Probiotics with uric acid reducing effect and application thereof

Abstract

The invention relates to probiotics with an effect of reducing uric acid and application of the probiotics in the field of microorganisms. The probiotic is lactobacillus rhamnosus, is named as CHP003, is preserved in the China General Microbiological Culture Collection Center on December 8, 2022, and has the preservation number of CGMCC (China General Microbiological Culture Collection Center) No.26176. The invention further discloses a preparation method of the probiotic. The lactobacillus rhamnosus CHP003 strain has a plurality of probiotic effects, including reduction of the activity of xanthine oxidase (XOD) and effective reduction of the serum uric acid level of a hyperuricemia model, and provides a new thought and means for treatment and prevention of metabolic diseases such as hyperuricemia, gout and the like.

Description

Technical Field

[0001] This invention relates to the field of microbiology, and more specifically, to a probiotic with uric acid-lowering effects and its applications. Background Technology

[0002] Uric acid (UA) is the final metabolic product of purine nucleotides (purines) in the human body. It is mainly produced in the liver, transported through the blood to the kidneys, and excreted in urine. It is an important metabolite in the human body and is closely related to the occurrence of various diseases. Increased uric acid production or decreased excretion leads to higher than normal serum uric acid levels, inducing hyperuricemia (HUA). In recent years, the prevalence of hyperuricemia in my country has shown a significant upward trend and a younger age of onset. Statistics show that the overall prevalence of hyperuricemia in my country is 13.3%, affecting approximately 177 million people, making it the "fourth highest" after hypertension, hyperglycemia, and hyperlipidemia. Gout, which is closely related to hyperuricemia, has an overall prevalence of 1.1%, affecting approximately 14.66 million people. Notably, nearly 60% of patients with hyperuricemia and gout symptoms are young people aged 18-35, showing a significant trend towards younger onset.

[0003] The main preventive and treatment methods for hyperuricemia are currently medication, traditional Chinese medicine (TCM), and dietary control. Medication provides rapid relief and is the most effective method for patients with acute hyperuricemia symptoms. However, the available medications for hyperuricemia are limited, primarily relying on xanthine oxidase inhibitors, allopurinol, and uricosuric drugs such as probenecid and benzbromarone. These drugs have significant side effects and low patient tolerance. Studies have shown that TCM can also effectively lower blood lipids and serum uric acid levels, alleviating symptoms. Many active ingredients in TCM can improve metabolic disorders and alleviate high-purine environments, and TCM treatment is generally safe with few side effects; however, its uric acid-lowering efficacy lacks clinical data. Besides medication, strict dietary control is another feasible method, but the exact purine content of various foods remains unclear. Dietary control also has the drawbacks of long treatment cycles and slow results. Therefore, finding a highly effective and low-toxicity treatment for hyperuricemia has become a research hotspot in recent years. Summary of the Invention

[0004] To address the aforementioned problems in the prior art, this invention proposes a probiotic with uric acid-lowering effects. Specifically, it relates to a probiotic with uric acid-lowering effects and its applications.

[0005] One objective of this invention is to provide a probiotic with uric acid-lowering effects. This probiotic is Lactobacillus rhamnosus, named CHP003, which was deposited on December 8, 2022, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 26176. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0006] The Lactobacillus rhamnosus CHP003 can reduce xanthine oxidase (XOD) activity, improve organ function, and reduce serum uric acid levels in a hyperuricemia model.

[0007] The second objective of this invention is to provide applications of the aforementioned probiotics.

[0008] The specific applications of probiotics may include their use in the preparation of products with uric acid-lowering effects, such as in the preparation of drugs with uric acid-lowering effects; or in the preparation of drugs for the prevention and / or treatment of hyperuricemia; or in the preparation of drugs for the relief of hyperuricemia; or in the preparation of fermented foods; or in the preparation of health products.

[0009] The third objective of this invention is to provide a pharmaceutical composition with uric acid-lowering effects, wherein the pharmaceutical composition includes Lactobacillus rhamnosus CHP003.

[0010] The pharmaceutical composition may also include a pharmaceutically acceptable carrier. The dosage form of the pharmaceutically acceptable carrier may be at least one of tablets, granules, capsules, pellets, sustained-release formulations, oral liquids, and injections.

[0011] Specifically, the Lactobacillus rhamnosus CHP003 contained in the pharmaceutical composition may be a live strain, a dry strain, or a strain metabolite.

[0012] Compared with the prior art, the beneficial effects of the present invention are:

[0013] This invention yields a strain of *Lactobacillus rhamnosus* CHP003, which possesses various probiotic effects, including reducing xanthine oxidase (XOD) activity and effectively lowering serum uric acid levels in a hyperuricemia model. This is of significant importance for the prevention and treatment of metabolic diseases such as gout and hyperuricemia. Furthermore, *Lactobacillus rhamnosus* CHP003 can improve the organ status of hyperuricemia model animals, such as the liver and kidneys, reducing organ burden and thus protecting organ function and minimizing organ damage caused by hyperuricemia.

[0014] Lactobacillus rhamnosus CHP003 exhibits significant uric acid-lowering effects and numerous other beneficial properties, thus possessing broad application prospects. It can be used to prepare uric acid-lowering drugs, health products, and functional foods, providing new ideas and methods for the treatment and prevention of metabolic diseases such as hyperuricemia and gout.

[0015] The Lactobacillus rhamnosus mentioned is CHP003, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) on December 8, 2022, with accession number CGMCC No. 26176. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0016] Figure 1 A schematic diagram illustrating the effect of Lactobacillus rhamnosus CHP003 probiotic on the kidney index of HUA mice;

[0017] Figure 2 A schematic diagram illustrating the effect of Lactobacillus rhamnosus CHP003 probiotic on liver index in HUA mice;

[0018] Figure 3 A schematic diagram showing the effect of Lactobacillus rhamnosus CHP003 probiotic on the spleen index of HUA mice;

[0019] Figure 4 A schematic diagram illustrating how Lactobacillus rhamnosus CHP003 probiotics significantly reduced uric acid levels in HUA mice;

[0020] Figure 5 A schematic diagram illustrating how Lactobacillus rhamnosus CHP003 probiotics significantly reduced creatinine levels in HUA mice;

[0021] Figure 6 Schematic diagram showing that Lactobacillus rhamnosus CHP003 probiotics significantly reduced urea nitrogen content in HUA mice;

[0022] Figure 7 This diagram illustrates how Lactobacillus rhamnosus CHP003 probiotics significantly inhibited XOD activity in HUA mice. Detailed Implementation

[0023] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0024] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0025] The experimental materials involved in the following embodiments are as follows:

[0026] (1) Lactobacillus rhamnosus CHP003 was isolated from fermented sauerkraut juice by Shenzhen Chuanghua Bio-Microbiology Laboratory and stored in glycerol tubes at -80℃. Under normal circumstances, colonies can be obtained by inoculating the strain on the surface of MRS solid medium plates and incubating them upside down in a 37℃ constant temperature anaerobic incubator for 24 hours.

[0027] (2) Reagent kits: Uric acid test kit (C012-2-1, Nanjing Jiancheng), creatinine test kit (C011-2-1, Nanjing Jiancheng), blood urea nitrogen test kit (C013-2-1, Nanjing Jiancheng), XOD kit (A002-1-1, Nanjing Jiancheng), xanthine oxidase activity assay kit (X1875, Sigma).

[0028] (3) MRS plates: 10.0g casein peptone, 10.0g beef extract, 5.0g yeast extract, 5.0g glucose, 5.0g sodium acetate, 2.0g diammonium citrate, 1.0g Tween 80, 2.0g K2HPO4, 0.2g MgSO4·7H2O, 0.05g MnSO4·H2O, 20.0g CaCO3, 13.0g agar, 1.0L distilled water, adjust pH to 6.8. Autoclave at 121℃ for 20min to prepare MRS solid culture medium.

[0029] (4) MRS liquid culture medium: 10.0g casein peptone, 10.0g beef extract, 5.0g yeast extract, 5.0g glucose, 5.0g sodium acetate, 2.0g diammonium citrate, 1.0g Tween 80, 2.0g K2HPO4, 0.2g MgSO4·7H2O, 0.05g MnSO4·H2O, 20.0g CaCO3, 1.0L distilled water, adjust pH to 6.8. Autoclave at 121℃ for 20min to prepare MRS liquid culture medium.

[0030] Isolation and identification of Lactobacillus rhamnosus strain CHP003

[0031] The Lactobacillus rhamnosus strain CHP003 was isolated from fermented sauerkraut juice, as detailed below:

[0032] Take 1×10 -51×10 -6 1×10 -7 0.1 mL of a distilled water dilution of Chinese cabbage sauerkraut juice was spread onto MRS-CaCO3 solid medium plates for isolation and incubated at 37°C for 24 h. Single colonies with distinct calcium dissolution zones were picked and transferred to MRS plates and incubated at 37°C for 24 h. Then, the colonies to be purified on the isolation plates were numbered using a marker, and the corresponding strain numbers were marked on the plates. After marking, colonies were picked and inoculated onto MRS plates, and the strain was purified using the streak plate method. If this method failed to isolate the strain, colonies were picked from enrichment plates, serially diluted in MRS liquid medium, and then spread onto the medium. Finally, referring to Bergey's Manual of Bacteriological Identification (8th Edition) and the Manual of Fungal Classification and Identification, the bacterial strain was first identified, and then the growth of the colonies was observed. A purified strain, numbered CHP003, was initially isolated. After 24 hours of incubation, the colonies were observed to be white, small, and with a smooth, flat surface.

[0033] Next, the isolated CHP003 strain was molecularly identified using universal 16S rDNA primers (8F: AGAGTTTGATCCTGGCTCAG, 1541R: AAGGAGGTGATCCAGCC). Shanghai Sangon Biotech Co., Ltd. then performed whole-genome sequencing on the CHP003 strain. The obtained sequence was BLAST-aligned in the NCBI Genome database, showing a 100% similarity to the Lactobacillus rhamnosus strain in Genebank (NCBI Reference Sequence: NZ_CP040780.1). Based on the strain's morphological characteristics and molecular biological identification methods, CHP003 was confirmed as *Lactobacillus rhamnosus*.

[0034] Finally, strain CHP003 was deposited, and the deposit information is as follows: deposit date: December 8, 2022; depositary institution: China General Microbiological Culture Collection Center (CGMCC); deposit number: CGMCCNo.26176; depositary address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing; classification and name: Lactobacillus rhamnosus.

[0035] Lactobacillus rhamnosus is mainly used in fermented foods, but strains from different sources have different effects, indicating that the new Lactobacillus rhamnosus strain CHP003 isolated from fermented sauerkraut juice in this invention may have new effects and functions.

[0036] Example 1: Functions and applications of Lactobacillus rhamnosus strain CHP003

[0037] (1) Grouping and drug treatment of mice

[0038] Twenty-four SPF-grade male KM mice, weighing 22–25 g, were randomly divided into four groups (n = 6 / group) according to body weight after one week of acclimatization: a negative control group (Control group), a hyperuricemia group (Model group), a febuxostat group, and a Lactobacillus rhamnosus group (CHP003 group). A HUA mouse model was established using potassium oxonate (PO) and hypoxanthine (HX). Except for the Control group, the other three groups of mice were intraperitoneally injected with 200 μL of potassium oxonate solution and 200 μL of hypoxanthine solution for 14 consecutive days. Mice in the Control group were injected with an equal volume of 0.5% CMC-Na solution. Simultaneously, mice in the Control and Model groups were administered 0.5 mL of physiological saline by gavage, mice in the Febuxostat group were administered 0.5 mL of febuxostat solution (concentration of 8 mg / kg) by gavage, and mice in the CHP003 group were administered 0.5 mL of the corresponding probiotic solution (probiotic solution prepared with physiological saline, probiotic concentration of 2 × 10⁻⁶). 8 (cfu / mL). All mice were fasted for 12 hours before biological samples were collected on day 14.

[0039] One hour after the last intraperitoneal injection on day 14, the mice were enucleated, and whole blood samples were collected. After standing for several hours, serum was obtained by centrifugation at 3500 rpm for 15 min and aliquoted. Liver, kidney, and spleen tissues were removed, rinsed with physiological saline, and weighed. Formed feces were collected from the intestines of each mouse under aseptic conditions. Except for the right kidney used for histopathological examination, which was stored in 4% paraformaldehyde, all samples were stored at -80°C.

[0040] (2) Detection of organ indices in mice

[0041] Before the end of the experiment, the mice were weighed. After sacrificing the mice, their left and right kidneys, liver, and spleen were removed. These organs were washed in physiological saline, thoroughly dried with filter paper, and then weighed. Data were recorded, and organ indices were calculated. The calculation formula is as follows:

[0042] Organ index = Organ weight (mg) / Mouse body weight (g)

[0043] The kidney index reflects the health status of kidney function. Specific data are shown in Table 1 and Figure (1).

[0044] Table 1

[0045]

[0046] From Table 1 and Figure 1 It is evident that the kidney index of mice in the Control group was significantly lower than that in the Model group, indicating that the intraperitoneal injection of PO and HX during the establishment of the HUA model had a toxic effect on the kidneys of mice. Compared with the Model group, the kidney index of mice in the CHP003 treatment group and the febuxostat group was significantly reduced, indicating that the probiotic CHP003 treatment group could alleviate kidney edema induced by PO and HX.

[0047] The liver is a key organ for uric acid production. See Table 2 for specific data. Figure 2 As shown.

[0048] Table 2

[0049]

[0050] From Table 2 and Figure 2 As can be seen, the liver index decreased in the Model group compared to the Control group, indicating that HUA caused some damage to the liver of mice. The liver index of mice treated with probiotic CHP003 increased significantly, indicating that the probiotic CHP003 treatment group can alleviate liver damage in HUA mice to some extent.

[0051] The spleen index can reflect the state of hyperactivity or suppression of the body's immune function. See Table 3 for specific data. Figure 3 As shown.

[0052] Table 3

[0053]

[0054] From Table 3 and Figure 3 As can be seen, the spleen index of mice in the Model group was significantly increased compared with the Control group (p<0.01), because inflammatory responses are often accompanied by hyperactive immune system function. Compared with the Model group, the spleen index of mice in the probiotic CHP003 treatment group was significantly decreased, indicating that probiotic CHP003 has a certain positive effect on immune function.

[0055] (3) Effect of Lactobacillus rhamnosus strain CHP003 on uric acid in HUA mice

[0056] Serum samples were thawed from a -80℃ freezer beforehand, and serum uric acid levels were measured strictly according to the kit instructions. Compared with the Control group, the uric acid level in the Model group was significantly increased (p<0.001), indicating that the HUA mouse model was successfully established. Compared with the Model group, the uric acid level in all treatment groups was significantly decreased, indicating that *Lactobacillus rhamnosus* CHP003 has anti-HUA activity. Specific data are shown in Table 4. Figure 4As shown.

[0057] Table 4

[0058]

[0059] (4) Effects of Lactobacillus rhamnosus strain CHP003 on creatinine and urea nitrogen levels in HUA mice

[0060] Excessive accumulation of uric acid crystals in kidney tissue can cause kidney inflammation. Clinically, serum creatinine and blood urea nitrogen levels are indicators of kidney damage. Serum samples were thawed from a -80°C freezer beforehand, and serum creatinine and blood urea nitrogen levels were measured strictly according to the kit instructions. Specific test data are shown in Tables 5 and 6. Compared with the Model group, the serum creatinine and blood urea nitrogen levels in other groups were significantly lower, indicating that *Lactobacillus rhamnosus* CHP003 has no significant effect on kidney function (Table 5). Figure 5 and Table 6, Figure 6 ).

[0061] Table 5

[0062]

[0063] Table 6

[0064]

[0065] (5) Effects of Lactobacillus rhamnosus strain CHP003 on xanthine oxidase activity in the liver of HUA mice

[0066] Hypoxanthine and xanthine are precursors of uric acid. Under the action of XOD, hypoxanthine is oxidized to xanthine, and xanthine is oxidized to uric acid. Therefore, XOD plays an important role in the development of hyperuricemia.

[0067] Frozen mouse liver tissue was removed from a -80°C freezer. An appropriate amount of sterile PBS was added, and the tissue was homogenized on ice using a hand-held tissue homogenizer. The resulting suspension was then obtained by centrifugation (5000g, 10 min). XOD activity in the liver was measured according to the kit instructions. Specific data are shown in Table 7. Figure 7 As shown in Table 7 and Figure (7), the activity of XOD in the Model group was significantly higher than that in the Control group, while that in the CHP003 group was significantly lower than that in the Model group, indicating that Lactobacillus rhamnosus CHP003 can significantly inhibit the activity of XOD in the liver.

[0068] Table 7

[0069]

[0070] This application aims to evaluate whether *Lactobacillus rhamnosus* CHP003 can reduce uric acid levels in hyperuricemic mice. To establish a hyperuricemic mouse model, mice were intraperitoneally injected with 240 mg / kg potassium oxonate solution and 480 mg / kg hypoxanthine solution for 14 consecutive days to maintain a high uric acid concentration. Experimental data showed that *Lactobacillus rhamnosus* CHP003 could improve the organ status of hyperuricemic model animals, such as the liver and kidneys, by reducing uric acid deposition in organs, reducing organ burden, and thus protecting organ function and reducing organ damage caused by hyperuricemia. The levels of uric acid, creatinine, blood urea nitrogen, and XOD activity in the Model group were significantly higher than those in the Control group, indicating that the hyperuricemic mouse model had been successfully established. Compared with the Model group, the levels of uric acid, creatinine, and blood urea nitrogen and XOD activity were decreased and inhibited in the probiotic CHP003 treatment group and the positive control group, indicating that *Lactobacillus rhamnosus* CHP003 has the potential to treat hyperuricemia.

[0071] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A probiotic with uric acid-lowering effect, characterized in that: The probiotic is Lactobacillus rhamnosus, named CHP003, which was deposited at the China General Microbiological Culture Collection Center on December 8, 2022, with accession number CGMCC No. 26176.

2. The application of probiotics according to claim 1, characterized in that... Application in the preparation of products with uric acid-lowering effects.

3. The application of probiotics according to claim 1, characterized in that... Application in the preparation of drugs with uric acid-lowering effects.

4. The application of probiotics according to claim 1, characterized in that... Application in the preparation of drugs for the prevention and / or treatment of hyperuricemia.

5. The application of the probiotics according to claim 1 in the preparation of fermented foods.

6. The application of the probiotics according to claim 1 in the preparation of health products.

7. A pharmaceutical composition having a uric acid-lowering effect, characterized in that: The pharmaceutical composition includes Lactobacillus rhamnosus CHP003.

8. The pharmaceutical composition with uric acid-lowering effect according to claim 7, characterized in that: The pharmaceutical composition also includes a pharmaceutically acceptable carrier.

9. The pharmaceutical composition with uric acid-lowering effect according to claim 7, characterized in that: The Lactobacillus rhamnosus CHP003 contained in the pharmaceutical composition is a live strain, a dry strain, or a strain metabolite.

10. The pharmaceutical composition with uric acid-lowering effect according to claim 8, characterized in that: The pharmaceutically acceptable carrier dosage form is at least one of the following: tablets, granules, capsules, pellets, sustained-release preparations, oral liquid preparations, and injections.

Images