60°C and 10 mM acetamide and Triton X-100 (50 µL / 500 mL) were added. The COVE-N-agar tube consists of the following: 218 g sorbitol, 10 g dextrose, 2.02 g KNO3, 25 g agar, 50 mL Cove salt solution, and topped with deionized water to 1000 mL. The COVE salt solution consists of the following: 26 g MgSO4·7H2O, 26 g KCl, 26 g KH2PO4, 50 mL COVE trace metal solution, and topped with deionized water to 1000 mL. The COVE trace metal solution consists of the following: 0.04 g Na2B4O7·10H2O, 0.4 g CuSO4·5H2O, 1.2 g FeSO4·7H2O, 0.7 g MnSO4·H2O, 0.8 g Na2MoO4·2H2O, 10 g ZnSO4·7H2O, and topped with deionized water to 1000 mL.

[0486] The polypeptide coding sequence of SEQ ID NO:17 was cloned from *Trichoderma viride* DNA by PCR. *Trichoderma viride* was cultured for 5 days in 100 ml YP + 2% glucose medium in 1000 ml conical shake flasks at 20°C. Mycelia were harvested from these flasks by filtering the medium through a Buchner vacuum funnel lined with MIRACLOTH® (EMD Millipore, Billerica, MA, USA). The mycelia were frozen in liquid nitrogen and stored at -80°C until further use. Genomic DNA was isolated using the DNEASY® Plant Maxi Kit (Kiager GmbH, Hilden, Germany) according to the manufacturer's instructions.

[0487] Genome sequencing information was generated using Illumina MySeq (Illumina Inc., San Diego, CA). 5 µg of isolated *Trichoderma viride* genomic DNA was used for library preparation and analysis according to the manufacturer's instructions. A 300 bp pairing end strategy was employed, resulting in library insert sizes of 200–500 bp. These reads were then fractionated into 25% segments and subsequently corrected (extracting the longest subsequences with 10 or more Phred scores). These reads were assembled using Idba version 0.18. Contigs shorter than 200 bp were discarded. The gene was invoked using GeneMark.hmm ES version 2.3c, and the catalytic domain was identified using the "Alk_Phosphatase PF00245" Hidden Markov Model provided by Pfam. The entire coding region of the polypeptide sequence was cloned from the *Trichoderma viride* genomic DNA by PCR using primers described below (SEQ ID NO: A and SEQ ID NO: B).

[0488] 5'-ACACAACTGG GGATCC ACCATGATTGCCAAGCTCGGA-3' (SEQ ID NO: A) 5'-AGATCTCGAG AAGCTT ACTAGTAGCTCTCCTTGCC-3' (SEQ ID NO: B) Bold letters indicate the coding sequence for Trichoderma viride. Restriction sites are underlined. The sequence to the left of the restriction site is homologous to the insertion site of pDau109 (WO 2005 / 042735).

[0489] In-Fusion™ Superior PCR Cloning Kit, Catalog No. 639620 According to the manufacturer's instructions (Thermo Scientific), perform the amplification reaction at the following final concentration (50 µl): 1X Phusion HC buffer 200 uM dNTP 2.0 mM MgCl2 0.5 μM of each primer in SEQ ID NO: 3 + 4 10 ng of Trichoderma citrinum genomic DNA.

[0490] The PCR reaction was incubated in a DYAD® Dual-Block Thermal Cycler (BioRad, USA) programmed as follows: one cycle at 98°C for 30 seconds; 30 cycles, each consisting of 10 seconds at 98°C, 20 seconds at 57°C, and 2 minutes at 72°C, followed by one cycle at 72°C for 5 minutes. The samples were cooled to 10°C before removal and further processing.

[0491] The PCR reaction was analyzed by 1% agarose gel electrophoresis using 40 mM Tris base, 20 mM sodium acetate, and 1 mM disodium EDTA (TAE) buffer. A main band of approximately 2.3 kb was observed. The remaining PCR reaction was purified directly using the ILLUSTRA™ GFX™ PCR DNA and Gel Strip Purification Kit (GE Healthcare, Piscataway, NJ, USA) according to the manufacturer's instructions.

[0492] 2 µg of plasmid pDau109 was digested with Bam HI and Hind III, and the digested plasmid was run on a 1% agarose gel using 50 mM Tris base-50 mM borate-1 mM disodium EDTA (TBE) buffer to remove filler fragments from the restriction plasmid. The bands were visualized by adding SYBR® Safe DNA gel stain (Lifetechnologies, Grand Island, NY, USA) and using a 470 nm transilluminator. The band corresponding to the restriction plasmid was excised and purified using the ILLUSTRA™ GFX™ PCR DNA and Gel Band Purification Kit. The plasmid was eluted to 10 mM Tris at pH 8.0 and its concentration was adjusted to 20 ng / µl. The 2.3 kb PCR fragment was cloned into pDau109 cells digested with Bam HI and Hind III (20 ng) using the IN-FUSION® PCR Cloning Kit (Clottec Laboratories, Inc., Mountain View, California, USA). The total IN-FUSION® reaction volume was 10 µl. The IN-FUSION® reaction was transformed into FUSION-BLUE™ E. coli cells (Clottec Laboratories, Inc., Mountain View, California, USA) according to the manufacturer's protocol and plated on LB agar plates supplemented with 50 µg ampicillin / ml. After overnight incubation at 37°C, transformed colonies were observed to grow under selection on these LB plates supplemented with 50 µg ampicillin / ml.

[0493] Selected colonies were used for analysis by colony PCR using the pDau222 and pDau109 vector primers described below. Four colonies were transferred from an LB plate supplemented with 50 µg ampicillin / ml to a new LB plate supplemented with 50 µg ampicillin / ml using a yellow inoculation needle (Nunc A / S, Denmark) and incubated overnight at 37°C.

[0494] Primer 8653: 5'-GCAAGGGATGCCATGCTTGG-3' (SEQ ID NO: C) Primer 8654: 5'-CATATAACCAATTGCCCTC-3' (SEQ ID NO: D) Each of the three colonies was directly transferred to a 200 µl PCR tube consisting of: 5 µl of 2X Thermo Scientific Dream Taq™ PCR Master Mix (Thermo Fisher Scientific, Rockford, Illinois, USA), 0.5 µl of primer 8653 (10 pm / µl), 0.5 µl of primer 8654 (10 pm / µl), and 4 µl of deionized water. Each colony PCR was incubated in a DYAD® dual-block thermal cycler programmed as follows: 1 cycle at 94°C for 60 seconds; 30 cycles, each at 95°C for 30 seconds, 60°C for 45 seconds, 72°C for 120 seconds, 68°C for 10 minutes, and 10°C for 10 minutes.

[0495] Four µl of each completed PCR reaction was submitted to a 1% agarose gel for electrophoresis using TAE buffer. All four *E. coli* transformants showed PCR bands of approximately 2.3 kb. Plasmid DNA was isolated from each of the four colonies using the QIAprep Spin Miniprep Kit (Qiager, Hilden, Germany). The resulting plasmid DNA was sequenced using an Applied Biosystems Model 3730 automated DNA sequencer with BIG-DYE™ Terminator Chemistry version 3.1 (Applied Biosystems, Inc., Foster City, California, USA) with primers 8653 and 8654.

[0496] This plasmid was selected for transformation of Aspergillus oryzae MT3568. Aspergillus oryzae MT3568 is a variant of Aspergillus oryzae JaL355. amdS (Acetamipridase)-destroyed gene derivative (WO 2002 / 40694), which in turn inactivates Aspergillus oryzae amdS Genes to repair pyrG Auxotrophic form. Protoplasts of Aspergillus oryzae MT3568 were prepared according to the method described on pages 14-15 of European Patent EP 0238023.

[0497] Following the manufacturer's instructions (Genomed), *E. coli* 190 containing the plasmid was grown overnight, and plasmid DNA was isolated using the Plasmid Midi Kit (Genomed JETquick Kit, catalog number 400250, GENOMED GmbH, Germany) according to the manufacturer's instructions. The purified plasmid DNA was transformed into *Aspergillus oryzae* MT3568. *Aspergillus oryzae* MT3568 protoplasts were prepared according to the method described in Christensen et al., 1988, *Bio / Technology 6*: 1419-1422. Selective plates consisted of: sucrose COVE with +10 mM acetamide +15 mM sCl + TRITON® X-100 (50 µl / 500 ml). These plates were incubated at 37°C. Briefly, 8 µl of plasmid DNA, representing 3 µg of DNA, was added to 100 µl of MT3568 protoplasts. Add 250 μL of 60% PEG solution and gently mix the tubes, incubating at 37°C for 30 minutes. Add the mixture to 10 mL of pre-melted Cove top agarose (which was melted and equilibrated to 40°C in a hot water bath before being added to the protoplast mixture). Spread the combined mixture onto two Cove-sucrose-selective Petri plates containing 10 mM acetamide. Incubate the plates at 37°C for 4 days. Identify individual Aspergillus transformants by growth on selective acetamide as a carbon source. Inoculate each of the four Aspergillus oryzae transformants into 750 µL of YP medium supplemented with 2% glucose, 750 µL of YP medium supplemented with 2% maltodextrin, and 750 µL of YP medium supplemented with DAP4C in 96-well plates and incubate statically at 37°C for 4 days. Simultaneously, scratch the four transformants onto COVE-2 sucrose agar.

[0498] Then, according to the manufacturer, the cultures from *Aspergillus oryzae* transformants were analyzed by SDS-PAGE targeting the production of the P63TNK ALP peptide using NUPAGE® 10% Bis-Tris SDS gel (Ingenieur, Carlsbad, California, USA). For each of these *Aspergillus oryzae* transformants, a single band at approximately 90 kDa was observed. Bands larger than the predicted size of 69 kDa were most likely due to glycosylation. One *Aspergillus oryzae* transformant that produced SEQ ID NO:17 was designated as *Aspergillus oryzae* EXP08508. *Aspergillus oryzae* EXP13030 was cultured at 30°C for 3 days in a 1000 ml Erlenmeyer flask containing 100 ml of DAP4C medium with stirring at 150 rpm.

[0499] The cloning and expression of SEQ ID NO:18 from *Polytrichum truncatedis* and SEQ ID NO:18 from *Morchella spp.* were precisely performed in the above description, as follows: Primers used for PCR amplification of the insert fragment: SEQ ID NO:18 ACACAACTGG GGATCC ACCATGTTCAGCCGACTAGCC AGATCTCGAG AAGCTT ACTATTTCTGGCAAGATCCAC Size of the generated PCR fragment: 2.2 kb Aspergillus recombinant protein size: 70.5 kDa, observed: approximately 85 kDa SEQ ID NO:19 ACACAACTGG GGATCC ACCATGAACGTCAACAGCCTG AGATCTCGAG AAGCTT ATTAGTGATGGAAGTGAGTAAGA Size of the generated PCR fragment: 1.8 kb Recombinant Aspergillus protein size: 53.3 kDa, observed: approximately 55 kDa.

[0500] Example 4: Purification of alkaline phosphatase Typically, the purification process of alkaline phosphatase (ALP) from the culture medium is first applied using hydrophobic interaction chromatography on an AKTA chromatography system (Cytiva), followed by ion exchange chromatography if necessary. The differences among all molecules lie in the buffer type, pH, and salt concentration.

[0501] The conductivity of the culture supernatant containing recombinant ALP was adjusted to approximately 190 mS / cm by adding ammonium sulfate. The culture was then loaded onto a phenyl agarose high-performance column (Stenofan, 17108203) equilibrated with 20 mM Tris-HCl at pH 7.0 containing 2.0 M ammonium sulfate. Elution conditions were set with a gradient of decreasing ammonium sulfate concentration from 2.0 M to 0. The elution fraction and the passing fraction were determined by SDS-PAGE. ALP activity was determined as described below.

[0502] Further purification was performed using ion-exchange chromatography. Fractions with ALP activity were combined and dialyzed against 20 mM Tris-HCl at pH 8.0, then loaded onto a MonoQ HR16 / 10 (Stenova, 17050601) or CaptoQ column (Stenova, 17547003) equilibrated with 20 mM Tris-HCl at pH 8.0. An elution process was performed using a gradient of NaCl concentration from 0 to 1 M (using 20 mM Tris-HCl (pH 8.0)). SDS-PAGE and ALP activity determination were performed on both the eluted and flushed fractions.

[0503] Finally, the fractions with enzyme activity were combined and then percolated with 20 mM PBS (pH 7.0). (Used via Qubit) TM Protein assay kit (Ingenieur, Q33212) is used to determine protein concentration.

[0504] Example 5: His-tagged purification method On a 5 mL HisTrap Excel column (GE Healthcare LifeSciences), using Ni 2+ His-labeled alkaline phosphatase was purified as a metal ion using immobilized metal chromatography (IMAC). The purification was performed at pH 7, with imidazole used to elute the binding protein. The purity of the purified enzyme was examined by SDS-PAGE, and the enzyme concentration was determined by absorbance at 280 nm after buffer exchange in 50 mM HEPES and 100 mM NaCl (pH 7.0). refer to:" The InterPro protein families and domains database: 20 years on [InterPro Protein Family and Domain Database: A 20-Year Retrospective] .Blum M1, Chang HY1, ChuguranskyS1, Grego T1, Kandasaamy S1, Mitchell A1, Nuka G1, Paysan-Lafosse T1, QureshiM1, Raj S1, Richardson L1, Salazar GA1, Williams L1, Bork P2, Bridge A3,Gough J4, Haft DH5, Letunic I6, Marchler-Bauer A5, Mi H7, Natale DA8, NecciM9, Orengo CA10, Pandurangan AP4, Rivoire C3, Sigrist CJA3, Sillitoe I10,Thanki N5, Thomas PD7, Tosatto SCE9, Wu CH8, Bateman A1, Finn RD1. NucleicAcids Research [Nucleic Acids Research], January 1, 2021, 49(D1):D344-D354 Example 6: Identification of Stable Variants Stable variants of SEQ ID 11 and SEQ ID NO: 61 to SEQ ID NO: 85 were identified by site saturation. The library was screened as described below. After identifying the modified substitutions, the modified substitution combinations were transformed into Bacillus subtilis using SOE PCR, and the resulting variants were screened in the same assay to identify stable combined variants.

[0505] Culture of variants used for assay The variant was seeded in 2.2 mL deep-well plates containing 600 µL of CAL18 medium and grown at 37 °C and 700 RPM for 2 days. The cells were centrifuged and the supernatant was used for assays.

[0506] Variant screening for identifying stable variants In this example, the variant was stressed at pH 4.0. This was used to identify stabilizing substitutions. To identify stabilizing combinations and rank the highest hits, the pH was lowered to pH 3.4, pH 3.2, and pH 3.0. The supernatant sample was aliquoted into two portions, designated “stressed” and “unstressed”. 8 µL of the stressed sample was diluted in 70 µL of pH 4.0 buffer (660 ml 1M citric acid + 340 ml 1M sodium citrate). 8 µL of the unstressed sample was diluted in 255 µL of pH 8.0 buffer (200 mM Tris pH 8, 0.1 mM CaCl2, 10 µM ZnCl2, 5 µM MgCl2, 0.01% Tween). Both samples were incubated at room temperature with shaking for 60 minutes. After incubation, the stressed sample was diluted as follows: 78 µL of the stressed sample was first added to 185 µL of pH 8 buffer, and then 35 µL was diluted from there to 175 mL of pH 8 buffer. The unstressed sample was similarly diluted by adding 35 µL to 175 µL of pH 8.0 buffer. After mixing, readings were performed by adding 10 µL of the diluted sample (stressed or unstressed) to a 385-well plate. Then, 40 µL of pNP-disodium phosphate hexahydrate (CAS 333338-18-4) at 2 mg / mL in 100 mM Tris pH 8.0, 0.01% tween, and 0.1 mM CaCl2 was added to each well, and the plate was immediately placed in the reader for data collection. A BioTek Neo2 plate reader was used. Absorbance was measured at 405 nm after 30 minutes, and the activity of each well was determined by the maximum slope of the kinetic curve. Hit is a variant that exhibits higher residual activity (activity of the stressed sample divided by the activity of the unstressed sample) than the reference and no less than the reference unstressed activation.

[0507] Example 7: Activity assay for determining the relative specific activity of alkaline phosphatase Alkaline phosphatase (ALP) candidates (0, 4–8 µg / ml) were incubated in assay solution (AS) at 38 °C for 15 min. Following incubation, the ALP candidate was serially diluted 10 times in 2-fold steps, and p-nitrophenyl phosphate substrate was added to a final concentration of 50.0 µg / ml. After 60 min at 40 °C, absorbance was measured at 405 nm to track the wavelength at which p-nitrophenyl phosphate is enzymatically catalyzed to p-nitrophenol by ALP. Pepsin was added to the assay solution to ensure uniform background during absorbance measurements, allowing for comparison with results from activity assays to determine residual ALP activity after gastric stimulation.

[0508] Data Analysis The background-corrected absorbance values ​​(Abscorr405Abs405corr) were plotted as a function of the logarithm of the enzyme concentration. Enz [, expressed as a percentage]. The logarithmic Hill formula (Equation 1) describes the data using 4-parameters: in a Describe the growth rate, IP Describe the inflection point. c Describe the asymptotes, and d Describe the asymptote. Use the following equation to find the inflection point obtained from Equation 1 ( IP )calculate EC 50 (µgEP / ml) value: Equation 2 here, c Max (in µg EP / ml) describes the highest enzyme concentration used in the assay. Using Equation 3, the concentration of a given ALP candidate was... EC 50 The value relative to alkaline phosphatase CIAP EC 50 Calculate relative specific activity ( Rel. spec act (in percentage): Example 8: Activity assay for determining the residual activity of alkaline phosphatase after gastric challenge (ALP gastric conditioned stress assay) Purpose of measurement This protocol describes an assay for determining the stability of wild-type and variant alkaline phosphatase (ALP) enzymes under gastric stress conditions. Gastric conditioned stress was defined as exposure to pepsin at pH 3 and 40°C for 15 min. ALP stability was evaluated by measuring ALP activity before and after stress exposure. Results are given as percentage of residual activity (%RA), defined as the activity of a given sample after stress relative to the unstressed activity of the same sample; pre-stress activity was defined as 100%.

[0509] Measurement scheme Each enzyme sample was diluted to a concentration of 2.4 ppm in Milli-Q water and 0.01 vol% Triton X-100. Each sample was divided into three distinct aliquots and each aliquot was diluted to 1.2 ppm in universal stress buffers (100 mM acetic acid, 100 mM MES, 100 mM HEPES, 100 mM glycine, 1 mM MgCl2, 1 mM CaCl2, 1 mM ZnCl2) at pH 8 and pH 3+ pepsin (550 U / mL), for a total volume of 100 µL. The samples were heated in a PCR incubator at 40 °C for 15 min. Following heat exposure, the activity of all three samples was measured by mixing 30 µL of the heat-treated sample with 170 µL of activity assay solution (1 mM 4-nitrophenyl phosphate disodium hexahydrate (CAS: 333338-18-4) in 100 mM acetic acid, 100 mM MES, 100 mM HEPES, and 100 mM glycine (pH 8)). Absorbance changes at 405 nm were read immediately for 30 min.

[0510] Material Test solution (AS, pH 8) 500 U / ml pepsin 1.17 - 1.53 mM HCl 10 mM Tris (5.8 mM base, 4.2 mM acid) 100 mM NaCl 0.01% (w / v) Tween 20 Deionized water, microfiltration Artificial gastric juice (AGJ, pH 3) 550 U / ml pepsin 1.3 - 1.7 mM HCl 100 mM NaCl 0.01% (w / v) Tween 20 Deionized water, microfiltration Neutralization buffer (pH 8) 100 mM Tris 100 mM NaCl 0.01% (w / v) Tween 20 Deionized water, microfiltration Alkaline phosphatase candidates (0, 4–8 µg / ml) were incubated in artificial gastric fluid (AGJ) at 38 °C for 15 min to simulate gastric challenge. After incubation, the pH was adjusted to pH 8 with neutralization buffer. The alkaline phosphatase candidates were serially diluted 10 times in 2-fold steps, and the substrate p-nitrophenyl phosphate was added to a final concentration of 50.0 µg / ml. After 60 min at 40 °C, absorbance was measured at 405 nm to track the wavelength at which p-nitrophenyl phosphate was enzymatically catalyzed to p-nitrophenol by alkaline phosphatase.

[0511] Data Analysis The background-corrected absorbance values ​​were plotted as a function of the logarithm of the enzyme concentration (in %). The data were described using a 4-parameter log-Hill formula (see: Equation 1). Using Equation 2, the inflection point obtained from Equation 1 ( IP )calculate EC 50 (µgEP / ml) value. The residual activity (%) of ALP after gastric challenge was determined using Equation 4. in ALP was obtained after incubating in AGJ for 15 minutes. EC 50 ,and ALP was obtained after incubation in AS for 15 minutes. EC 50 .

[0512] Data Analysis Determine the initial rate (OD / min) for each sample and use the initial rate of the sample dissolved at pH 8 as an exponent to calculate the percentage of residual activity (%RA) at 100%.

[0513] Residual activity of the samples was assessed after 15 min of stress at 40°C, at different pH levels, and with / without pepsin. Wild-type SEQ ID NO:50 and SEQ ID NO:11 showed no activity after treatment with high gastric stress. However, the prior art variant SEQ ID NO:107 (with a C-terminal histidine or when concentrated and HEAL1115_Ct_His) retained some of its activity after gastric stress treatment. SEQ ID NO:103 showed comparable activity after gastric stress treatment, but SEQ ID NO:104 showed higher activity (73 OD / min / ppm) and a higher percentage of residual activity (12%) compared to SEQ ID NO:107 (21 OD / min / ppm and 6%, respectively).

[0514] Table 9 Example 9: Determination of phosphatase activity at pH 7.0 75 μL of phosphatase-containing enzyme solution (diluted in MQ water with 0.01% (v / w) Triton X-100) was dispensed into the wells of a microtiter plate (e.g., a NUNC 269620 96-well plate), and 75 μL of substrate was added (to prepare the substrate, two 5 mg p-nitrophenyl phosphate tablets (Sigma-Aldrich, catalog number 20-106) were dissolved in 10 mL of 50 mM Hepes, 100 mM NaCl, 1 mM CaCl2, 1 mM MgCl2, and 1 mM ZnCl2 (pH 7.0)). The plate was sealed and incubated for 15 minutes with shaking at 750 rpm at 37°C. After the incubation period, 75 μL of stop reagent (0.5 M NaOH) was added, and the absorbance at 405 nm was measured using a microtiter plate spectrophotometer. The blank solution (75 μL 0.01% (v / w) Triton X-100 + 75 μL substrate) was incubated for 15 min as described above, followed by the addition of 75 μL of stop reagent, and the absorbance was measured at 405 nm. This value was subtracted from the phosphatase reading. One phosphatase unit is defined as the enzyme activity that releases 1 μmol of phosphate per min under given reaction conditions (buffer blind subtraction). Under the assay conditions, the absorbance of 1 μmol of p-nitrophenol was determined to be 56 AU (AU = absorbance unit).

[0515] Determination of pH curve of phosphatase As described in the "Determination of Phosphatase Activity" section above, pH profiles were established at 37°C over a pH range of 6.0 to 11.0 (in 1.0 pH increments), except that a buffer mixture (100 mM glycine, 100 mM acetic acid, 100 mM MES, and 100 mM Hepes, 1 mM CaCl2, 1 mM MgCl2, and 1 mM ZnCl2, adjusted to the relevant pH) was used instead of the Hepes pH 7.0 buffer. The results are summarized in Table 3. The values ​​given for each pH in the 6.0–11.0 range are the absorbance at 405 nm (A405) divided by the phosphatase concentration in ppm (determined by the A280 of the purified sample and the calculated extinction coefficient of the phosphatase).

[0516] Example 10: Thermal stability (nDSF method) Nanoscale differential scanning fluorometry (nDSF) was used to determine the thermal stability of the alkaline phosphatase of the present invention at different pH values. The purified sample was diluted to 0.4 mg / mL in 250 mM HEPES (4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid), 250 mM glycine, 250 mM acetic acid, and 250 mM MES (2-(N-morpholino)ethanesulfonic acid) (pH 3, pH 4, pH 5, pH 7, pH 9, and pH 11).

[0517] The instrument used for nDSF experiments was a Prometheus NT-Plex with an autosampler from Nanotemper Technologies GmbH, Germany. Samples were loaded into the Prometheus NT-Plex using a capillary chip (PR-AC002). Experiments were conducted between 20°C and 95°C, with a temperature gradient of 3.3°C / min. The melting temperature (Tm value) was obtained using PR-ThermControl software from the peak value of the first derivative derived from the signal trajectory (350 / 330 nm fluorescence ratio or 330 nm fluorescence). The results are listed in Table 4.

[0518] Example 11: Thermal stability (method for determining thermal transition) Protein thermal folding analysis (TSA, thermal transformation assay) The protein thermal folding of alkaline phosphatase peptides was monitored using a real-time PCR instrument (Applied Biosystems; Step-One-Plus) with Sypro Orange (Ingenieur, S-6650). Purified enzyme samples were diluted to 0.8 mg / mL in 100 mM glycine, 100 mM acetic acid, 100 mM MES, and 100 mM HEPES, and adjusted to pH 3.0, 4.0, 5.0, 7.0, 8.0, 9.0, 10.0, and 11.0 with and without 1 mM CaCl2, 1 mM MgCl2, and 1 mM ZnCl2. Next, 15 μl of the enzyme sample diluted in the buffer solution adjusted to the relevant pH was mixed with Sypro Orange (concentration = 10X; stock solution from the supplier = 5000X) in water (1:1).

[0519] The plate was sealed with an optical PCR seal. The PCR instrument was set to a scan rate of 76 °C per hour, starting at 25 °C and completing at 96 °C. Fluorescence was monitored every 20 seconds using an in-built-in LED blue light and a ROX-filter (610 nm, emission) for excitation. Tm values ​​were calculated as the temperature at which the first derivative (dF / dK) reached its maximum (Gregory et al. 2009, J. Biomol. Screen. 14: 700). The results are listed in Tables 8.1–8.3. As can be seen at pH 7 and the pH of all other tests, the peptides of the present invention are more thermally stable than SEQ ID NO:50.

[0520] Table 8.1 This experiment was repeated after being published in WO 2023 / 102002, in which all skeletons had His tags. Table 8.2 The purified enzyme (including SEQ ID NO: 1 of WO 2023 / 102002) was expressed without a His tag and tested at pH 3.0. Therefore, SEQ ID NO: 104 has comparable thermal stability to SEQ ID NO: 107 (which was developed according to WO 2023 / 102002 for its thermal stability).

[0521] Table 8.3 Example 12 - Cellular Assay of ATP Activity The bacteria were inoculated into broth (Staphylococcus aureus in LB broth and Ls33 in MRS broth) and incubated overnight. The bacteria were then re-inoculated into fresh broth and incubated for an additional 24 hours to ensure high growth capacity. The bacteria were then diluted in fresh broth and inoculated into plates.

[0522] Alkaline phosphatase and ATP were mixed in 100 mM HEPES buffer and incubated with shaking at 40°C for 1 hour, then added to the bacteria in the plate. The concentrations indicated in the table are the final concentrations in the bacterial plate. OD600 was measured immediately and after 24 hours. Bacterial growth without additives was set to 100%.

[0523] Table 10a Table 10b Table 10c Table 10d Example 13 - LPS Activity The alkaline phosphatase titrant was mixed with 300 µg / mL LPS in 50 mM HEPES buffer supplemented with 0.0% Triton X-100. The mixture was incubated with shaking at 40°C for 60 min. Free phosphate was detected using a malachite green phosphate assay kit (R&D Systems) following the manufacturer's protocol.

[0524] In short, 10 µL of reagent A (ammonium molybdate, in 3 M sulfuric acid) was added to all samples, followed by incubation for 10 min. Then, 10 µL of reagent B (malachite green oxalate and polyvinyl alcohol) was added, and the samples were incubated for another 20 min. The plate was read at OD620. Background from each component (alkaline phosphatase, LPS, buffer) was subtracted to reveal OD values ​​derived solely from LPS dephosphorylation. A nonlinear curve was fitted and EC50 was calculated based on the free phosphate levels measured by alkaline phosphatase titration.

[0525] MAMP - Detoxification Test LPS dephosphorylation was measured using a malachite green phosphate assay kit to detect free PO4. E. coli LPS was treated with ALP titration, followed by detection of released PO4. LPS, flagellin, and bacterial detoxification were measured in the following: TLR4 reporter cells, HT-29 epithelial cell line, and primary immune cells. ALP-treated LPS was added to cells, and luminescence (for reporter cells) or cytokines were measured to evaluate the stimulatory capacity of LPS and flagellin. LPS: Malachite Green Phosphate Assay Kit - Results 300 µg / mL *E. coli* O111:B4 LPS was titrated with ALP at 40°C for 1 hour. Buffer: 50 mM HEPES with 0.01% Triton X-100. Background from LPS, ALP, and buffer was subtracted. CIAP was obtained from Sigma and used as a reference. Table 10 Example 14 - Preventing inflammation by lowering IL-1β levels THP-1 cells were cultured in RPMI 1640 medium supplemented with 10 mM HEPES, 10% FBS, and 1% penicillin / streptomycin. THP-1 cells were seeded at 2 × 10⁵ cells / well in flat-bottomed plates and stimulated with 10 ng / mL PMA (phorbol 12-myristate 13-acetate) for 24 h to induce a macrophage phenotype. THP-1 macrophages were washed twice with pre-warmed PBS and then incubated in fresh complete medium for 6 h before being allowed to stand.

[0526] The cells were then stimulated with 1 µg / mL LPS for 18 hours, followed by additional washing in pre-warmed PBS.

[0527] Alkaline phosphatase and ATP were mixed and incubated with shaking at 40°C for 1 hour, and then added to LPS-stimulated THP-1 macrophages.

[0528] After 1 hour of incubation, the supernatant was harvested and IL-1β was analyzed by flow cytometry bead array (CBA).

[0529] Table 11 As demonstrated, the alkaline phosphate of the present invention significantly reduces IL-1β levels.

Claims

1. A polypeptide having alkaline phosphatase activity, wherein the polypeptide is of bacterial or fungal origin, or a variant of a bacterial or fungal-derived polypeptide, wherein the polypeptide is stable to gastric or pepsin.

2. The polypeptide with alkaline phosphatase activity as claimed in claim 1, wherein the polypeptide retains at least 1% of its activity after gastric conditioned conditions, such as at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, or at least 35% of its activity after gastric stimulation, such as at least 20% activity.

3. The polypeptide having alkaline phosphatase activity as described in any one of claims 1 or 2, wherein the polypeptide has at least 70% sequence identity with a polypeptide selected from the group consisting of, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity: SEQ ID NO:18, SEQ ID NO:30, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:67, SEQ ID NO:71, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, and SEQ ID NO:

85.

4. The polypeptide according to any one of claims 1 to 3, wherein the polypeptide has a relative activity greater than that of calf intestinal alkaline phosphatase.

5. A polypeptide having alkaline phosphatase activity, said polypeptide being selected from the group consisting of: (a) With SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO:11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO:22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO:33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO:56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQID NO: 62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQpolypeptides having at least 70% sequence identity with SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84 and SEQ ID NO:85; (b) A polypeptide that has at least 70% sequence identity with the mature polypeptide of (a); (c) A polypeptide encoded by a polynucleotide, wherein the polynucleotide has at least 70% sequence identity with the mature polypeptide encoding sequence of the polypeptide of (a) or (b); (d) A polypeptide derived from a polypeptide of (a) or (c) or a mature polypeptide of (b) by substitution, deletion or addition of 1 to 120 amino acids, such as 1 to 100, 1 to 80, 1 to 60 or 1 to 40 amino acids. (e) A polypeptide derived from (a), (b), (c), or (d), wherein the N-terminus and / or C-terminus have been extended by adding 1 to 50 amino acids, such as 1 to 40, 1 to 30, or 1 to 20 amino acids; and (f) Fragments of the polypeptides described in (a), (b), (c), (d) or (e); The polypeptide of (a), (b), (c), (d), or (e) or the fragment of (f) has alkaline phosphatase activity.

6. The polypeptide of claim 5, wherein the basic polypeptide is of bacterial or fungal origin, or a variant of a bacterial or fungal polypeptide, more preferably a bacterial polypeptide or a variant of a bacterial polypeptide, and has alkaline phosphatase activity.

7. The polypeptide of any one of claims 1 to 6, wherein the polypeptide has alkaline phosphatase activity, wherein the polypeptide has at least 70% sequence identity with a polypeptide selected from the group consisting of, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 ... NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO:

42. SEQ ID NO:

43. SEQ ID NO:

44. SEQ ID NO:

45. SEQ ID NO:

46. SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO:58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, and SEQ ID NO:

85.

8. The polypeptide of any one of claims 1 to 7, wherein the polypeptide has alkaline phosphatase activity and is selected from the group consisting of: a) A polypeptide having at least 70% sequence identity with SEQ ID NO:61, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; b) A polypeptide having at least 70% sequence identity with SEQ ID NO:62, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; c) A polypeptide having at least 70% sequence identity with SEQ ID NO:63, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; d) A polypeptide having at least 70% sequence identity with SEQ ID NO:64, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; e) A polypeptide having at least 70% sequence identity with SEQ ID NO:65, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; f) A polypeptide having at least 70% sequence identity with SEQ ID NO:66, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; g) A polypeptide having at least 70% sequence identity with SEQ ID NO:67, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; h) A polypeptide having at least 70% sequence identity with SEQ ID NO:68, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; i) A polypeptide having at least 70% sequence identity with SEQ ID NO:69, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; j) A polypeptide having at least 70% sequence identity with SEQ ID NO:70, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; k) A polypeptide having at least 70% sequence identity with SEQ ID NO:71, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; l) A polypeptide having at least 70% sequence identity with SEQ ID NO:72, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; m) A polypeptide having at least 70% sequence identity with SEQ ID NO:73, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; n) A polypeptide having at least 70% sequence identity with SEQ ID NO:74, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; o) A polypeptide having at least 70% sequence identity with SEQ ID NO:75, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; p) A polypeptide having at least 70% sequence identity with SEQ ID NO:76, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; q) A polypeptide having at least 70% sequence identity with SEQ ID NO:77, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; r) A polypeptide having at least 70% sequence identity with SEQ ID NO:78, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; s) A polypeptide having at least 70% sequence identity with SEQ ID NO:79, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; t) a polypeptide having at least 70% sequence identity with SEQ ID NO:80, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; u) A polypeptide having at least 70% sequence identity with SEQ ID NO:81, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; v) A polypeptide having at least 70% sequence identity with SEQ ID NO:82, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; x) A polypeptide having at least 70% sequence identity with SEQ ID NO:83, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity; y) A polypeptide having at least 70% sequence identity with SEQ ID NO:84, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity; and z) A polypeptide having at least 70% sequence identity with SEQ ID NO:85, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity.

9. The polypeptide according to any one of claims 5 to 8, wherein the polypeptide has a relative activity greater than that of calf intestinal alkaline phosphatase.

10. The polypeptide according to any one of claims 1 to 9, wherein the polypeptide has an activity at least equal to that of calf intestinal alkaline phosphatase at pH 7, 8, 9, 10 or 11, preferably at pH 7, 8 or 9, and preferably at pH 7.

11. A composition comprising the polypeptide as described in any one of claims 1 to 10.

12. The composition of claim 11, wherein the composition is an aqueous solution comprising the polypeptide of any one of claims 1 to 10, or a suspension comprising the polypeptide of any one of claims 1 to 10 in a suspended form.

13. The composition of claim 11 or 12, further comprising: At least one fat-soluble vitamin, and / or At least one water-soluble vitamin, and / or At least one trace mineral.

14. An animal feed additive comprising a polypeptide as described in any one of claims 1 to 10.

15. An animal feed comprising a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

16. An animal technology additive comprising a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

17. A method for preparing an animal feed additive, an animal technology additive, or a feed, said method comprising adding a polypeptide as described in any one of claims 1 to 10.

18. Use of the polypeptide according to any one of claims 1 to 10 in the preparation of feed additives, feed compositions or animal technology additives.

19. A method for increasing the weight gain of an animal, the method comprising feeding the animal a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

20. A method for improving the food conversion rate of an animal, the method comprising feeding the animal a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

21. A method for detoxifying lipopolysaccharides in animals, the method comprising feeding the animals a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

22. A method for reducing an immune response in an animal, the method comprising feeding the animal a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

23. A method for reducing inflammation in an animal, the method comprising feeding the animal a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

24. A method for mitigating IL or TNF response in an animal, the method comprising feeding the animal a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

25. A method for maintaining or supporting gut health in an animal, or for improving gut health thereby promoting the growth of symbiotic bacteria, the method comprising feeding the animal a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

26. A method for maintaining an effective intestinal barrier, the method comprising feeding the animal a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

27. A method for preventing colitis or inflammation of the colonic wall in an animal, the method comprising feeding the animal a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

28. A method for preventing low birth weight, such as low birth weight induced by perinatal malnutrition, the method comprising feeding the animal a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

29. A method for improving weight gain in animals with below-average birth weight, the method comprising feeding the animal a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

30. A method of regulating fat absorption or neutralizing acidic digestate entering the small intestine by stimulating bicarbonate secretion and surface pH regulation, the method comprising feeding the animal a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

31. A method for preventing antibiotic-associated infections from Salmonella Typhimurium and / or Clostridium difficile, the method comprising feeding the animal a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

32. A method for preventing weight loss in infected animals, the method comprising feeding the animals a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

33. A method for maintaining or restoring (healthy) gut microbiota in an animal treated with antibiotics, the method comprising feeding the animal a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

34. A method for preventing or reducing intestinal colonization or systemic translocation of harmful bacteria, or for "dysbiosis," i.e., for altering the bacterial and / or archaea balance of the intestinal microecology, the method comprising feeding the animal a polypeptide as described in any one of claims 1 to 10, a composition as described in any one of claims 11 to 13, or an animal feed additive as described in claim 14.

Citation Information

Patent Citations

  • Enzyme containing granulates suitable for use as detergent additives

    EP0170360A1

  • Protected enzyme systems

    EP0238216A1

  • Method for production of an enzyme granulate

    EP0304331A2

  • Enzyme containing granulate and method for production thereof

    EP0304332A2

  • Process for coating water soluble or water dispersible particles by means of the fluid bed technique

    GB1483591A