Bacillus thuringiensis CMS-5E8 and application thereof
By using Bacillus thuringiensis CMS-5E8 carrying multiple insecticidal protein encoding genes, the problem of controlling diamondback moth, flea beetle, and sclerotinia stem rot in cruciferous vegetables in Hainan Province has been solved, achieving integrated pest management and promoting the development of green agriculture.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-16
- Publication Date
- 2026-03-13
AI Technical Summary
Existing technologies are insufficient to effectively control diamondback moth, flea beetle, and sclerotinia stem rot in cruciferous vegetables in Hainan Province, especially lacking biological control methods that can simultaneously target multiple pests and diseases.
Bacillus thuringiensis CMS-5E8, which carries multiple insecticidal protein encoding genes, including Cry1Aa, Cry1Ah, and Cry1Be, was used to prepare microbial preparations to inhibit vegetable diseases and kill pests.
It has achieved effective suppression of sclerotinia stem rot in Chinese cabbage and efficient eradication of diamondback moth and flea beetle, promoting the sustainable development of green agricultural production.
Smart Images

Figure CN121653008A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological control technology, specifically relating to Bacillus thuringiensis CMS-5E8 and its applications. Background Technology
[0002] The diamondback moth (Plutella xylostella), belonging to the family Plutellidae in the order Lepidoptera, is a major global pest of cruciferous vegetables, primarily damaging cabbage, cauliflower, Chinese cabbage, and radish. In the climate of Hainan Province, this insect has multiple generations per year, exceeding 10, with significant generation overlap. It causes damage year-round, especially the larvae which feed intensively on leaves, sometimes leaving only the veins, resulting in loss of photosynthetic capacity and significantly impacting vegetable yield and quality. Due to the high cropping index of vegetables and the prevalence of continuous cropping and intercropping, food is abundant in the fields year-round. Combined with the warm and humid climate, this provides ideal conditions for the continuous reproduction and accumulation of diamondback moth populations. Furthermore, this insect has developed varying degrees of resistance to multiple chemical pesticides, making control increasingly difficult and thus gradually rising to become a key pest of cruciferous vegetables in Hainan Province, posing a sustained threat to vegetable production safety.
[0003] The striped flea beetle (Phyllotreta striolata), belonging to the family Chrysomelidae in the order Coleoptera, is commonly known as the dog flea, cabbage flea, or ground beetle. It primarily infests cruciferous vegetables such as cabbage, radish, mustard greens, and kale. In Hainan Province, this insect has 7-8 generations per year, with overlapping generations. Adults and larvae cause damage year-round, with seedlings suffering the most severe damage. Adults can also spread diseases such as soft rot and black rot in cabbage. With the adjustment of Hainan Province's planting structure and the continuous expansion of vegetable planting area, the province's annual vegetable planting area is expected to reach approximately 153,000 mu (10,200 hectares) by 2025. Furthermore, the prevalence of continuous cropping and intercropping in most areas creates a suitable environment for the striped flea beetle's continuous damage, making it one of the major vegetable pests in Hainan Province.
[0004] *Sclerotinia sclerotiorum* (Lib.) de Bary is a necrotrophic plant fungal pathogen with a very wide host range, affecting more than 6,000 plant species across 75 families, including various types of cruciferous vegetables, legumes, and peanuts. Sclerotinia sclerotiorum rot in Chinese cabbage is a serious disease caused by *Sclerotinia sclerotiorum*, severely impacting rapeseed yield and quality, leading to tissue rot, lodging, and even the death of the entire plant. Chemical pesticides are the most effective means of controlling sclerotinia sclerotiorum rot; however, with increasingly severe environmental and resistance issues, biological control has become a sustainable and effective strategy due to its environmental friendliness and low likelihood of resistance development. Currently, biological control agents mainly include fungi, bacteria, and fungal viruses. Fungi mainly include *Trichoderma* and *Coniothyrium minitans*. Bacteria mainly include *Bacillus* and *Pseudomonas*. Bacillus has played an important role in the prevention and control of various diseases due to its wide distribution, strong genetic stability, and strong resistance.
[0005] Bacillus thuringiensis (Bt) is a species of Gram-positive spore-forming bacillus widely found in soil, rhizosphere, water, and insect bodies. It produces insecticidal crystal proteins with high insecticidal activity and is widely used to control Lepidoptera, Hemiptera, and Coleoptera pests. In biological control, Bt formulations are the most widely used and successful biological insecticides, accounting for approximately 3% of the insecticide market. Their application in pest and disease control has significant practical value. In recent years, Bacillus thuringiensis (Bt) has made significant progress in inhibiting fungal diseases as an important biocontrol resource. Its antibacterial mechanism has surpassed traditional insecticidal crystal proteins, and has been found to involve multi-pathway and multi-molecular synergistic effects. Current research is progressing from strain screening to the identification of its antibacterial active ingredients, the analysis of its mechanism of action, and genetic modification. Enhancing the production of antibacterial substances such as chitinase through genetic engineering has become a hot topic. Meanwhile, developing highly efficient and stable compound microbial pesticides by combining Bt formulations with other biocontrol bacteria or low-dose chemical pesticides is an important direction for promoting its field application. These advances have laid a solid foundation for Bt to become a green pesticide for controlling fungal diseases.
[0006] Nevertheless, screening for more novel and specific Bacillus thuringiensis strains for highly effective insecticidal purposes against specific target pests remains an important task in the development of biocontrol microbial products. Summary of the Invention
[0007] To address the shortcomings of existing technologies and practical needs, this invention provides a novel Bacillus thuringiensis, which is applied to inhibit sclerotinia stem rot in Chinese cabbage and / or kill the diamondback moth (a lepidopteran pest) and / or the flea beetle (a coleopteran pest).
[0008] Specifically, the present invention adopts the following technical solution:
[0009] In a first aspect, the present invention provides a Bacillus thuringiensis CMS-5E8, which is classified and named Bacillus thuringiensis. It is deposited at the China General Microbiological Culture Collection Center with accession number CGMCC 35311 and deposit date of July 21, 2025.
[0010] In one or more embodiments, the strain carries sixteen insecticidal protein encoding genes: Cry1Aa, Cry1Ah, Cry1Be, Cry1If, Cry1Na, Cry1Ea, Cry1La, Cry2Ab, Cry2Ah, Vip3Aa, Vip3Ad, Spp1Aa, Vpb4Ca, Tpp78Ba, Mpp46Ab, and Mpp3Aa.The nucleotide sequence of the Cry1Aa gene is shown in SEQ ID NO: 1, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 2; the nucleotide sequence of the Cry1Ah gene is shown in SEQ ID NO: 3, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 4; the nucleotide sequence of the Cry1Be gene is shown in SEQ ID NO: 5, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 6; the nucleotide sequence of the Cry1If gene is shown in SEQ ID NO: 7, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 8; the nucleotide sequence of the Cry1Na gene is shown in SEQ ID NO: 9, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 10; the nucleotide sequence of the Cry1Ea gene is shown in SEQ ID NO: 11, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 12; the nucleotide sequence of the Cry1La gene is shown in SEQ ID NO: 13, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 14. The nucleotide sequence of the Cry2Ab gene is shown in SEQ ID NO: 14; the nucleotide sequence of the Cry2Ab gene is shown in SEQ ID NO: 15, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 16; the nucleotide sequence of the Cry2Ah gene is shown in SEQ ID NO: 17, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 18; the nucleotide sequence of the Vip3Aa gene is shown in SEQ ID NO: 19, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 20; the nucleotide sequence of the Vip3Ad gene is shown in SEQ ID NO: 21, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 22; the nucleotide sequence of the Spp1Aa gene is shown in SEQ ID NO: 23, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 24; the nucleotide sequence of the Vpb4Ca gene is shown in SEQ ID NO: 25, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 26; the nucleotide sequence of the Tpp78Ba gene is shown in SEQ ID NO: 14. As shown in NO: 27, the amino acid sequence of the insecticidal protein encoded by it is shown in SEQ ID NO: 28; the nucleotide sequence of the Mpp46Ab gene is shown in SEQ ID NO: 29, and the amino acid sequence of the insecticidal protein encoded by it is shown in SEQ ID NO: 30; the nucleotide sequence of the Mpp3Aa gene is shown in SEQ ID NO: 31, and the amino acid sequence of the insecticidal protein encoded by it is shown in SEQ ID NO: 32.
[0011] Secondly, the present invention provides a microbial preparation containing Bacillus thuringiensis as described in the present invention, or containing fermentation broth of Bacillus thuringiensis, or containing lyophilized powder of Bacillus thuringiensis, or containing inactivated cells of Bacillus thuringiensis, or containing lysate of Bacillus thuringiensis, or containing extract of Bacillus thuringiensis.
[0012] It should be understood that microbial strains used for biocontrol generally produce certain special products during their growth or fermentation process, such as antibiotics, bacteriocins, proteins, or other antibacterial substances. Therefore, the scope of protection of this invention should also include the products of Bacillus thuringiensis, including but not limited to Bacillus thuringiensis fermentation broth, Bacillus thuringiensis lyophilized powder, inactivated Bacillus thuringiensis cells, Bacillus thuringiensis lysates, and Bacillus thuringiensis extracts.
[0013] Thirdly, the present invention provides the application of the Bacillus thuringiensis or the microbial preparations described herein in inhibiting vegetable diseases and / or killing lepidopteran pests and / or killing coleopteran pests.
[0014] The Bacillus thuringiensis described in this invention not only inhibits vegetable diseases but can also be used to kill lepidopteran and coleopteran pests. As mentioned above, the scope of protection of this invention also includes the products of the Bacillus thuringiensis. Therefore, any product containing the Bacillus thuringiensis, or a fermentation broth containing the Bacillus thuringiensis, or a freeze-dried powder containing the Bacillus thuringiensis, or inactivated cells containing the Bacillus thuringiensis, or lysates containing the Bacillus thuringiensis, or an extract containing the Bacillus thuringiensis, can also be used to inhibit vegetable diseases and / or kill lepidopteran and / or coleopteran pests.
[0015] Fourthly, the present invention provides the use of the Bacillus thuringiensis or the microbial preparations described herein in the preparation of pesticides for inhibiting vegetable diseases and / or killing lepidopteran pests and / or killing coleopteran pests.
[0016] In one or more embodiments, the vegetable disease is sclerotinia stem rot of Chinese cabbage; the lepidopteran pest is diamondback moth; and the coleopteran pest is striped flea beetle.
[0017] In one or more embodiments, the culture temperature of the Bacillus thuringiensis is 30°C.
[0018] Fifthly, the present invention provides a pesticide formulation comprising at least one of the Bacillus thuringiensis and the microbial formulation described herein.
[0019] In one or more embodiments, the pesticide formulation further includes other microbial agents that have a synergistic effect with the Bacillus thuringiensis described in this invention.
[0020] It should be understood that although the Bacillus thuringiensis described in this invention can inhibit vegetable diseases and kill lepidopteran and coleopteran pests, it is not excluded that it can be used in combination with other biocontrol bacteria with similar functions or other pathogen control functions, so that the pesticide of this invention has a stronger effect in inhibiting vegetable diseases and / or killing lepidopteran and / or killing coleopteran pests, or has a broader function in controlling other pathogens.
[0021] In one or more embodiments, the pesticide formulation is a suspension concentrate, an oil suspension concentrate, a powder, a wettable powder, or a granule.
[0022] It should be understood that the pesticide formulations described in this invention refer to compositions that utilize beneficial microorganisms to kill or suppress the number of pathogenic organisms to control the occurrence and development of plant diseases. The pesticide formulations described in this invention contain the aforementioned Bacillus thuringiensis or the aforementioned microbial preparations, and can be prepared into formulations of different forms according to reagent requirements. Furthermore, the pesticide formulations of the present invention may, as needed, include appropriate carriers or excipients such as solvents, propellants, solubilizers, co-solvents, emulsifiers, colorants, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, flow aids, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesion agents, integrators, penetration enhancers, pH adjusters, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, encapsulating agents, humectants, absorbents, diluents, flocculants and anti-flocculation agents, filter aids, release inhibitors, etc. Of course, the addition of these carriers or excipients should not affect the original biological control effect of the Bacillus thuringiensis or the microbial formulations.
[0023] Compared with the prior art, the present invention has the following advantages:
[0024] This invention directly isolated and screened Bacillus thuringiensis strain CMS-5E8 from soil samples of wild rice fields in Hainan. This strain carries 16 insecticidal protein encoding genes, including Cry1Aa, Cry1Ah, Cry1Be, Cry1If, Cry1Na, Cry1Ea, Cry1La, Cry2Ab, Cry2Ah, Vip3Aa, Vip3Ad, Spp1Aa, Vpb4Ca, Tpp78Ba, Mpp46Ab, and Mpp3Aa. It not only exhibits strong insecticidal toxicity and good insecticidal effect but also has a certain inhibitory effect on fungal diseases. It can be widely applied in agricultural pest and disease control, promoting the sustainable development of green agricultural production. Attached Figure Description
[0025] Figure 1 The cell and crystal morphology of the Bacillus thuringiensis CMS-5E8 strain described in this invention.
[0026] Figure 2 This is the experimental result of the antibacterial activity of Bacillus thuringiensis CMS-5E8 described in this invention against Sclerotinia sclerotinia in Chinese cabbage. Detailed Implementation
[0027] Bacillus thuringiensis, or Bt for short, is a Gram-positive bacterium widely found in soil worldwide. It is currently the most thoroughly researched, widely used, and successful microbial pesticide in the world, playing a crucial role in organic agriculture and integrated pest management. The most unique feature of Bacillus thuringiensis is that while forming spores (a dormant form that helps the bacteria resist adverse environments), it produces a crystalline protein toxic to specific insects, also known as "δ-endotoxin" or "insectic crystalline protein."
[0028] Although existing technologies disclose that Bacillus thuringiensis can be used to control a variety of crop pests, there are no reports that the bacterium can be used simultaneously to suppress vegetable diseases, kill lepidopteran and coleopteran pests, especially to suppress sclerotinia stem rot of cabbage, and kill diamondback moth and flea beetle.
[0029] It should be understood that in this invention, Bacillus thuringiensis CMS-5E8, Bacillus thuringiensis CMS-5E8, Bacillus thuringiensis CMS-5E8, or the abbreviated description "CMS-5E8" are all different names for the same strain, and those skilled in the art would not consider these strains with different names to be different strains.
[0030] Example
[0031] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.
[0032] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention.
[0033] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0034] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.
[0035] Example 1: Isolation, screening, identification and preservation of Bacillus thuringiensis
[0036] 1.1 Separation and Screening
[0037] Soil samples were collected from fields in Hongqi Town, Qiongshan District, Haikou City, Hainan Province, where water chestnuts are grown. A suitable amount of soil sample was added to isolation medium and incubated at 30℃ and 200rpm for 10 hours. Afterward, the samples were incubated in a water bath at 80℃ for 15 minutes. 100µL of each of four concentrations (stock solution, stock solution diluted 10 times, 100 times, and 1000 times) was pipetted onto 1 / 2LB solid plates (two plates for each concentration). Small glass beads were added and the plates were shaken to ensure even distribution. After standing at room temperature for 10 minutes, the plates were placed in a 30℃ incubator. After 48 hours, colony morphology was observed. Colonies resembling Bt were selected, stained with fuchsin, and examined under an oil immersion microscope for the presence of spores and parasporal crystals. Bacillus thuringiensis strains detected from the same isolate were selected based on colony morphology and color, vegetative cells, and spore crystal morphology. One strain of each morphology was purified and preserved for future use.
[0038] One of the strains (later named CMS-5E8) formed single colonies after 48 hours of cultivation on 1 / 2 LB medium. The colonies were milky white, round or nearly round, with neat edges, thicker in the center and gradually thinning towards the edges. Crystals were generally observed after about 30 hours. Under a scanning electron microscope, the Bt strain cells were observed to be long rod-shaped, the spores were oblong rod-shaped, and the crystals were rhomboid (e.g., ...). Figure 1 (As shown).
[0039] 1.2 Identification
[0040] Genomic DNA was extracted from the strain, and a bacterial framework diagram was constructed by Shanghai Sangon Biotech Co., Ltd. The insecticidal genes contained in the strain were analyzed by alignment using the Bt Toxin database (http: / / bcam.hzau.edu.cn / BtToxin_scanner / index.php). Full-length primers (see Table 1) were designed to clone the full-length insecticidal genes. The sequencing results were aligned by NCBI Blast sequence comparison and analyzed by DNAMAN 5.2 software using Multiple Sequence Alignment.
[0041] Morphological and molecular biological identification revealed that the strain was Bacillus thuringiensis, and that the strain contained sixteen insecticidal protein encoding genes: Cry1Aa, Cry1Ah, Cry1Be, Cry1If, Cry1Na, Cry1Ea, Cry1La, Cry2Ab, Cry2Ah, Vip3Aa, Vip3Ad, Spp1Aa, Vpb4Ca, Tpp78Ba, Mpp46Ab, and Mpp3Aa.The nucleotide sequence of the Cry1Aa gene is shown in SEQ ID NO: 1, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 2; the nucleotide sequence of the Cry1Ah gene is shown in SEQ ID NO: 3, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 4; the nucleotide sequence of the Cry1Be gene is shown in SEQ ID NO: 5, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 6; the nucleotide sequence of the Cry1If gene is shown in SEQ ID NO: 7, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 8; the nucleotide sequence of the Cry1Na gene is shown in SEQ ID NO: 9, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 10; the nucleotide sequence of the Cry1Ea gene is shown in SEQ ID NO: 11, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 12; the nucleotide sequence of the Cry1La gene is shown in SEQ ID NO: 13, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 14. The nucleotide sequence of the Cry2Ab gene is shown in SEQ ID NO: 14; the nucleotide sequence of the Cry2Ab gene is shown in SEQ ID NO: 15, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 16; the nucleotide sequence of the Cry2Ah gene is shown in SEQ ID NO: 17, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 18; the nucleotide sequence of the Vip3Aa gene is shown in SEQ ID NO: 19, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 20; the nucleotide sequence of the Vip3Ad gene is shown in SEQ ID NO: 21, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 22; the nucleotide sequence of the Spp1Aa gene is shown in SEQ ID NO: 23, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 24; the nucleotide sequence of the Vpb4Ca gene is shown in SEQ ID NO: 25, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 26; the nucleotide sequence of the Tpp78Ba gene is shown in SEQ ID NO: 14. As shown in NO: 27, the amino acid sequence of the insecticidal protein encoded by it is shown in SEQ ID NO: 28; the nucleotide sequence of the Mpp46Ab gene is shown in SEQ ID NO: 29, and the amino acid sequence of the insecticidal protein encoded by it is shown in SEQ ID NO: 30; the nucleotide sequence of the Mpp3Aa gene is shown in SEQ ID NO: 31, and the amino acid sequence of the insecticidal protein encoded by it is shown in SEQ ID NO: 32.
[0042] According to NCBI BLAST analysis, the Cry1Aa, Cry1Ah, Cry1Be, Cry1Na, Cry1Ea, Cry1La, Cry2Ab, Cry2Ah, Vip3Aa, Vip3Ad, Ssp1Aa, Vpb4Ca, Tpp78Ba, and Mpp46Ab genes in strain CMS-5E8 showed a maximum similarity of 100% with known DNA and amino acid sequences. The Cry1If gene showed a maximum similarity of 99% with known DNA and amino acid sequences, and the Mpp3Aa gene showed a maximum similarity of 73% with known DNA and amino acid sequences.
[0043] Table 1. Primers for full-length genes
[0044] Primer Sequence (5’- 3’) Cry1Aa-5 ATGGATAACAATCCGAACATCAATGAAT Cry1Aa-3 CTATTCCTCCATAAGGAGTAATTCCACGCT Cry1Ah-5 ATGGAGATAGTGAATAATCAGAATCAATG Cry1Ah-3 CTATTCCTCCATAAGGAGTAATTCCAC Cry1Be-5 ATGACTTCAAATAGGAAAAATGAGAATGAAAT Cry1Be-3 CTATTCCTCC ATAAGGAGTAATTCCACG Cry1If-5 GTGAAAGCATTGGTATATTCTTGGACG Cry1If-3 CTACATGTTACGCTCAATATGGAGTTG Cry1Na-5 ATGAATTCAAAGGAACATGATTATCTAAAAGT Cry1Na-3 CTATTCAACAGGAATAAATTCAATTTTATCCAC Cry1Ea-5 ATGGAGATAGTGAATAATCAGAATCAATGC Cry1Ea-3 TTATTCCTCCATAAGAAGTA ATTCCACGCT Cry1La-5 ATGGATAACAATCCGAAAATCCAGGAAT Cry1La-3 TTATTCCTCCATAAGGAGTA ATTCCACGCT Cry2Ab-5 ATGAATAGTGTATTGAATAGCGGAAGAACT Cry2Ab-3 TTAATAAAGTGGTGAAATAT TAGTTGGTACAAG Cry2Ah-5 ATGAATAGTGTATTGAATAGCGGAAGAGCTACT Cry2Ah-3 TTAATAAAGTGGTGAAATATTAGTTGGAACAAAC Vip3Aa-5 ATGAACAAGAATAATACTAAATTAAGCACAAGAG Vip3Aa-3 TTACTTAATAGAGACATCGTAAAAATGTACAATAGG Vip3Ad-5 ATGAATAATACTAAATTAAATGCAAGGGCCTTAC Vip3Ad-3 TTATTTAATAGAGAAATCATAAAAATGTACAATAGTACC Ssp1Aa-5 GTGATTTTTCTGAATATTAAGAAAAACA Ssp1Aa-3 TTAATGACTAATACTAGCTGTTGGGTATA Vpb4Ca-5 ATGATGAAAAAAATCCCTCATAAACTACT Vpb4Ca-3 TCAGTTCATTATATTTTGTACTTTGTCT Tpp78Ba-5 ATGAAAAAAAAGAAGATTAAGAGATTGCCG Tpp78Ba-3 CTAATTAGTTATTGTTCTTACTAGTGTTTGATTCG Mpp46Ab-5 ATGATTATACAAGAAAAATTATCTTTTTCAGATCTAG Mpp46Ab-3 CTACTTGATCACTTTTTGTTTATAGGAATA AGGTTC Mpp3Aa-5 ATGGGTATAAGTGTTTTATCATTTCCTTTAGCT Mpp3Aa-3 TTACATATTTAAATGAACCTCCATATTTATAAACAAG
[0045] 1.3 Preservation
[0046] The strain CMS-5E8 was deposited on July 21, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC 35311, and classified as Bacillus thuringiensis.
[0047] Example 2: Pretreatment of CMS-B11 fermentation broth and quantification of parasporal crystal proteins
[0048] 2.1 Pretreatment of CMS-B11 fermentation broth
[0049] The CMS-5E8 strain preserved in glycerol tubes was inoculated into 5 mL (approximately 10 μL) of sterilized LB liquid medium and cultured at 30°C for 8–12 h (OD600 > 0.8) to obtain seed culture. This seed culture was then inoculated at a volume fraction of 5% into sterilized beef extract peptone fermentation medium and fermented at 30°C with shaking for 48–50 h. The supernatant was used for indoor antibacterial activity tests. The fermentation broth was centrifuged at 4500 r / min for 15 min, and the supernatant was collected and concentrated 10-fold. Appropriate concentrations were prepared according to experimental requirements for indoor and field control trials.
[0050] 2.2 Quantitative analysis of parasporal crystal proteins
[0051] First, inoculate the culture medium with unconcentrated beef extract peptone until the bacterial cells undergo lipid lysis (30℃ constant temperature, 230 rpm / min shaking culture for 39 h); collect the bacterial cells by centrifugation at 10000 rpm for 8 min in a low-temperature refrigerated centrifuge; suspend the bacterial cells in 1M NaCl and centrifuge at 10000 rpm for 8 min, discarding the supernatant; wash the precipitate with sterile distilled water; resuspend the precipitate in 50 mM Na2CO3 and 50 mM EDTA (5% mercaptoethanol, pH 9.5-10.5) and incubate on ice at 100 rpm for at least 4 hours; centrifuge at 10000 rpm for 10 min, and collect the supernatant; add 1 / 10 volume of 3M NaAc to the supernatant to adjust the pH to 4.5-5.0, mix well, and incubate on ice for at least 2 hours; centrifuge at 10000 rpm for 10 min, and collect the precipitate; wash the protein with sterile distilled water until no mercaptoethanol remains; dissolve the precipitate in an appropriate amount of 50 mM Na2CO3 (pH 10.2) and incubate on ice for 1 hour. After dissolution, SDS-PAGE and BSA were compared for quantification, and the concentration of the protein lysate was determined to be 75 μg / mL.
[0052] Example 3: Determination of the indoor antibacterial activity of CMS-5E8 against Sclerotinia stem rot in Chinese cabbage
[0053] Indoor antibacterial activity was determined using the confrontation method and the Oxford cup method. The pathogenic fungus (from the National Engineering Research Center for Pesticides, Nankai University) was placed in the center of a petri dish, with three Oxford cups placed at equal intervals. Each Oxford cup was inoculated with 50 μL of fresh Bt fermentation broth. After 48–72 h, the size of the bacterial colony was measured. Each treatment was replicated three times.
[0054] Colony diameter was measured using the cross-multiplication method. The target bacterial colony diameter was denoted as D, and the control group colony diameter was denoted as Do. The mycelial growth inhibition rate of the pathogen was calculated using the following formula:
[0055] Mycelial growth inhibition rate (%) = (Do - D) / (Do - 4) x 100%
[0056] The results are as follows Figure 2 As shown, the calculated inhibition rate of CMS-5E8 against the pathogen of Sclerotinia sclerotinia in Chinese cabbage is 83.1%.
[0057] Example 4: Field control efficacy of CMS-5E8 against sclerotinia stem rot in Chinese cabbage
[0058] The experiment was conducted at the Yongfa Experimental Base in Chengmai County. The tested vegetable variety was black-leaf bok choy (Hainan Lin Zhongmin variety). The experimental site was red soil with a moderate organic matter content. Sprinkler irrigation was used in the experimental garden, with moderate planting density and uniform management across all experimental plots. The lettuce was in the transplanting and survival stage when the first pesticide was applied.
[0059] One type of Bacillus thuringiensis bacterial agent is a bacterial suspension, available in 500-fold and 1000-fold dilutions.
[0060] Cell arrangement: random; Cell area: 20m² greenhouse 2 Number of repetitions: 3.
[0061] For foliar spraying, the operator should walk back and forth at a constant speed in the field with the sprayer on their back to ensure even application of the pesticide to the target areas of the plants. Start with the blank control area and apply the pesticide from low to high concentration. Alternatively, follow the protocol requirements and label instructions. Do not overfill the sprayer to avoid leakage; the pesticide prepared on the same day should be used on the same day. Apply the pesticide twice, on October 10th and 14th, 2025, for a total of two applications. Apply the pesticide per 667m². 2 The volume of the pesticide solution used was 60L. No fungicides were used within one week prior to the experiment, and the results of this experiment were not affected by previous pesticide use. No other pesticides were applied during the experiment to control other pests and diseases.
[0062] On the 7th day after the second application (October 21, 2025), the incidence of sclerotinia stem rot in Chinese cabbage was investigated. The investigation was conducted in accordance with the "Field Efficacy Trial of Fungicides for the Control of Sclerotinia Stem Rot in Chinese Cabbage" published by our unit. All plants in each plot were investigated, and the total number of plants investigated and the number of diseased plants were recorded.
[0063] Methods for calculating drug efficacy:
[0064]
[0065] In the formula: CK1 is the disease incidence rate in the control area after application of the pesticide. PT1 is the disease incidence rate in the treatment area after application of the pesticide.
[0066] The results are shown in Table 2. The control efficacy of CMS-5E8 stock solution at a dilution of 500 times and 1000 times against sclerotinia stem rot in Chinese cabbage was 54.2% and 36.3%, respectively. Therefore, CMS-5E8 showed good field control efficacy against sclerotinia stem rot in Chinese cabbage.
[0067] Table 2. Field control efficacy of Bt inoculant against sclerotinia stem rot in Chinese cabbage.
[0068]
[0069] Example 5: Indoor insecticidal activity determination of CMS-5E8 against diamondback moth and striped flea beetle
[0070] All experiments were conducted using the leaf immersion method on March 11, 2025. A cultured Bacillus thuringiensis CMS-5E8 bacterial suspension (75 μg / mL) was prepared and five experimental concentration gradients were set up according to the protein lysate: 75 μg / mL, 37.5 μg / mL, 18.75 μg / mL, 9.375 μg / mL, and 4.6875 μg / mL. Bok choy leaves with roots were washed with clean water and dried. The roots were wrapped with water-soaked absorbent cotton. Fresh, uniform leaves were selected and immersed in the protein solutions of each concentration for 10 minutes, then dried.
[0071] For the diamondback moth, live testing requires placing 30 2nd-3rd instar larvae in a testing box, with each box containing 30 larvae. Each treatment is repeated three times. The larvae are incubated at 25℃ in a biochemical incubator for 96 hours. After incubation, the number of dead and live larvae is counted, and the feeding behavior of the larvae is observed. For the striped flea beetle, live testing requires placing 30 adult beetles in a testing bag, with each treatment repeated three times. The larvae are incubated at 25℃ in a biochemical incubator for 5 days. After incubation, the number of dead and live larvae is counted, and the feeding behavior of the adults is observed.
[0072] Bioassay results showed that the CMS-5E8 protein had high insecticidal activity against diamondback moth and flea beetle. Poisoned diamondback moths and flea beetles turned black and died, their entire bodies becoming black and rotting. In contrast, the control insects showed greater appetite, increased activity, and normal development. The LC50 of the protein solution of this strain against diamondback moth was 16.06 μg / mL (95% confidence level, confidence interval 13.82–18.66 μg / mL); and against flea beetle, the LC50 was 60.12 μg / mL (95% confidence level, confidence interval 38.80–93.15 μg / mL) (Table 3).
[0073] Table 3. Indoor insecticidal activity of CMS-5E8 against diamondback moth and striped flea beetle.
[0074]
[0075] Example 6: Sporulation characteristics of CMS-5E8 strain
[0076] With a concentration of 1×10 8 CMS-5E8 bacterial suspension (cfu / mL) was cultured on 1 / 2 LB medium (100 μL / plate) for 15 days at different temperatures (20℃, 22℃, 24℃, 25℃, 26℃, 27℃, 28℃, 29℃, 30℃, and 35℃). The sporulation rate per unit area was then measured to determine that the optimal sporulation rate of CMS-5E8 strain was achieved at 30℃.
[0077] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.
Claims
1. A Bacillus thuringiensis CMS-5E8 strain, characterized in that, The Bacillus thuringiensis CMS-5E8 is classified as Bacillus thuringiensis and is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC 35311 and deposit date of July 21, 2025.
2. The Bacillus thuringiensis as described in claim 1, characterized in that, The strain carries sixteen insecticidal protein encoding genes: Cry1Aa, Cry1Ah, Cry1Be, Cry1If, Cry1Na, Cry1Ea, Cry1La, Cry2Ab, Cry2Ah, Vip3Aa, Vip3Ad, Spp1Aa, Vpb4Ca, Tpp78Ba, Mpp46Ab, and Mpp3Aa. The nucleotide sequence of the Cry1Aa gene is shown in SEQ ID NO: 1; the nucleotide sequence of the Cry1Ah gene is shown in SEQ ID NO: 3; the nucleotide sequence of the Cry1Be gene is shown in SEQ ID NO: 5; the nucleotide sequence of the Cry1If gene is shown in SEQ ID NO: 7; the nucleotide sequence of the Cry1Na gene is shown in SEQ ID NO: 9; the nucleotide sequence of the Cry1Ea gene is shown in SEQ ID NO: 11; the nucleotide sequence of the Cry1La gene is shown in SEQ ID NO: 13; and the nucleotide sequence of the Cry2Ab gene is shown in SEQ ID NO:
14. The nucleotide sequence of the Cry2Ah gene is shown in SEQ ID NO: 15; the nucleotide sequence of the Vip3Aa gene is shown in SEQ ID NO: 19; the nucleotide sequence of the Vip3Ad gene is shown in SEQ ID NO: 21; the nucleotide sequence of the Spp1Aa gene is shown in SEQ ID NO: 23; the nucleotide sequence of the Vpb4Ca gene is shown in SEQ ID NO: 25; the nucleotide sequence of the Tpp78Ba gene is shown in SEQ ID NO: 27; the nucleotide sequence of the Mpp46Ab gene is shown in SEQ ID NO: 29; and the nucleotide sequence of the Mpp3Aa gene is shown in SEQ ID NO:
31.
3. A microbial preparation, characterized in that, The microbial preparation contains Bacillus thuringiensis as described in claim 1, or contains fermentation broth of Bacillus thuringiensis, or contains lyophilized powder of Bacillus thuringiensis, or contains inactivated cells of Bacillus thuringiensis, or contains lysate of Bacillus thuringiensis, or contains extract of Bacillus thuringiensis.
4. The use of Bacillus thuringiensis as described in claim 1 or 2, or the microbial preparation as described in claim 3, in inhibiting vegetable diseases and / or killing lepidopteran pests and / or killing coleopteran pests.
5. The use of Bacillus thuringiensis as described in claim 1 or 2, or the microbial preparation as described in claim 3, in the preparation of pesticides for inhibiting vegetable diseases and / or killing lepidopteran pests and / or killing coleopteran pests.
6. The application as described in claim 4 or 5, characterized in that, The vegetable disease mentioned is sclerotinia stem rot in Chinese cabbage; the lepidopteran pest is diamondback moth; and the coleopteran pest is striped flea beetle.
7. The application as described in claim 4 or 5, characterized in that, The culture temperature of the Bacillus thuringiensis was 30℃.
8. A pesticide formulation, characterized in that, The pesticide formulation comprises at least one of Bacillus thuringiensis as described in claim 1 or 2, and the microbial formulation as described in claim 3.
9. The pesticide formulation as described in claim 8, characterized in that, The pesticide formulation also includes other microbial agents that have a synergistic effect with Bacillus thuringiensis as described in claim 1 or 2.
10. The pesticide formulation according to claim 8, characterized in that, The pesticide formulation is one of the following: suspension concentrate, oil suspension concentrate, powder, wettable powder, and granules.