Knock-in system for efficient and specific fluorescence labeling of early kidney progenitor cells of zebrafish, construction method and application

Abstract

The invention belongs to the technical field of fish biology, and relates to a knock-in system for efficient and specific fluorescence labeling of early kidney progenitor cells of zebrafish, a construction method and application. Based on an MMEJ repair strategy, the applicant screens out an efficient gRNA target site from an intron of an nphs1 genome, designs an efficient knock-in plasmid with a micro-homologous sequence characteristic preferred by MMEJ repair, injects a knock-in system into a zebrafish embryo through micro-injection, and finally obtains the high-efficiency knock-in plasmid with the micro-homologous sequence characteristic preferred by MMEJ repair. The animal model for efficient and specific fluorescence labeling of early kidney progenitor cells of zebrafish in the embryo one day earlier is obtained, the nphs1 coding sequence of the model is kept complete, the spatio-temporal expression pattern and expression level of the nphs1 gene are traced in vivo, and the development change of the kidney progenitor cells of zebrafish is observed and analyzed. Therefore, the method can be applied to screening of drugs related to kidney diseases and research of action mechanisms, and has important significance on research of kidney progenitor cell related diseases by using zebrafish.

Description

Technical Field

[0001] This invention belongs to the field of fish biotechnology. It relates to a highly efficient and specific fluorescent labeling knock-in system for early kidney progenitor cells in zebrafish, its construction method, and its application. Background Technology

[0002] Zebrafish kidneys are highly similar to human kidneys in morphology, function, and molecular composition. Furthermore, zebrafish possess unique physiological characteristics, such as high reproductive capacity, in vitro fertilization and development, and transparent embryos. Zebrafish have become an important model for studying human kidney development and related diseases. Therefore, constructing an in vivo visualization model of kidney progenitor cells is of great significance for studying the developmental changes of kidney progenitor cells and the pathogenesis of related diseases.

[0003] Traditional transgenic zebrafish models provide tissue-specific fluorescent protein expression, enabling researchers to label and observe renal tubules in real time (Zhou W, Boucher RC, Bollig F, et al. Characterization of mesonephric development and regeneration using transgenic zebrafish. American journal of physiology Renal physiology, 2010, 299: F1040-1047). For example, the Tg(Eco.Tshb:EGFP) strain uses the promoter sequence of grouper thyroid-stimulating hormone β-subunit (tshβ) to drive the specific expression of the green fluorescent protein reporter gene (EGFP) in renal tubules [Wang Y, Sun ZH, Zhou L, et al. Grouper tshbeta promoter-driven transgenic zebrafish marks proximal kidney tubule development. PloS one, 2014, 9: e97806]. Similar to the endogenous tshβ in zebrafish, the gtshβ (grouper tshβ) sequence can also drive GFP expression in the pituitary gland and kidneys. Developmental details of the proximal renal tubules were marked in this transgenic zebrafish strain, which has become an important tool for studying renal tubular development.

[0004] To construct a zebrafish model of kidney disease, Zhou et al. used the promoter of the podocyte-specifically expressed Podocin gene to construct a transgenic zebrafish model, Tg(pod:NTRmCherry) (Zhou W, Hildebrandt F. Inducible podocyte injury and proteinuria in transgenic zebrafish. J Am SocNephrol. 2012 Jun;23(6):1039-47. doi: 10.1681 / ASN.2011080776. Epub 2012 Mar22. PMID: 22440901; PMCID: PMC3358760.). In Tg(pod:NTRmCherry) embryos at 5 days post fertilization (dpf), mCherry can specifically label the anterior kidney glomeruli. When Tg(pod:NTRmCherry) embryos were treated with a solution containing metronidazole (MTZ), the embryos exhibited a phenotype highly consistent with that of human patients with nephrotic syndrome, further supporting the effectiveness of zebrafish as an animal model of kidney disease. Therefore, transgenic zebrafish with a fluorescent reporter system play a crucial role in the rapid development of kidney development research and the use of zebrafish as an animal model of kidney disease for drug screening.

[0005] However, an ideal zebrafish model has yet to be constructed for in vivo labeling and real-time observation of early (day 1) zebrafish kidney progenitor cells. To clarify the molecular identity and biological characteristics of kidney stem cells, Yu et al. used site-directed knock-in technology to attempt to trace zebrafish embryonic kidney progenitor cells using classic mammalian kidney progenitor markers osr1, lhx1a, and eya1. They found that none of the above reporter strains could effectively label them. Subsequently, they constructed the Tg(eya2:eGFP) knock-in strain using the eya1-related gene eya2. At 46 hours post-fertilization (hpf) in this strain of embryos, eGFP⁺ cells first appeared in the intertubular space, but failed to label earlier (day 1) renal progenitor cells, nor specifically label the anterior glomeruli (Yu T, Liu X, Tan X, Zhang Y, He Z, Yang W, Tian T, Li Y, Zhao J, Liu C. Identification of renal stem cells in zebrafish. Sci Adv. 2025 Aug 22;11(34):eadx5296. doi: 10.1126 / sciadv.adx5296. Epub 2025 Aug 22. PMID: 40845090;PMCID: PMC12372851.). Therefore, screening for suitable renal progenitor cell marker genes is crucial to solving the problem of early labeling of renal progenitor cells.

[0006] While gene knock-in technology has achieved some success in zebrafish, it remains difficult to achieve at most sites. The main challenges facing zebrafish gene knock-in technology include low efficiency, an incomplete understanding of the fine molecular mechanisms of DNA repair during gene knock-in, and the need for optimization of the technical process. While knock-in technology mediated by non-homologous end joining (NHEJ) is relatively efficient, it suffers from limitations such as uncertain integration direction, unpredictable flanking sequences at the integration site, and the lack of suitable gRNA targets for introns in many gene sequences. Homologous recombination (HR)-mediated knock-in technology can achieve precise integration, but its low insertion efficiency (around 1.5%) leads to arduous screening work. Furthermore, this technology requires long left and right homologous arm sequences (around 2000 bp), and the amplification of large DNA fragments also poses challenges to vector construction.

[0007] Microhomology-mediated end joining (MMEJ) repair mechanisms are widely used for repairing DNA double-strand breaks in early zebrafish development. Wierson et al. reported a technique for efficient knock-in into the zebrafish genome using the MMEJ repair mechanism. This technique can achieve precise in-frame integration at the genome level, with an insertion efficiency of over 10% in F0 generation germ cells. However, to date, there are few successful cases of gene knock-in using this technique. The knock-in vector designed by Wierson et al. used two UgRNA sequences. When we also used this technique with two UgRNA sequences for knock-in, we found that the success rate of this insertion technique was very low (below 5%), and even failed to produce effective insertion. Therefore, designing and constructing efficient gene insertion vectors is crucial for the successful development of gene knock-in strains. Summary of the Invention

[0008] The purpose of this invention is to provide a highly efficient and specific fluorescently labeled knock-in system for early zebrafish kidney progenitor cells. The knock-in system comprises a knock-in plasmid, Cas9 mRNA, UgRNA, and sgRNA. The sgRNA is shown in SEQ ID NO. 1, the UgRNA is shown in SEQ ID NO. 2, and the knock-in plasmid is shown in SEQ ID NO. 3. The invention can be completed by replacing the green fluorescent gene in the knock-in plasmid with a yellow fluorescent gene, a red fluorescent gene, or a blue fluorescent gene.

[0009] The purpose of this invention is to provide a method for constructing a zebrafish model of early renal progenitor cells with efficient and specific fluorescent labeling.

[0010] The final objective of this invention is to provide an application of the above-described knock-in system.

[0011] To achieve the above objectives, the present invention employs the following technical measures:

[0012] A highly efficient and specific fluorescently labeled knock-in system for early zebrafish kidney progenitor cells, wherein the system is a reagent or kit comprising: a knock-in plasmid, Cas9 mRNA, UgRNA, and sgRNA.

[0013] The sgRNA is shown in SEQ ID NO.1, the UgRNA is shown in SEQ ID NO.2, and the knock-in plasmid is shown in SEQ ID NO.3.

[0014] Another option for the knock-in system described above is to replace the green fluorescent gene in the knock-in plasmid with a yellow fluorescent gene, a red fluorescent gene, or a blue fluorescent gene.

[0015] The knock-in system described above has the following concentrations: knock-in plasmid 20 ng / ul, Cas9 mRNA 500 ng / ul, sgRNA 50 ng / ul, and UgRNA 500 ng / ul.

[0016] A zebrafish model of early kidney progenitor cells with highly efficient and specific fluorescent labeling was obtained by microinjecting the aforementioned knock-in system into zebrafish embryos.

[0017] A method for constructing a zebrafish model with efficient and specific fluorescent labeling of early renal progenitor cells and stable inheritance includes the following steps: microinjecting the above knock-in system into zebrafish embryos, culturing F0 generation embryos to sexual maturity, lateral crossing F0 generation individuals with wild-type strains one by one, collecting embryos for fluorescence screening, selecting F1 generation embryos with positive fluorescence expression and further sequencing, and continuing to breed F2 generation of F1 generation with correct genotype identification to obtain zebrafish model.

[0018] Any of the following applications of the above-described key-input system:

[0019] 1) Zebrafish used to prepare fluorescently labeled kidney progenitor cells;

[0020] 2) Used to prepare zebrafish models for drug screening in kidney diseases;

[0021] 3) Used to prepare zebrafish models for studying the pharmacology of kidney diseases;

[0022] 4) Used to prepare a zebrafish model for observing the developmental changes of early renal progenitor cells in zebrafish;

[0023] 5) Zebrafish model used for research on renal progenitor cell diseases.

[0024] Compared with the prior art, the present invention has the following advantages:

[0025] (1) This invention utilizes the MMEJ repair strategy, which combines precision and relative efficiency. It screens for highly efficient gRNA target sites within the introns of the nphs1 genome and designs a highly efficient knock-in plasmid with microhomological sequences (20 bp) preferred by MMEJ repair. In 12 F0 generation fish, 3 offspring were successfully knocked in, achieving a knock-in efficiency of up to 25%, thus solving the problem of low success rates in gene knock-in mediated by microhomology-mediated end joining (MMEJ). The constructed gene knock-in line Ki (nphs1-P2A-Gal4-UTRactin; UAS:GFP-UTRglobin) embryos maintain the integrity of the nphs1 coding sequence, thus not affecting nphs1 function. Furthermore, the Gal4 coding sequence is precisely fused downstream of the nphs1 coding sequence. Meanwhile, by using the Gal4 / UAS transcriptional activation system in the inserted fragment and GFP as a reporter gene, a zebrafish model that can efficiently and specifically label 1dpf renal progenitor cells can be obtained, which can be applied to the screening of drugs related to kidney diseases and the study of their mechanisms of action.

[0026] (2) The zebrafish gene knock-in model constructed in this invention can trace the spatiotemporal expression pattern and expression level of the nphs1 gene. Compared with traditional transgenic technology, where the promoter sequence is artificially cloned, there may be incomplete cloning of regulatory sequences, which may not accurately reflect gene expression. Furthermore, the expression of transgenes is regulated by the integration site sequence. In the site-directed knock-in model constructed in this invention, the Gal4 coding sequence is precisely integrated downstream of the nphs1 genome coding sequence. Therefore, the expression of Gal4 is regulated by the expression of the endogenous gene nphs1 promoter, thus more accurately reflecting the changes in nphs1 gene expression.

[0027] (3) The zebrafish knock-in model constructed by the method described in this invention can maintain the integrity of the nphs1 coding sequence. Although gene knock-in technology has achieved some success in zebrafish, precise gene knock-in or sequence editing in zebrafish remains difficult for most sites. Furthermore, because the fine molecular mechanisms of DNA repair during gene knock-in are not fully understood, the inserted sequence generated by site-directed knock-in technology is not entirely consistent with the designed sequence. This invention utilizes CRISPR / Cas9 gene editing technology, first screening sgRNA target sequences, and then designing knock-in plasmid sequences based on the target sequences. The constructed knock-in plasmid contains a UgRNA sequence for linearization of the knock-in plasmid, short homologous sequences (approximately 20 bp) flanking the UgRNA containing the sgRNA sequence from the nphs1 genome upstream and downstream, the sgRNA sequence from the nphs1 genome and the entire downstream coding sequence, the coding sequence of the Gal4 transcription factor, and a USA:eGFP expression cassette. This ensures that after the knock-in plasmid is integrated into the nphs1 coding sequence through the microhomology-mediated end-joint repair mechanism, the integrity of the nphs1 coding sequence is maintained, thus not affecting the normal development of the zebrafish kidneys.

[0028] (4) The Gal4 / UAS transcriptional activation system inserted into the zebrafish knock-in model constructed by the present invention, with eGFP as the reporter gene, also realizes the efficient and specific induction of gene expression regulation technology in zebrafish kidney progenitor cells, which can be used to induce the efficient and specific expression of other functional genes regulated by UAS in kidney progenitor cells.

[0029] (5) The gene knock-in model constructed in this invention uses the nphs1 gene of zebrafish as the target gene, and for the first time achieves the labeling of zebrafish 1dpf kidney progenitor cells. Compared with the gene knock-in models constructed using classic marker genes of kidney progenitor cells in previous studies, which could not effectively label early kidney progenitor cells, this invention selects the nphs1 gene, which is specifically expressed in podocytes 24 hours after fertilization. Under the action of the knock-in Gal4 / UAS transcription amplification system, it can efficiently and specifically fluorescently label early kidney progenitor cells at 1dpf, and can directly observe and analyze the developmental changes of zebrafish kidney progenitor cells. This provides a powerful platform for studying and tracking the development of kidney progenitor cells in vivo, which is of great significance for the study of kidney progenitor cell-related diseases. Attached Figure Description

[0030] Figure 1 is Sequencing results of sgRNA that can generate highly efficient mutations at the nphs1 gene locus were verified.

[0031] After sgRNA targeting the 5'GATGGTATTGGATGATGG3' gene was injected into zebrafish embryos, sequencing peaks showed that the sgRNA produced a highly efficient mutation at the nphs1 gene locus.

[0032] Figure 2 This is a schematic diagram illustrating the principle of inserting a knock-in plasmid into the nphs1 gene locus.

[0033] The figure shows that: First, double-strand breaks were generated at the sgRNA target sequence at the nphs1 gene locus using CRISPR / Cas9 gene editing technology. Then, a knock-in plasmid containing the following components was constructed: a UgRNA sequence for linearizing the knock-in plasmid; short homologous sequences flanking the UgRNA sequence from the nphs1 genome upstream and downstream to ensure integration of the knock-in plasmid into the downstream of the nphs1 coding sequence via microhomology-mediated end-joint repair; the sgRNA sequence and the entire downstream coding sequence from the nphs1 genome to maintain the integrity of the nphs1 coding sequence; the coding sequence of the Gal4 transcription factor and a USA:eGFP expression cassette for fluorescent labeling of the nphs1 gene expression. Under the action of sgRNA, UgRNA, and Cas9 mRNA, the knock-in plasmid will integrate into the nphs1 genome.

[0034] Figure 3 Sequencing alignment results after the gene knock-in plasmid was inserted into the nphs1 gene locus;

[0035] The results showed that after the knock-in plasmid was inserted into the nphs1 gene locus, the integrity of the nphs1 coding sequence was maintained, but the nphs1 coding sequence termination sequence was deleted. Therefore, the nphs1 promoter will co-express the Gal4 gene downstream of the nphs1 coding sequence. The nphs1 coding sequence and the Gal4 coding sequence are separated by a 2A short peptide. The 2A short peptide ensures that the protein sequence of the nphs1 gene is not affected by the Gal4 transcription factor protein.

[0036] Figure 4 This is a fluorescence expression map of embryos in the knock-in model.

[0037] (A) Cells expressing bright GFP can be observed to be scattered on the ventral side of the notochord starting at 1 dpf in the embryo, and aggregate into clusters at 2 dpf (B). Bright GFP can be continuously observed in the anterior kidney glomeruli from 4 dpf (f, f') to 6 dpf (h, h'). Detailed Implementation

[0038] The methods described in the embodiments of this invention are conventional methods well known to those skilled in the art, unless otherwise specified. For details, please refer to *Molecular Cloning: A Laboratory Manual* (2nd edition, J. Sambrook et al., Science Press, 1993). Unless otherwise specified, the biological reagents used in this invention are from Ferrantas.

[0039] Example 1:

[0040] A method for constructing a zebrafish model of efficient and specific fluorescent labeling of early renal progenitor cells, comprising the following steps:

[0041] 1. Synthesize high-efficiency sgRNA on the nphs1 gene

[0042] A target site for sgRNA was selected at the zebrafish nphs1 gene locus, specifically 5'GATGGTATTGGATGATGG3'. The corresponding sgRNA was synthesized via in vitro transcription. Embryos were microinjected, and the sgRNA cleavage efficiency at the target site was assessed. Finally, high-efficiency sgRNAs meeting the gene knock-in requirements were selected at the last intron. The specific preparation process is as follows:

[0043] (1) Synthesis of sgRNA at specific sites

[0044] Based on the nphs1 gene sequence reported in Ensembl (GRCz11) under gene number ENSDARG00000060758, sgRNA target primers sgRNA-nphs1 (5' TTGTAATACGACTCACTATAGATGGTATTGGATGATGGGTTTTAGAGCTAGAAATAG3') and gRNA-R (5' AAAAAAAGCACCGACTCGGTGCCACT3') were designed using the last intron sequence of the nphs1 genome transcript. Using plasmid pMD19-T-gRNA scaffold (http: / / www.zfish.cn / resource / CZP3) as a template, the gRNA template was amplified by PCR. The gRNA template was recovered using a PCR product recovery kit. Then, sgRNA was synthesized using T7 RNA polymerase and recovered using a reaction recovery kit. Its sequence is shown in SEQ ID NO.1.

[0045] (2) Cas9 mRNA synthesis

[0046] Cas9 mRNA was synthesized using plasmid pT3TS(T3:zCas9-UTRglobin) (http: / / www.zfish.cn / resource / CZP11) and an in vitro transcription kit (Ambion mMESSAGE mMACHINE kit).

[0047] (3) Target validation and target efficiency

[0048] A sgRNA / Cas9 mRNA complex (Cas9 mRNA: 500 ng / µl, sgRNA: 50 ng / µl) was injected into zebrafish embryos. When the embryos reached 1 day post-fetal (dpf), embryonic genomic DNA was extracted. The nphs1 gene sequence was amplified by PCR using primers nphs1-F (5'CACAAGCCCTTTCACTCAT3') and nphs1-R (5'CAAAACGGCAGGTCTGTATC3'). Sequencing was then used to detect mutations in the nphs1 gene sequence. Sequencing peaks showed that sgRNA generated a highly efficient mutation at the nphs1 gene locus, which could be used for gene knock-in. The sequencing peaks were as follows: Figure 1 Show.

[0049] 2. Gene knock-in plasmid construction

[0050] (1) Gene knock-in plasmid design

[0051] The artificially synthesized knock-in plasmid p(nphs1-P2A-Gal4-UTRactin; UAS:GFP-UTRglobin) has the sequence shown in SEQ ID NO.3, as follows: Figure 2 As shown in SEQ ID NO.3, the knock-in plasmid p(nphs1-P2A-Gal4-UTRactin; UAS:GFP-UTRglobin) has the following characteristics:

[0052] A. Contains a UgRNA sequence. Used for gene knock-in plasmid linearization. The UgRNA sequence is artificially designed and its sequence is shown in SEQ ID NO.2.

[0053] B. The UgRNA contains short homologous sequences upstream and downstream of the sgRNA sequence in the nphs1 genome. When the nphs1 genome undergoes a double-strand break under the influence of sgRNA, and the knock-in plasmid also undergoes a double-strand break under the influence of UgRNA, the DNA double-strand break will trigger the cell's DNA double-strand break repair mechanism. The microhomologous sequences flanking the UgRNA will mediate the precise integration of the knock-in plasmid into the nphs1 genome.

[0054] C. Contains the sgRNA sequence from the nphs1 genome and the complete downstream coding sequence. Used to maintain the integrity of the nphs1 genome sequence after knock-in plasmid insertion. However, a single-base mutation is performed on the sgRNA sequence in the knock-in vector to ensure that the sgRNA cannot be recognized after insertion, and that the sgRNA is located within an intron, so that single-base mutations in the intron do not affect the coding sequence of the nphs1 gene.

[0055] D. Contains the coding sequence of the Gal4 transcription factor. The coding sequence of the Gal4 transcription factor is separated from the nphs1 genome by a 2A short peptide. After the knock-in plasmid is inserted, the coding sequence of the Gal4 transcription factor will be inserted downstream of the coding sequence of the nphs1 genome, and the 2A short peptide ensures that the protein sequence of the nphs1 gene is not affected by the Gal4 transcription factor protein.

[0056] E. Contains the UAS:eGFP expression cassette. After plasmid insertion, eGFP is used as the reporter gene, and nphs1 expression is tracked by fluorescence. This enables a highly efficient and specific gene expression regulation technique to be established in zebrafish kidney progenitor cells. The eGFP reporter gene can be replaced with other appropriate reporter genes, such as red, yellow, or blue fluorescent genes, to complete this invention.

[0057] (2) Construction of gene knock-in plasmid

[0058] The artificially synthesized sequence F contains AgeI and BspEI double restriction sites, the aforementioned UgRNA sequence, short homologous sequences flanking the UgRNA containing the sgRNA sequence from the nphs1 genome upstream and downstream, the sgRNA sequence from the nphs1 genome, and the entire downstream coding sequence. The specific sequence is as follows:

[0059] accggtggtggtgcaatagttgggtcaacgacttcctgcacgggcactgagtgatggtattggatgagggtggtgcaatagttttcatataacagattctctccgcagattctattttgtttatggatgtcatttatttg gattttttctctatagggaagagcatacagtaaagctgatgtggacgtaacaattggagctttgattcaatggtgtacagacgcagaagagatacagacctgccgtttgagctcagaggcgagctggttggatccgga.

[0060] The synthesized sequence F was ligated into the artificially synthesized plasmid p (P2A-Gal4-UTRactin; UAS:GFP-UTRglobin) by AgeI and BspEI restriction enzyme digestion and ligation, thus obtaining the knock-in plasmid p (nphs1-P2A-Gal4-UTRactin; UAS:GFP-UTRglobin), the sequence of which is shown in SEQ ID NO.3.

[0061] (3) Universal UgRNA synthesis

[0062] UgRNA was synthesized in vitro for linearization of gene knock-in plasmids. First, based on the UgRNA sequence in the gene knock-in plasmid, UgRNA target primers UgRNA-F (5' TTGTAATACGACTCACTATAGGTCAACGACTTCCTGCACGTTTTAGAGCTAGAAATAG3') and gRNA-R (5' AAAAAAAGCACCGACTCGGTGCCACT3') were designed. Using plasmid pMD19-T-gRNAscaffold (http: / / www.zfish.cn / resource / CZP3) as a template, the gRNA template was amplified by PCR. The gRNA template was recovered using a PCR product recovery kit. Then, UgRNA was synthesized using T7 RNA polymerase and recovered using a reaction recovery kit. Its sequence is shown in SEQ ID NO.2.

[0063] 3. Microinjection to establish F0 generation gene knock-in zebrafish

[0064] Through microinjection and microinjection method (Zhu Z, Li G, He L, et al. Novel gene transfer into the fertilized eggs of goldfish (Carassius auratus L. 1758). Z angew Ichthyol (1985, 1:31-34) Gene knock-in system was injected into zebrafish embryos to obtain F0 generation embryos, with 1 nl injected into each embryo. The knock-in system included gene knock-in plasmid p(nphs1-P2A-Gal4-UTRactin; UAS:GFP-UTRglobin): 20 ng / ul, Cas9 mRNA: 500 ng / ul, target site sgRNA: 50 ng / ul, and universal target UgRNA on the knock-in plasmid: 500 ng / ul.

[0065] 4. Genetic testing of F0 generation gene knock-in zebrafish

[0066] The F0 generation gene knock-in population was cultured until sexual maturity. Twelve F0 offspring were then crossbred one by one with wild-type zebrafish. The hybrid embryos were cultured at 28ºC, and fluorescence screening was performed under a fluorescence microscope. Three F0 offspring were found to specifically express fluorescence in kidney progenitor cells. Embryos with positive fluorescence expression were selected as the F1 generation for further culture. The knock-in efficiency of the F0 generation was as high as 25%.

[0067] 5. Screening and identification of F1 generation individuals

[0068] The F1 generation was cultured to sexual maturity, and the caudal fins of F1 zebrafish were harvested. The knock-in sequence was amplified by PCR using primers nphs1-F (5'CACAAGCCCTTTCACTCAT3') and Gal4-R (5'GATGAGCCCTTGTGAGTGG'). Sequencing was then used to screen F1 zebrafish whose knock-in plasmids were integrated into the nphs1 genome sequence. In this example, the intact CDS sequence of the nphs1 gene in the F1 generation selected through sequencing indicates that the nphs1 gene function is not affected. The sequencing results are as follows: Figure 3 .

[0069] Therefore, after the zebrafish model knock-in plasmid constructed in this invention is integrated into the nphs1 genome sequence, the nphs1 gene coding sequence remains intact, the coding sequence of the Gal4 transcription factor will be precisely inserted downstream of the nphs1 coding sequence in the genome, and the 2A short peptide ensures that the protein sequence of the nphs1 gene is not affected by the Gal4 transcription factor protein.

[0070] 6. F1 generation breeds F2 generation

[0071] The F1 generation with the correct genotype was used to breed the F2 generation. F2 embryos with positive fluorescence expression were selected under a fluorescence dissecting microscope to obtain a zebrafish model Ki (nphs1-P2A-Gal4-UTRactin; UAS:GFP-UTRglobin) that can be stably inherited by targeting the nphs1 gene with fluorescent knock-in.

[0072] 7. Gene knock-in of zebrafish embryos resulted in highly efficient and specific expression of GFP in 1dpf kidney progenitor cells.

[0073] Ki(nphs1-P2A-Gal4-UTRactin;UAS:GFP-UTRglobin) embryos were observed under a fluorescence microscope for fluorescence tracking. The results showed that the fluorescence expression characteristics of cells expressing bright GFP were consistent with the expression of the nphs1 gene (Kramer-Zucker AG, Wiessner S, Jensen AM, Drummond IA. Organization of the pronephric filtration apparatus in zebrafish requires Nephrin, Podocin and the FERM domain protein Mosaic eyes. Dev Biol. 2005 Sep 15;285(2):316-29.doi: 10.1016 / j.ydbio.2005.06.038. PMID: 16102746; PMCID: PMC2836015.). Specifically, cells expressing bright GFP could be observed to be scattered on the ventral side of the notochord starting at 1 dpf of the embryo, and aggregated into clusters at 2 dpf. Bright GFP was consistently observed in the anterior kidney glomeruli from 4 dpf to 6 dpf.

[0074] Therefore, the zebrafish model constructed in this invention co-expresses the Gal4 gene with the endogenous nphs1 promoter. Under the action of the Gal4 / UAS transcription amplification system and with GFP as a reporter gene, the spatiotemporal expression of the nephrin gene can be tracked in live zebrafish. Simultaneously, it efficiently and specifically expresses fluorescent protein in kidney progenitor cells at 1 dpf, thus providing a powerful platform for in vivo observation and tracking of kidney progenitor cell development.

Claims

1. A highly efficient and specific fluorescently labeled knock-in system for early zebrafish kidney progenitor cells, wherein the system is a reagent or kit, and the reagent or kit comprises: Knock-in plasmid, Cas9 mRNA, UgRNA and sgRNA; The sgRNA is shown in SEQ ID NO.1, the UgRNA is shown in SEQ ID NO.2, and the knock-in plasmid is shown in SEQ ID NO.

3.

2. A highly efficient and specific fluorescently labeled knock-in system for early zebrafish kidney progenitor cells, wherein the system is a reagent or kit, and the reagent or kit comprises: Knock-in plasmid, Cas9 mRNA, UgRNA and sgRNA; The sgRNA is shown in SEQ ID NO.1, the UgRNA is shown in SEQ ID NO.2, and the knock-in plasmid is shown in SEQ ID NO.

3. The green fluorescent gene in the knock-in plasmid is replaced with a yellow fluorescent gene, a red fluorescent gene, or a blue fluorescent gene.

3. The knock-in system according to claim 1 or 2, wherein the concentrations of each substance in the knock-in system are: 20 ng / ul knock-in plasmid, 500 ng / ul Cas9 mRNA, 50 ng / ul sgRNA and 500 ng / ul UgRNA.

4. A zebrafish model of early renal progenitor cells with highly efficient and specific fluorescent labeling, obtained by microinjection of the knock-in system of claim 1 or 2 into a zebrafish embryo.

5. A method for constructing a zebrafish model of early renal progenitor cells with efficient and specific fluorescent labeling and stable inheritance, comprising the following steps: The knock-in system described in claim 1 or 2 is microinjected into zebrafish embryos. After the F0 generation embryos reach sexual maturity, each F0 generation individual is crossbred with a wild-type strain. Embryos are collected for fluorescence screening, and F1 generation individuals with positive fluorescence expression are selected and further sequenced. The F1 generation with the correct genotype is then used to breed F2 generation to obtain a zebrafish model.

6. Any of the following applications of the knock-in system according to claim 1 or 2: 1) Zebrafish used to prepare fluorescently labeled kidney progenitor cells; 2) Zebrafish models for drug screening in kidney diseases; 3) Used to prepare zebrafish models for studying the pharmacology of kidney diseases; 4) Used to prepare a zebrafish model for observing the developmental changes of early renal progenitor cells in zebrafish; 5) Used to prepare zebrafish models for studying kidney progenitor cell diseases.

Images