Phenylalanine ammonialyase mutant and application thereof
By designing a phenylalanine ammonia-lyase mutant and optimizing the enzymatic hydrolysis process, the nutritional and stability problems of existing low-phenylalanine foods have been solved, achieving efficient and precise phenylalanine removal. This makes it a special food suitable for patients with phenylketonuria and expands the application of plant protein.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-10
- Publication Date
- 2026-03-31
AI Technical Summary
Existing low-phenylalanine formula foods suffer from problems such as limited variety, low nutritional value, high price, and poor palatability. Furthermore, traditional methods for removing phenylalanine have issues such as low adsorption selectivity, difficulty in recovery, and potential introduction of secondary pollution. Natural phenylalanine ammonia-lyase has poor thermal stability under high temperature or long reaction conditions, which limits its industrial application.
A phenylalanine ammonia-lyase mutant was designed and constructed. Its catalytic activity and thermal stability were improved by site-directed mutagenesis. Combined with ultrasonic cell disruption and the phased addition of neutral protease, efficient enzymatic hydrolysis of proteins and precise removal of phenylalanine were achieved.
It achieves efficient and precise removal of phenylalanine from proteins under mild conditions, making the product easily absorbed. It is suitable for special medical purpose formula foods for patients with phenylketonuria, expanding the application prospects of plant protein in low-phenylalanine products.
Smart Images

Figure CN121759438A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioengineering technology. More specifically, this invention relates to a phenylalanine ammonia-lyase mutant and its applications. Background Technology
[0002] Phenylketonuria (PKU) is an autosomal recessive inherited amino acid metabolism disorder, primarily caused by mutations in the gene encoding phenylalanine hydroxylase or a deficiency of its coenzyme tetrahydrobiopterin. Patients cannot metabolize phenylalanine normally, leading to its accumulation in the blood and causing irreversible intellectual impairment, behavioral abnormalities, epilepsy, acquired microcephaly, and a range of other neurological symptoms, often accompanied by hypopigmentation of the skin, hair, and eyes. Currently, the safest and most effective intervention for phenylalanine is dietary control, providing patients with special medical foods containing extremely low levels of phenylalanine to maintain blood phenylalanine levels within a safe range. However, existing low-phenylalanine formula foods still face problems such as limited variety, low nutritional value, high price, and poor palatability, failing to meet the comprehensive nutritional needs of patients of different ages. The preparation of traditional low-phenylalanine proteins mainly involves two steps: enzymatic hydrolysis of the protein and the separation and removal of phenylalanine. In the removal stage, existing technologies mostly rely on physical or chemical adsorption methods, such as activated carbon, macroporous adsorption resins, or straw powder. Although these methods can remove phenylalanine to some extent, they generally suffer from problems such as low adsorption selectivity, difficulty in recovery, and potential introduction of secondary pollution.
[0003] Phenylalanine ammonia-lyase is a key enzyme in plant secondary metabolic pathways, efficiently and specifically catalyzing the deamination of L-phenylalanine to trans-cinnamic acid and ammonia. This enzymatic reaction is mild, environmentally friendly, and the products are easily separable, making it considered to have great potential for the green preparation of low-phenylalanine proteins. Previous studies have reported its use in the production of *Rhodotorula glutinis* (…). Rhodosporidium toruloides ) and variable anemones ( Anabaena variabilis Phenylalanine ammonia-lyases can remove L-phenylalanine from commercial casein and acid-hydrolyzed soy protein, with conversion rates of 92% and 80%, respectively. However, these naturally derived enzymes often face problems in practical applications, such as low expression levels, poor thermal stability, limited conversion rates, and cross-catalytic activity with tyrosine. They are difficult to adapt to the high-temperature or long-term reaction conditions commonly encountered in food processing, thus limiting their industrial application potential. Summary of the Invention
[0004] One object of the present invention is to solve at least the above-mentioned problems and to provide at least the advantages that will be described later.
[0005] To achieve these objectives and other advantages according to the invention, the invention provides a phenylalanine ammonia-lyase mutant, said phenylalanine ammonia-lyase mutant having the activity of converting phenylalanine to trans-cinnamic acid, and is a protein of either a) or b) below: a) The serine at position 73 of the amino acid sequence shown in SEQ ID NO: 1 is replaced with asparagine, or the phenylalanine at position 84 of the amino acid sequence shown in SEQ ID NO: 1 is replaced with tyrosine, or the valine at position 90 of the amino acid sequence shown in SEQ ID NO: 1 is replaced with arginine, or the glutamic acid at position 95 of the amino acid sequence shown in SEQ ID NO: 1 is replaced with valine. b) A protein derived from (a) in which one or more amino acids have been substituted, deleted, or added to the amino acid sequence in a) while still retaining phenylalanine ammonia-lyase activity.
[0006] The phenylalanine ammonia-lyase mutant described in this invention exhibits strict substrate specificity. Sequence and structural analysis revealed that the key substrate-selective residue F107 determines that the enzyme possesses catalytic activity only for L-phenylalanine. To verify this characteristic, enzyme activity assays were performed using L-phenylalanine and L-tyrosine as substrates, respectively. The results showed that NoPAL and its mutants both exhibited catalytic activity only for L-phenylalanine, with no significant effect on L-tyrosine, thus ensuring precise removal of phenylalanine in complex protein systems and avoiding interference with other essential amino acids.
[0007] This invention also provides a method for screening mutants of the phenylalanine ammonia-lyase. Based on the predicted structure and catalytic mechanism analysis of wild-type phenylalanine ammonia-lyase (amino acid sequence shown in SEQ ID NO:1) derived from Nostocsp. ATCC 53789, sites that may affect substrate binding, catalytic efficiency, and structural stability were rationally selected and designed for key regions such as the active site and inner cap ring. A mutant library was constructed through site-directed mutagenesis, and after expression and purification, the catalytic activity, thermostability, and substrate specificity of each mutant for L-phenylalanine were systematically evaluated. Finally, four superior mutants—S73N, F84Y, V90R, and E95V—were obtained, which, while maintaining strict substrate specificity, exhibited significantly enhanced catalytic activity and good thermostability. Among them, S73N showed the highest phenylalanine removal rate in various proteolysis systems and was identified as the optimal mutant.
[0008] This invention also provides a gene encoding a phenylalanine ammonia-lyase mutant. For example, the base sequence of a DNA molecule encoding the S73N mutant shown in SEQ ID NO: 2 is shown in SEQ ID NO: 7; the base sequence of a DNA molecule encoding the F84Y mutant shown in SEQ ID NO: 3 is shown in SEQ ID NO: 8; the base sequence of a DNA molecule encoding the V90R mutant shown in SEQ ID NO: 4 is shown in SEQ ID NO: 9; and the base sequence of a DNA molecule encoding the E95V mutant shown in SEQ ID NO: 5 is shown in SEQ ID NO: 10. Of course, due to the degeneracy of codons, any DNA molecule capable of encoding the above amino acid sequences is acceptable.
[0009] The present invention also provides an expression vector for the encoded gene and an engineered bacterium.
[0010] The present invention also provides an application of a phenylalanine ammonia-lyase mutant in the production of low-phenylalanine protein.
[0011] The present invention also provides a method for producing low-phenylalanine protein, characterized by comprising the following steps: After the protein raw material is subjected to ultrasonic cell disruption, neutral protease is added for enzymatic hydrolysis to obtain the enzymatic hydrolysate. The enzymatic hydrolysate is then inactivated and centrifuged, and the supernatant is collected. A genetically engineered bacterium expressing a phenylalanine ammonia-lyase mutant was prepared, wherein the phenylalanine ammonia-lyase mutant was as described in claim 1; the genetically engineered bacterium was cultured to prepare a phenylalanine ammonia-lyase mutant enzyme solution. Phenylalanine ammonia-lyase mutant enzyme solution was added to the supernatant to catalyze the reaction. After the reaction was completed, low-phenylalanine protein was harvested from the reaction product.
[0012] The above method constructs a complete production process for low-phenylalanine proteins. It begins with ultrasonic cell disruption to efficiently open the protein structure, followed by controlled hydrolysis with neutral proteases to expose phenylalanine residues. Finally, it utilizes a unique, highly active, and stable phenylalanine ammonia-lyase mutant for precise catalysis. This method solves the problems of fragmented steps, low efficiency, and significant nutrient loss in traditional processes, achieving continuous, efficient, and gentle conversion from raw materials to finished products, providing a complete technical solution for industrial production.
[0013] Preferably, the catalytic reaction conditions for adding the phenylalanine ammonia-lyase mutant enzyme solution to the supernatant are pH 7.5-8.5, temperature 54-57℃, the amount of the phenylalanine ammonia-lyase mutant enzyme solution added to the supernatant is 7-8 μg / mL, and the reaction time is 22-24 h.
[0014] Through in-depth research on the enzymatic properties of the phenylalanine ammonia-lyase mutant (especially S73N), the optimal environmental window for achieving its highest catalytic activity and stability was determined. Under mildly alkaline conditions (pH 7.5-8.5, temperature 54-57℃), with an addition of 7-8 μg / mL for 22-24 hours, this mutant can achieve highly efficient conversion of phenylalanine while maximizing enzyme activity and product quality. Determining this specific parameter range resolves the issues of ambiguous reaction conditions and unstable efficiency in practical applications of this mutant, providing a direct and reliable operational basis for its industrial application.
[0015] Preferably, the method for preparing the phenylalanine ammonia-lyase mutant enzyme solution includes: Genetically engineered bacteria were cultured in liquid culture medium. When the OD of the bacterial solution... 600 When the value reaches 0.7-0.8, the temperature is lowered, isopropyl thiogalactopyranoside is added to the bacterial culture to induce expression, the bacterial cells are broken, and the product is purified.
[0016] By controlling the cell growth density (induced at an OD600 value of 0.7-0.8) and employing an IPTG-induced expression strategy, the expression of soluble proteins was effectively promoted. High-activity enzyme solutions were then obtained through disruption and purification. This method solves the bottleneck problems of large-scale preparation and unstable activity of mutant enzymes, providing a stable and efficient source of enzyme preparations for industrial production.
[0017] Preferably, the specific process of ultrasonic cell disruption, enzymatic hydrolysis, inactivation, and centrifugation is as follows: The protein raw material was placed in an ultrasonic cell disruptor for ultrasonic treatment. The ultrasonic working conditions were: power 150-170 W, ultrasonic time 5-7 min. After ultrasonic treatment, a pretreated solution was obtained. Add neutral protease to the pretreatment solution at a concentration of 1000-4200 U / g, and then hydrolyze the solution at a constant temperature of 49-51 °C for 4.8-5.2 h to obtain the enzymatic hydrolysate. The enzyme hydrolysate was placed in a water bath at 88-92℃ for 18-20 min to inactivate it. Centrifuge at 4000-4200 r / min for 18-20 min and collect the supernatant.
[0018] By precisely controlling the physical crushing and enzymatic hydrolysis conditions, the problems of insufficient raw material processing and large fluctuations in enzymatic hydrolysis efficiency were optimized and solved, ensuring the acquisition of a clear supernatant with full exposure of phenylalanine residues, laying a solid foundation for the efficient catalysis of mutant enzymes.
[0019] Preferably, the process of adding neutral protease to the pretreatment solution is carried out in stages, specifically as follows: First, the total amount of neutral protease added was set to 1000-4200 U / g; After the pretreatment solution is heated to 49-51℃ and stabilized, immediately add 50%-60% of the total amount and stir at a stirring speed of 500-600 rpm for 10-15 minutes. The degree of hydrolysis of the system is obtained through online monitoring. When the degree of hydrolysis reaches 8%-10%, 30%-35% of the total amount of enzyme is added, along with calcium. 2+ Ionic solutions are used to bring the final concentration of Ca²⁺ ions in the system to 0.01-0.03 mol / L. During this stage, the stirring rate is reduced to 300-400 rpm. Continue to monitor the degree of hydrolysis of the system. When the degree of hydrolysis reaches 18%-20%, add the remaining 5%-10% of neutral protease and adjust the pH of the system to 7.2-7.5.
[0020] The above method is based on enzyme reaction kinetics and product inhibition theory, implementing intelligent staged addition with real-time hydrolysis degree as feedback. Staged addition uses the hydrolysis degree of the enzymatic hydrolysis system as the trigger node, and is implemented in three stages combined with the catalytic kinetics of neutral proteases. This approach can solve secondary technical problems such as substrate inhibition caused by excessively high local enzyme concentration due to single addition, insufficient hydrolysis due to subsequent enzyme activity decay, and over-hydrolysis. Specifically, the first stage is the initiation stage, where a high initial enzyme concentration rapidly breaks the protein molecular backbone, creating sites for subsequent targeted hydrolysis; the second stage is the enhancement stage, where Ca... 2+ Ions can stabilize the active site of neutral proteases, thereby alleviating the inhibition of enzyme activity by enzymatic hydrolysis intermediates. A low stirring rate is used in this stage to reduce the shear force and potential oxidation risk of the reaction system. The third stage is the finishing stage, which aims to precisely control the hydrolysis endpoint and promote the conversion of large protein molecules into target small peptides. This addition method can increase the exposure rate of phenylalanine residues. A higher exposure rate of phenylalanine residues can make the subsequent catalytic reaction of phenylalanine ammonia-lyase mutant easier to carry out.
[0021] Preferably, the method for obtaining the degree of hydrolysis of the system through online detection includes the following steps: The system is directly detected using an ultraviolet detection probe. During detection, absorbance values are simultaneously acquired at wavelengths of 220-225 nm (for characterizing the number of peptide bonds) and 280-285 nm (for characterizing the exposure of aromatic amino acid residues). The ratio of absorbance values at the two wavelengths is calculated, and the real-time degree of hydrolysis is obtained by converting this ratio into a preset correspondence with the degree of hydrolysis. This correspondence is established through pre-conducted gradient hydrolysis experiments and covers a degree of hydrolysis range of 5%-25%. Absorbance acquisition and degree of hydrolysis calculation are performed every 3-5 minutes during the detection process. When the detected degree of hydrolysis reaches the preset threshold, the corresponding stage of neutral protease addition program is initiated.
[0022] The above method utilizes the characteristic changes in ultraviolet absorption spectra during protein hydrolysis to establish a rapid, online, and non-destructive real-time monitoring method for the degree of hydrolysis. The ratio of absorbance at 220-225 nm (peptide bonds) to 280-285 nm (aromatic amino acids) is used as an indicator, and converted into real-time hydrolysis degree through a pre-established calibration curve. This method achieves second-level monitoring and feedback control of the enzymatic hydrolysis process, solving the technical problems of traditional offline detection's lag and inability to guide production in real time, enabling precise execution of the aforementioned staged addition.
[0023] The present invention has at least the following beneficial effects: This invention uses phenylalanine ammonia-lyase (NoPAL) derived from Nostoc sp. ATCC 53789 as a template and rationally designs several single-point mutants, including S73N, F84Y, V90R, and E95V. Among them, the optimal mutant, S73N, exhibits excellent catalytic performance in protein hydrolysate, showing the highest removal rate of phenylalanine from various raw materials such as whey protein and rice protein. Experimental results show that this mutant maintains strict substrate specificity while significantly improving catalytic efficiency compared to the wild type, and both the mutant and wild type exhibit better thermostability than commonly used commercial enzymes (AvPAL). The low-phenylalanine protein products prepared using this invention contain approximately 0.6%-1.0% phenylalanine (by protein equivalent), are easily absorbed, and possess good application characteristics. This provides a new technical pathway for developing special medical purpose formula foods suitable for patients with phenylketonuria and also expands the application prospects of plant proteins in low-phenylalanine products.
[0024] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description
[0025] Figure 1 This is an electrophoresis result analysis diagram of mutants such as NoPAL S73N phenylalanine ammonia-lyase in the embodiments of the present invention.
[0026] Figure 2 This is a thermal stability analysis diagram of mutants such as NoPAL S73N phenylalanine ammonia-lyase in the embodiments of the present invention.
[0027] Figure 3 The diagram shows the kinetic parameters of mutants such as NoPAL S73N phenylalanine ammonia-lyase in the embodiments of the present invention. Detailed Implementation
[0028] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can implement it based on the description.
[0029] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not exclude the presence or addition of one or more other elements or combinations thereof.
[0030] It should be noted that, unless otherwise specified, the experimental methods described in the following implementation plan are all conventional methods, and the reagents and materials described are all commercially available unless otherwise specified.
[0031] The NoPAL enzyme described in this invention exhibits strict substrate specificity for L-phenylalanine, retaining 90% of its residual activity after treatment at 70°C for 2 hours. Its thermostability is 40% higher than that of the commonly used commercial enzyme AvPAL. This enzyme achieves L-phenylalanine removal rates of 80.6% and 82.8% in rice protein and whey protein systems, respectively. Further rational design of the wild-type strain of NoPAL resulted in an L-phenylalanine removal rate of 95% in the whey protein system, significantly outperforming currently reported phenylalanine ammonia-lyases derived from *Rhodotorula buergerianum* and *Anabaena variegata*. This study provides a promising new technological pathway for the enzymatic preparation of low-phenylalanine proteins for industrial application.
[0032] This invention utilizes conventional techniques and methods found in the fields of genetic engineering and molecular biology, and these general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can, based on the technical solutions described in this invention, employ other conventional methods, experimental protocols, and reagents, without being limited to the specific embodiments of this invention. For example, the following experimental materials and reagents may be used in this invention: Strains and vectors: Escherichia coli DH5α Trans 1-T1 (Trugen Gene, Beijing, China) is used for gene cloning; E. coli T7 Express (Bomaide Gene, Beijing, China) is used for protein expression; vectors with the T7 promoter are also used. p ET-28a(+) (Novagen) is used for recombinant plasmid construction.
[0033] Enzymes and kits: DNA polymerase, ligase, and DpnI enzyme were purchased from Takara; restriction endonucleases were purchased from NEB; plasmid extraction kit and gel purification and recovery kit were purchased from Tiangen Biotech; lactose was purchased from Sigma-Aldrich; glucose and galactose were purchased from Solarbio; and all other reagents were domestically produced (available from general biochemical reagent companies).
[0034] Culture medium formulations: Liquid LB medium: 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0; Solid LB medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar powder; All the above culture media were autoclaved at 103 kPa and 121℃ for 20 min. For the solid culture medium, after cooling to about 50℃, 100 mg / mL kanamycin was added and the medium was poured into plates in a clean bench for later use.
[0035] Phenylalanine ammonia-lyase activity assay and method: 50 μL of enzyme solution was added to 450 μL Tris-HCl buffer (pH: 8.5) and pre-incubated for 5 min. Then, 50 μL L-phe (2 mM) was added, and the reaction was allowed to proceed for another 5 min. The absorbance of the product was measured at 310 nm. The amount of enzyme required to generate 1 μL of hydrolysis product per minute was defined as one enzyme activity unit (U). An inactivated enzyme solution was used as a blank control.
[0036] Detection method for trans-cinnamic acid products: High-performance liquid chromatography (HPLC) was used to detect the amount of trans-cinnamic acid in the reaction system. Chromatographic conditions were: Waters Atlantis d C18 column, column temperature: 25°C, mobile phase solution: water (0.1% formic acid) and methanol (0.1% formic acid) in a ratio of 70:30 (v / v), flow rate: 1 ml / min, detection wavelength: 310 nm. The amount of trans-cinnamic acid was determined using the external standard method based on retention time and peak area.
[0037] Detection method for phenylalanine substrate: The conversion rate of L-phenylalanine was determined using the phenylalanine assay kit (MAK005) manufactured by Sigma-Aldrich, according to the method described in the instruction manual.
[0038] The phenylalanine removal rate is calculated using the following formula: Protein content determination: Protein content was determined by the Kjeldahl method according to GB5009.5-2016.
[0039] SEQ ID NO: 1 NoPAL WT MKTLSQAQSKTLPQQFSFTGNSSGNVIIGNQKLTINDVARVARNGALVSLTDNADVLQNIHASCDYINNAVESGEPIYGVTSGFGGMANVAISREQASELQTNLVWFLKTGAGNKLPLADVRAAMLLRANSHMYGASGIRLELIKRMETFLNAGVTPYVYEFGSIGASGDLVPLSYITGSLIGLDPSFKVDFNGKEMDAPTALSQLNLSPLTLLPKEGLAMMNGTSVMTGIAANCVYDTQILTAIAMGVHALDIQALNGTNQSFHPFIHNSKPHPGQLWAADQMISLLANSQLVRDELDGKHDYRDHELIQDRYSLRCLPQYLGPIVDGISQIAKQIEIEINSVTDNPLIDVNNQASYHGGNFLGQYVGVGMDHLRYYIGLMAKHLDVQIALLASPEFSNGLPPSLLGNRERKVNMGLKGLQICGNSIMPLLTFYGNSIADRFPTHAEQFNQNINSQGYTSATLARRSVDIFQNYMAIALMFGVQAVDLRTYKKTGHYDARVCLSPATERLYSAVRHVVGQKPSSDRPYIWNDNEQGLDEHIARISADIAAGGLIVKAVQDIC SEQ ID NO: 2 S73N protein sequence: MKTLSQAQSKTLPQQFSFTGNSSGNVIIGNQKLTINDVARVARNGALVSLTDNADVLQNIHASCDYINNAVENGEPIYGVTSGFGGMANVAISREQASELQTNLVWFLKTGAGNKLPLADVRAAMLLRANSHMYGASGIRLELIKRMETFLNAGVTPYVYEFGSIGASGDLVPLSYITGSLIGLDPSFKVDFNGKEMDAPTALSQLNLSPLTLLPKEGLAMMNGTSVMTGIAANCVYDTQILTAIAMGVHALDIQALNGTNQSFHPFIHNSKPHPGQLWAADQMISLLANSQLVRDELDGKHDYRDHELIQDRYSLRCLPQYLGPIVDGISQIAKQIEIEINSVTDNPLIDVNNQASYHGGNFLGQYVGVGMDHLRYYIGLMAKHLDVQIALLASPEFSNGLPPSLLGNRERKVNMGLKGLQICGNSIMPLLTFYGNSIADRFPTHAEQFNQNINSQGYTSATLARRSVDIFQNYMAIALMFGVQAVDLRTYKKTGHYDARVCLSPATERLYSAVRHVVGQKPSSDRPYIWNDNEQGLDEHIARISADIAAGGLIVKAVQDIC SEQ ID NO: 3 F84Y protein sequence: MKTLSQAQSKTLPQQFSFTGNSSGNVIIGNQKLTINDVARVARNGALVSLTDNADVLQNIHASCDYINNAVESGEPIYGVTSGYGGMANVAISREQASELQTNLVWFLKTGAGNKLPLADVRAAMLLRANSHMYGASGIRLELIKRMETFLNAGVTPYVYEFGSIGASGDLVPLSYITGSLIGLDPSFKVDFNGKEMDAPTALSQLNLSPLTLLPKEGLAMMNGTSVMTGIAANCVYDTQILTAIAMGVHALDIQALNGTNQSFHPFIHNSKPHPGQLWAADQMISLLANSQLVRDELDGKHDYRDHELIQDRYSLRCLPQYLGPIVDGISQIAKQIEIEINSVTDNPLIDVNNQASYHGGNFLGQYVGVGMDHLRYYIGLMAKHLDVQIALLASPEFSNGLPPSLLGNRERKVNMGLKGLQICGNSIMPLLTFYGNSIADRFPTHAEQFNQNINSQGYTSATLARRSVDIFQNYMAIALMFGVQAVDLRTYKKTGHYDARVCLSPATERLYSAVRHVVGQKPSSDRPYIWNDNEQGLDEHIARISADIAAGGLIVKAVQDIC SEQ ID NO: 4 V90R protein sequence: MKTLSQAQSKTLPQQFSFTGNSSGNVIIGNQKLTINDVARVARNGALVSLTDNADVLQNIHASCDYINNAVESGEPIYGVTSGFGGMANRAISREQASELQTNLVWFLKTGAGNKLPLADVRAAMLLRANSHMYGASGIRLELIKRMETFLNAGVTPYVYEFGSIGASGDLVPLSYITGSLIGLDPSFKVDFNGKEMDAPTALSQLNLSPLTLLPKEGLAMMNGTSVMTGIAANCVYDTQILTAIAMGVHALDIQALNGTNQSFHPFIHNSKPHPGQLWAADQMISLLANSQLVRDELDGKHDYRDHELIQDRYSLRCLPQYLGPIVDGISQIAKQIEIEINSVTDNPLIDVNNQASYHGGNFLGQYVGVGMDHLRYYIGLMAKHLDVQIALLASPEFSNGLPPSLLGNRERKVNMGLKGLQICGNSIMPLLTFYGNSIADRFPTHAEQFNQNINSQGYTSATLARRSVDIFQNYMAIALMFGVQAVDLRTYKKTGHYDARVCLSPATERLYSAVRHVVGQKPSSDRPYIWNDNEQGLDEHIARISADIAAGGLIVKAVQDIC SEQ ID NO: 5 E95V protein sequence: MKTLSQAQSKTLPQQFSFTGNSSGNVIIGNQKLTINDVARVARNGALVSLTDNADVLQNIHASCDYINNAVESGEPIYGVTSGFGGMANVAISRVQASELQTNLVWFLKTGAGNKLPLADVRAAMLLRANSHMYGASGIRLELIKRMETFLNAGVTPYVYEFGSIGASGDLVPLSYITGSLIGLDPSFKVDFNGKEMDAPTALSQLNLSPLTLLPKEGLAMMNGTSVMTGIAANCVYDTQILTAIAMGVHALDIQALNGTNQSFHPFIHNSKPHPGQLWAADQMISLLANSQLVRDELDGKHDYRDHELIQDRYSLRCLPQYLGPIVDGISQIAKQIEIEINSVTDNPLIDVNNQASYHGGNFLGQYVGVGMDHLRYYIGLMAKHLDVQIALLASPEFSNGLPPSLLGNRERKVNMGLKGLQICGNSIMPLLTFYGNSIADRFPTHAEQFNQNINSQGYTSATLARRSVDIFQNYMAIALMFGVQAVDLRTYKKTGHYDARVCLSPATERLYSAVRHVVGQKPSSDRPYIWNDNEQGLDEHIARISADIAAGGLIVKAVQDIC SEQ ID NO:6 NoPAL WT SEQ ID NO: 7 NoPAL S73N DNA sequence SEQ ID NO: 8 NoPAL F84Y DNA sequence SEQ ID NO: 9 NoPAL V90R DNA sequence SEQ ID NO: 10 NoPAL E95V DNA sequence Example 1: 1) Construction of phenylalanine ammonia-lyase mutant: using mutants carrying wild-type phenylalanine ammonia-lyase No Recombinant plasmids encoding the PAL gene p Using ET-28a(+) as a template, design corresponding primers: F (NoPAL S73N) CGCGGTGGAAAACGGCGAACCGATTTATGGCGTGAC R (NoPAL S73N) TCGGTTCGCCGTTTTCCACCGCGTTGTTAATATAAT F (NoPAL F84Y) GACCAGCGGCTATGGCGGCATGGCAAATGTTGCGAT R (NoPAL F84Y) CCATGCCGCCATAGCCGCTGGTCACGCCATAAATCG F (NoPAL V90R) CATGGCAAATAGAGCGATTAGCCGCGAACAGGCGAG R (NoPAL V90R) GGCTAATCGCTCTATTTGCCATGCCGCCAAAGCCGC F (NoPAL E95V) GATTAGCCGCGTACAGGCGAGCGAACTGAAACCAA R (NoPAL E95V) CGCTCGCCTGTACGCGGCTAATCGCAACATTTGCCA In vitro site-directed mutagenesis was performed using the Quickchange PCR method. The PCR products were treated overnight with Dpn I and then transformed into E. coli DH5α. Trans The 1-T1 competent cells were used, and the resulting plasmids were confirmed by DNA sequencing.
[0040] 2) Preparation of mutant enzymes: Recombinant plasmids pET-28b-S73N, pET-28b-Y84F, pET-28b-V90R, and pET-28b-E95K, constructed using the phenylalanine ammonia-lyase gene and its mutants, were heat-shocked and transformed into the enzyme. Escherichia coli Transetta (DE3 The host was used to construct a genetically engineered bacterium expressing phenylalanine ammonia-lyase. The above-mentioned genetically engineered bacterium was cultured at 37°C. When the OD of the bacterial culture reached... 600When the value reached 0.8, the cells were induced with isopropyl thiogalactopyranoside (IPTG) at 18℃ for 14 h. After high-pressure homogenization to disrupt the bacterial cells, the supernatant was sequentially passed through an affinity chromatography column (nickel column), an anion exchange column, and gel filtration chromatography (Superdex 200) to obtain four phenylalanine ammonia-lyase enzyme solutions (5.1 mg / mL): phenylalanine ammonia-lyase S73N mutant enzyme solution, phenylalanine ammonia-lyase F84Y mutant enzyme solution, phenylalanine ammonia-lyase E95V mutant enzyme solution, and phenylalanine ammonia-lyase V90R mutant enzyme solution. The corresponding SDS-PAGE values are as follows: Figure 1 As shown.
[0041] 3) Thermostability analysis of mutant enzyme solutions: The enzyme solutions of each phenylalanine ammonia-lyase mutant were added to pH 8.5 buffer and incubated at 10, 20, 30, 40, 45, 50, 55, 60, 70, and 80 °C for 0.16, 0.5, 1, 2, 4, and 6 h, respectively, under optimal reaction conditions. Thermostability comparison between NoPAL mutants and AvPAL at 70 °C is shown below. Figure 2 As shown.
[0042] 4) Enzyme kinetic analysis of mutant enzyme solutions: The mutant phenylalanine ammonia-lyase solutions were added to pH 8.5 buffer and reacted with different final concentrations (10-200 μM) of L-phenylalanine at 55℃ for 5 min. The amount of trans-cinnamic acid generated was monitored by HPLC, and quantification was performed using a trans-cinnamic acid standard curve. Experimental data were fitted using the Michaelis-Menten equation in GraphPad Prism 8.3 software to calculate the enzyme kinetics. k cat and K m Values. All experiments were repeated three times, and results are expressed as mean ± standard deviation. The kinetic parameters of each mutant are compared, for example... Figure 3 As shown.
[0043] Example 2: 1) Dissolving and pulverizing rice protein Weigh 0.5 g of rice protein and dissolve it in 10 ml of water. Shake to mix well and then use 160 W ultrasonic cell disruption for 6 min to obtain the pretreated solution.
[0044] 2) Neutral protease treatment Add 0.02 g of 4000 U / g neutral protease to the pretreatment solution, hydrolyze at pH 7.0 and 50℃ for 5 h, inactivate the enzyme at 90℃ for 20 min, cool, and centrifuge at 4000 rpm for 20 min to obtain the supernatant. The phenylalanine content was determined by a phenylalanine assay kit.
[0045] 3) Enzymatic hydrolysis of phenylalanine ammonia-lyase Add 7.5 μg / mL of the phenylalanine ammonia-lyase S73N mutant enzyme solution prepared in Example 1 to the supernatant obtained above, and react in a 50°C water bath for 24 h to obtain a low-phenylalanine enzyme hydrolysate. Using an inactivated enzyme solution as a blank control, perform the same method to determine the phenylalanine content using a phenylalanine assay kit.
[0046] 4) Phenylalanine removal rate analysis: Analysis using the phenylalanine detection kit showed that the maximum removal rate of phenylalanine reached 86.7%.
[0047] Example 3: 1) Dissolving and pulverizing whey protein Weigh 0.5 g of whey protein and dissolve it in 10 ml of water. Shake to mix well and then use ultrasound to disrupt the cell structure to obtain the pretreated solution.
[0048] 2) Neutral protease treatment Add 2 g of 1000 U / g neutral protease to the pretreatment solution, hydrolyze at pH 7.0 and 50℃ for 5 h, inactivate the enzyme at 90℃ for 20 min, cool, and centrifuge at 4000 rpm for 20 min to obtain the supernatant. The phenylalanine content is determined by a phenylalanine assay kit.
[0049] 3) Enzymatic hydrolysis of phenylalanine ammonia-lyase Add 7.5 μg / mL of the phenylalanine ammonia-lyase S73N mutant enzyme solution prepared in Example 1 to the supernatant obtained above, and react in a 50°C water bath for 24 h to obtain a low-phenylalanine enzyme hydrolysate. Using an inactivated enzyme solution as a blank control, perform the same method to determine the phenylalanine content using a phenylalanine assay kit.
[0050] 4) Phenylalanine removal rate analysis: Analysis using the phenylalanine detection kit showed that the maximum removal rate of phenylalanine can reach 95%.
[0051] Example 4: Using the same strategy as in Example 2, the difference is that the phenylalanine ammonia-lyase F84Y mutant enzyme solution prepared in Example 1 was used, and the maximum removal rate of phenylalanine reached 84% as analyzed by the phenylalanine detection kit.
[0052] Example 5: Using the same strategy as in Example 2, the difference is that the phenylalanine ammonia-lyase E95V mutant enzyme solution prepared in Example 1 was used, and the maximum removal rate of phenylalanine reached 86.3% as analyzed by the phenylalanine detection kit.
[0053] Example 6: Using the same strategy as in Example 2, the difference is that the phenylalanine ammonia-lyase V90R mutant enzyme solution prepared in Example 1 was used, and the maximum removal rate of phenylalanine reached 85.4% as analyzed by the phenylalanine detection kit.
[0054] Example 7: Using the same strategy as in Example 3, the difference is that the phenylalanine ammonia-lyase F84Y mutant enzyme solution prepared in Example 1 was used, and the maximum removal rate of phenylalanine reached 86.8% as analyzed by the phenylalanine detection kit.
[0055] Example 8: Using the same strategy as in Example 3, the difference is that the phenylalanine ammonia-lyase E95V mutant enzyme solution prepared in Example 1 was used. The maximum removal rate of phenylalanine reached 91.2% when analyzed by a phenylalanine detection kit.
[0056] Example 9: Using the same strategy as in Example 3, the difference is that the phenylalanine ammonia-lyase V90R mutant enzyme solution prepared in Example 1 was used, and the maximum removal rate of phenylalanine reached 92.4% as analyzed by the phenylalanine detection kit.
[0057] Example 10: The same strategy as in Example 2 was used, except that the neutral protease treatment was performed by adding it in stages, specifically: The pretreated solution was placed in a reactor equipped with an online ultraviolet detection system, and after being heated to 50°C and stabilized, the hydrolysis process was started.
[0058] First stage (start-up stage): Immediately add 55% of the total amount (calculated based on 4000 U / g protein) (i.e., corresponding to 0.011 g of neutral protease), and maintain stirring at 550 rpm for 12 min to allow the enzyme to act rapidly on the protein backbone.
[0059] The second stage (enhancing stage): The degree of hydrolysis of the system is monitored in real time using an online ultraviolet detection system. This system collects absorbance values every 4 minutes at wavelengths of 220-225 nm (characteristic absorption of peptide bonds) and 280-285 nm (characteristic absorption of aromatic amino acid exposure), and calibrates the system according to a preset absorbance ratio-hydrolysis degree calibration curve (based on a pre-detected absorbance ratio A). 222 / A 282 The quadratic polynomial equation obtained by fitting the hydrolysis degree DH% data points using the least squares method is: DH(%) = 9.8217 × (A 222 / A 282 ) 2 -15.3580×(A 222 / A 282Calculate the real-time degree of hydrolysis using (+11.2402). When the monitoring shows that the degree of hydrolysis reaches 9%, automatically add 32% of the total amount added (i.e., corresponding to 0.0064 g of neutral protease), and simultaneously add CaCl2 solution to make the Ca in the system equalize. 2+ The final concentration was 0.02 mol / L, and the stirring rate was adjusted to 350 rpm to reduce shear oxidation and stabilize enzyme activity.
[0060] The third stage (final stage): Continue to monitor the degree of hydrolysis. When it reaches 19%, add the remaining 13% of neutral protease (i.e., 0.0026 g), and at the same time, use dilute NaOH solution to fine-tune the pH of the system to 7.3.
[0061] The total enzymatic hydrolysis time was controlled at 5 hours, and the temperature was maintained at 50℃ throughout the process.
[0062] Ultimately, analysis using the phenylalanine detection kit showed that the maximum removal rate of phenylalanine reached 90.2%.
[0063] To establish and validate a dual-wavelength UV absorption ratio method for online monitoring of protein hydrolysis, the following systematic gradient hydrolysis experiments and data analysis were conducted: (1) Experimental design: Protein raw material: Rice protein, a representative variety, is selected.
[0064] Enzymatic hydrolysis system: Refer to the basic conditions in Example 2, and fix the protein concentration (50 mg / mL), temperature (50℃), and pH 7.0.
[0065] Gradient hydrolysis was achieved by precisely controlling the amount of neutral protease added (from 500 to 5000 U / g protein, with 8 gradients) and the reaction time (1, 2, 3, 4, and 5 h, a total of 5 time points) to prepare a series of samples covering the degree of hydrolysis (DH) range of 5% to 25%.
[0066] (2) Standard determination of degree of hydrolysis (DH): After each sample reaction is completed, take a sample immediately and inactivate the enzyme in a boiling water bath for 10 minutes.
[0067] The pH-stat method (or trinitrobenzenesulfonic acid TNBS method) in Appendix A of the national standard GB / T 22492-2008 "Soybean Peptide Powder" was used as the baseline method to accurately determine the degree of hydrolysis (DH%) of each sample. Each sample was measured in triplicate, and the average value was taken.
[0068] (3) Acquisition of ultraviolet absorption spectroscopy data: The sample with the known DH value was appropriately diluted, and the 200-350 nm ultraviolet absorption spectrum was scanned using a spectrophotometer (or online flow cell) equipped with an ultraviolet detection probe.
[0069] Precisely record the absorbance values (A) of each sample at wavelengths of 222 nm (characteristic absorption peak of peptide bond n-π* transition) and 282 nm (characteristic absorption peak of aromatic amino acid residues such as tyrosine and phenylalanine). 222 and A 282 ).
[0070] Calculate the absorbance ratio R = A for each sample. 222 / A 282 .
[0071] (4) Calibration curve fitting: With the degree of hydrolysis (DH%) as the dependent variable (Y), the absorbance ratio (A) 222 / A 282 Using X as the independent variable, we perform mathematical fitting on all experimental data points (n=40).
[0072] By comparison, the quadratic polynomial model (Y = aX) 2 The goodness of fit (R²) of +bX+c) 2 The result (>0.98) is better than the linear model, indicating that it can more accurately describe the nonlinear relationship between peptide bond breaking and aromatic amino acid exposure across the entire degree of hydrolysis.
[0073] For the rice protein-neutral protease system, the calibration curve equation obtained by fitting is: DH(%) = 9.8217 × (A 222 / A 282 ) 2 -15.3580×(A 222 / A 282 )+11.2402.
[0074] (5) Method verification: Precision verification: For the same sample with a DH of approximately 15%, 10 consecutive online UV detections were performed. The relative standard deviation (RSD) of the calculated DH values was <2.5%, indicating good repeatability of the method.
[0075] Accuracy verification: Five verification samples with different degrees of hydrolysis were randomly selected, and DH was determined using both the online method (calculated through calibration curves) and the baseline pH-stat method. The results showed that the average relative error of the two methods was <5%, proving that the online method has reliable accuracy.
[0076] Real-time verification: During a 5-hour hydrolysis reaction, the online monitoring system output a DH value every 3 minutes, successfully capturing the dynamic changes in the hydrolysis rate and accurately triggering the staged enzyme addition event, thus verifying its feasibility for real-time process control.
[0077] Through the experiments described above, a system based on the ultraviolet dual-wavelength absorbance ratio (A) was established. 222 / A 282 A reliable quantitative correlation between the degree of hydrolysis (DH%) and the degree of hydrolysis (DH%) was established. This calibration curve provides the core conversion basis for the online detection method described in this invention. Those skilled in the art can establish corresponding calibration curves through similar gradient experiments based on the specific protein raw materials and proteases used, thereby achieving precise and real-time process control of the production method of this invention.
[0078] Example 11: Using the same strategy as in Example 10, the difference is that the phenylalanine ammonia-lyase F84Y mutant enzyme solution prepared in Example 1 was used, and the maximum removal rate of phenylalanine reached 88.2% as analyzed by the phenylalanine detection kit.
[0079] Example 12: Using the same strategy as in Example 10, the difference is that the phenylalanine ammonia-lyase E95V mutant enzyme solution prepared in Example 1 was used, and the maximum removal rate of phenylalanine reached 90.5% as analyzed by the phenylalanine detection kit.
[0080] Example 13: Using the same strategy as in Example 10, the difference is that the phenylalanine ammonia-lyase V90R mutant enzyme solution prepared in Example 1 was used, and the maximum removal rate of phenylalanine reached 91.1% as analyzed by the phenylalanine detection kit.
[0081] Examples 10-13, building upon the single-stage addition of neutral protease in Examples 2-5, introduced a staged, intelligent addition strategy based on real-time hydrolysis degree feedback. A dual-wavelength UV online monitoring system was employed to achieve real-time judgment and process control of the hydrolysis degree. This addition method increased the exposure rate of phenylalanine residues, thereby facilitating the subsequent catalytic reaction of the phenylalanine ammonia-lyase mutant and effectively improving the final removal rate of phenylalanine.
[0082] Rice protein was hydrolyzed according to the neutral protease treatment conditions in Example 2 (single addition) and Example 10 (staged addition). The characteristic changes in the ultraviolet absorption spectrum during protein hydrolysis were utilized by real-time monitoring of A... 222 / A 282 The ratio is used to indirectly assess the exposure level of phenylalanine residues. A 222 / A 282 A higher ratio indicates more peptide bond breaks per unit of aromatic amino acid exposure, meaning more "efficient" hydrolysis and more complete exposure of aromatic amino acids (including Phe). The test results are shown in Table 1.
[0083] Table 1. Ultraviolet monitoring of rice protein hydrolysis process A 222 / A 282 Comparison of ratio changes The results showed that the A values of the phased addition group (Example 10) at each monitoring time point were... 222 / A 282 The ratios were consistently and significantly higher than those of the single-addition group (Example 2), indicating that the staged strategy rapidly overcame substrate inhibition through an initial high enzyme concentration, achieving more peptide bond breakage and associated aromatic amino acid exposure per unit time. This lays a solid material foundation for the subsequent phenylalanine ammonia-lyase (PAL) mutant to more efficiently contact and catalyze the substrate, thereby achieving a higher phenylalanine removal rate.
[0084] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details and examples shown and described herein.
Claims
1. A phenylalanine ammonia-lyase mutant, characterized in that, The phenylalanine ammonia-lyase mutant has the activity of converting phenylalanine into trans-cinnamic acid, and is a protein of a) or b) as follows: a) the serine at position 73 of the amino acid sequence shown in SEQ ID NO: 1 is substituted with asparagine, or the phenylalanine at position 84 of the amino acid sequence shown in SEQ ID NO: 1 is substituted with tyrosine, or the valine at position 90 of the amino acid sequence shown in SEQ ID NO: 1 is substituted with arginine, or the glutamic acid at position 95 of the amino acid sequence shown in SEQ ID NO: 1 is substituted with valine; b) a protein derived from (a) in which the amino acid sequence is substituted, deleted or added with one or several amino acids and still retains the phenylalanine ammonia-lyase activity.
2. A gene encoding the phenylalanine ammonia-lyase mutant of claim 1.
3. An expression vector comprising the gene of claim 2 and an engineered bacterium.
4. Use of the phenylalanine ammonia-lyase mutant of claim 1 in the production of low-phenylalanine protein.
5. A method for producing a low phenylalanine protein, characterized by, comprising the following steps: After the protein raw material is treated by ultrasonic cell pulverization, neutral protease is added for enzymolysis to obtain an enzymolysis liquid, the enzymolysis liquid is inactivated and centrifuged, and the supernatant is collected; An engineered bacterium expressing a phenylalanine ammonia-lyase mutant is prepared, the phenylalanine ammonia-lyase mutant is as claimed in claim 1, the engineered bacterium is cultured, and a phenylalanine ammonia-lyase mutant enzyme liquid is prepared; The supernatant is added with the phenylalanine ammonia-lyase mutant enzyme liquid for catalytic reaction, and after the reaction is completed, low-phenylalanine protein is harvested from the reaction product.
6. The method for producing a low-phenylalanine protein according to claim 5, wherein The catalytic reaction conditions for adding the phenylalanine ammonia-lyase mutant enzyme liquid into the supernatant are pH 7.5-8.5, temperature 54-57°C, the addition amount of the phenylalanine ammonia-lyase mutant enzyme liquid in the supernatant is 7-8 μg / mL, and the reaction time is 22-24 h.
7. The method for producing a low-phenylalanine protein according to claim 6, wherein The preparation method of the phenylalanine ammonia-lyase mutant enzyme liquid comprises: The genetically engineered bacteria are cultured in liquid medium, and when the OD value of the bacterial liquid reaches 0.7-0.8, the temperature is lowered, isopropyl thiogalactoside is added to the bacterial liquid for inducing expression, the bacterial cells are broken, and the product is obtained after purification. 600 The genetically engineered bacteria are cultured in liquid medium, and when the OD value of the bacterial liquid reaches 0.7-0.8, the temperature is lowered, isopropyl thiogalactoside is added to the bacterial liquid for inducing expression, the bacterial cells are broken, and the product is obtained after purification.
8. The method for producing a low-phenylalanine protein according to claim 5, wherein The specific processes of the ultrasonic cell pulverization treatment, enzymolysis, inactivation and centrifugation are as follows: The protein raw material is placed in an ultrasonic cell crusher for ultrasonic treatment, wherein the ultrasonic working conditions are: power 150-170 W, ultrasonic time 5-7 min, and after the ultrasonic treatment, a pretreatment liquid is obtained; Neutral protease is added to the pretreatment liquid, the addition amount is 1000-4200 U / g, then the liquid is hydrolyzed at a constant temperature of 49-51°C for 4.8-5.2 h under constant stirring, and an enzymolysis liquid is obtained; The enzymolysis liquid is placed in a water bath at 88-92°C for inactivation treatment for 18-20 min; Centrifugation is performed at 4000-4200 r / min for 18-20 min, and the supernatant is collected.
9. The method for producing a low-phenylalanine protein according to claim 8, wherein The process of adding neutral protease to the pretreatment liquid adopts staged addition, specifically as follows: Firstly, the total addition amount of neutral protease is set to be 1000-4200 U / g; After the pretreatment liquid is warmed to 49-51°C and stabilized, 50%-60% of the total addition amount of neutral protease is immediately added, and the stirring speed is maintained at 500-600 rpm for 10-15 min; When the hydrolysis degree reaches 8%-10%, add 30%-35% of the total amount of enzyme and Ca 2+ Ion solution, so that the final concentration of Ca²⁺ ions in the system reaches 0.01-0.03 mol / L, and the stirring rate is reduced to 300-400 rpm at this stage. When the degree of hydrolysis reaches 18%-20%, the remaining 5%-10% of neutral protease is added while the pH value of the system is adjusted to 7.2-7.
5.
10. The method for producing a low-phenylalanine protein according to claim 9, wherein The method for obtaining the degree of hydrolysis of the system by online detection comprises the following steps: The system is directly detected by using an ultraviolet detection probe. During the detection, the absorbance values at 220-225 nm wavelength for representing the number of peptide bonds and at 280-285 nm wavelength for representing the exposure amount of aromatic amino acid residues are collected simultaneously. The ratio of the absorbance values at the two wavelengths is calculated. The real-time degree of hydrolysis is obtained by converting the ratio according to a preset corresponding relationship between the ratio and the degree of hydrolysis. The corresponding relationship is established by a gradient hydrolysis experiment performed in advance and covers a range of 5%-25% of the degree of hydrolysis. During the detection, the absorbance collection and the degree of hydrolysis calculation are completed every 3-5 min. When the detected degree of hydrolysis reaches a preset threshold, the neutral protease addition program of the corresponding stage is started.