Knock-in system for stable inheritance and real-time fluorescence monitoring of cat gene expression quantity of zebrafish, construction method and application
By designing an efficient knock-in plasmid for the MMEJ repair mechanism in zebrafish and combining it with eGFP fluorescent labeling, the problems of low gene knock-in efficiency and complex detection were solved, achieving stable inheritance and real-time fluorescence monitoring, thus improving detection accuracy and efficiency.
Patent Information
- Application Number
- CN202511729613.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-24
- Publication Date
- 2026-02-27
AI Technical Summary
Existing technologies make it difficult to achieve efficient and accurate gene knock-in in zebrafish, especially the stable inheritance and real-time fluorescence monitoring of the cat gene. Furthermore, traditional methods are complex to operate or lack sufficient accuracy, and cannot truly reflect gene expression.
Using gene editing technology based on the MMEJ repair mechanism, a highly efficient knock-in plasmid containing DgRNA with MMEJ repair preference characteristics was designed. The knock-in plasmid was integrated into the cat genome via microinjection and combined with eGFP fluorescent protein labeling to achieve stable inheritance and real-time fluorescence monitoring.
It achieves a high knock-in efficiency of up to 12.5% for the cat genome, and the eGFP fluorescence expression is synchronized with the cat gene, which can truly reflect changes in gene expression, simplify the detection process, and improve the accuracy and efficiency of detection.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of fish bioengineering, and relates to a knock-in system for stably expressing and real-time fluorescently monitoring the expression amount of a cat gene of zebrafish, a construction method and application. BACKGROUND
[0002] Environmental pollution can cause oxidative stress in organisms, resulting in a large number of free radicals in the organism, imbalance of the oxidation system and the antioxidant system, and various physiological and biochemical changes. Zebrafish and mammals have similar antioxidant defense systems, and the active oxygen produced by normal metabolism can be controlled by the antioxidant defense system. Catalase (CAT) is a key enzyme in the biological defense system, widely exists in plants, animals and microorganisms, and exists in the liver of animals at a high concentration. The main function is to catalyze the decomposition of hydrogen peroxide into water and oxygen, and remove hydrogen peroxide in the body, so as to protect cells from damage to cell structure by free radicals. Catalase (CAT) is one of the key antioxidant enzymes for removing free radicals in the body. The expression of catalase (CAT) is induced or inhibited due to the presence of pollutants, and its activity can reflect the degree of oxidative damage to the body, thereby indicating an important parameter of whether the organism is in a pollution stress state. Therefore, how to conveniently and quickly detect the expression of catalase (CAT) is crucial for detecting the oxidative stress of environmental pollutants on zebrafish and evaluating antioxidant active substances.
[0003] At present, the expression of catalase is mainly determined by in vitro technical methods (such as iodometric titration method and visible spectrophotometry), and the oxidative stress is evaluated. The iodometric titration method is relatively simple to operate, but the reaction time is not easy to control, the error of titration endpoint judgment is large, and there are many intermediate reaction interference factors, so the standard deviation of the data measured by this method is large, and the accuracy is poor. Compared with the iodometric method, the standard deviation of the data obtained by the visible spectrophotometry is small, and the accuracy is high, but the method is complex to operate, and the intermediate reaction interference factors can also interfere with the results. Therefore, these in vitro technical methods for determining catalase have several problems to be solved.
[0004] Zebrafish has the advantages of small individual, large egg production, easy feeding, transparent embryo, etc. Therefore, zebrafish model is widely used in the field of medicine for drug safety, toxicology and drug screening research. In 2025, the national standard (GB / T45221-2025) was released, which used transgenic tg (cyp19a1b:GFP) zebrafish embryos to detect endocrine active substances through estrogen receptors. This experiment is a mechanism-based in vivo screening test, which aims to detect endocrine active chemicals through estrogen receptors as agonists by inducing the expression of green fluorescent protein (GFP) driven by cyp19a1b promoter. Therefore, in vivo zebrafish can trace the spatial and temporal expression of specific genes by inducing GFP expression ability, and the effect of compounds on zebrafish can be directly evaluated. However, so far, there is no ideal zebrafish model that can show the expression level of catalase cat by fluorescent protein.
[0005] With the development of gene editing technology, "gene site-directed knock-in technology" is gradually established and developed. If this technology can be efficiently established in zebrafish, specific gene sequences can be artificially edited, not only the target gene can be specifically destroyed, but also exogenous sequences can be introduced into endogenous gene sites, such as introducing reporter genes like eGFP for convenient labeling and detection. Therefore, compared with transgenic technology, the integration of exogenous genes in the genome mediated by site-directed knock-in technology can more truly simulate the expression of endogenous genes, avoiding the random integration of traditional transgenic technology, and will become a powerful tool for directed genetic modification of animals.
[0006] Although some success has been achieved in zebrafish using gene knock-in technology, it is still difficult to achieve for most sites. The main challenges of zebrafish gene knock-in technology include low efficiency, unclear fine molecular mechanism of DNA repair during gene knock-in process, and optimization of technical process. Although the knock-in technology based on non-homologous end joining (NHEJ) mechanism has relatively high efficiency, the integration direction is uncertain, the sequence on both sides of the integration site cannot be predicted, and many gene sequences do not have suitable gRNA target sites, which leads to certain limitations of site-directed knock-in technology based on NHEJ repair mechanism. The knock-in technology based on homologous recombination (HR) can achieve precise integration, but the low insertion efficiency (about 1.5%) will lead to heavy screening work. Moreover, long flanking homologous arm sequences (about 2000 bp) are needed in this technology, and the amplification of large fragments of DNA also brings certain difficulties to vector construction.
[0007] Microhomology -mediated end joining (MMEJ) repair mechanism is widely used for DNA double-strand break repair in the early development process of zebrafish. Wierson et al. reported a technology for efficient knock-in in the zebrafish genome using MMEJ repair mechanism, which can realize precise in-frame integration at the genome level, and the insertion efficiency in the germ cells of F0 generation is higher than 10%. However, up to now, there are few successful cases of gene knock-in using this technology. Wierson et al. designed a knock-in vector using two UgRNA sequences, and we also used this technology to use two UgRNA sequences for knock-in, and found that the success rate of this insertion technology was very low (less than 5%), and even no effective insertion could be produced. Therefore, how to design and construct an efficient gene insertion vector is crucial for the successful development of a gene knock-in strain. SUMMARY
[0008] The purpose of the present application is to provide a knock-in system for stably inherited and real-time fluorescent monitoring of cat gene expression in zebrafish, which comprises a knock-in plasmid, Cas9 mRNA, DgRNA and sgRNA, wherein the sgRNA is shown as SEQ ID NO. 1, the DgRNA is shown as SEQ ID NO. 2, and the knock-in plasmid is shown as SEQ ID NO. 3, and the green fluorescent gene in the knock-in plasmid can be replaced by a yellow fluorescent gene, a red fluorescent gene or a blue fluorescent gene to complete the present application.
[0009] The purpose of the present application is to provide a method for constructing a zebrafish model for stably inherited and real-time fluorescent monitoring of cat gene expression.
[0010] The last purpose of the present application is to provide the application of the above-mentioned knock-in system.
[0011] In order to achieve the above-mentioned purposes, the present application adopts the following technical measures:
[0012] A knock-in system for stably inherited and real-time fluorescent monitoring of cat gene expression in zebrafish, wherein the system is a reagent or a kit, and the reagent or the kit comprises a knock-in plasmid, Cas9 mRNA, DgRNA and sgRNA.
[0013] The sgRNA is shown as SEQ ID NO. 1, the DgRNA is shown as SEQ ID NO. 2, and the knock-in plasmid is shown as SEQ ID NO. 3.
[0014] The knock-in system described above, and another option is that the green fluorescent gene in the knock-in plasmid is replaced by a yellow fluorescent gene, a red fluorescent gene or a blue fluorescent gene.
[0015] The concentration of each substance in the above-mentioned knock-in system is: 20 ng / ul of the knock-in plasmid, 500 ng / ul of Cas9 mRNA, 50 ng / ul of sgRNA, and 500 ng / ul of DgRNA.
[0016] A zebrafish model which is genetically stable and can monitor the expression amount of the cat gene in real time fluorescence is obtained by microinjecting the above-mentioned knock-in system into zebrafish embryos.
[0017] A method for constructing a zebrafish model which is genetically stable and can monitor the expression amount of the cat gene in real time fluorescence, the steps of which include: microinjecting the above-mentioned knock-in system into zebrafish embryos, culturing the F0 generation embryos to sexual maturity, crossbreeding the F0 generation individuals with wild-type strains one by one, collecting the embryos for fluorescence screening, selecting the F1 generation with positive fluorescence expression and further sequencing, continuing to breed the F2 generation from the F1 generation with correct genotypes, and obtaining the zebrafish model.
[0018] Any one of the following applications of the above-mentioned knock-in system:
[0019] 1) for preparing fluorescently labeled liver cells of zebrafish;
[0020] 2) for preparing a zebrafish model which is genetically stable and fluorescently labeled with the cat gene;
[0021] 3) for preparing a zebrafish model for detecting the oxidative stress response of animals to environmental pollutants;
[0022] 4) for preparing a zebrafish model for evaluating antioxidant active substances;
[0023] Compared with the prior art, the present application has the following advantages:
[0024] (1) The present application has the characteristics of accuracy and relatively high efficiency based on the MMEJ repair strategy, high-efficiency gRNA target sites are screened out in the cat genome, and a high-efficiency knock-in plasmid containing DgRNA with the preferred characteristics of MMEJ repair is designed. Among the 8 F0 generation fish screened, 1 fish that can pass on the gene knock-in success to the offspring is screened, i.e., the knock-in efficiency is as high as 12.5%, solving the problem of low success rate of gene knock-in based on microhomology-mediated end joining (MMEJ). The constructed gene knock-in strain Ki(cat-P2A-eGFP-UTRsv40) embryo maintains the integrity of the cat coding sequence and will not affect the function of cat. Moreover, the eGFP fluorescent protein coding sequence is accurately fused downstream of the cat coding sequence, so that the expression of the eGFP protein is also regulated by the cat gene promoter and is synchronized with the expression of cat.
[0025] (2) The fluorescently labeled zebrafish model constructed by the present application can trace the temporal and spatial expression pattern and expression level of the cat gene. Compared with the traditional transgenic technology, the promoter sequence is artificially cloned, and the cloned regulatory sequence may not be complete, which cannot truly reflect the expression of the gene, and the expression of the transgene is regulated by the sequence of the integrated site. The fluorescently labeled zebrafish model constructed by the present application has the eGFP coding sequence integrated downstream of the cat genomic coding sequence, so that the expression of eGFP is regulated by the expression of the endogenous cat promoter, thereby more truly reflecting the expression change of the cat gene.
[0026] (3) The fluorescently labeled zebrafish model constructed by the present application can maintain the integrity of the cat coding sequence. Although the gene knock-in technology has achieved certain success in zebrafish, it is still difficult to achieve precise gene knock-in or sequence editing for most sites. At the same time, due to the unclear fine molecular mechanism of DNA repair in the process of gene knock-in, the inserted sequence produced by the site-directed knock-in technology is not completely consistent with the designed sequence. The present application uses gene editing technology to design a high-efficiency knock-in plasmid containing DgRNA with the preferred characteristics of MMEJ repair, to ensure that after the knock-in plasmid is integrated into the cat coding sequence under the action of the microhomology-mediated end joining repair mechanism, the integrity of the cat coding sequence can be maintained, so as to not affect the normal development of zebrafish.
[0027] (4) The fluorescently labeled zebrafish model constructed by the present application can highly express fluorescent proteins in the liver and can be used to observe the morphological characteristics of the liver.
[0028] (5) The fluorescently labeled zebrafish model constructed by the present application can first use eGFP fluorescent protein to trace the expression change of the cat gene in live zebrafish, and the activity of catalase (CAT) can reflect the degree of oxidative damage of the body, thereby establishing a technology for analyzing oxidative stress caused by environmental pollutants and evaluating antioxidant active substances by detecting the expression amount of eGFP fluorescent protein. At present, in environmental toxicology experiments and cosmetic efficacy evaluation experiments, the activity of cat in experimental animals is mainly detected by extracting RNA samples, but this in vitro technology has the problems of complex operation, time-consuming, and many factors affecting the results. The present application directly observes the expression amount of eGFP in zebrafish, which is more convenient and faster and more truly reflects the expression change of catalase (Catalase, CAT) in vivo, thereby providing a more powerful technical method for environmental toxicology experiments and cosmetic efficacy evaluation experiments. BRIEF DESCRIPTION OF DRAWINGS
[0029] Figure 1 To verify the sequencing results of the sgRNA capable of producing efficient mutation at the cat gene locus;
[0030] After sgRNA of 5' GTTCATGTTTATTCACGTGG 3' was injected into zebrafish embryos, sequencing peak showed that sgRNA produced high-efficiency mutation at cat gene locus.
[0031] Figure 2 A schematic diagram for inserting knock-in plasmid into cat gene locus by using gene knock-in technology;
[0032] As shown in the figure, firstly, CRISPR / Cas9 gene editing technology was used to produce double-strand break at sgRNA target sequence of cat gene locus. Meanwhile, DgRNA sequence of knock-in plasmid was designed according to sgRNA sequence to produce DNA double-strand break on knock-in plasmid. Micro-homologous arm sequence of genomic break sequence and knock-in plasmid break sequence will start MMEJ, thereby mediating integration of knock-in plasmid p(DgRNA-cat-P2A-eGFP-UTRsv40) into cat gene locus in genome, and realizing targeted genetic modification of cat gene.
[0033] Figure 3 Sequencing alignment results after inserting knock-in plasmid into cat gene locus;
[0034] The results show that after inserting knock-in plasmid into cat gene locus, the integrity of cat coding sequence is still maintained, but the stop codon of cat is removed, so the cat promoter will co-express eGFP gene downstream of cat coding sequence. The coding sequence of cat and eGFP is separated by 2A short peptide, and 2A short peptide makes the protein of cat gene not affected by eGFP fluorescent protein.
[0035] Figure 4 EGFP expression in zebrafish model of gene knock-in cat genome is synchronized with endogenous cat gene expression
[0036] (A) At 4 dpf, fluorescent protein is specifically expressed in the liver of zebrafish with gene knock-in cat genome. (B) In the zebrafish oxidative stress model established by H2O2, after 2 hours of H2O2 treatment, the expression of GFP in the liver of zebrafish model with gene knock-in cat genome is enhanced. (C) In the zebrafish oxidative stress model established by H2O2, after 2 days of H2O2 treatment, the expression of GFP in the liver of zebrafish model with gene knock-in cat genome is reduced. (D) The intensity of fluorescent expression was counted by using ImageJ software. (E) The expression level of cat gene was detected by quantitative PCR. The results show that the results of quantitative PCR are consistent with the changes of eGFP fluorescent expression. DETAILED DESCRIPTION
[0037] The methods in the embodiments of the present application are not particularly specified, and are conventional methods well known to those skilled in the art, and can be referred to the Guide to Molecular Cloning Experiments (Second Edition, J. Sambrook et al., Science Press, 1993). The biological reagents used in the present application are from Fermantas Company if not particularly specified.
[0038] Embodiment 1
[0039] A method for constructing a zebrafish model stably inheriting a cat gene and capable of real-time fluorescence monitoring, comprising the following steps:
[0040] 1. Synthesis of high-efficiency sgRNA on cat gene
[0041] Selecting a sgRNA target site on the cat genome of zebrafish, the target site is 5' GTTCATGTTTATTCACGTGG 3'. Corresponding sgRNA is synthesized by in vitro transcription, embryos are microinjected and the sgRNA cutting efficiency of the target site is detected, and finally a high-efficiency sgRNA meeting the requirements of gene knock-in is screened at the last exon, and the specific preparation process is as follows:
[0042] (1) Synthesis of specific site sgRNA
[0043] According to the sequence of cat gene (ENSDARG00000104702) in Ensembl (GRCz11) in the website, the last exon sequence of cat genome is selected to design gRNA target primer gRNA-cat (5' TGTAATACGACTCACTATAGTTCATGTTTATTCACGTGGGTTTTAGAGCTAGAAATAG 3') and gRNA-R (5' AAAAAAAGCACCGACTCGGTGCCACT 3'). The sgRNA template is amplified by PCR with the plasmid pMD19-T-gRNA scaffold ((http: / / www.zfish.cn / resource / CZP3)) as the template. The sgRNA template is recovered by a PCR product recovery kit. Then the T7 RNA polymerase is used to synthesize sgRNA, and the sgRNA is recovered by a recovery kit, and the sequence is shown in SEQ ID NO. 1.
[0044] (2) Synthesis of Cas9 mRNA
[0045] The Cas9 mRNA was synthesized using the plasmid pT3TS (T3:zCas9-UTRglobin) (http: / / www.zfish.cn / resource / CZP11) and the in vitro transcription kit (Ambion mMESSAGE mMACHINE kit).
[0046] (3) Target validation and target efficiency
[0047] The sgRNA / Cas9 mRNA complex (Cas9 mRNA: 500 ng / ul, sgRNA: 50 ng / ul) was injected into zebrafish embryos, and when the embryos developed to 1 day, genomic PCR was extracted, and the cat gene sequence was amplified using primers cat-F (5' AGTTGCTCTAAAATATGGTAGC 3') and cat-R (5' TCAGTCAAGGCAGAAAGG 3'), and sequencing identified that the specific site sgRNA produced high-efficiency mutation on the cat gene, and the sequencing peak is shown in Figure 1 .
[0048] 2. Gene knock-in plasmid construction
[0049] (1) Design of gene knock-in plasmid
[0050] The knock-in plasmid p(DgRNA-cat-P2A-eGFP-UTRsv40) synthesized artificially, and its sequence is shown in SEQ ID NO. 3. As shown in SEQ ID NO. 3, the knock-in plasmid p(DgRNA-cat-P2A-eGFP-UTRsv40) has the following characteristics: Figure 2
[0051] A. It contains an artificially designed DgRNA sequence. It is used for linearization of the gene knock-in plasmid, and the sequence downstream of the DgRNA after linearization of the plasmid is homologous to the sequence upstream of the sgRNA sequence, which can mediate the knock-in plasmid to be integrated into the genome by the MMEJ repair mechanism. In addition, this homologous sequence is single-base mutated to ensure that after the knock-in plasmid is inserted, it cannot be recognized by sgRNA, and the single-base mutation is a synonymous mutation of the CAT protein and will not change the protein sequence of the CAT gene.
[0052] B. It contains the entire coding sequence downstream of the sgRNA sequence in the cat genome. It is used to maintain the integrity of the cat genomic sequence after the knock-in plasmid is inserted.
[0053] C. The coding sequence of fluorescent protein eGFP. The coding sequence of fluorescent protein eGFP is spaced with 2A short peptide with cat genome. When the knock-in plasmid is inserted, the coding sequence of fluorescent protein eGFP will be inserted downstream of the genomic cat coding sequence, and the 2A short peptide makes the protein sequence of the cat gene not affected by the eGFP protein. The eGFP is used as a reporter gene to track the expression of cat. The eGFP as a reporter gene is replaced by other reporter genes, such as red fluorescent gene, yellow fluorescent gene or blue fluorescent gene, and the application can be completed.
[0054] (2) Construction of gene knock-in plasmid
[0055] The synthetic sequence F contains Age I and BspEI double enzyme digestion sites and the above sequence, and the specific sequence is: accggtccggctggcctggtgttcatgtttactcacgtggtggagcgtctgctgtggctgcagcttctaagatgggatccgga. The synthetic sequence is connected into the artificial synthetic vector p(P2A-GFP-UTRglobin) by using the method of Age I and BspEI enzyme digestion and ligation, and the knock-in plasmid p(DgRNA-cat-P2A-eGFP-UTRsv40) is obtained, and its sequence is shown in SEQ ID NO. 3.
[0056] (3) Artificial design of DgRNA synthesis
[0057] DgRNA is synthesized in vitro, which is used for linearization of gene knock-in plasmid and integration of knock-in plasmid into genome by using MMEJ repair mechanism. First, according to the DgRNA sequence in the gene knock-in plasmid, the DgRNA target primer DgRNA-F (5’ TGTAATACGACTCACTATAGTGAGTAAACATGAACACCGTTTTAGAGCTAGAAATAG 3’) and gRNA-R (5’ AAAAAAAGCACCGACTCGGTGCCACT 3’) are designed. The DgRNA template is amplified by PCR using the plasmid pMD19-T-gRNA scaffold ((http: / / www.zfish.cn / resource / CZP3)) as a template. The DgRNA template is recovered by using a PCR product recovery kit. Then, the T7 RNA polymerase is used to synthesize DgRNA, and the DgRNA is recovered by using a recovery kit, and its sequence is shown in SEQ ID NO. 2.
[0058] 3. Microinjection to establish F0 generation gene knock-in zebrafish
[0059] The gene knock-in system was injected into zebrafish embryos to obtain F0 generation embryos by microinjector and microinjection method (Zhu Z, Li G, He L, et al. Novel gene transfer into the fertilized eggs of goldfish (Carassius auratus L. 1758). Z angew ichthyol , 1985, 1:31-34) to obtain F0 generation embryos, and each embryo was injected with 1 nl. The knock-in system included the gene knock-in plasmid p(DgRNA-cat-P2A-eGFP-UTRsv40): 20 ng / ul, Cas9 mRNA: 500 ng / ul, target site sgRNA: 50 ng / ul, and knock-in plasmid target site DgRNA: 50 ng / ul.
[0060] 4. Genetic detection of F0 generation gene knock-in zebrafish
[0061] The F0 generation gene knock-in population was cultured to sexual maturity, and 8 F0 generation zebrafish were crossed with wild-type zebrafish. The hybrid embryos were cultured at 28ºC, and fluorescence microscopy was used to screen the embryos for fluorescence. One F0 offspring was found to specifically express fluorescence in liver cells, and the fluorescence-positive embryo was selected as the F1 generation population for further culture. The F0 generation knock-in efficiency was as high as 12.5%.
[0062] 5. Screening and identification of F1 generation individuals
[0063] The F1 generation population was cultured to sexual maturity, and the F1 generation zebrafish tail fin was used to amplify the knock-in sequence using primers cat-F (5' AGTTGCTCTAAAATATGGTAGC 3') and eGFP-R (5' TGCCGTTCTTCTGCTTGTC 3'). Sequencing was used to screen F1 generation zebrafish in which the knock-in plasmid was integrated into the cat genomic sequence. In this example, sequencing showed that the CDS sequence of the cat gene in the F1 generation remained intact, indicating that the function of the cat gene was not affected. The sequencing results are shown in Figure 3 .
[0064] Therefore, after the knock-in plasmid is integrated into the cat genomic sequence in the zebrafish model constructed by the present application, the cat genomic sequence remains intact, and the coding sequence of the eGFP fluorescent protein is inserted downstream of the cat coding sequence. The 2A short peptide does not affect the protein sequence of the cat gene.
[0065] 6. F1 generation breeding F2 generation
[0066] The F1 generation with correct genotype is continuously bred to F2 generation, and the F2 generation embryos with positive fluorescence expression are selected under a fluorescence dissecting microscope to obtain the stable genetically fluorescent labeled zebrafish model Ki(cat-P2A-eGFP-UTRsv40) targeting the cat gene.
[0067] Example 2:
[0068] Application of the zebrafish model prepared in Example 1:
[0069] 1. The zebrafish model with gene knock-in into the cat genome can specifically label liver cells
[0070] Previous studies have shown that the cat gene is specifically expressed in the liver. In order to observe the expression of eGFP in the zebrafish with gene knock-in into the cat genome, we collected the Ki(cat-P2A-eGFP-UTRsv40) embryos and observed the fluorescence expression of the embryos under a fluorescence microscope. The results show that the liver cells of the embryos specifically express eGFP fluorescence, and the fluorescence expression characteristics are consistent with the expression of the cat gene. The fluorescence expression characteristics are as follows: Figure 4 A.
[0071] Therefore, the zebrafish model constructed in the present application co-expresses the eGFP gene by the endogenous cat promoter, and uses eGFP as a reporter gene to track the temporal and spatial expression of the cat gene in living zebrafish. At the same time, the fluorescent protein is highly expressed in the liver, thereby providing a powerful platform for in vivo observation and tracking of liver development.
[0072] 2. The eGFP expression in the fluorescent labeled zebrafish model can evaluate the expression change of the cat gene
[0073] Previous studies have shown that H2O2 can be used to establish an oxidative stress model in zebrafish by directly increasing intracellular ROS levels to trigger oxidative damage and stress response. When zebrafish embryos are treated with H2O2, the cat activity shows a first induction and then a suppression and weakening effect, showing a first increase and then a decrease trend. The specific process is as follows: under short-time (2 h) oxidative stress, the embryos will activate CAT and other antioxidant enzymes to remove excess active oxygen, thereby significantly increasing the cat activity. Long-time (48 h) oxidative stress will cause damage to the enzyme system in the zebrafish body, thereby inhibiting the CAT enzyme activity of the zebrafish embryos and significantly reducing the expression amount. We detect the expression amount of the fluorescent protein in the stable genetically fluorescent labeled zebrafish model targeting the cat gene, to determine whether it can indicate the expression change of the cat.
[0074] We detected whether the expression of fluorescent protein in the zebrafish model with cat genome knock-in gene could be up-regulated under short-time (2 hours) oxidative stress. Zebrafish embryos with cat genome knock-in gene were collected at 4 days after fertilization, treated with H2O2 (200 μM) for 2 hours, and the fluorescence expression in the embryos was observed. Meanwhile, the RNA of the embryos was extracted, and the expression level of cat gene was detected by quantitative PCR. The results showed that, compared with the control group, the expression of cat-activated CAT enzyme was up-regulated in the embryos treated with H2O2 (200 μM) for 2 hours. The results of quantitative PCR and the change in fluorescence intensity statistics were consistent, both of which were up-regulated, indicating that the expression of fluorescent protein in the zebrafish model with cat genome knock-in gene would increase with the up-regulation of cat gene expression. The fluorescence expression characteristics are as follows Figure 4 B.
[0075] Meanwhile, zebrafish embryos with cat genome knock-in gene were collected at 2 days after fertilization, treated with H2O2 (100 μM) for 2 days, and the fluorescence expression in the embryos was observed when the embryos developed to 4 days. Meanwhile, the RNA of the embryos was extracted, and the expression level of cat gene was detected by quantitative PCR. The results showed that, in the embryos treated with H2O2 (100 μM), the results of fluorescent protein detection and the results of quantitative PCR showed that the expression of cat gene was down-regulated. The change trend of the results detected by the two methods was consistent, indicating that, under long-time (2 days) oxidative stress, the expression of fluorescent protein in the zebrafish model with cat genome knock-in gene would decrease with the down-regulation of cat gene expression. The fluorescence expression characteristics are as follows Figure 4 C.
[0076] Therefore, the expression of EGFP fluorescence in the zebrafish model constructed by the present application is synchronized with the expression of cat gene, and the change in the expression of cat gene can indicate whether the organism is in a pollution stress state and is related to the degree of oxidative stress state of the organism, so that the oxidative stress reaction of zebrafish to environmental pollutants and the evaluation of antioxidant active substances can be directly and quickly detected by observing the expression of EGFP fluorescence in the model.
Claims
1. A stably inherited and real-time fluorescence monitoring method for zebrafish cat A gene expression knock-in system, wherein the system is a reagent or kit, and the reagent or kit includes: Knock-in plasmid, Cas9 mRNA, DgRNA and sgRNA; The sgRNA is shown in SEQ ID NO.1, the DgRNA is shown in SEQ ID NO.2, and the knock-in plasmid is shown in SEQ ID NO.
3.
2. A stable genetic method for real-time fluorescence monitoring of zebrafish cat A gene expression knock-in system, wherein the system is a reagent or kit, and the reagent or kit includes: Knock-in plasmid, Cas9 mRNA, DgRNA and sgRNA; The sgRNA is shown in SEQ ID NO.1, the DgRNA is shown in SEQ ID NO.2, and the knock-in plasmid is shown in SEQ ID NO.3; the green fluorescent gene in the knock-in plasmid is replaced with a yellow fluorescent gene, a red fluorescent gene, or a blue fluorescent gene.
3. The knock-in system according to claim 1 or 2, wherein the concentrations of each substance in the knock-in system are: 20 ng / ul knock-in plasmid, 500 ng / ul Cas9 mRNA, 50 ng / ul sgRNA and 500 ng / ul DgRNA.
4. A stable genetically inherited method with real-time fluorescence monitoring capability. cat A zebrafish model of gene expression levels, obtained by microinjecting the knock-in system of claim 1 or 2 into a zebrafish embryo.
5. A stable genetically inherited method with real-time fluorescence monitoring capability. cat The method for constructing a zebrafish model of gene expression levels includes the following steps: The knock-in system described in claim 1 or 2 is microinjected into zebrafish embryos. After the F0 generation embryos reach sexual maturity, each F0 generation individual is crossbred with a wild-type strain. Embryos are collected for fluorescence screening, and F1 generation individuals with positive fluorescence expression are selected and further sequenced. The F1 generation with the correct genotype is then used to breed F2 generation to obtain a zebrafish model.
6. Any of the following applications of the knock-in system according to claim 1 or 2: 1) Zebrafish used to prepare fluorescently labeled liver cells; 2) Used to prepare stable genetically inherited and fluorescently labeled materials cat A zebrafish model of genes; 3) Used to prepare a zebrafish model for detecting oxidative stress responses in animals to environmental pollutants; 4) Zebrafish model used to prepare and evaluate antioxidant active substances.