Joint

Abstract

The invention relates to a joint and application thereof. A linker according to the present invention comprises: a binding part having a structure capable of binding to a desired genetic information substance; and at least two or more puromycin-like substances capable of covalently binding to the C-terminal of a desired peptide.

Description

Technical Field

[0001] The present invention relates to a linker comprising a binding portion having a structure capable of binding with desired genetic information material and at least two puromycin-like substances, the use of the linker, a genetic information material-linker linker comprising the linker, and a genetic information material-linker-peptide linker comprising the linker. Background Technology

[0002] 1. Demonstration method

[0003] The techniques for matching genotypes and phenotypes, which emerged as tools in evolutionary molecular engineering, are also known as display methods. Known methods include phage display, ribosome display, microbead droplet method, STABLE method (non-covalent DNA display), and mRNA display (“In vitro virus”, Nemoto N, et al. FEBS Lett. 414, 405-408 (1997) (Non-Patent Document 1), WO98 / 016636 (Patent Document 1); or “RNA-peptide fusions”, Roberts, RW & Szostak, JW, Proc. Natl. Acad. Sci. USA., 94, Non-patent literature 2 includes 12297-12302(1997), WO1998 / 31700 (Patent Literature 12), cDNA display method, photocrosslinked cDNA display method (WO2016 / 159211 (Patent Literature 6)), TRAP (transcription-translation coupled with association of puromycin linker) display method (T. Ishizuka et al., TRAP display: a high-speed selection method for the generation of functional polypeptides., Am. Chem. Soc. 2013, 135, 14, 5433-5440 (Non-patent Literature 3)), cDNA TRAP display method (T. Kondo et al., cDNA TRAP display for rapid and stable in vitro selection of antibody-like proteins., Chem. Commun., 2021, 572416-572419 (Non-patent Literature 4)), etc.

[0004] In the display method, when selecting functional peptides or proteins from a library, their sequences can be easily read due to their connection to the corresponding genes, which is useful when selecting the genetic information of polypeptides with specific functions. By combining the display method of cell-free translation systems (in vitro protein synthesis systems) with the reprogramming of the genetic code, it is possible to synthesize peptides containing non-natural amino acid residues (non-natural peptides).

[0005] 2. Display method via puromycin

[0006] The aforementioned method integrates genotype and phenotype by linking mRNA (as the genotype) with peptide molecules (as the phenotype) using a cell-free translation system (in vitro protein synthesis system). A representative method employs puromycin, an analogue of the 3' terminal portion of tyrosine-tRNA, to link the synthesized peptide molecule with the mRNA encoding the peptide. Furthermore, besides puromycin, puromycin derivatives and other substances can also link peptides to mRNA (WO2011 / 049157 (Patent Document 2)).

[0007] In this puromycin-like display method, puromycin is pre-linked to mRNA via a suitable linker and introduced into a cell-free translation system to synthesize peptides from mRNA. The puromycin-like substance, acting as a substrate for peptide transfer reactions in ribosomes, is linked to the C-terminus of the elongating peptide chain. The peptide molecule, as the translation product, is then linked to mRNA via the puromycin-like substance. In other puromycin-like display methods, mRNA and puromycin-like substance are linked covalently using RNA ligase or non-covalently using nucleic acid hybridization. These methods, including mRNA display (In vitro virus method), cDNA display, photocrosslinked cDNA display (WO2016 / 159211 (Patent Document 6)), and TRAP (transcription-translation coupled with association of puromycin linker) display, can link various nucleic acid substances to puromycin-like substances in a covalent or non-covalent manner.

[0008] In the methods described above, puromycin-like substances function as substrates for peptide transfer reactions in ribosomes. However, for linkers of nucleic acids and their translation products via puromycin-like substances, only linkers consisting of one nucleic acid and one translation product are known (e.g., WO1998 / 016636 (Patent Document 1), WO2011 / 049157 (Patent Document 2), WO2006 / 041194 (Patent Document 3), Japanese Patent Application Publication No. 2011-528912 (Patent Document 4), etc.). The method of displaying via puromycin-like substances utilizes only linkers consisting of a single nucleic acid and a monovalent translation product (peptide).

[0009] Existing technical documents

[0010] Patent documents

[0011] Patent Document 1: WO1998 / 016636

[0012] Patent Document 2: WO2011 / 049157

[0013] Patent Document 3: WO2006 / 041194

[0014] Patent Document 4: Japanese Patent Application Publication No. 2011-528912

[0015] Patent Document 5: Japanese Patent Application Publication No. 2008-125396

[0016] Patent Document 6: WO2016 / 159211

[0017] Patent Document 7: WO2012 / 026566

[0018] Patent Document 8: Japanese Patent Application Publication No. 2008-125396

[0019] Patent Document 9: WO2007 / 066627

[0020] Patent Document 10: WO2019 / 077887

[0021] Patent Document 11: WO2023 / 234425

[0022] Patent Document 12: WO1998 / 31700

[0023] Non-patent literature

[0024] Non-patent literature 1: N Nemoto, et al., FEBS Lett., 1997, 414, 405-408

[0025] Non-patent literature 2: Roberts, RW, et al., Proc. Natl. Acad. Sci. USA., 1997, 94, 12297-12302

[0026] Non-patent literature 3: T. Ishizuka et al., Am. Chem. Soc. 2013, 135, 14, 5433-5440

[0027] Non-patent literature 4: T. Kondo et al., Chem. Commun., 2021, 572416-572419

[0028] Non-patent literature 5: Liu et al., Proc. Natl. Acad. Sci. USA. 2012, 109(2), 413-418

[0029] Non-patent literature 6: Ko et al., J.Am.Chem.Soc.2022, 144, 47, 21494-21501

[0030] Non-patent literature 7: IPKorndorefer and A. Skerra, Protein Sci., 2002, 11, 4, 883-893

[0031] Non-patent literature 8: KAMcDonnell et al., J.Med.Chem., 2010, 53, 4, 1587-1596

[0032] Non-patent literature 9: MNPascha et al., ACS Chem.Biol., 2022, 17, 9, 2425-2436

[0033] Non-patent literature 10: K. Muguruma et al., ACS Omega, 2019, 4, 11, 14390-14397

[0034] Non-patent literature 11: N. Terasaka et al., Nat. Chem. Biol., 2014, 10, 7, 555-557

[0035] Non-patent literature 12: H. Murakami et al., Nat. Methods, 2006, 3, 5, 357-359

[0036] Non-patent literature 13: T. Kawakami et al., Chem. Biol., 2008, 15, 1, 32-42

[0037] Non-patent literature 14: M.Saito et al., Nat.Commun., 2021, 12, 1, 2654

[0038] Non-patent literature 15: KATO T, et al. Nucleic Acids Res. 51, 8169-8180, 2023

[0039] Non-patent literature 16: Y. Goto et al., J. Am. Chem. Soc. 131, 14, 5040-5041, 2009

[0040] Non-patent literature 17: Zhenling Cui, et al., Front Bioeng Biotechnol. 8, 1031, 2020

[0041] Non-patent literature 18: Mizusawa et al., Bioorg. Med. Chem., 2009, 17, 6, 2381-2387

[0042] Non-patent literature 19: Hayashi et al., ACS Chem.Biol., 2012, 7, 3, 607-613

[0043] Non-patent literature 20: Hadidi et al., Angew Chem Int Ed Engl., 2023, 62, 23,e202216784

[0044] Non-patent literature 21: Starck et al., RNA., 2002, 8, 7, 890-903

[0045] Non-patent literature 22: Bao T Le et al., Mol Ther Nucleic Acids., 2019, 1, 14, 142-157

[0046] Non-patent literature 23: Irina Anosova et al., Nucleic Acids Res., 2016., Feb 18, 44, 3, 1007-1021

[0047] Non-patent literature 24: Michiko Kimoto et al., Front Mol Biosci, 2022, May 24, 9, 851646

[0048] Non-patent literature 25: Naho Akiyama et al., Nat Struct Mol Biol., 2024, Mar, 27

[0049] Non-patent literature 26: Valerie de Crecy-Lagard et al., Trends Microbiol., 2021, Jan, 29, 1, 41-53

[0050] Non-patent literature 27: MHSchreier et al., Journal of Molecular Biology, Vol. 116, No. 4, 727-753

[0051] Non-patent literature 28: H. Trachsel et al., Journal of Molecular Biology, Vol. 116, No. 4, 755-767

[0052] Non-patent literature 29: PCJelenc et al., Proceedings of the Natural AcademyScience of the United States of America Vol.76, No.7, 3174-3178 Summary of the Invention

[0053] The technical problem solved by the invention

[0054] One aspect of the present invention aims to provide a linker comprising a binding portion having a structure capable of binding with desired genetic information material and at least two puromycin-like substances, the use of the linker, a genetic information material-linker linker comprising the linker, a genetic information material-linker-peptide linker comprising the linker, etc.

[0055] Problem Solving Methods

[0056] The inventors unexpectedly discovered that by translating a target mRNA-linker linker, which is linked to a target mRNA with a linker described below, in ribosomes, a linker in which multiple translation products bind to one mRNA can be obtained. Further, by repeating this step, such a linker can be obtained efficiently, leading to the invention. The linker contains puromycin-like substances that bind to multiple sites of the branch. Because the linker of this invention contains multiple puromycin-like substances, by introducing the mRNA-linker linker of this invention into a cell-free translation system, peptide synthesis from mRNA can yield a linker between nucleic acid and translation products.

[0057] The present invention includes the following methods, but is not limited thereto.

[0058] [Method 1]

[0059] A connector comprising:

[0060] A binding portion having a structure capable of binding with desired genetic information material, and

[0061] At least two puromycin-like substances,

[0062] The aforementioned puromycin-like substance can covalently bond to the C-terminus of the desired peptide.

[0063] [Method 2]

[0064] According to the connector described in method 1, wherein,

[0065] The binding portion of the structure described above, which has the ability to bind to the desired genetic information material, contains nucleic acids that can bind to the desired genetic information material.

[0066] [Method 3]

[0067] The connector according to method 1 or 2 is used to link the genetic information material to the peptide encoded by the genetic information material.

[0068] [Method 4]

[0069] According to the connectors described in methods 1 to 3, wherein,

[0070] The genetic information material mentioned above is nucleic acid.

[0071] [Method 5]

[0072] According to the connectors described in methods 1 to 3, wherein,

[0073] The aforementioned puromycin-like substance is puromycin.

[0074] [Method 6]

[0075] An application of a connector, the connector comprising:

[0076] A binding portion having a structure capable of binding with desired genetic information material, and

[0077] At least two puromycin-like substances,

[0078] The aforementioned puromycin-like substance can covalently bond to the C-terminus of the desired peptide.

[0079] The above-described uses are for linking the genetic information material to the peptide encoded by the genetic information material.

[0080] [Method 7]

[0081] A genetic information material—a connector—comprising:

[0082] (a) The connectors described in methods 1-3, and

[0083] (b) The genetic information material that is bound to the junction of (a) the connector.

[0084] [Method 8]

[0085] A genetic information material-connector-peptide linker, comprising:

[0086] (a) The connectors described in methods 1-3,

[0087] (b) the genetic information material at the junction of the connector in (a), and

[0088] (c) A peptide encoded by the aforementioned genetic information material that binds to at least two puromycin-like substances at the linker of (a).

[0089] [Method 9]

[0090] A method for manufacturing a genetic information material-connector-peptide linker, the method comprising:

[0091] (1) A process of translating genetic information material by supplying the genetic information material-connector linker described in method 7 to a cell-free translation system, wherein the puromycin-like substance in the linker binds to the translated peptide to obtain the genetic information material-connector-peptide linker.

[0092] [Method 10]

[0093] According to the manufacturing method of method 9, the method includes the following steps prior to step (1):

[0094] (0) The process of combining the connector described in methods 1 to 3 with the desired genetic information material to obtain a genetic information material-connector connector.

[0095] [Method 11]

[0096] The manufacturing method according to method 9 or 10 includes:

[0097] (2) Repeat the process of (1) more than twice.

[0098] [Method 12]

[0099] A library comprising at least two genetic information material-connector-peptide linkers as described in 8.

[0100] [Method 13]

[0101] A screening method for peptides that bind to a desired target substance, the method comprising:

[0102] A process of contacting a library containing at least two of the genetic information material-connector-peptide linkers described in method 8 with the target material described above.

[0103] [Method 14]

[0104] An evaluation method for assessing the binding affinity of a desired target substance to a peptide, the method comprising:

[0105] The process of bringing the genetic information material-connector-peptide linker described in method 8 into contact with the target material described above.

[0106] [Method 15]

[0107] A method for manufacturing a genetic information material-connector-peptide linker, the method comprising:

[0108] (1-i) A process of translating genetic information material into a genetic information material-adaptor linker by combining a linker containing at least one puromycin-like substance with a desired genetic information material in a cell-free translation system, wherein the puromycin-like substance in the linker combines with the translated peptide to obtain a genetic information material-adaptor-peptide linker; and

[0109] (2-i) is a process that repeats (1-i) more than twice.

[0110] [Method 16]

[0111] A method for manufacturing a genetic information material-connector-peptide linker, the method comprising:

[0112] (1-ii) A process of supplying a genetic information material-adaptor linker, which contains at least two puromycin-like substances and is combined with a desired genetic information material, to a cell-free translation system for translating the genetic information material, wherein the puromycin-like substances in the adapter are combined with the translated peptide to obtain a genetic information material-adaptor-peptide linker.

[0113] [Method 17]

[0114] A method comprising displaying two or more peptides encoded by a desired genetic material, wherein,

[0115] The aforementioned peptides are linked to the aforementioned genetic information material via functional groups that can covalently bond to the C-terminus of the aforementioned peptides.

[0116] [Method 18]

[0117] According to the display method described in method 17, the method includes:

[0118] The step of supplying the genetic information material-connector linker described in Method 7 to a cell-free translation system to translate the peptide from the genetic information material includes the step of binding the puromycin-like substance to the translated peptide.

[0119] The effects of the invention

[0120] Regarding the aforementioned "linker formed by the binding of multiple translation products to a single genetic information substance via a puromycin-like substance," if the translation products possess target-binding ability, the target substance can be identified through multiple such translation products. This allows for the attribution of multivalent interactions (affinity effects) to the translation products targeting the target. Therefore, by using such a linker of the present invention in, for example, display methods in cell-free translation systems (such as display methods via puromycin-like substances) and affinity screening (in-tube elimination methods), peptide-genetic information substance linkers bound to the target substance can be recovered more efficiently. Attached Figure Description

[0121] [ Figure 1-1Figure 1 illustrates the structures of each of the connectors 1-15 used in the embodiments. In the structures “cccgcctcccgccccccgtcc” (SEQ ID NO.1) and “ctcccgccccccgtcc” (SEQ ID No.60), c, g, and t refer to nucleotides with cytosine, guanine, and thymine as bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the aforementioned DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures within square brackets and the subscript numbers represent repeating structures and their repeat numbers, respectively.

[0122] [ Figure 1-2 Figure 1 illustrates the structures of each of the connectors 1-15 used in the embodiments. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the aforementioned DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures within square brackets and the subscript numbers represent repeating structures and their repeat numbers, respectively.

[0123] [ Figure 1-3 Figure 1 illustrates the structures of each of the connectors 1-15 used in the embodiments. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the aforementioned DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures within square brackets and the subscript numbers represent repeating structures and their repeat numbers, respectively.

[0124] [ Figure 1-4Figure 1 illustrates the structures of each of the connectors 1-15 used in the embodiments. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the aforementioned DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures within square brackets and the subscript numbers represent repeating structures and their repeat numbers, respectively.

[0125] [ Figure 1-5 Figure 1 illustrates the structures of each of the connectors 1-15 used in the embodiments. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the aforementioned DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures within square brackets and the subscript numbers represent repeating structures and their repeat numbers, respectively.

[0126] [ Figure 1-6 Figure 1 illustrates the structures of each of the connectors 1-15 used in the embodiments. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the aforementioned DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures within square brackets and the subscript numbers represent repeating structures and their repeat numbers, respectively.

[0127] [ Figure 1-7Figure 1 illustrates the structures of each of the connectors 1-15 used in the embodiments. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the aforementioned DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures within square brackets and the subscript numbers represent repeating structures and their repeat numbers, respectively.

[0128] [ Figure 1-8 Figure 1 illustrates the structures of each of the connectors 1-15 used in the embodiments. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the aforementioned DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures within square brackets and the subscript numbers represent repeating structures and their repeat numbers, respectively.

[0129] [ Figure 1-9 Figure 1 illustrates the structures of each of the connectors 1-15 used in the embodiments. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the aforementioned DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures within square brackets and the subscript numbers represent repeating structures and their repeat numbers, respectively.

[0130] [ Figure 1-10Figure 1 illustrates the structures of each of the connectors 1-15 used in the embodiments. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the aforementioned DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures within square brackets and the subscript numbers represent repeating structures and their repeat numbers, respectively.

[0131] [ Figure 2-1 Figure 2 shows the structures of the precursors used in the synthesis of each adapter 2-15. In the structures “cccgcctcccgccccccgtcc” (SEQ ID NO.1) and “ctcccgccccccgtcc” (SEQ ID No.60), c, g, and t refer to nucleotides with cytosine, guanine, and thymine as bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by linking these nucleotides. In the above DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscript numbers in square brackets represent repeating structures and their repeat numbers, respectively. Alkyne puromycin was used in the synthesis of adapters 4-6, 8, and 11-15.

[0132] [ Figure 2-2 Figure 2 shows the structures of the precursors used in the synthesis of each adapter 2-15. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the above DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscript numbers within square brackets represent repeating structures and their repeat numbers, respectively. Alkyne puromycin is used in the synthesis of adapters 4-6, 8, and 11-15.

[0133] [ Figure 2-3Figure 2 shows the structures of the precursors used in the synthesis of each adapter 2-15. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the above DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscript numbers within square brackets represent repeating structures and their repeat numbers, respectively. Alkyne puromycin is used in the synthesis of adapters 4-6, 8, and 11-15.

[0134] [ Figure 2-4 Figure 2 shows the structures of the precursors used in the synthesis of each adapter 2-15. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the above DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscript numbers within square brackets represent repeating structures and their repeat numbers, respectively. Alkyne puromycin is used in the synthesis of adapters 4-6, 8, and 11-15.

[0135] [ Figure 2-5 Figure 2 shows the structures of the precursors used in the synthesis of each adapter 2-15. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the above DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscript numbers within square brackets represent repeating structures and their repeat numbers, respectively. Alkyne puromycin is used in the synthesis of adapters 4-6, 8, and 11-15.

[0136] [ Figure 2-6Figure 2 shows the structures of the precursors used in the synthesis of each adapter 2-15. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the above DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscript numbers within square brackets represent repeating structures and their repeat numbers, respectively. Alkyne puromycin is used in the synthesis of adapters 4-6, 8, and 11-15.

[0137] [ Figure 2-7 Figure 2 shows the structures of the precursors used in the synthesis of each adapter 2-15. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the above DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscript numbers within square brackets represent repeating structures and their repeat numbers, respectively. Alkyne puromycin is used in the synthesis of adapters 4-6, 8, and 11-15.

[0138] [ Figure 2-8 Figure 2 shows the structures of the precursors used in the synthesis of each adapter 2-15. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the above DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscript numbers within square brackets represent repeating structures and their repeat numbers, respectively. Alkyne puromycin is used in the synthesis of adapters 4-6, 8, and 11-15.

[0139] [ Figure 2-9Figure 2 shows the structures of the precursors used in the synthesis of each adapter 2-15. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the above DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscript numbers within square brackets represent repeating structures and their repeat numbers, respectively. Alkyne puromycin is used in the synthesis of adapters 4-6, 8, and 11-15.

[0140] [ Figure 2-10 Figure 2 shows the structures of the precursors used in the synthesis of each adapter 2-15. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the above DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscript numbers within square brackets represent repeating structures and their repeat numbers, respectively. Alkyne puromycin is used in the synthesis of adapters 4-6, 8, and 11-15.

[0141] [ Figure 2-11 Figure 2 shows the structures of the precursors used in the synthesis of each adapter 2-15. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the above DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscript numbers within square brackets represent repeating structures and their repeat numbers, respectively. Alkyne puromycin is used in the synthesis of adapters 4-6, 8, and 11-15.

[0142] [ Figure 2-12Figure 2 shows the structures of the precursors used in the synthesis of each adapter 2-15. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the above DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscript numbers within square brackets represent repeating structures and their repeat numbers, respectively. Alkyne puromycin is used in the synthesis of adapters 4-6, 8, and 11-15.

[0143] [ Figure 2-13 Figure 2 shows the structures of the precursors used in the synthesis of each adapter 2-15. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the above DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscript numbers within square brackets represent repeating structures and their repeat numbers, respectively. Alkyne puromycin is used in the synthesis of adapters 4-6, 8, and 11-15.

[0144] [ Figure 2-14 Figure 2 shows the structures of the precursors used in the synthesis of each adapter 2-15. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the above DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscript numbers within square brackets represent repeating structures and their repeat numbers, respectively. Alkyne puromycin is used in the synthesis of adapters 4-6, 8, and 11-15.

[0145] [ Figure 2-15Figure 2 shows the structures of the precursors used in the synthesis of each adapter 2-15. In the structures “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc”, the “c”, “g”, and “t” refer to nucleotides with cytosine, guanine, and thymine bases, respectively. “cccgcctcccgccccccgtcc” and “ctcccgccccccgtcc” refer to the DNA formed by the linkage of these nucleotides. In the above DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscript numbers within square brackets represent repeating structures and their repeat numbers, respectively. Alkyne puromycin is used in the synthesis of adapters 4-6, 8, and 11-15.

[0146] [ Figure 3 ] Figure 3 The results were evaluated using gel electrophoresis and fluorescence imaging to assess the formation of mRNA-adaptor linkers. Figure 3 a and b are the results of analyzing how the bivalent linker (linker 4) can be linked to several mRNAs with different total base numbers obtained by randomizing a portion of the translation region with any of the deoxynucleotides with adenine, guanine, cytosine, or uracil as bases. Figure 3 c represents the results of analysis on mRNAs that can be linked to a portion of the translation region by randomization of any of the deoxyribonucleotides with adenine, guanine, cytosine, or uracil bases, regardless of the number of puromycins in the branched chain structure or the linker. Figure 3 d represents the results of analyzing the ability of a bivalent linker (linker 8), which has a phosphate group at the 5' end and can form a covalent bond with the 3' end of the mRNA through a ligation reaction, to link with a portion of the translation region to several mRNAs with different numbers of bases obtained by randomization of any of the deoxynucleotides with adenine, guanine, cytosine, or uracil.

[0147] [ Figure 4 ] Figure 4 The results of the analysis are as follows: For the linker (linker 4 precursor 2) with azide groups at the ends of the two branched chain structures, which are combined with mRNA, alkynyl puromycin is introduced via CuAAC reaction (AAC: Azide-Alkyne-cycloaddition), thereby creating an mRNA-linker linker with two puromycin groups at the ends.

[0148] [ Figure 5 ] Figure 5 The results were evaluated using gel electrophoresis and fluorescence imaging to assess the binding reaction between peptides and mRNA-linker connectants. Figure 5 a is an image obtained when detecting fluorescence originating from Cy5. Figure 5 b is an image obtained during fluorescence detection of fluorescein. These are the results of an analysis of a case where multiple peptides were efficiently displayed via puromycin in the linker through artificial cyclic translation using a divalent linker (linker 3).

[0149] [ Figure 6 ] Figure 6 a is the result of analysis by gel electrophoresis and fluorescence imaging of the following situation: multiple peptides can be displayed via puromycin in the linker through artificial cyclic translation using a bivalent linker (linker 3). Figure 6 b indicates that artificial cyclic translation demonstrated an increase in the number of linkers for multiple peptides. Figure 6 c. Figure 6 d represents the results of an analysis of the following: through artificial cyclic translation, the peptide display of the monovalent linker (linker 2) increased.

[0150] [ Figure 7 ] Figure 7 The results of analysis using gel electrophoresis and fluorescence imaging show that reverse transcription can also be performed in mRNAs that hybridize with bivalent adapters (adaptor 3).

[0151] [ Figure 8 ] Figure 8 The results were obtained by analyzing the following situation using gel electrophoresis and fluorescence imaging: multiple peptides can be displayed even in bivalent adapters with different adapter lengths.

[0152] [ Figure 9 ] Figure 9 a is the result of analysis by gel electrophoresis and fluorescence imaging of the following: biotin modification at the 5' end of linker 4 and linker 12 modified with a guanine-based deoxynucleotide before the branch in the linker can be specifically cleaved by RNase T1. Figure 9 b represents the results of evaluating the binding reaction of peptides to the mRNA-linker 12 linker using gel electrophoresis and fluorescence imaging. This indicates that multiple peptides can be efficiently displayed via puromycin in the linker through artificial cyclic translation using a bivalent linker (linker 12).

[0153] [ Figure 10 ] Figure 10Figure a shows that, in the evaluation of binding affinity of Strep-tag II and streptavidin as model peptides and model target proteins, the recovery rate of DNA derived from target protein binding was improved by using a bivalent adapter (adapter 3). Furthermore, it was shown that artificial cyclic translation further improved the recovery rate of target protein binding DNA. The recovery rates (%) in the graphs represent the mean, and the error bars represent the standard deviation (n=3). Figure 10 Figure b shows that, in the evaluation of binding affinity between Strep-tag II and streptavidin as model peptides and model target proteins, the use of bivalent adapters (adapters 3-6) improved the recovery rate of DNA derived from the binding of the target protein, with the enhancement rate varying according to branch length. The recovery rates (%) in the graphs represent the mean, and the error bars represent the standard deviation (n=3).

[0154] [ Figure 11 ] Figure 11 This indicates that, in the evaluation of binding capacity using Human IgG Fc protein-binding peptides, the recovery rate of DNA derived from binding to the target protein was improved when artificial cyclic translation was performed using a bivalent adapter (adapter 3). The recovery rates (%) in the graphs represent the mean, and the error bars represent the standard deviation (n=3).

[0155] [ Figure 12 ] Figure 12 This indicates that, in the recovery evaluation using hemagglutinin (HA)-binding peptides, the recovery rate of DNA derived from binding to the target protein was improved by using a bivalent adapter (Adapter 3). Additionally, it is shown that the recovery rate of DNA derived from binding to the target protein was improved by performing artificial cyclic translation. The recovery rates (%) in the graphs represent the mean, and the error bars represent the standard deviation (n=3).

[0156] [ Figure 13 ] Figure 13 This indicates that in the recovery evaluation using neonatal Fc receptor (FcRn)-binding peptides, the use of bivalent adapters (adapters 3–6) enhances the recovery of DNA derived from the binding of the target protein; the shorter the branched strand length, the higher the enhancement rate. The recovery rates (%) in the graphs represent the mean, and the error bars represent the standard deviation (n=3).

[0157] [ Figure 14 ] Figure 14This indicates that, in the evaluation of recovery rates in each round of screening for Fc-binding peptides using a random peptide library, when using a bivalent adapter (Adapter 4), a significantly higher recovery rate of DNA derived from binding to the target protein can be obtained each time a screening round is repeated, compared to the recovery rate of DNA derived from non-specific binding (obtained from negative screening).

[0158] [ Figure 15 ] Figure 15 This indicates that, in the evaluation of the recovery rate of gene sequences obtained by screening with Fc-binding peptides, the peptide sequences obtained by screening with bivalent adapters (adapter 4) can achieve a higher recovery rate of DNA derived from binding to the target protein compared to the recovery rate of DNA derived from non-specific binding.

[0159] [ Figure 16 ] Figure 16 This indicates that, in the evaluation of the binding affinity of Strep-tag II and streptavidin as model peptides and model target proteins, the recovery rate of DNA derived from the binding to the target protein was improved when the adapter was covalently bonded to mRNA, compared with the use of a monovalent adapter (adapter 7). The recovery rates (%) in the graphs represent the mean, and the error bars represent the standard deviation (n=3).

[0160] [ Figure 17 ] Figure 17 a is the result of analysis by gel electrophoresis and fluorescence imaging of the following: the 3' end amino acids of the monovalent linker (linker 9) and the divalent linker (linker 10) are acylated. Figure 17 b shows the structure of a puromycin-like substance prepared by acylation of the amino acid at the 3' end of the linker. Figure 17 c shows the structure of a bivalent linker created by acylation of the 3' end amino acid of the linker. In the structure “cccgcctcccgccccccgtcc”, c, g, and t refer to nucleotides with cytosine, guanine, and thymine bases, respectively, and “cccgcctcccgccccccgtcc” refers to the DNA formed by the linkage of these nucleotides. In the above DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to the PEG structure via a phosphodiester bond. The structures within square brackets and the subscript numbers represent repeating structures and their repeat numbers, respectively.

[0161] [ Figure 18 ] Figure 18This indicates that, in the evaluation of binding affinity of Strep-tag II and streptavidin as model peptides and target proteins, in a state where amino acids are covalently bonded to the ribose at the 3' end of the divalent adapter (Adapter 10) via ester bonds, forming a puromycin-like substance, the recovery rate of DNA derived from binding to the target protein was improved by using the divalent adapter (Adapter 10) compared to using the monovalent adapter (Adapter 9). The recovery rates (%) in the graphs represent the mean, and the error bars represent the standard deviation (n=3).

[0162] [ Figure 19 ] Figure 19 The results show that, in evaluating the binding affinity of Strep-tag II and streptavidin as model peptides and model target proteins, the recovery rate of DNA derived from target protein binding was improved by using a trivalent adapter (Adapter 11) compared to the case using a monovalent adapter. Furthermore, the results indicate that the recovery rate of target protein-bound DNA increased with the number of cycles of artificial cyclic translation. The recovery rates (%) in the graphs represent the mean, and the error bars represent the standard deviation (n=3).

[0163] [ Figure 20 ] Figure 20 This indicates that, in the evaluation of the binding affinity of Strep-tag II and streptavidin as model peptides and model target proteins, the recovery rate of DNA derived from the binding to the target protein was improved by using a trivalent adapter (Adapter 15) compared to the case using a monovalent adapter. The recovery rates (%) in the graphs in the figure represent average values ​​(n=2). Detailed Implementation

[0164] This invention includes, without limitation, the following methods. Unless otherwise stated, the technical and scientific terms used in this specification have the same meaning as commonly understood by those skilled in the art. The substances, materials, and examples disclosed in this specification are merely illustrative and not intended to be limiting. In this specification, the reference to "in one method" is not intended to limit the scope of the invention.

[0165] 1. Connector

[0166] In one embodiment, the present invention relates to a connector. The connector of the present invention comprises: a binding portion having a structure capable of binding to desired genetic information material, and at least two puromycin-like substances capable of covalently bonding to the C-terminus of the desired peptide. The covalent bonding is preferably an amide bond.

[0167] "Genetic information material" refers to substances that are translated into peptides (containing information) in ribosomes.

[0168] In one approach, the "genetic information material" is nucleic acid. The nucleic acid serving as the genetic information material can be either naturally occurring or non-natural. Naturally occurring nucleic acids include naturally occurring modified nucleic acids, while non-natural nucleic acids include nucleic acids modified by non-natural substances or whose structure has been partially replaced. Types of nucleic acids include RNA, RNA-DNA hybrids, etc. Although not limited, RNA is preferred as such a nucleic acid. The base sequence of the aforementioned genetic information material can be known or unknown. This sequence can be based on sequences existing in nature or can be artificially designed. For example, it can be a sequence randomly synthesized through organic synthesis, or a sequence encoding a protein with an unknown sequence through random mutation insertion using PCR.

[0169] As described above, the "genetic information material" encodes a peptide, the amino acid sequence of which can be a known sequence or an unknown sequence. Furthermore, the length of the peptide is not particularly limited. In one embodiment, the peptide encoded by the "genetic information material" can consist of one or more amino acids, preferably two or more, with no particular upper limit, and can be less than 1000, less than 500, less than 100, less than 50, less than 30, or less than 20 amino acids.

[0170] Therefore, in one approach, the length of the "genetic information material" can be more than 3 bases, preferably more than 6 bases, and there is no particular upper limit, which can be less than 3000 bases, less than 1500 bases, less than 300 bases, less than 150 bases, less than 90 bases, or less than 60 bases.

[0171] Furthermore, there are no particular limitations on the types of peptides encoded by the "genetic information material." These peptides can include molecules capable of linking to tRNA and condensing via ribosomes. It is known that ribosomes can translate various molecules with structures different from those of ordinary amino acids ("Translation initiation with exotic amino acids using EF-P-responsive artificial initiator tRNA", KATO T, et al. Nucleic Acids Res. 51, 8169-8180, 2023 (Non-Patent Literature 15), "Translation initiation with initiator tRNA Charged with Exotic Peptides", Goto Y, et al. J. Am. Chem. Soc. 131, 14, 5040-5041, 2009 (Non-Patent Literature 16), "Cell-Free Approach for Non-canonical Amino Acids Incorporation Into Polypeptides", Zhenling Cui, et al. Front Bioeng Biotechnol. 8, 1031, 2020 (Non-Patent Literature 17)). Therefore, even structures different from amino acids can be applied to this invention as long as they can be translated by ribosomes. That is, in this specification, a peptide that can be translated by ribosomes is simply a molecule that can be linked to tRNA and can be translated by ribosomes.

[0172] The aforementioned peptides can be molecules containing natural amino acid residues, non-natural amino acid residues, or other structures capable of linking to tRNA and being translated by ribosomes. Here, non-natural amino acids are any compounds capable of linking to tRNA and being condensed by ribosomes. Examples of non-limiting examples include β-amino acids, γ-amino acids, L-amino acids, D-amino acids (also called D-type amino acids), N-methyl amino acids, N-ethyl amino acids, and other N-alkyl amino acids, peptides, α-substituted amino acids, α-α-disubstituted amino acids, cyclic α-amino acids, amino acid mutants, amino acid derivatives, and other chemically modified amino acids. Furthermore, the aforementioned peptides may contain hydroxy acids capable of linking to RNA and being condensed by ribosomes. Additionally, for peptides translated from "genetic information material" in ribosomes, their shape is not limited; after translation, they can be any shape, such as single-chain peptides, cyclic peptides (including peptides with a cyclic portion), or peptides with specific secondary structures. In one embodiment, the translated peptide is cyclic.

[0173] In one embodiment, the peptide is a peptide that binds to a target substance. In another embodiment, the peptide is a fragment or full-length protein. In one embodiment, the peptide is an antagonist or agonist of the target substance. In one embodiment, the peptide is an antigen or an antibody against that antigen. Non-limitingly, the peptide may be an extended peptide that serves as a substrate for peptide transfer reactions in ribosomes. The term "peptide encoded by genetic information material" in this specification includes not only peptides that have fully completed translation from genetic information material, but also peptides that are extended during translation.

[0174] "A structure that can bind to desired genetic information material" refers to a structure that can bind directly or indirectly to desired genetic information material.

[0175] One way to describe a "structure capable of indirectly binding to desired genetic information material" is as follows: a structure capable of binding to desired genetic information material via a suitable connector. The aforementioned suitable connector is a connector capable of linking the desired genetic information material to the connector of the present invention. The aforementioned suitable connector includes substances capable of directly binding to the desired genetic information material and substances capable of directly binding to the connector of the present invention. As a substance capable of directly binding to the aforementioned desired genetic information material, a nucleic acid capable of binding to the aforementioned desired genetic information material can be used.

[0176] Another way in which a substance can be indirectly bonded to the connector of the present invention is through a set of functional groups that can bond with each other. By selecting a set of functional groups that can bond with each other, using one of the functional groups in the appropriate connector and the other in the connector of the present invention, the appropriate connector can be bonded to the connector of the present invention. In this case, the "set of functional groups that can bond with each other" can be appropriately selected based on the technical common sense of those skilled in the art. As non-limiting examples of reactions using such a set of functional groups for bonding, examples include: reactions via click chemistry or biological conjugation reactions, represented by the pairing of azide and alkyne, nucleophilic substitution or nucleophilic addition reactions using the pairing of nucleophilic and electrophilic functional groups, etc. As specific examples of these, examples include the pairing of azide with non-cyclic strained alkyne, the pairing of azide with cyclic strained alkyne, the pairing of thiol with maleimide, and the pairing of thiol with haloacetyl group. Furthermore, the structure of the aforementioned suitable connector is not particularly limited as long as it achieves the above objectives. Given these objectives, an appropriate structure can be selected based on the technical knowledge of those skilled in the art.

[0177] The above describes one aspect of the connector of the present invention as a "connection portion having a structure capable of indirectly binding with desired genetic information material". This connection portion has a structure having a structure that allows it to bind with "one of a set of functional groups capable of binding with each other" of the appropriate connector when the desired genetic information material is bound via an appropriate connector.

[0178] Another way to distinguish between "a binding portion having a structure capable of binding to desired genetic information material" and "a binding portion comprising a nucleic acid capable of binding to the desired genetic information material" is to include a binding portion comprising a nucleic acid capable of binding to the desired genetic information material. In the case where the "binding portion having a structure capable of binding to desired genetic information material" comprises a nucleic acid capable of binding to the desired genetic information material, the nucleic acid portion of the connector of the present invention can directly bind to the desired genetic information material.

[0179] The nucleic acid “capable of binding to genetic information material” can be of a natural type, a non-natural type, or a mixture of natural and non-natural nucleic acids. While not limited, DNA can be used as such a nucleic acid. Furthermore, in this specification, the “non-natural nucleic acid” constituting the aforementioned “nucleic acid capable of binding to genetic information material” also includes peptide nucleic acids. Peptide nucleic acids are molecules with a structure similar to DNA or RNA, which maintains a peptide structure on the backbone, and are sometimes called PNAs. Using alternative sugars (deoxyribose or ribose), peptide nucleic acids have a backbone composed of N-(2-aminoethyl)glycine amide bonds. Moreover, the purine ring and pyrimidine ring, corresponding to nucleic acid bases, are bound to the backbone via methylene and carbonyl groups. As long as peptide nucleic acids can bind to the desired genetic information material, they can also serve as constituent elements of the aforementioned linker, just like natural nucleic acids.

[0180] The aforementioned nucleic acid can be selected based on the purpose of the adapter and common technical knowledge, choosing an appropriate structure that "can bind to the desired genetic information material". Preferably, it is a structure capable of covalent or non-covalent bonding. The base sequence of the aforementioned nucleic acid is not particularly limited. The length of the aforementioned nucleic acid base sequence is also not particularly limited, as long as it is a length capable of binding to the desired genetic information material, and can be appropriately determined based on the length of the desired genetic information material. In one embodiment, the length of the aforementioned nucleic acid base sequence is the length capable of specifically hybridizing with the desired genetic information material. In one embodiment, the length of the nucleic acid base sequence is 2 or more bases, 3 or more bases, 5 or more bases, 10 or more bases, 11 or more bases, 12 or more bases, 13 or more bases, 14 or more bases, 15 or more bases, 16 or more bases, 17 or more bases, 18 or more bases, 19 or more bases, 20 or more bases, or 22 or more bases. From the viewpoint of maintaining the binding of nucleic acid to the desired genetic information material, when the length of the hybridized nucleic acid base sequence is 9 bases or less, it is preferable that, in addition to hybridization, the nucleic acid is covalently bonded to the desired genetic information material by methods described later. Furthermore, in one embodiment, the length of the nucleic acid base sequence is 200 bases or less, 150 bases or less, 100 bases or less, 80 bases or less, 70 bases or less, 60 bases or less, 55 bases or less, 50 bases or less, 45 bases or less, 40 bases or less, 35 bases or less, 30 bases or less, or 25 bases or less. In another embodiment, the length of the nucleic acid base sequence falls within any combination of the lengths mentioned above and below. All or part of the nucleic acid base sequence can bind to the genetic information material.

[0181] The aforementioned nucleic acids and genetic information material can be linked by non-covalent and / or covalent bonds. The specific method of binding the nucleic acids and genetic information material is not limited, but a non-covalent bond with a single-stranded DNA capable of specifically hybridizing with the target RNA (preferably the target mRNA) is preferred. Other methods include: UV irradiation of a single-stranded DNA containing photocrosslinkable non-natural nucleic acids that hybridizes with the target RNA at a specific site, causing photocrosslinking between the target RNA and the single-stranded DNA; enzymatic covalent bonding of the target RNA and the ends of the single-stranded DNA using RNA ligase or DNA ligase; and so on.

[0182] In one approach, "nucleic acid capable of binding to genetic information material" is single-stranded DNA capable of specifically hybridizing with target RNA. While not limited to this, such DNA can also contain non-natural nucleic acids.

[0183] The aforementioned connector contains at least two puromycin-like substances. In this specification, the connector containing two puromycin-like substances is referred to as a "bivalent connector," and the connector containing n puromycin-like substances is referred to as an "n-valent connector."

[0184] In this specification, "puromycin-like substance" refers to a substance having a site capable of connecting to a substance constituting a linker and covalently bonding to the C-terminus of a peptide on a ribosome. Such a substance is not limited to puromycin or its derivatives described later; for example, it could be a molecule described in Patent Document 1 that binds to repressive tRNA and becomes integrated with it, thus being recognized by the ribosome. In one embodiment, the "puromycin-like substance" is a substance that functions to react with peptidyl-tRNA bound to the P site of a ribosome to form a complex with an extended peptide; there is no particular limitation on such a substance. Here, "peptidyl-tRNA" can be peptidyl-tRNA generated during the translation process of a peptide encoded by the aforementioned genetic information material. In one embodiment, the puromycin-like substance can covalently bond to such peptidyl-tRNA on a ribosome, preferably by an amide bond.

[0185] In addition, one form of "purinomycin-like substance" is a substance having a structure in which a nucleoside or nucleic acid or a substance having a similar chemical structural backbone or a continuum thereof is chemically bonded to an amino acid or a substance having a similar chemical structural backbone, and has the function of reacting with peptidyl tRNA bound to the P site of the ribosome to form a complex with an extended peptide.

[0186] In one embodiment, the puromycin-like substance is puromycin.

[0187] Additionally, as an alternative, puromycin-like substances are puromycin derivatives. Puromycin derivatives are not limited to substances that completely possess the puromycin structure, but also include substances lacking a portion of the puromycin structure, or substances in which a portion is substituted with another structure. Non-limiting examples of puromycin derivatives include: 3'-N-aminoacylpuromycin aminonucleotide (PANS-amino acid), and 3'-N-aminoacyladenosine aminonucleotide (AANS-amino acid) linked by an amide bond formed by the dehydration condensation of the amino group of 3'-aminoadenosine and the carboxyl group of an amino acid. Examples of PANS-amino acids include: PANS-Gly, whose amino acid moiety is glycine; PANS-Val, whose amino acid moiety is valine; PANS-Ala, whose amino acid moiety is alanine; or a mixture of PANS-amino acids whose amino acid moiety corresponds to all of the amino acids. Furthermore, examples of AANS-amino acids include: AANS-Gly, whose amino acid moiety is glycine; AANS-Val, whose amino acid moiety is valine; AANS-Ala, whose amino acid moiety is alanine; or a mixture of AANS-amino acids corresponding to each amino acid moiety and a complete amino acid. Additionally, nucleosides or substances that form ester bonds between nucleosides and amino acids can be used (WO2011 / 049157 (Patent Document 2)). In addition, non-limiting examples of puromycin derivatives include: alkyne analogs of puromycin (“Imaging protein synthesis in cells and tissues with an alkyneanalog of puromycin” Liu et al., Proc.Natl.Acad.Sci.USA. 2012, 109(2), 413-418 (Non-Patent Literature 5)) and Puroswitch, which enables photo-controlled translation (“Optical Control of Translation with a Puromycin Photoswitch” Ko et al., J.Am.Chem.Soc. 2022,144, 47, 21494-21501 (Non-Patent Literature 6)).

[0188] In another embodiment, the puromycin-like substance can be a substance composed of puromycin or a derivative thereof and one or two residues of deoxyribonucleotide or ribonucleotide. Non-limiting examples of such substances include ribocytidyl puromycin (rCpPur), deoxydylpuromycin (dCpPur), and deoxyuridine puromycin (dUpPur).

[0189] In another embodiment, the puromycin-like substance may be a substance in which the adenine-like structure bound at position 1 of the glycoskeletal skeleton of puromycin is replaced by a substance with a different chemical structural skeleton. As a non-limiting example, substances in which the adenine-like structure bound at position 1 of the glycoskeletal skeleton of puromycin is replaced by adenine, a thieno[3,4-d]pyrimidine skeleton and an aziridine structure, or a thieno[3,4-d]pyrimidine skeleton and a 3,3-difluoroaziridine structure (“Inherently Emissive Puromycin Analogues for Live Cell Labelling” Hadidi etal., Angew Chem Int Ed Engl., 2023, 62, 23, e202216784, Non-Patent Literature 20).

[0190] In another embodiment, the puromycin-like substance may be a substance in which the amino acid-like structure at position 3 of the glycoskeletal backbone of puromycin is replaced by a hydroxyl residue such as a natural amino acid residue, a non-natural amino acid residue, a hydroxy acid, or a hydroxy acid derivative, and forms an amide bond or an ester bond with the C-terminus of the peptide on the ribosome. As a non-limiting example, a substance in which the amino acid-like structure at position 3 of the glycoskeletal backbone of puromycin is replaced by β-alanine or (2r)-3-hydroxy-2-methylpropionic acid (“Synthesis of puromycin derivatives with backbone-elongated substrates and associated translation inhibitory activities” Mizusawa et al., Bioorg. Med. Chem., 2009, 17, 6, 2381-2387, Non-Patent Literature 18).

[0191] In another embodiment, the puromycin-like substance can be a substance in which one or more nucleic acids, low molecular weight compounds, or PEG, or other molecules, are bound to the 5-position of the sugar backbone in puromycin. As non-limiting examples, substances in which 1 to 30 nucleic acids are linked to the 5-position of the sugar backbone in puromycin, substances linked to biotin, and substances linked to fluorescein (“Puromycin oligonucleotides reveal steric restrictions for ribosomeentry and multiple modes of translation inhibition” Starck et al., RNA, 2002, 8, 7, 890-903, Non-Patent Literature 21).

[0192] Additionally, puromycin is a similar substance targeting the 3' end of tyrosine-tRNA, and can be used to replace the nucleic acid structure as described below. It is known, as is common knowledge, that the glycosyl backbone or phosphate portion of RNA or DNA can be replaced by various non-natural glycosyl backbones or amide backbones (Bao T Le et al., Antisense Oligonucleotides Targeting Angiogenic Factors as Potential Cancer Therapeutics., Mol Ther NucleicAcids., 2019, 1, 14, 142-157, Nonpatent Literature 22; and Irina Anosova et al., The structural diversity of artificial genetic polymers., Nucleic Acids Res., 2016, Feb18, 44, 3, 1007-1021, Nonpatent Literature 23). Examples of non-natural backbones include PNA, LNA, PS, 2'-F, 2'OMe, 2'-O-OMe, PMO, NP, UNA, 4'Thio, FANA, CeNA, HNA, tcDNA, ENA, ANA, hDNA, fRNA, GNA, TNA, XyNA, and dXyNA. Substances that replace the sugar or phosphate portions of puromycin or puromycin analogs with alternative non-natural sugar or phosphate backbones are also a type of puromycin-like substance.

[0193] Furthermore, RNA or DNA molecules with non-natural bases are known to possess DNA or RNA hybridization capabilities (Michiko Kimoto et al., Genetic Code Engineering by Natural and UnnaturalBase Pair Systems for the Site-Specific Incorporation of Non-Standard AminoAcids Into Proteins., Front Mol Biosci, 2022, May 24, 9, 851646. Non-Patent Literature 24). Examples of such non-natural backbones, without limitation, include isoG, isoC, P, Z, s, y, Ds, Pa, Ds, Px, 5SICS, NaM, TPT3, NaM, CNMO, TAT1, NaM, and 5FM. Substances created by replacing the base portions of puromycin or puromycin analogs with non-natural base backbones are also a form of puromycin-like substance.

[0194] Furthermore, it is known that naturally occurring modified RNA molecules retain or partially possess the functions of native RNA (Naho Akiyama et al., Structural insights into the decoding capability of isoleucine tRNAs with lysidine and agmatidine., Nat Struct Mol Biol., 2024, Mar, 27 (Non-Patent Literature 25), and Valerie de Crecy-Lagard., Functions of bacterial tRNA modifications: from ubiquity to diversity., Trends Microbiol., 2021, Jan, 29, 1, 41-53 (Non-Patent Literature 26)). Substances created by replacing the sugar backbone, phosphate backbone, or base portion of puromycin or puromycin analogues with naturally occurring modified RNA backbones are also a method for producing puromycin-like substances.

[0195] The number of puromycin-like substances contained in the above-mentioned connector is at least two, with no particular upper limit. Non-limitingly, it is preferably 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4, or 2 to 3. In one embodiment, the number of puromycin-like substances contained in the connector is 2, 3, 4, 5, or 6.

[0196] Nucleic acids capable of binding to desired genetic information can be present either at the ends or in the middle of the connector. Assuming the connector is interpreted as a copolymer formed by linking two or more monomeric compounds, and omitting the detailed structures of each monomer constituting the copolymer, the structure of the connector is simply represented by a line connecting the connecting portions of adjacent monomers. In this specification, the ends of the lines representing the connector are referred to as the ends of the connector, and the portions having connecting portions in the lines at both ends are referred to as the middle portion of the connector.

[0197] At least two puromycin-like substances may be present at either the end or the middle of the joint. In one embodiment, the joint is branched (branched joint), and each branch chain may be individually bound with a puromycin-like substance. It should be noted that, in this specification, "branched" refers to the state of the branched lines when the joint is described with lines as described above. Furthermore, the lengths of the branch chains in a branched joint may be the same or different. In one embodiment, the lengths of the branch chains in a branched joint are the same.

[0198] The structure of the aforementioned connector is not particularly limited as long as it can be attached to the C-terminus of the elongating peptide during the translation process. Those skilled in the art can choose an appropriate structure based on the purpose of the connector and common technical knowledge.

[0199] Although not limited, the aforementioned connector as a whole possesses moderate flexibility, is based on a simple straight-chain structure with few side chains, includes at least one branch, and may have a straight-chain structure with few side chains that branches into at least three branches within the branch (hereinafter, each chain-like structural portion joined at the branch will be referred to as a "branched chain"). It should be noted that, in this specification, "branched into three branches within the branch" means that at the branch, three chain-like structures are joined together at their respective ends. For example, connector 1 described in the embodiment does not have a branch, while connector 3 has one branch and three branched chains. The aforementioned branched chains may further include branch portions. Furthermore, although not limited, the connector as a whole may be hydrophilic. Additionally, although not limited, to construct the aforementioned connector, for example, suitable choices may be made of single-stranded or double-stranded DNA, oligonucleotides such as RNA, polyalkylene glycols such as polyethylene, polyalkylene glycols such as polyethylene glycol (PEG), polystyrene, straight-chain polysaccharides, straight-chain peptides, or combinations thereof. When these linear substances are used in combination, they can be appropriately linked with suitable connecting groups (-NH-, -CO-, -O-, -NHCO-, -CONH-, -NHNH-, -O-PO2H-O-, -(CH2)). n -[n is, for example, 1~10, preferably 1~3], -S-, -SO-, etc.) are chemically linked.

[0200] In a non-limiting manner, the above-mentioned connector comprises the following structures (1) to (4).

[0201] (1) The linking part with genetic information material via phosphodiester bonds and the linking part with puromycin via phosphodiester bonds;

[0202] (2) Combine branches with three branch chains;

[0203] (3) A linear portion of PEG connected to genetic information material, or a linear portion of PEG monomers, alkylene monomers, or a combination of PEG and alkylene monomers; and

[0204] (4) The above-mentioned linear portion is a linker based on phosphodiester bonds and / or amide bonds, and / or a linker formed by CuAAC reaction (AAC: Azide-Alkyne-cycloaddition) or SPAAC reaction ((strain-promoted Azide-Alkyne-cycloaddition) azide-alkyne cycloaddition reaction).

[0205] Alternatively, in a non-limiting manner, the above-mentioned connector comprises the following structures (1) to (4).

[0206] (1) The linking part with genetic information material via phosphodiester bonds and the linking part with puromycin via phosphodiester bonds;

[0207] (2) Combine branches with four branch chains;

[0208] (3) A linear portion of PEG connected to genetic information material, or a linear portion of PEG monomers, alkylene monomers, or a combination of PEG and alkylene monomers; and

[0209] (4) The linking part of the straight chain based on phosphodiester bond and / or amide bond, and / or the linking part combined via CuAAC reaction (AAC: Azide-Alkyne-cycloaddition) or SPAAC reaction ((strain-promoted Azide-Alkyne-cycloaddition) azide-alkyne cycloaddition reaction).

[0210] The length of the aforementioned linker is not particularly limited, as long as it allows for connection to the C-terminus of the elongating peptide during the translation process. It is known that the overall length of the linker does not significantly affect its display efficiency (“cDNA TRAP display for rapid and stable in vitro selection of antibody-like proteins” T. Kondo et al., Chem. Commun., 2021, 572416-572419 (Non-Patent Document 4)). Those skilled in the art can select an appropriate length based on the purpose of the linker in this application and on general technical knowledge.

[0211] The synthesis of the aforementioned linker can be carried out using known methods. Non-limitingly, for example, a puromycin-like substance can be introduced into a linear substance that is bound to a nucleic acid using a CuAAC reaction (AAC: Azide-Alkyne-cycloaddition) or a SPAAC reaction ((strain-promoted Azide-Alkyne-cycloaddition) azido-alkyne addition cyclization reaction).

[0212] The ability of the aforementioned puromycin-like substance to covalently bond with the C-terminus of a desired peptide means that the puromycin-like substance exists in the linker (at the end or middle portion) in a state capable of covalently bonding with the C-terminus of the desired peptide. It can be considered that the puromycin-like substance in such a state can serve as a substrate for peptide transfer reactions in the ribosome, covalently bonding with the C-terminus of the elongating peptide. A preferred form of this covalent bond is an amide bond. Those skilled in the art can appropriately design the linker to achieve this state based on existing technology. One approach is that the nucleoside (containing a chemical structural backbone similar to that of a nucleoside) of the aforementioned puromycin-like substance is covalently bonded to an amino acid (containing a substance having a chemical structural backbone similar to that of an amino acid) located at the C-terminus of the desired peptide. As an alternative, at least one, preferably two or more, and more preferably all of the aforementioned puromycin-like substances are bound to the ends of the branched chains constituting the linker that are not bound to the branched portions. Additionally, in another approach, the aforementioned puromycin-like substance is bound to the side chains of the branched chains present in the middle portion of the linker.

[0213] Therefore, the type and size (length) of the peptide capable of binding puromycin-like substances are not particularly limited. One desirable form of peptide is a linear peptide, preferably one with a linear C-terminus. The aforementioned peptides may contain not only native amino acid residues but also non-native amino acid residues. Examples of such peptides without limitation include the fluorescent model peptide (amino acid sequence: SEQ ID NO. 19), streptavidin-binding peptide (amino acid sequence: SEQ ID NO. 21), human neonatal Fc receptor (FcRn)-binding peptide (amino acid sequence: SEQ ID NO. 23), hemagglutinin (HA)-binding peptide (amino acid sequence: SEQ ID NO. 25), and human IgG Fc protein (Fc)-binding peptide (amino acid sequence: SEQ ID NO. 27) described in the examples; the peptides may be selected from at least one of these peptides.

[0214] Additionally, without limitation, the aforementioned peptides can be peptides in the process of extension, serving as substrates for peptide transfer reactions in ribosomes. The term "peptide" in this specification includes not only peptides that have fully completed the translation of genetic information material, but also peptides in the process of translation.

[0215] In one embodiment, the aforementioned connector is used to link the genetic information material to a peptide encoded by the genetic information material.

[0216] The aforementioned linker may be appropriately modified according to its intended use. Known modification methods may be used, but there are no limitations. For example, by modifying it with binding agents such as biotin, FLAG tags, HA tags, and His tags, fluorescent molecules, fluorescent proteins, chemiluminescent proteins, peroxidases, alkaline phosphatases, etc., the genetic information material-linker-peptide linker described in section 4 below can be appropriately used in "8. Evaluation Method of Binding Ability" below. Furthermore, there is no particular limitation on the number of modifying agents for the linker; it may be a single agent or multiple agents.

[0217] 2. Applications of the connector

[0218] In one embodiment, the present invention relates to the use of the aforementioned connector for linking genetic information material to a peptide encoded by the aforementioned genetic information material.

[0219] In one embodiment, the present invention relates to the use of a linker comprising a binding portion having a structure capable of binding to desired genetic information material, and at least two puromycin-like substances capable of covalently binding to the C-terminus of a desired peptide.

[0220] The intended use is to link the aforementioned genetic information material to a peptide encoded by the aforementioned genetic information material.

[0221] Regarding the "connector" and its constituent elements, as described in "1. Connector," the "binding portion having a structure capable of binding to desired genetic information material" in the connector binds to the aforementioned genetic information material. The puromycin-like substance can covalently bond to the C-terminus of the desired peptide. Therefore, by means of the connector, the genetic information material can be linked to the peptide encoded by the genetic information material. Since at least two or more of the puromycin-like substances are present in the connector, two or more of the aforementioned peptides can be linked to the genetic information material.

[0222] The present invention relates to a connector for linking the aforementioned genetic information material to a peptide encoded by the aforementioned genetic information material.

[0223] This invention relates to kits or compositions (e.g., laboratory compositions) containing the aforementioned connectors. These kits or compositions are used, for example, to link genetic information material to peptides encoded by the aforementioned genetic information material. Alternatively, these kits or compositions are used in "7. Screening methods," "8. Methods for evaluating binding ability," "10. Methods for displaying peptides," etc.

[0224] 3. Genetic information material - connector

[0225] In one embodiment, the present invention relates to a genetic information material-connector linker. The genetic information material-connector linker of the present invention comprises:

[0226] (a) the aforementioned connector, and

[0227] (b) The genetic information material that is bound to the junction of (a) the connector.

[0228] The term "connector" and its constituent elements, "genetic information material," etc., are described in "1. Connector" or "2. Uses of Connector."

[0229] The aforementioned connector is a way in which the genetic information material is connected to a "connection portion having a structure capable of binding with the desired genetic information material" in the aforementioned connector.

[0230] As described in “1. Connector”, one embodiment of the connector is a connector comprising a junction having a structure capable of indirectly binding with desired genetic information material. In this embodiment, the connector may further comprise the aforementioned suitable connector, which can be a connector of genetic information material – the aforementioned suitable connector – the connector of the present invention. The aforementioned suitable connector is a connector capable of connecting the desired genetic information material to the connector of the present invention. The aforementioned suitable connector comprises a substance capable of directly binding with the desired genetic information material and a substance capable of directly binding with the connector of the present invention.

[0231] Furthermore, the aforementioned connector only needs to include (a) and (b) as its constituent elements. In the manufacturing process of the connector, it is not necessary to use the aforementioned joint; a "joint precursor" can also be used. A "joint precursor" refers to an intermediate used to produce the aforementioned joint, such as an intermediate before a puromycin-like substance is bound to the aforementioned joint. One type of such a joint precursor is characterized by having two or more reactive groups for binding puromycin-like substances, thus becoming the aforementioned joint by separately binding puromycin-like substances. Such a joint precursor is also an aspect of the present invention.

[0232] For example, as described in Examples 3-2, the genetic information material-adaptor linker obtained by binding the desired genetic information material to the adapter precursor and then binding the puromycin-like substance also includes (a) and (b) as its constituent elements, and is therefore one way of the above-described "genetic information material-adaptor linker".

[0233] In another embodiment, the invention includes a linker of desired genetic information material and a puromycin-like substance, the linker comprising:

[0234] The desired genetic information material, and

[0235] At least two puromycin-like substances,

[0236] The aforementioned desired genetic information material is linked to at least two puromycin-like substances.

[0237] Of the aforementioned puromycin-like substances, at least two puromycin-like substances are capable of covalently bonding to the C-terminus of the desired peptide.

[0238] The aforementioned linker contains at least two puromycin-like substances capable of covalently bonding to the C-terminus of the desired peptide. In this specification, the term "genetic information material-linker linker" may include the aforementioned "genetic information material-linker linker" provided there are no technical problems.

[0239] The aforementioned genetic information material-linker connector enables the genetic information material to be linked to a peptide encoded by the genetic information material via the connector constituting the connector. In one embodiment, the present invention relates to the use of the aforementioned connector for linking the genetic information material to a peptide encoded by the genetic information material.

[0240] Furthermore, the aforementioned linker can be suitably used in “6. library preparation,” “7. screening method,” “8. binding capacity evaluation method,” “10. peptide display method,” etc. In one embodiment, the present invention relates to the use of the linker to the aforementioned genetic information material in library preparation, screening methods, or binding capacity evaluation methods.

[0241] In one embodiment, the present invention relates to a linker-genetic material linking the aforementioned genetic information material to a peptide encoded by the aforementioned genetic information material. In another embodiment, the present invention relates to a linker-genetic material linking the aforementioned linker used in library preparation, screening methods, or methods for evaluating binding capacity.

[0242] This invention relates to kits or compositions (e.g., laboratory compositions) comprising the aforementioned linker and the aforementioned genetic information material. These kits or compositions are used, for example, to link genetic information material to a peptide encoded by the aforementioned genetic information material. Alternatively, these kits or compositions can be used in the following sections: “6. Preparation of a library,” “7. Screening methods,” “8. Methods for evaluating binding ability,” “10. Methods for displaying peptides,” etc.

[0243] 4. Genetic information material - adapter - peptide linker

[0244] In one embodiment, the present invention relates to a genetic information material-adaptor-peptide linker. The aforementioned genetic information material-adaptor-peptide linker comprises:

[0245] (a) The above-mentioned joint,

[0246] (b) the genetic information material at the junction of the connector in (a), and

[0247] (c) A peptide encoded by the aforementioned genetic information material that is bound to at least one of the puromycin-like substances at the junction of (a).

[0248] The term "connector" and its constituent elements, "genetic information material," "peptide," etc., are described in "1. Connector," "2. Uses of Connector," or "3. Genetic Information Material - Connector Connector."

[0249] The peptide in (c) is linked to at least one, preferably two or more, puromycin-like substances of the linker. Preferably, the peptide in (c) is linked to all or part (two or more) of the puromycin-like substances of the linker. In one embodiment, the peptide in (c) is linked to all the puromycin-like substances of the linker. That is, the upper limit of the number of peptides in (c) is the number of puromycin-like substances present in the linker. In one embodiment, the peptide in (c) is linked to all the puromycin-like substances of the linker. Non-limitingly, two or more, preferably two to eight, two to seven, two to six, two to five, two to four, or two to three peptides are linked. In one embodiment, two peptides are linked.

[0250] The aforementioned "genetic information material-adaptor-peptide linker" can be suitably used, for example, in "6. library preparation," "7. screening methods," "8. methods for evaluating binding ability," and "10. peptide display methods," etc. In one embodiment, the present invention relates to the use of the aforementioned genetic information material-adaptor-peptide linker in library preparation, screening methods, or methods for evaluating binding ability. In another embodiment, the present invention relates to the aforementioned genetic information material-adaptor-peptide linker used in library preparation, screening methods, or methods for evaluating binding ability.

[0251] In another embodiment, the present invention comprises a genetic information material-purinemycin-like substance-peptide linker, which includes:

[0252] (d) The desired linker between genetic information material and puromycin-like substance;

[0253] The peptide encoded by the desired genetic information material, which is bound to the puromycin-like substance of the linker of (e) and (d).

[0254] “The desired genetic information material and the puromycin-like substance linker”, “peptide”, etc., as described in 3. Genetic information material-linker linker or the above description.

[0255] This invention relates to kits or compositions (e.g., laboratory compositions) containing the aforementioned genetic information material-linker-peptide linker. This invention also relates to kits or compositions (e.g., laboratory compositions) containing the aforementioned genetic information material-purinemycin-like substance-peptide linker. The aforementioned kits or compositions can be used, for example, in the following sections: "6. Preparation of libraries," "7. Screening methods," "8. Methods for evaluating binding ability," and "10. Methods for displaying peptides."

[0256] 5. Method for manufacturing genetic information material-connector-peptide linker (1)

[0257] In one embodiment, the present invention relates to a method for manufacturing genetic information material-linker-peptide linkers. The manufacturing method includes:

[0258] (1) A process of translating genetic information material by supplying the genetic information material-connector linker of the present invention into a cell-free translation system, wherein the puromycin-like substance in the linker binds to the translated peptide to obtain the genetic information material-connector-peptide linker.

[0259] Non-limitingly, prior to step (1), the procedure includes: (0) a step of combining the aforementioned connector with the desired genetic information material to obtain a genetic information material-connector connector.

[0260] "Connector" and its constituent elements, "genetic information material", "peptide", etc., as described in "1. Connector", "2. Uses of Connector", "3. Genetic Information Material-Connector Linker" or "4. Genetic Information Material-Connector-Peptide Linker".

[0261] In step (0), the method of binding the adapter to the genetic information material is not particularly limited, and can be carried out by any known method depending on the binding method. "Hybridization" can be carried out by subjecting the adapter and genetic information material to conditions suitable for nucleic acid hybridization (temperature, salt concentration, etc.). In addition, methods such as UV irradiation of single-stranded DNA that hybridizes with the target mRNA at a specific site to achieve binding through photocrosslinking, or enzymatic covalent bonding of the target mRNA to the ends of the single-stranded DNA using RNA ligase or DNA ligase, can also be carried out using known materials and known conditions.

[0262] In step (1), the genetic information material-linker conjugate obtained in step (0) is translated in ribosomes. The puromycin-like substance in the linker binds to the translated peptide to obtain the genetic information material-linker-peptide conjugate.

[0263] There are no particular limitations on the methods used to translate genetic information; any known methods for translation can be used. The peptide can be a peptide present after the translation process involving the aforementioned puromycin-like substance, or it can be a peptide in the extension phase serving as a substrate for peptide transfer reactions within the ribosome.

[0264] Non-limiting, the above manufacturing method (especially the translation step in (1)) uses a cell-free translation system. Non-limiting, the cell-free translation system is composed of ribosomes extracted from cells, and energy sources such as protein factors involved in translation, tRNA, amino acids, and ATP, and their regeneration system, as long as it can translate mRNA into protein, without particular limitation. Non-limiting, the cell-free translation system may contain initiation factors, elongation factors, dissociation factors, aminoacyl-tRNA synthetase, etc. These factors can be obtained by purifying extracts from various cells. Cells used for purifying factors include, for example, prokaryotic cells or eukaryotic cells. As prokaryotic cells, Escherichia coli cells, highly thermophilic bacteria cells, or Bacillus subtilis cells can be mentioned. As eukaryotic cells, cells using yeast cells, wheat germ, rabbit reticulocytes, plant cells, insect cells, or animal cells as materials are known. In addition, in addition to naturally occurring tRNA and aminoacyl-tRNA synthetase (ARS), artificial tRNA and artificial aminoacyl-tRNA synthetase that recognizes non-natural amino acids can also be used. Alternatively, chemically synthesized tRNA or tRNA ligases can be used.

[0265] Furthermore, without limitation, cell-free translation systems refer to reconstituted cell-free translation systems. An example of a reconstituted cell-free translation system is a system that primarily refines E. coli extracts, recombining various factors to remove components unrelated to translation. The recombinant cell-free translation system requires purified ribosomes, translation initiation factors, translation elongation factors, mRNA, aminoacyl-tRNA, substrates such as ATP and GTP (MHSchreier, B. Erni and T. Staehelin (1977) “Initiation of mammalian protein synthesis. I. Purification and characterization of seven initiation factors.” Journal of Molecular Biology, Vol.116, No.4, 727-753 (Non-Patent Literature 27); H. Trachsel, B. Emi, MHSchreier and T. Staehelin (1977) “Initiation of mammalian protein synthesis. II. The assembly of the initiation complex with purified initiation factors.” Journal of Molecular Biology, Vol.116, No.4, 755-767 (Non-Patent Literature 28)). Among them, aminoacyl-tRNA can be replaced by adding tRNA and aminoacyl-tRNA synthetase and their substrates to the same reaction solution.In addition, as in a typical cell-free translation system, to improve the efficiency and fidelity of the translation reaction, proteins, enzymes and their substrates such as translation termination factor, ribosome regeneration factor, creatine kinase, myokinase, nucleotide diphosphate kinase, and pyrophosphatase may be added (PC Jelenc and C.G. Kurland (1979) “Nucleoside triphosphate regeneration decreases the frequency of translation errors” Proceedings of the Natural Academy Science of the United States of America Vol.76, No.7, 3174-3178 (Non-Patent Literature 29)).

[0266] Compared to previous cell-free translation systems that used cell extracts, recombinant cell-free translation systems can easily prevent the contamination of harmful substances such as nucleases and proteases.

[0267] In addition, when synthesizing peptides containing specific amino acids, the FIT system (WO2012 / 026566 (Patent Document 7)) can be used without limitation.

[0268] As in Example 5 Figure 5 (b) Example 6 Figure 6 As shown in (a) and (b), in the case of a single translation reaction, although the amount is smaller compared to the case of artificial cyclic translation, a genetic information material-linker-peptide linker is obtained by binding the puromycin-like substances in the linker to the translated peptides. While not bound by theory, it can be assumed that after the translation reaction, the ribosomes naturally dissociate from the peptides, initiating the translation of a second or subsequent peptide, with the translated peptides binding to the puromycin-like substances in the linker. Alternatively, it can be envisioned that multiple ribosomes bind to the translated genetic information material to form polyribosomes, with the peptides translated by each ribosome binding to the puromycin-like substances in the linker.

[0269] Preferably, the aforementioned genetic information material-linker-peptide linker is dissociated from the ribosome after manufacturing, i.e., after peptide synthesis is complete (including during peptide synthesis). The dissociation of the linker from the ribosome, i.e., the dissociation of the peptide from the ribosome, can be carried out by known methods. For ribosomes to function, they need to maintain a suitable stereostructure, which requires Mg ions. Therefore, by adding a substance that can bond with Mg ions, such as EDTA, Mg ions can be captured, causing the ribosome to denature and lose its function. Therefore, by non-limitingly adding substances such as EDTA to denature the ribosome, the linker in a dissociated state can be obtained efficiently. Alternatively, a substance capable of denaturing the ribosome can be added instead of EDTA.

[0270] In one embodiment, the manufacturing method described above includes repeating step (1) more than twice (step (2)). The manufacturing method described above, which includes repeating step (1) more than twice, is sometimes referred to in this specification as "manual cyclic translation (method)". There is no particular limitation on the number of times step (1) is repeated. In one embodiment, it is repeated 2 to 8 times, 2 to 7 times, 2 to 6 times, 2 to 5 times, 2 to 4 times, or 2 to 3 times. In one embodiment, step (1) is repeated twice. Additionally, in one embodiment, step (1) is repeated three times.

[0271] It should be noted that when using an n-valent adapter as the adapter, artificial cyclic translation can be performed more than twice. From the viewpoint of the binding efficiency of peptides to puromycin-like substances, a higher number of repetitions is preferred, and more preferably more than n times. In order to repeat the translation of genetic information material more than twice, it is preferable to temporarily dissociate ribosomes from peptides that have been translated or peptides that are in the middle of translation. That is, it is preferable to perform the ribosome dissociation process after the translation process of genetic information material. The ribosome dissociation method is as described above. Even without artificial ribosome dissociation, sometimes ribosomes will spontaneously dissociate from peptides and begin the translation of a second or subsequent peptide.

[0272] When ribosomes are dissociated by adding a substance that can bind to Mg ions as described above, it is preferable to add undenatured ribosomes after setting the ribosomes to non-denaturing conditions when performing the next translation step.

[0273] For example, by adding Mg(OAc)2 (e.g., at a concentration of about 9-20 mM), Mg ions can be added, making the ribosomes ready for translation.

[0274] Furthermore, by immobilizing the aforementioned genetic information material-linker-peptide linker onto a solid phase such as magnetic beads, and then adding a solution under non-denaturing conditions after removing the liquid phase portion under ribosome denaturation conditions, ribosomes can be made into a translatable state.

[0275] In one embodiment, the aforementioned genetic information material-adaptor-peptide linker can be treated post-manufacturing to improve the stability of the mRNA portion of the mRNA-adaptor-peptide linker. As a stabilization treatment, for example, an RNA-DNA hybrid strand can be formed by reverse transcription using the linker as a template. Non-limitingly, a reverse transcription reaction solution is added to a reaction solution containing the genetic information material-adaptor-peptide linker obtained through translation, and a reverse transcription reaction is performed.

[0276] Non-limitingly, the recovery rate of the recovery using peptide-bound material is higher than that of the case using a linker containing only one puromycin-like substance when the above-described genetic information material-linker-peptide linker is used compared to the case using a linker containing only one puromycin-like substance. In one embodiment, by using the above-described genetic information material-linker-peptide linker, compared to the case using a linker containing only one puromycin-like substance, it is possible to obtain peptide-bound material (target material) with a recovery rate of 1.5 times, 2 times or more, 3 times or more, 5 times or more, 10 times or more, 20 times or more, 100 times or more, or 600 times or more.

[0277] The target substance (peptide-binding substance) can be any substance capable of binding to peptides, and there are no particular limitations on its type. Examples of non-limiting target substances include proteins, nucleic acids, glycans, low-molecular-weight compounds, and cells. In one embodiment, the target substance is a protein.

[0278] In one embodiment, the present invention relates to a genetic information material-linker-peptide linker, which is manufactured by a method comprising:

[0279] (1) A process of combining the above-mentioned connector with the desired genetic information material to obtain a genetic information material-connector linker; and

[0280] (2) A process of translating genetic information material-adaptor linkers obtained in step (1) into a cell-free translation system, wherein the puromycin-like substance in the linker binds to the translated peptide to obtain genetic information material-adaptor-peptide linkers.

[0281] Such "genetic information material-connector-peptide linker" can be appropriately used for, for example, "6. library preparation", "7. screening methods", "8. binding ability evaluation methods", and "10. peptide display methods".

[0282] 6. Document Library

[0283] In one embodiment, the present invention relates to a library comprising at least two genetic information material-linker-peptide linkers of the present invention.

[0284] The term "linker" and its constituent elements, "genetic information material," "peptide," etc., are described in the descriptions in "1. Linker," "2. Uses of Linker," "3. Genetic Information Material-Linker Connector," or "4. Genetic Information Material-Linker-Peptide Connector."

[0285] The aforementioned library is characterized by containing at least two of the aforementioned genetic information materials—linkers—peptide linkers, which can otherwise be prepared by known methods. For example, as shown in Examples 10, 11, 12, 13, 15, and 16, the aforementioned linkers exhibit high recoveries in any of the different display methods, and therefore can be used in known display methods and libraries that utilize puromycin-like substances.

[0286] In a non-limiting sense, the above-mentioned library is a library created by combining display methods that link the aforementioned adapters and genetic information materials in a cell-free translation system via covalent or non-covalent bonds. Furthermore, in a non-limiting sense, the library is a library created using mRNA display, TRAP display, or RAPID display methods.

[0287] Furthermore, without limitation, the above-mentioned libraries are random peptide libraries. For example, by using randomized nucleic acids as genetic information material, libraries containing genetic information material-adaptor-peptide linkers encoding multiple peptides can be obtained.

[0288] The aforementioned genetic information material-linker-peptide linker contains at least two desired peptides, each of which binds individually to a puromycin-like substance in the linker. The two or more peptides (depending on the linker length, etc.) can exist in close proximity where they are likely to interact. Therefore, it is possible to screen for peptide-binding substances with weaker binding affinity. Furthermore, by using the library of this invention, genetic information material-peptide linkers bound to the target material can be recovered more efficiently.

[0289] 7. Screening Methods

[0290] In one embodiment, the present invention relates to a method for screening peptides that bind to a desired target substance. The method includes the step of contacting a library containing at least two of the aforementioned genetic information material-linker-peptide linkers with the target substance.

[0291] "Connector" and its constituent elements, "genetic information material", "peptide", "library", etc., as described in "1. Connector", "2. Uses of Connector", "3. Genetic Information Material-Connector Linker", "4. Genetic Information Material-Connector-Peptide Linker" or "6. Library".

[0292] Examples of the target substances mentioned above, which are not limited to specific substances, include proteins, nucleic acids, glycans, low-molecular-weight compounds, and cells. In one embodiment, the target substance is a protein.

[0293] The screening method described above is characterized by using a library containing at least two of the aforementioned genetic information materials—linker-peptide linkers, in other words, the aforementioned library. In other respects, known screening methods can be used. In the aforementioned screening method, peptide-binding substances with weaker binding affinity can be screened for the aforementioned peptides. Furthermore, the screening method of the present invention enables more efficient recovery of genetic information materials—peptide linkers—bound to the target substance.

[0294] 8. Combined with ability evaluation methods

[0295] In one embodiment, the present invention relates to a method for evaluating the binding affinity of a desired target substance to a peptide. The method includes a step of contacting the genetic information material-linker-peptide linker of the present invention with the target substance.

[0296] The term "linker" and its constituent elements, "genetic information material," "peptide," etc., are described in the descriptions in "1. Linker," "2. Uses of Linker," "3. Genetic Information Material-Linker Connector," or "4. Genetic Information Material-Linker-Peptide Connector."

[0297] The evaluation method described above is characterized by contacting the genetic information material-linker-peptide linker of the present invention with the target material, without any other particular limitation. In one embodiment, the evaluation method includes: a step of contacting the genetic information material-linker-peptide linker with the target material, and a step of measuring the binding ability of the peptide in the linker to the target material. The method for evaluating the binding ability is not particularly limited, and known methods for evaluating binding ability can be used. The target material can be present in solution, immobilized on carriers such as beads, chips, or plates, or expressed in cells, viruses, etc. Furthermore, the genetic information material-linker-peptide linker of the present invention can be immobilized on beads or sensor chips, etc., and the interaction with the target material can be evaluated. The binding ability of the target material can be evaluated using known methods. As non-limiting examples of methods for evaluating such binding ability, detection methods based on mass difference, such as surface plasmon resonance and biolayer interferometry, ELISA, qPCR quantification, flow cytometry, pigment staining, chemical colorimetric detection, chemiluminescence detection, and fluorescence detection can be cited.

[0298] The genetic information material-linker-peptide linker of the present invention can be modified using known affinity tags and modifying substances, such as binding substances represented by FLAG tags, HA tags, and His tags, fluorescent molecules, fluorescent proteins, chemiluminescent proteins, peroxidases, alkaline phosphatases, and other colorimetric proteins. Alternatively, as described in the examples, it can also be labeled with biotin. The genetic information material-linker-peptide linker modified in this way can be suitable for immobilization, purification, and evaluation of binding affinity.

[0299] Alternatively, the modified genetic information material-connector-peptide linker can be reacted with target material immobilized on beads, chips, plates, or expressed in cells, viruses, etc., and their binding can be identified using known labeling detection methods.

[0300] The binding affinity of the modified genetic information material-linker-peptide linker described above can be evaluated using known methods. As non-limiting examples, the binding affinity can be evaluated using methods such as surface plasmon resonance (SPR), mass difference-based detection methods (e.g., biolayer interferometry), ELISA, qPCR, flow cytometry, pigment staining, chemiluminescence detection, and fluorescence detection.

[0301] As shown in the embodiments, the above evaluation method uses the genetic information material-linker-peptide linker of the present invention, thus improving the binding ability to the target material. Even for peptide-binding materials with weaker binding ability to peptides, the binding ability can be evaluated more accurately.

[0302] 9. Method for manufacturing genetic information material-connector-peptide linker (2)

[0303] In one embodiment, the invention includes:

[0304] (1-i) A process of translating genetic information material into a genetic information material-adaptor linker by combining an adapter containing at least one puromycin-like substance with a desired genetic information material in a cell-free translation system, wherein the puromycin-like substance in the adapter combines with the translated peptide to obtain a genetic information material-adaptor-peptide linker; and

[0305] (2-i) is a process that repeats (1-i) more than twice.

[0306] In one embodiment, the present invention relates to a method for manufacturing a genetic information material-connector-peptide linker, the method comprising, prior to step (1-i): (0-i) a step of binding a connector to a desired genetic information material to obtain a genetic information material-connector linker, the connector comprising a binding portion having a structure capable of binding to the desired genetic information material, and at least one puromycin-like substance, wherein the puromycin-like substance is covalently bonded to the C-terminus of the desired peptide.

[0307] In one embodiment, the present invention relates to a method for manufacturing a genetic information material-linker-peptide linker, the method comprising:

[0308] (1-ii) A process of providing a genetic information material-adaptor linker, which is formed by combining a linker containing at least two puromycin-like substances with a desired genetic information material, to a cell-free translation system for translating the genetic information material, wherein the puromycin-like substances in the linker combine with the translated peptide to obtain a genetic information material-adaptor-peptide linker.

[0309] In one embodiment, the present invention includes, prior to step (1-ii), a step (0-ii) of binding a connector to desired genetic information material to obtain a genetic information material-connector linker, wherein the connector comprises a binding portion having a structure capable of binding to the desired genetic information material, and a connector of at least two puromycin-like substances, wherein the puromycin-like substances are covalently bonded to the C-terminus of the desired peptide. Here, the constituent elements of the connector, "genetic information material," "peptide," etc., are as described in "1. Connector," "2. Use of Connector," "3. Genetic Information Material-Connector Linker," or "4. Genetic Information Material-Connector-Peptide Linker." Furthermore, steps (1) and (2) are as described above.

[0310] The manufacturing method described in "5. Method for manufacturing genetic information material-linker-peptide linker (1)" includes a step of artificial cyclic translation. The inventors have discovered that the method including the artificial cyclic translation step is not limited to the linker "containing two or more puromycin-like substances" described above, and is also effective when a linker "containing one puromycin-like substance" (also referred to as a "monovalent linker" in this specification) is provided. This is illustrated, for example, in Example 10. Figure 10 Example 11 Figure 11 and Example 12 Figure 12As shown in the figure. In these arbitrary embodiments, when using a monovalent adapter, comparing one translation step with two steps, the recovery rate of the latter is significantly improved. Although not bound by theory, it can be considered that when a adapter with one puromycin-like substance is supplied to the translation step, in one translation step, a large amount of unbound peptide adapter remains in the reaction solution, and as a result, by repeating the translation step two or more times, the number of peptide-bound adapters in the reaction solution increases.

[0311] The genetic information material-linker-peptide linker obtained by the above manufacturing method can be suitably used in screening methods for peptides that bind to desired target substances and in methods for evaluating the binding affinity between desired target substances and peptides. The screening method and the evaluation method for binding affinity are not particularly limited, and known methods can be used respectively.

[0312] The matters described in “5. Method for manufacturing genetic information material-linker-peptide linker (1)” also apply to “9. Method for manufacturing genetic information material-linker-peptide linker (2)”, provided that there is no technical contradiction.

[0313] 10. Methods for displaying peptides

[0314] In one embodiment, the present invention relates to a method for displaying two or more peptides encoded by a desired genetic information material from genetic information material, wherein...

[0315] The aforementioned peptides are linked to the aforementioned genetic information material via functional groups that can covalently bond to the C-terminus of the aforementioned peptides.

[0316] "Genetic information material," "peptide," etc., as described in "1. Connector," "2. Uses of Connector," "3. Genetic Information Material-Connector Linker," or "4. Genetic Information Material-Connector-Peptide Linker."

[0317] In one embodiment, the above display method includes:

[0318] The process of translating the aforementioned peptide from the aforementioned genetic information material by supplying the aforementioned genetic information material-linker connector to a cell-free translation system includes a step of binding the aforementioned puromycin-like substance to the translated peptide.

[0319] The terms “process of binding the linker to the genetic information material”, “cell-free translation system”, and “process of translating peptides” are described in “5. Method for manufacturing genetic information material-linker-peptide linker (1)”.

[0320] The display method of the present invention can display multiple peptides encoded by a desired genetic information material, thereby increasing affinity and enabling more efficient recovery of genetic information material-peptide linkers bound to the target material.

[0321] Example

[0322] The present invention will now be described in detail with reference to specific embodiments, but the invention is not limited to these embodiments. Those skilled in the art can readily make modifications or alterations to the invention based on the description herein, and all such modifications and alterations are included within the scope of the invention.

[0323] [Example 1: Assembly of various connectors]

[0324] For the adapters, as the mRNA hybridization region, they are designed to contain "cccgcctcccgccccccgtcc" (SEQ ID NO.1) or "ctcccgccccccgtcc" (SEQ ID NO.60). Additionally, adapters 1, 2, 7, and 9 are designed to contain one amide bond capable of forming an amide bond with the C-terminus of the desired peptide; adapters 3-6, 8, 10, and 12 are designed to contain two amide bonds capable of forming an amide bond with the C-terminus of the desired peptide; adapters 11 and 15 are designed to contain three amide bonds capable of forming an amide bond with the C-terminus of the desired peptide; adapter 13 is designed to contain four amide bonds capable of forming an amide bond with the C-terminus of the desired peptide; and adapter 14 is designed to contain six amide bonds capable of forming an amide bond with the C-terminus of the desired peptide. Figure 1-1 , 1-2 (1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10). The method for assembling the above joints is designed as follows.

[0325] Connectors 1, 7, 9, and 10: Referring to the corresponding non-patent literature below, connector 1 (non-patent literature 3), connector 7 (“InVitro Selection of Anti-Akt2 Thioether-Macrocyclic Peptides Leading to Isoform-Selective Inhibitors” Hayashi et al., ACS Chem.Biol., 2012, 7, 3, 607-613, non-patent literature 19), and connectors 9 and 10 (patent literature 2), are typically synthesized using the phosphoramidite method and purified using high-speed liquid chromatography (HPLC).

[0326] Linker 2: A linker 2 precursor with a thiol at the 3' end was synthesized via the conventional phosphoramidite method. Figure 2-1After undergoing Cy5 modification based on the Michael addition reaction of the above thiol to maleimide, it was purified by HPLC.

[0327] Linker 3: A precursor 1 with two primary amines at the 5' end was synthesized via the conventional phosphoramidite method. Figure 2-1 This was reacted with 4-azido-butane-1-oic acid NHS ester, which is an NHS ester with an amine-reactive N-hydroxysuccinimide (NHS) ester at one end, to synthesize linker 3 precursor 2 ( Figure 2-2 Afterwards, HPLC purification was performed. Then, the linker 3 precursor 3 (…) was synthesized using the conventional phosphoramide method. Figure 2-2 The linker 3 was synthesized by combining with the linker 3 precursor 2 via a SPAAC reaction, and then purified by HPLC.

[0328] Linkers 4-6, 8, 11-15: Precursor 1 with multiple primary amines at the 5' end synthesized via the conventional phosphoramidite method. Figure 2-3 , 2-4 2-5, 2-7, 2-8, 2-10, 2-11, 2-13, 2-15) were reacted with 4-azido-butane-1-oic acid NHS ester, which has an amine-reactive NHS ester at one end, to synthesize precursor 2 (links 4-6, 8, 11-15) of the linker. Figure 2-3 , 2-4 After purifying the samples (2-5, 2-7, 2-9, 2-10, 2-12, 2-14, 2-15) by HPLC, alkynylpurinol was synthesized using the conventional phosphoramide method. Figure 2-6 The precursors 4-6, 8, and 11-15 were synthesized by reacting with CuAAC and then purified by HPLC.

[0329] Based on the above-designed synthesis method, adapters 1 and 3 were synthesized by BEX Corporation (Japan), and adapters 2, 4-15 were synthesized by Gene Design Corporation (Japan). For adapter 12, precursor 2 of adapter 12 (synthesized by Gene Design Corporation (Japan)) and alkynylpurine were used for synthesis. For connectors 4-12, 15, and connector 12 precursor 2, analysis was performed by GeneDesign using HPLC (BioAccord SYSTEM, Waters Corporation) (column: XBridge C18 Column 130Å 2.5μm 4.6mm x 75mm, column temperature: 60℃, solvent A: 100mM hexafluoroisopropanol (HFIP) 8mM triethylamine, solvent B: methanol, solvent B gradient: 5-40% (5-30% for connectors 4, 9, 10, and connector 12 precursor 2, 5-50% for connector 8, and 5-60% for connectors 11 and 13-15), 20 minutes, flow rate: 1mL / min). The purity of the connectors obtained from the above analysis is as follows.

[0330] Connector 4: 96.3%

[0331] Connector 5: 95.6%

[0332] Connector 6: 91.6%

[0333] Connector 7: 97.6%

[0334] Connector 8: 95.54%

[0335] Connector 9: 98.75%

[0336] Connector 10: 98.18%

[0337] Connector 11: 90.3%

[0338] Precursor 2 of connector 12: 97.68%

[0339] Connector 13: 92.65%

[0340] Connector 14: 89.38%

[0341] Connector 15: 96.17%

[0342] In addition, GeneDesign implemented an electrospray ionization time-of-flight mass spectrometer (ESI-TOF-MS, BioAccord) TM The results of the quality analysis (SYSTEM, Waters) are as follows.

[0343] Connector 4: ESI-TOF-MS, [MH] -Calculated value: 10808.12; Measured value: 10807.00 (after deconvolution).

[0344] Connector 5: ESI-TOF-MS, [MH] - Calculated value: 11496.72; Measured value: 11496.00 (after deconvolution).

[0345] Connector 6: ESI-TOF-MS, [MH] - Calculated value: 12185.32; Measured value: 12184.00 (after deconvolution).

[0346] Connector 7: ESI-TOF-MS, [MH] - Calculated value: 7587.33; Measured value: 7588.0 (after deconvolution).

[0347] Connector 8: ESI-TOF-MS, [MH] - Calculated value: 9398.84; Measured value: 9400.30 (after deconvolution).

[0348] Connector 9: ESI-TOF-MS, [MH] - Calculated value: 9150.22; Measured value: 9150.90 (after deconvolution).

[0349] Connector 10: ESI-TOF-MS, [MH] - Calculated value: 1115.62; Measured value: 11115.00 (after deconvolution).

[0350] Connector 11: ESI-TOF-MS, [MH] - Calculated value: 13659.18; Measured value: 13662.00 (after deconvolution).

[0351] Connector 12 precursor: ESI-TOF-MS, [MH] - Calculated value: 9303.66; Measured value: 9302.00 (after deconvolution).

[0352] Connector 13: ESI-TOF-MS, [MH] - Calculated value: 16493.59; Measured value: 16493.00 (after deconvolution).

[0353] Connector 14: ESI-TOF-MS, [MH] - Calculated value: 22880.98; Measured value: 22880.60 (after deconvolution).

[0354] Connector 15: ESI-TOF-MS, [MH]- Calculated value: 12281.98; Measured value: 12284.80 (after deconvolution).

[0355] For the synthesized linkers 1–12 (final concentration: 20 μM), 3-hydroxypyridinecarboxylic acid (final concentration: 50% (v / v), saturated solution, 50% acetonitrile, 0.1% trifluoroacetic acid, 10 mg / mL diammonium citrate) was added, and the mixture was crystallized (RT) on an MTP 384 TARGET PLATE POLISHED STEEL BC (Bruker). The crystallized samples were analyzed using matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF-MS, autoflex (registered trademark), maX, Bruker) in linear mode and positive ion mode. The results are as follows.

[0356] Connector 1: MALDI-TOF-MS (m / z), [M+H] + Calculated value: 8995.34; Measured value: 8994.27.

[0357] Connector 2: MALDI-TOF-MS (m / z), [M+H] + Calculated value: 9956.42; Measured value: 9956.17.

[0358] Connector 3: MALDI-TOF-MS (m / z), [M+H] + Calculated value: 13782.77; Measured value: 13782.73.

[0359] Connector 4: MALDI-TOF-MS (m / z), [M+H] + Calculated value: 10810.13; Measured value: 10808.55.

[0360] Connector 5: MALDI-TOF-MS (m / z), [M+H] + Calculated value: 11498.73; Measured value: 11496.18.

[0361] Connector 6: MALDI-TOF-MS (m / z), [M+H] + Calculated value: 12187.33; Measured value: 12185.45.

[0362] Connector 7: MALDI-TOF-MS (m / z), [M+H] + Calculated value: 7589.35; Measured value: 7589.90.

[0363] Connector 8: MALDI-TOF-MS (m / z), [M+H]+ Calculated value: 9400.86; Measured value: 9400.68.

[0364] Connector 9: MALDI-TOF-MS (m / z), [M+H] + Calculated value: 9152.24; Measured value: 9152.58.

[0365] Connector 10: MALDI-TOF-MS (m / z), [M+H] + Calculated value: 11117.64; Measured value: 11117.02.

[0366] Connector 11: MALDI-TOF-MS (m / z), [M+H] + Calculated value: 13661.20; Measured value: 13661.66.

[0367] Connector 12: MALDI-TOF-MS (m / z), [M+H] + Calculated value: 11725.66; Measured value: 11724.23.

[0368] Based on these results, the obtained material was confirmed as the target connector.

[0369] [Example 2: Synthesis of DNA used in the example]

[0370] Template DNA is synthesized to produce mRNA that binds to the adapter.

[0371] Template DNA is prepared by ligating synthetic single-stranded DNA to primers using polymerase chain reaction (PCR). Tables 1-1 and 1-2 show the base sequences of the synthetic single-stranded DNA used in the PCR for preparing template DNA. Additionally, Table 1-3 shows the primer sequences used in the examples described in this specification. Table 2 shows the combinations of synthetic single-stranded DNA and primers used in the synthesis of each template DNA in this example.

[0372]

[0373]

[0374]

[0375]

[0376] Table 3 shows the amino acid sequences of the template DNAs obtained by the PCR described above, and the peptides encoded by the translation regions of the template DNAs in the translation reactions of the following examples. The template DNAs consist of a T7 promoter sequence, a ribosome-binding sequence, a start codon, a peptide sequence, a spacer peptide sequence, an amber codon, and a linker hybridization sequence.

[0377]

[0378]

[0379] In Tables 3-1 and 3-2, lowercase letters represent DNA, and uppercase letters are abbreviations for commonly used amino acids. Fph refers to N-(3',6'-dihydroxy-3-oxo-3-H-spiro[isophenylfuran-1,9'-oxanthracene]-5-carboxyl)-L-phenylalanine, MeA refers to N-methyl-L-alanine, and ClAcY refers to N-2-chloroacetyl-L-tyrosine. Underlined regions indicate translation regions in the template DNA.

[0380] It should be noted that the template DNA (SEQ ID NO. 18) prepared using the "synthetic single-stranded DNA for model sequences" in the table contains: an oligonucleotide encoding a fluorescent model peptide (SEQ ID NO. 19) containing a fluorescein structure; the template DNA (SEQ ID NO. 20) prepared using the "synthetic single-stranded DNA for Strep-tag II" contains: an oligonucleotide encoding a streptavidin-binding peptide (SEQ ID NO. 21, "Improved affinity of engineered streptavidin for the Strep-tag II peptide is due to a fixed open conformation of the lid-like loop at the binding site" IPKorndorefer and A. Skerra, Protein Sci., 2002, 11, 4,883-893 (Non-Patent Literature 7)); and the template DNA (SEQ ID NO. 22) prepared using the "synthetic single-stranded DNA for FcRn binder" contains: a human neonatal Fc receptor (FcRn)-binding peptide (SEQ ID NO. 23, "Synthesis and Structure-Activity Relationships of..."). The oligonucleotide encoding the hemagglutinin (HA) binding peptide (SEQ ID NO. 25, “Inhibition of H1 and H5 Influenza A Virus Entry by Diverse Macrocyclic Peptides Targeting the Hemagglutinin Stem Region”, KAMcDonnell et al., J.Med.Chem., 2010, 53, 4, 1587-1596 (Non-Patent Literature 8)); the template DNA (SEQ ID NO. 24) prepared by “Synthetic Single-Stranded DNA for HA binder” contains: an oligonucleotide encoding the hemagglutinin (HA) binding peptide (SEQ ID NO. 25, “Inhibition of H1 and H5 Influenza A Virus Entry by Diverse Macrocyclic Peptides Targeting the Hemagglutinin Stem Region”, MNPascha et al., ACS Chem.Biol.).Oligonucleotides encoding human IgG Fc protein (Fc) binding peptides (SEQ ID NO. 27, “Kinetics-Based Structural Requirements of Human Immunoglobulin G Binding Peptides” K. Muguruma et al., ACS Omega, 2019, 4, 11, 14390-14397 (Non-Patent Document 10)). Template DNA (SEQ ID NO. 26) prepared by “Synthetic Single-Stranded DNA for Fc Binder” contains: oligonucleotides encoding human IgG Fc protein (Fc) binding peptides (SEQ ID NO. 27, “Kinetics-Based Structural Requirements of Human Immunoglobulin G Binding Peptides” K. Muguruma et al., ACS Omega, 2019, 4, 11, 14390-14397 (Non-Patent Document 10)).

[0381] According to Table 2, 100 μL of PCR reaction solution (final concentration: 1×Phusion HF buffer, 200 μM dNTPs, 3% dimethyl sulfoxide (DMSO), 2 units of Phusion DNA polymerase) was prepared, containing synthetic single-stranded DNA (excluding the synthetic single-stranded DNA used for mRNA A-L containing random regions) (final concentration: 2 nM) and corresponding primers (final concentration: 500 nM). The reaction was performed using a thermal cycler (T100 thermal cycler, BioRad) at 98°C for 60 seconds, for 25 cycles (98°C for 10 seconds, 61°C for 30 seconds, 72°C for 30 seconds). The reaction products were purified using AMPure XP (Beckman Coulter).

[0382] In addition, according to Table 2, an Extension PCR reaction solution containing synthetic single-stranded DNA (final concentration: 1 μM, each SEQ ID NO. 32-43) for mRNA A-L containing random regions was prepared (final concentration: 1 μM of the corresponding reverse primer, 1×buffer for KOD-Plus- ver.2 (Toyobo Co., Ltd.), 200 μM dNTPs, 1.5 mM MgSO4, 0.02 U / μL KOD plus (Toyobo Co., Ltd.)). The reaction was carried out using a thermal cycler (T100 thermal cycler, BioRad Corporation) at 94°C for 2 minutes, 5 cycles (60°C, 40 seconds, 68°C for 60 seconds), and 68°C for 60 seconds. Next, the prepared reaction solution was diluted 40-fold with PCR reaction buffer (final concentration: 10mM Tris-HCl (pH 8.5), 50mM KCl, 0.1% (v / v) Triton X-100, 2mM MgCl2, 250μM dNTPs, 250nM corresponding forward primer, 250nM corresponding reverse primer, Taq DNA Polymerase (NEB) 0.02U / μL). The reaction was then performed using a thermal cycler (T100 thermal cycler, BioRad) at 95℃ for 40 seconds, for 4 cycles {95℃ 40 seconds, 50℃ 40 seconds, 72℃ 60 seconds}, and then at 72℃ for 60 seconds. After the reaction, purification was performed based on phenol / chloroform extraction and ethanol precipitation. The resulting particles were then re-dissolved in ultrapure water.

[0383] [Example 3: Preparation of mRNA-adaptor linkers]

[0384] Example 3-1 Preparation of mRNA and fabrication of mRNA-adaptor linkers

[0385] The template DNA prepared in Example 2 ( Excluding Based on template DNA containing random regions of mRNA (A-L), mRNA was synthesized via a transcription reaction based on T7 RNA polymerase. The resulting product was purified using RNAClean XP (Beckman Coulter). After purification, the mRNA concentration was determined by UV absorption at 260 nm and diluted to 20 μM.

[0386] In addition, template DNA containing mRNA A-L with random regions was diluted 5-fold with transcription mix (final concentration: 40mM Tris-HCl (pH 8.0), 1mM Spermidine, 0.01% (v / v) Triton X-100, 10mM DTT, 20mM MgCl2, 25mM KOH, 3.75mM NTPs, 0.24μM T7 RNA polymerase) and reacted at 37°C for 6 hours. After the reaction, DNase reaction solution (final concentration: 40mM Tris-HCl (pH 8.0), 10mM MgSO4, 1mM CaCl2, 0.025U / μL RQ1 RNase-Free DNase (PROMEGA)) was added and reacted at 37°C for 1 hour. Finally, the reaction solution was purified by phenol / chloroform extraction, and the mRNA concentration was determined by UV absorbance at 260nm, and diluted to 20μM.

[0387] The mRNAs prepared in this way (excluding mRNAs based on template DNA containing random regions of mRNA I-L) (final concentration: 5 μM) and the adapters prepared in Example 1 (final concentration: 5.5 μM) were heated (95°C, 3 min) in 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES)-KOH (final concentration: 62.5 mM, pH 7.6) and KOAc (final concentration: 375 mM, pH 7.6) and then allowed to hybridize at room temperature, thereby producing 5 μM mRNA-adaptor linkers.

[0388] In the mRNA-linker linkers prepared in this way, for linkers using mRNA A~H containing random regions, they were dissolved in 5 times the volume of loading buffer (final concentration: 7M urea, 10mM EDTA, 1mM Tris-HCl (pH 7.6)), heated at 95°C for 1 minute, and then subjected to 8% denaturing urea polyacrylamide electrophoresis and SYBR Green II staining, followed by fluorescence imaging using PharosFX (Biorad).

[0389] For mRNAs prepared based on template DNA containing random regions (mRNA I-L), each mRNA (final concentration: 1 μM) was mixed with adapter 8 (final concentration: 1.5 μM), 1x Ligation buffer (Takara), DMSO (final concentration: 10% (v / v), T4 RNA ligase (Takara, final concentration: 5 U / μL)) and ligated at 37°C for 1 hour. A portion of the prepared mRNA-adaptor ligand was dissolved in 5 times the volume of loading buffer (final concentration: 7M urea, 10mM EDTA, 1mM Tris-HCl (pH 7.6)), heated at 95°C for 1 minute, and then subjected to 8% denaturing urea polyacrylamide electrophoresis and SYBR Green II staining, followed by fluorescence imaging using PharosFX (Biorad).

[0390] Figure 3 The results of the analysis of mRNA-adaptor linkers are shown. For any mRNA-adaptor linker, a fluorescent band originating from the mRNA-adaptor linker was observed relative to the high molecular weight side of the mRNA. This indicates that various linkers can be applied to a wide variety of genetic information materials.

[0391] Example 3-2 Binding of puromycin-like substance to mRNA-linker 4 precursor 2 linker

[0392] The mRNA (final concentration: 5 μM) and adapter 4 precursor 2 (final concentration: 10 μM) prepared from the template DNA of the model sequence in Example 3-1 were heated (95°C, 3 minutes) in HEPES-KOH (final concentration: 62.5 mM, pH 7.6) and KOAc (final concentration: 375 mM, pH 7.6) and then allowed to hybridize at room temperature, thereby producing a 5 μM mRNA-adaptor 4 precursor 2 linker. Next, alkynylpurinol (final concentration: 53.4 μM), DMSO (final concentration: 10% (v / v)), Tris(3-hydroxypropyltriazolylmethyl)amine (THPTA) / copper(II) sulfate solution (final concentration: THPTA = 10 mM, copper(II) sulfate = 5 mM), and sodium ascorbate (final concentration: 10 mM) were added to the above linker (final concentration: THPTA = 10 mM, copper(II) sulfate = 5 mM), and CuAAC (AAC: Azide-Alkyne-cycloaddition) reaction was carried out at room temperature for 2 hours. After CuAAC reaction, the mixture was purified by ethanol precipitation, dissolved in 5 times the volume of loading buffer (final concentration: 7 M urea, 10 mM EDTA, 1 mM Tris-HCl (pH 7.6)), heated at 95 °C for 1 minute, and then subjected to 8% denaturing urea polyacrylamide electrophoresis and SYBR Green I staining, followed by fluorescence imaging using PharosFX (Biorad).

[0393] Figure 4 The results of fluorescence imaging are shown in the figure. The fluorescent band originating from the mRNA-linker 4 precursor 2 linker shifted completely to the high molecular weight side after the CuAAC reaction, which can be attributed to the reaction of the two azide groups contained in the same linker with alkyne-puromycin. This indicates that mRNA-linker linkers containing two puromycins can be indirectly prepared by introducing one of a pair of functional groups, such as an azide-alkyne, into the mRNA and reacting it with puromycin, which constitutes the other pair of functional groups.

[0394] [Example 4: Preparation of aminoacyl-tRNA]

[0395] The aminoacyl-tRNAs available for translation reactions in cell-free translation systems were prepared as described below.

[0396] As amino acid-activated esters used in the aminoacylation of tRNA based on the acylation catalyst RNA (ARS ribozyme), the following were prepared: (3',6'-dihydroxy-3-oxo-3-H-spiro[isophenylfuran-1,9'-oxanthracene]-5-carboxyl)-L-phenylalanine cyanomethyl ester (Fph-CME, “An orthogonal ribosome-tRNA pair via engineering of the peptidyl transferase center” N. Terasaka et al., Nat. Chem. Biol., 2014, 10, 7, 555-557) and L-tryptophan cyanomethyl ester (W-CME, “A highly flexible tRNA acylation method for non-natural polypeptide synthesis” H. Murakami et al., Nat. Methods, 2006, 3, 5, 357-359 (Non-Patent Literature 12)), N-methyl-L-alanine dinitrobenzyl ester (MeA-DBE, “Messenger RNA-programmed incorporation of multiple N-methyl-amino acids into linear and cyclic peptides” T. Kawakami et al., Chem. Biol., 2008, 15, 1, 32-42 (Non-Patent Literature 13)), N-2-chloroacetyl-L-tyrosine cyanomethyl ester (ClAcY-CME, “Macrocyclic peptides exhibit antiviral effects against influenza virus HA and prevent pneumonia in animal models” M. Saito et al., Nat. Commun., 2021, 12, 1, 2654 (Non-Patent Literature 14)) (prepared by the method disclosed in Japanese Patent Application Publication No. 2008-125396 (Patent Literature 8)).

[0397] To ligate Fph-CME, W-CME, or ClAcY-CME to tRNA as an ARS ribozyme, an enhanced flexizyme was used (Table 4, eFx, WO2007 / 066627 (Patent Document 9)). For MeA-DBE, a dinitrobenzyl flexizyme was used (Table 4, dFx, WO2007 / 066627 (Patent Document 9)).

[0398] At this point, in order to assign Fph, W, and ClAcY to the codons of AUG and MeA to the codons of UGC, Ini-tRNA with CAU in the anticodon portion (Table 4, WO2012 / 026566 (Patent Document 7)) and tRNA with GCA were used, respectively. GCA (Table 4, WO2019 / 077887 (Patent Document 10)).

[0399] For Fph-CME, W-CME, and ClAcY-CME (final concentration: 5 mM), eFx (final concentration: 25 μM), Ini-tRNA (final concentration: 25 μM), HEPES-KOH (final concentration: 100 mM, pH 7.5), MgCl2 (final concentration: 50 mM), and DMSO (final concentration: 20%) were added, and aminoacylation was performed overnight at 0 °C. For MeA-DBE (final concentration: 5 mM), dFx (final concentration: 25 μM), tRNA were added. GCA The following solutions were used for ammonia acylation: HEPES-KOH (final concentration: 100 mM, pH 7.5), MgCl2 (final concentration: 50 mM), and DMSO (final concentration: 20%). The ammonia-acylated samples were then subjected to ethanol precipitation after adding an equal volume of 3 M NaOAc (pH 5.2).

[0400] Next, the particles were redissolved with 0.3M NaOAc (pH 5.2) and then precipitated with ethanol again. Finally, the particles were washed once with 70% ethanol containing 0.1M NaOAc (pH 5.2) and once with 70% ethanol. The resulting aminoacyl-tRNA particles were dissolved in 0.2% acetic acid.

[0401]

[0402] Table 4 shows a list of ARS ribozymes and tRNA sequences (SEQ ID NO. 28-31) used in the examples. Uppercase letters indicate the commonly used abbreviation system for each RNA.

[0403] [Example 5: Translation reaction using mRNA-adaptor linkers (1)]

[0404] Translational reactions were performed using the mRNA-adaptor linkers prepared in Example 3.

[0405] The cell-free translation system used in translation is structured as follows.

[0406] 50mM HEPES-KOH [pH 7.6], 100mM KOAc, 20mM creatine phosphate, 12.5mM Mg(OAc)2, 2mM guanosine triphosphate (GTP), 2mM adenosine triphosphate (ATP), 1mM cytidine triphosphate (CTP), 1mM uridine triphosphate (UTP), 2mM spermidine, 1mM dithiothreitol (DTT), 1.5mg / mL E. coli total tRNA (Roche), 1.2μM ribosomes, 2.7μM initiation factor 1 (IF1), 0.4μM initiation factor 2 (IF2), 1.5μM initiation factor 3 (IF3), 0.25μM termination factor 2 (RF2), 0.17μM termination factor 3 (RF3), 0.5μM ribosome termination factor (RRF), 10μM Elongation factor thermal instability (EF-Tu), 10 μM elongation factor thermal stability (EF-Ts), 0.26 μM elongation factor G (EF-G), 5 μM elongation factor P (EF-P), 0.6 μM methionine transformylase, 4 μg / mL creatine kinase (Roche), 3 μg / mL myokinase (Sigma), 0.1 μM pyrophosphatase, 0.1 μM nucleotide-bisphosphatase kinase.

[0407] The model sequence mRNA encoding the fluorescent model peptide containing the luciferin structure prepared in Example 3, along with a linker 2 or 3 (final concentration: 1 μM), and two aminoacyl-tRNAs (final concentrations: 10 μM Fph-Ini tRNA and 10 μM MeA-tRNA) were added to it. GCAThe 15 amino acids (final concentrations: 2 mM Ala, Arg, Asn, Gly, His, Ile, Leu, Phe, Pro, Ser, Thr, Trp, Val, Asp, Tyr) and 15 aminoacyl-tRNA synthetases (final concentrations: 0.73 μM AlaRS, 0.03 μM ArgRS, 0.38 μM AsnRS, 0.09 μM GlyRS, 0.02 μM HisRS, 0.4 μM IleRS, 0.04 μM LeuRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.09 μM ThrRS, 0.03 μM TrpRS, 0.02 μM ValRS, 0.13 μM AspRS, 0.02 μM TyrRS) were subjected to a translation reaction at 37 °C for 30 minutes (first translation reaction). After the reaction, ethylenediaminetetraacetic acid (EDTA, final concentration: 12.5 mM) was added, and the mixture was placed on an ice bath for 10 minutes to denature the ribosomes.

[0408] Next, a second translation reaction was performed to conduct artificial cyclic translation. Mg(OAc)₂ (final concentration: 12.5 mM), translation-related solutions (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL total tRNA from *E. coli* (Roche), 0.47 mM DTT, and aminoacyl-tRNA (final concentration: 10 μM Fph-Ini tRNA, 10 μM M eA-tRNA) were added. GCA The ribosomes (final concentration: 1.2 μM) and the ribosomes were used for translation at 37 °C for 30 minutes (second translation reaction). After the reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0409] An equal volume of Novex (trademark) Tricin SDS Sample Buffer (2x, Thermo) was added to the post-translational reaction solution. Separation was performed by electrophoresis with 16% tricine denaturing polyacrylamide (1x Novex (trademark) Tricin SDS Running Buffer). The electrophoresed gel was then subjected to fluorescence imaging using PharosFX (Biorad) (excitation: fluorescein or Cy5 mode, filter: fluorescein or Cy5).

[0410] The results obtained are as follows Figure 5 As shown. Figure 5Image 'a' is obtained during fluorescence detection of Cy5. Figure 5 Image b is obtained during fluorescence detection derived from luciferin. Linker 2 is a 5'-terminal linker labeled with Cy5. When bound to a fluorescent model peptide containing the luciferin structure, fluorescent bands derived from Cy5 and luciferin are superimposed. When the linker 2 and the mRNA are translated under conditions containing the amino acids required for translation, fluorescent bands of Cy5 and luciferin are superimposed relative to the high molecular weight side of the linker. Based on the above results, it is possible to confirm peptide binding to the linker by molecular weight shift using luciferin-labeled peptides.

[0411] When translating the linker 3 of mRNA, fluorescent bands are obtained only when the required amino acids for translation are present. Since the fluorescent band derived from luciferin is located on the high molecular weight side relative to linker 2, it can be considered that this fluorescent band originates from the mRNA-linker 3-peptide linker. Furthermore, when translating using the linker 3 of mRNA, two fluorescent bands derived from peptides are obtained, which can be attributed to the difference in molecular weight due to the different number of peptides bound to the end of linker 3.

[0412] In addition, by using a bivalent linker (linker 3), two fluorescent bands were obtained even without artificial cyclic translation. However, by performing artificial cyclic translation, the fluorescence intensity of the high molecular weight side of the two fluorescent bands was enhanced. This can be attributed to the addition of a peptide to the linker that had bound a peptide in the first translation, which caused the fluorescence intensity of the fluorescent band to increase.

[0413] The results above indicate that mRNA-promoter-peptide linkers with multiple peptides can be obtained by translating mRNA-promoter linkers in a cell-free translation system. Furthermore, mRNA-promoter-peptide linkers can be efficiently displayed by performing artificial cyclic translation.

[0414] [Example 6: Translational reaction using mRNA-adaptor linkers (2)]

[0415] As an mRNA-linker linker, an mRNA-linker linker was prepared by hybridizing linkers 2 and 3 with model sequence mRNAs encoding fluorescent model peptides containing fluorescein structures. Artificial cyclic translation was performed under the same conditions as in Example 5, and finally EDTA (final concentration: 5 mM) was added to stop the translation reaction.

[0416] In this embodiment, in order to improve the resolution of electrophoresis, nuclease treatment was performed in addition to the procedures in Example 5. Specifically, RNase H (NEB, 2.5 units) and RNase T1 (Thermo, 200 units) were added to the translation solution, and nuclease treatment was performed at 37°C for 2 hours. After nuclease treatment, tricine denaturing polyacrylamide electrophoresis and fluorescence imaging were performed under the same conditions as in Example 5.

[0417] The results obtained are as follows Figure 6 As shown. Figure 6 Images a and c are obtained during fluorescence detection derived from fluorescein. In mRNA-adaptor linkers that underwent artificial cyclic translation using a bivalent adapter (adaptor 3), nuclease treatment resulted in significantly separated fluorescent bands (two in number) compared to the untreated bands. Figure 6 a). On the other hand, for mRNA-adaptor linkers used in artificial cyclic translation with a monovalent adapter (adaptor 2), even with improved separation capabilities through nuclease treatment, the fluorescent band derived from the peptide is only one ( Figure 6 c). This indicates that multiple peptides are linked in the mRNA-linker linker that has undergone artificial cyclic translation using a bivalent linker (linker 3).

[0418] Furthermore, it was shown that artificial cyclic translation enhanced the fluorescence band intensity derived from peptides. Figure 6 (b) and (d) By repeatedly performing the translation reaction, the proportion of mRNA-linker linkers that have formed covalent bonds with peptides can be increased.

[0419] [Example 7: Translational reaction using mRNA-adaptor linkers (3)]

[0420] As mRNA-linker linkers, artificial cyclic translation was performed under the same conditions as in Example 5, using mRNA-linker linkers formed by hybridizing linkers 2 and 3 with model sequence mRNAs encoding fluorescent model peptides containing luciferin structures. In this example, reverse transcription was performed in a reaction solution containing the translation products, based on the procedures of Example 5.

[0421] Specifically, a reverse transcription reaction solution (final concentration: 49.5 mM Tris-HCl, 74.2 mM KCl, 18.4 mM MgCl2, 1 mM DTT, 0.3 mM deoxynucleotide triphosphate (dNTPs), 20 units / μL MLV reverse transcriptase, 12 μM TGG-ssG4S2.R23RT (SEQ ID NO. 9)) was added to the reaction solution containing the translation products obtained above, and reverse transcription was performed at 42 °C for 30 minutes. After reverse transcription, tricine denaturing polyacrylamide electrophoresis and fluorescence imaging were performed under the same conditions as in Example 5.

[0422] The results obtained are as follows Figure 7 As shown. Figure 7 This image is obtained during fluorescence detection derived from luciferin. Hybridization of TGG-ssG4S2.R23RT with the mRNA-adaptor 2-peptide linker resulted in a shift of the fluorescent band from this linker towards the higher molecular weight side. Furthermore, the mRNA-adaptor-peptide linker hybridized with TGG-ssG4S2.R23RT further shifted towards the higher molecular weight side after reverse transcription.

[0423] In the mRNA-linker 3-peptide linker, unlike linker 2, multiple distinct fluorescent bands were observed. This indicates that multiple peptides are linked in the bivalent linker, enabling reverse transcription.

[0424] [Example 8: Translational reaction using mRNA-adaptor linkers (4)]

[0425] As mRNA-linker linkers, artificial cyclic translation was performed under the same conditions as in Example 6, using mRNA-linker linkers formed by hybridizing linkers 2, 3, 4, 5, and 6 with model sequence mRNAs encoding fluorescent model peptides containing fluorescein structures.

[0426] The results obtained are as follows Figure 8 As shown. Figure 8 This image is a composite of images obtained from separate fluorescence detections of Cy5 and luciferin. In the mRNA-linker linker using a monovalent adapter (linker 2), only one fluorescent band was observed from the peptide. In contrast, mRNA-linker linkers using linkers 3, 4, 5, and 6, which have two puromycins, all yielded two fluorescent bands from the peptide.

[0427] Based on the above, even if the linker lengths between different puromycins are different, it is still possible to obtain mRNA-linker-peptide linkers with multiple peptides for bivalent linkers.

[0428] [Example 9: Translational reaction using mRNA-adaptor linkers (5)]

[0429] Example 9-1 Specific cleavage of connector 12 based on RNaseT1

[0430] For adapters 4 and 12, enzyme treatment was performed overnight at 37°C in RNase T1 solution (200 U RNase T1 (Thermo), 50 mM Tris-HCl (pH 7.5), 2 mM EDTA). After enzyme treatment, the samples were subjected to denaturing urea-polyacrylamide electrophoresis and SYBR Green II staining, followed by fluorescence imaging using PharosFX (Biorad).

[0431] The results obtained are as follows Figure 9 As shown in a. For linker 4, which does not have a deoxynucleotide with guanine as its base, the position of the fluorescent band did not change even after enzyme treatment. On the other hand, for linker 12, which is modified with a deoxynucleotide with guanine as its base before the branch, the fluorescent band shifted to the lower molecular weight side after enzyme treatment, indicating that specific cleavage can be achieved by performing such modification.

[0432] Example 9-2 Analysis of Displayed Peptides Based on Tricin PAGE

[0433] As an mRNA-linker linker, an mRNA-linker linker was used to hybridize linker 12 with a model sequence mRNA encoding a fluorescent model peptide containing a fluorescein structure. Artificial cyclic translation was performed under the same conditions as in Example 5, and finally EDTA (final concentration: 5 mM) was added to stop the translation reaction.

[0434] In this embodiment, in order to improve the resolution of electrophoresis, nuclease treatment was performed in addition to the procedures in Example 5. Specifically, RNase T1 (Thermo Scientific, 200 units) was added to the translation solution, and nuclease treatment was performed at 37°C for 2 hours. After nuclease treatment, tricine denaturing polyacrylamide electrophoresis and fluorescence imaging were performed under the same conditions as in Example 5.

[0435] The results obtained are as follows Figure 9 As shown in b. Figure 9 Image b is obtained by detecting and superimposing the fluorescence derived from Cy5 and fluorescein. For mRNA-adaptor linkers that have undergone artificial cyclic translation using a bivalent adapter (adaptor 12), nuclease treatment resulted in a significant separation of fluorescent bands into two compared to the untreated bands. Figure 9b). On the other hand, for mRNA-adaptor linkers that have undergone artificial cyclic translation using a monovalent adapter (adaptor 2), even with improved separation capabilities through nuclease treatment, the fluorescent band derived from the peptide is only one ( Figure 9 b). This indicates that multiple peptides are linked in the mRNA-linker linker that has undergone artificial cyclic translation using a bivalent linker (linker 12).

[0436] [Example 10: Demonstration of mRNA-adaptor-peptide linkers based on Strep-tagII as a model peptide]

[0437] A demonstration experiment was conducted using an mRNA-linker-peptide linker with Strep-tagII as the model peptide to evaluate the recovery rate associated with streptavidin binding.

[0438] The following experiments were conducted using mRNA-adaptor linkers, which were formed by hybridizing adapter 1 or adapters 3-6 with the mRNA encoding Strep-tagII prepared in Example 3.

[0439] For the cell-free translation system constructed in Example 5, the above-mentioned mRNA-adaptor linker (final concentration: 1 μM), one aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine amino acids (final concentration: 2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp) and nine aminoacyl-tRNA synthases (final concentration: 0.09 μM GlyRS, 0.02 μM M IsRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM M LysRS, 0.03 μM TrpRS) were added, and a translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, for samples not undergoing artificial cyclic translation, EDTA was added to bring the final concentration to 16.7 mM, and for samples to undergo artificial cyclic translation, EDTA was added to bring the final concentration to 12.5 mM. The samples were then incubated on ice for 10 minutes to denature the ribosomes.

[0440] Furthermore, a second translation reaction was performed on the samples that underwent artificial cyclic translation.

[0441] For the reaction solution used in the first translation reaction described above, Mg(OAc)₂ (final concentration: 12.5 mM), translation-related solutions (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL total tRNA from E. coli (Roche), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (second translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0442] Next, a reverse transcription reaction solution (final concentration: 49.5 mM Tris-HCl, 74.2 mM KCl, 18.4 mM MgCl2, 1 mM DTT, 0.30 mM dNTPs, 20 units / μL MLV reverse transcriptase, 12 μM RT-Strep-tag II (SEQ ID NO.14)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42 °C for 30 minutes.

[0443] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) and HEPES (final concentration: 53.4 mM) were added, and desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column that had been replaced with HBS-T (0.05% (v / v) Tween20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0444] After desalting, magnetic beads immobilized with streptavidin (final concentration: 1 mg / mL, Dynabeads M-280 streptavidin, Thermo Scientific) were added, and the binding reaction was carried out at 4°C for 1 hour. As a negative control, magnetic beads immobilized with Protein G (final concentration: 1 mg / mL, Dynabeads Protein G for Immunoprecipitation, Thermo Scientific) were added to the desalted sample, and the binding reaction was carried out at 4°C for 1 hour. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. Then, the magnetic beads were resuspended using HBS-T (0.5 mg / mL), transferred to a new sample tube, and mixed at 4°C for 5 minutes. This process of magnetic separation / supernatant removal / HBS-T resuscitation / 5-minute mixing at 4°C was repeated twice. Finally, after magnetic separation / removal of the supernatant, the sample was resuspended in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (2 mg / mL) and heated at 95 °C for 5 minutes. Magnetic separation was then performed after heating, and the supernatant was recovered.

[0445] The amount of DNA in the liquid before the addition of the desalted target protein and the amount of DNA recovered using magnetic beads were quantified by real-time PCR. A LightCycler 96 (Roche Applied Science) was used for the real-time PCR assay. The reaction solution prepared by adding Taq polymerase, SYBR Green I (diluted 100,000 times, Invitrogen), dNTPs (final concentration: 0.25 mM), MgCl2 (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_Strep-tag II (SEQ ID NO.10) (0.25 μM), and the sample solution was used for the assay.

[0446] The results of the above demonstration experiment were as follows: Figure 10 As shown. Here, recovery rate (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the liquid before the addition of the target protein. In the evaluation of the binding affinity of the model peptide and the model target protein, respectively, using a 2-valent adapter (adapter 3), the recovery rate of DNA derived from the binding of the target protein was significantly enhanced compared to that using a 1-valent adapter (adapter 1). Furthermore, the aforementioned enhancement in recovery rate was also confirmed in artificial circular translation. Figure 10a). Furthermore, when comparing divalent connectors (connectors 3-6) with different branch chain lengths, the above recovery rates showed different enhancement rates depending on the type of branch chain length of the connector. Figure 10 b). Based on these results, it can be concluded that the binding affinity to the target protein is enhanced through the affinity effect derived from multiple peptides linked to the aforementioned linker.

[0447] [Example 11: Demonstration of mRNA-linker-peptide linkers based on Fc binder as a model peptide]

[0448] Example 11-1 Biotinylation of Fc

[0449] Recombinant human IgG1 Fc protein (final concentration: 29 μM, 110-HG, R&D Systems) and EZ-Link NHS-PEG4-Biotin (final concentration: 290 μM, Thermo) were reacted overnight at 4°C in 1x phosphate buffer saline (PBS). After the reaction, purification was performed using Bio-Gel P30 Gel (Biorad) replaced with 1x PBS.

[0450] Example 11-2 Immobilization of biotinylated Fc on magnetic beads

[0451] The biotinylated Fc (2.8 μM) prepared above and magnetic beads (final concentration: 31 mg / mL, Dynabeads M-280 streptavidin, Thermo Scientific) were mixed at 4 °C for 20 min. After magnetic separation and removal of the supernatant, the mixed magnetic beads were resuspended using HBS-T. This process of magnetic separation / supernatant removal / HBS-T resuspension was performed a total of two times. Finally, after magnetic separation / supernatant removal, resuspension was performed using HBS-T (final concentration: 10 mg / mL).

[0452] Examples 11-3: Demonstration of mRNA-adaptor-peptide linkers based on Fc binder as the model peptide

[0453] The following experiments were conducted using mRNA-connector linkers, which were formed by hybridizing linker 1 or linker 3 with the mRNA encoding the Fc binder prepared in Example 3.

[0454] For the cell-free translation system constructed in Example 5, the following were added: the above-mentioned mRNA-adaptor linker (final concentration: 1 μM), 15 amino acids (2 mM Leu, Met, Val, Ser, Pro, Thr, Ala, Tyr, His, Lys, Asp, Glu, Cys, Trp, Gly), and 15 aminoacyl-tRNA synthetases (0.04 μM LeuRS, 0.03 μM MetRS, 0.02 μM ValRS, 0.04 μM SerRS, 0.16 μM ProRS, 0.09 μM ThrRS, 0.73 μM AlaRS, 0.02 μM TyrRS, 0.02 μM HisRS, 0.11 μM LysRS, 0.13 μM AspRS, 0.23 μM GluRS, 0.02 μM CysRS, 0.03 μM TrpRS, 0.09 μM Gly). GlyRS was used for translation at 37°C for 30 minutes. After the reaction, EDTA was added to make a final concentration of 16.7 mM for samples that did not undergo artificial cyclic translation, and to make a final concentration of 12.5 mM for samples that underwent artificial cyclic translation. The samples were then incubated on ice for 10 minutes to denature the ribosomes.

[0455] Furthermore, a second translation reaction was performed on the samples that underwent artificial cyclic translation.

[0456] For the reaction solution used in the first translation reaction described above, Mg(OAc)₂ (final concentration: 12.5 mM), translation-related solutions (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL total tRNA from E. coli (Roche), 0.47 mM DTT), and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37 °C for 30 minutes. After the reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0457] Next, a reverse transcription reaction solution (final concentration: 49.5 mM Tris-HCl, 74.2 mM KCl, 18.4 mM MgCl2, 1 mM DTT, 0.30 mM dNTPs, 20 units / μL MLV reverse transcriptase, 12 μM RT-Fc binder (SEQ ID NO.17)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42 °C for 30 minutes.

[0458] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) and oxidized glutathione (final concentration: 1 mM, Nacalai) were added, and the reaction was carried out at 37°C for 1 hour.

[0459] For the above samples, after adding HEPES (final concentration: 53.4 mM), desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column that had been replaced with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0460] The desalted sample was mixed with either the aforementioned Fc-immobilized magnetic beads (final concentration: 6.2 mg / mL) or unimmobilized Fc magnetic beads (final concentration: 6.2 mg / mL, Dynabeads M-280 streptavidin, Thermo Scientific) and the binding reaction was performed at 4°C for 1 hour. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. The beads were then resuspended in HBS-T (1.5 mg / mL), transferred to a new sample tube, and mixed at 4°C for 5 minutes. This process of magnetic separation / supernatant removal / HBS-T resuscitation / 5-minute mixing at 4°C was repeated twice. Finally, after magnetic separation / supernatant removal, the beads were resuspended in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (12.4 mg / mL) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was recovered.

[0461] The amount of DNA in the liquid before the addition of the desalted target protein and the amount of DNA recovered using magnetic beads were quantified by real-time PCR. A LightCycler 96 (Roche Applied Science) was used for the real-time PCR assay. The reaction solution prepared by adding Taq polymerase, SYBR Green I (diluted 100,000 times, Invitrogen), dNTPs (final concentration: 0.25 mM), MgCl2 (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_Fc binder (SEQ ID NO.13) (0.25 μM), and the sample solution was used for the assay.

[0462] The results of the above demonstration experiment were as follows: Figure 11As shown. Here, recovery rate (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the liquid before the addition of the target protein. In the recovery rate evaluation using Fc binder and Fc as model peptides and model target proteins, DNA was recovered with a high recovery rate only when a bivalent adapter (adapter 3) was used. A high recovery rate can be obtained by using the bivalent adapter of the target. In addition, a high recovery rate was obtained when artificial circular translation was performed compared to the case without it. Artificial circular translation is effective in recovering the linker bound to the target with a high recovery rate. Based on these results, it can be concluded that the binding ability to the target protein is improved by the affinity effect derived from the multiple peptides linked to the aforementioned adapter.

[0463] [Example 12: Demonstration of mRNA-linker-peptide linkers based on HA binder as a model peptide]

[0464] Example 12-1 Immobilization of HA onto magnetic beads

[0465] Influenza A virus H5N1 (A / Indonesia / 5 / 2005) hemagglutinin / HA protein-HIS-tag (final concentration: 4.5 μM, 11060-V08B, ShinoBiological) was mixed with magnetic beads (final concentration: 4 mg / mL, Dynabeads His-tag Isolation and Pulldown, Thermo) at 4°C for 20 minutes. After magnetic separation and removal of the supernatant, the mixed magnetic beads were resuspended using HBS-T. This process of magnetic separation / supernatant removal / HBS-T resuspension was repeated twice. Finally, after magnetic separation / supernatant removal, resuspension was performed using HBS-T (final concentration: 10 mg / mL).

[0466] Example 12-2 Demonstration of mRNA-linker-peptide linkers based on HA binder as a model peptide

[0467] The following experiments were conducted using mRNA-connector linkers, which were formed by hybridizing linker 1 or linker 3 with the mRNA encoding the HA binder prepared in Example 3, respectively.

[0468] For the cell-free translation system constructed in Example 5, the following were added: the above-mentioned mRNA-adaptor linker (final concentration: 1 μM), one aminoacyl-tRNA (10 μM ClAcY Ini-tRNA), 13 amino acids (2 mM Phe, Leu, Val, Ser, Thr, Ala, Tyr, His, Asn, Lys, Cys, Trp, Gly), and 12 aminoacyl-tRNA synthetases (0.68 μM PheRS, 0.04 μM LeuRS, 0.02 μM ValRS, 0.04 μM SerRS, 0.09 μM ThrRS, 0.73 μM AlaRS, 0.02 μM TyrRS, 0.02 μM MisRS, 0.38 μM AsnRS, 0.11 μM LysRS, 0.02 μM CysRS, 0.03 μM TrpRS, 0.09 μM... GlyRS was used for translation at 37°C for 30 minutes. After the reaction, EDTA was added to make a final concentration of 16.7 mM for samples that did not undergo artificial cyclic translation, and to make a final concentration of 12.5 mM for samples that underwent artificial cyclic translation. The samples were then incubated on ice for 10 minutes to denature the ribosomes.

[0469] Furthermore, for the reaction solution used in the first translation reaction described above, Mg(OAc)₂ (final concentration: 12.5 mM), translation-related solutions (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL total tRNA from E. coli (Roche), 0.47 mM DTT), aminoacyl-tRNA (final concentration: 10 μM ClAcY Ini-tRNA), and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0470] Next, a reverse transcription reaction solution (final concentration: 49.5 mM Tris-HCl, 74.2 mM KCl, 18.4 mM MgCl2, 1 mM DTT, 0.30 mM dNTPs, 20 units / μL MLV reverse transcriptase, 12 μM RT-HA binder (SEQ ID NO.16)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42 °C for 30 minutes.

[0471] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) and HEPES (final concentration: 53.4 mM) were added, and desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column that had been replaced with HBS-T (0.05% (v / v) Tween20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0472] The desalted sample was mixed with either the HA immobilized magnetic beads (final concentration: 4 mg / mL) or the unimmobilized HA magnetic beads (final concentration: 4 mg / mL, Dynabeads His-tag Isolation and Pulldown, Thermo Scientific) and the binding reaction was carried out at 4°C for 1 hour. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. The beads were then resuspended in HBS-T (2 mg / mL), transferred to a new sample tube, and mixed at 4°C for 5 minutes. This process of magnetic separation / supernatant removal / HBS-T resuspension / 5-minute mixing at 4°C was repeated twice. Finally, after magnetic separation / supernatant removal, the beads were resuspended in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (8 mg / mL) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was recovered.

[0473] The amount of DNA in the liquid before the addition of the desalted target protein and the amount of DNA recovered using magnetic beads were quantified by real-time PCR. A LightCycler 96 (Roche Applied Science) was used for the real-time PCR assay. The reaction solution prepared by adding Taq polymerase, SYBR Green I (diluted 100,000 times, Invitrogen), dNTPs (final concentration: 0.25 mM), MgCl2 (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_HA binder (SEQ ID NO.12) (0.25 μM), and the sample solution was used for the assay.

[0474] The results of the above demonstration experiment were as follows: Figure 12As shown. Here, recovery rate (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the liquid before the addition of the target protein. In the evaluation of the binding affinity of HA binder and HA as model peptides and model target proteins, the recovery rate of DNA derived from the binding of the target protein was increased by using a bivalent adapter (adaptor 3) compared to a monovalent adapter (adaptor 1). The mRNA-adaptor-peptide linker bound to the target protein was recovered in high yield by using the target adapter. Furthermore, it was shown that the above recovery rate was increased by performing artificial cyclic translation, and the mRNA-adaptor-peptide linker bound to the target protein could be recovered with high efficiency by performing artificial cyclic translation. Based on these results, it can be concluded that the binding affinity to the target protein is improved by the affinity effect derived from the multiple peptides linked to the above adapters.

[0475] [Example 13: Demonstration of mRNA-linker-peptide linkers based on FcRn binder as a model peptide]

[0476] Example 13-1 Fabrication of FcRn Immobilized Beads

[0477] Magnetic beads (final concentration: 9.3 mg / mL, Dynabeads M-280 streptavidin, Thermo) and biotinylated FcRn (0.7 μM, FCM-H82W7, ACRObiosystems) were mixed at 4°C for 20 minutes. After magnetic separation and removal of the supernatant, the mixed beads were resuspended using HBS-T. This process of magnetic separation / supernatant removal / HBS-T resuspension was repeated twice. Finally, after magnetic separation / supernatant removal, resuspension was performed using HBS-T (final concentration: 10 mg / mL).

[0478] Example 13-2 Demonstration of mRNA-adaptor-peptide linkers based on FcRn binder as model peptide

[0479] The following experiments were conducted using mRNA-adaptor linkers, which were formed by hybridizing adapter 1 or adapters 3-6 with the mRNA encoding the FcRn binder prepared in Example 3.

[0480] For the cell-free translation system constructed in Example 5, the above-mentioned mRNA-adaptor linker (final concentration: 1 μM), 12 amino acids (2 mM Phe, Leu, Met, Ser, Pro, Thr, Tyr, His, Asn, Cys, Arg, Gly) and 12 aminoacyl-tRNA synthetases (0.68 μM PheRS, 0.04 μM LeuRS, 0.03 μM MetRS, 0.04 μM SerRS, 0.16 μM ProRS, 0.09 μM ThrRS, 0.02 μM TyrRS, 0.02 μM HisRS, 0.38 μM AsnRS, 0.02 μM CysRS, 0.03 μM ArgRS, 0.09 μM GlyRS) were added, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA was added to bring the final concentration to 12.5 mM, and the mixture was placed on an ice bath for 10 minutes to denature the ribosomes.

[0481] Furthermore, for the reaction solution used in the first translation reaction described above, Mg(OAc)₂ (final concentration: 12.5 mM), translation-related solutions (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL total tRNA from E. coli (Roche), 0.47 mM DTT), and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0482] Next, a reverse transcription reaction solution (final concentration: 49.5 mM Tris-HCl, 74.2 mM KCl, 18.4 mM MgCl2, 1 mM DTT, 0.30 mM dNTPs, 20 units / μL MLV reverse transcriptase, 12 μM RT_FcRn binder (SEQ ID NO.15)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42 °C for 30 minutes.

[0483] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) and oxidized glutathione (final concentration: 1 mM, Nacalai) were added, and the reaction was carried out at 37°C for 1 hour.

[0484] For the above samples, after adding HEPES (final concentration: 53.4 mM), desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column that had been replaced with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0485] The desalted sample was mixed with the aforementioned FcRn immobilized magnetic beads (final concentration: 3.2 mg / mL) and the binding reaction was carried out at 4°C for 1 hour. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. Then, the magnetic beads were resuspended in HBS-T (1.6 mg / mL), transferred to a new sample tube, and mixed at 4°C for 5 minutes. This process of magnetic separation / supernatant removal / HBS-T resuspension / 5-minute mixing at 4°C was repeated twice. Finally, after magnetic separation / supernatant removal, the beads were resuspended in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (3.2 mg / mL) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was recovered.

[0486] The amount of DNA in the liquid before the addition of the desalted target protein and the amount of DNA recovered using magnetic beads were quantified by real-time PCR. A LightCycler 96 (Roche Applied Science) was used for the real-time PCR assay. The reaction solution prepared by adding Taq polymerase, SYBR Green I (diluted 100,000 times, Invitrogen), dNTPs (final concentration: 0.25 mM), MgCl2 (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_FcRn binder (SEQ ID NO.11) (0.25 μM), and the sample solution was used for the assay.

[0487] The results of the above demonstration experiment were as follows: Figure 13As shown. Here, recovery rate (%) represents the proportion of DNA recovered from the magnetic beads relative to the amount of DNA in the liquid before the addition of the target protein. In the evaluation of binding affinity between FcRn binder and FcRn as model peptides and model target proteins, the recovery rate of DNA derived from binding to the target protein increased in all bivalent adapters (adapters 3-6) compared to monovalent adapters (adapter 1). By using the adapters of the target protein, the recovery rate of mRNA-adapter-peptide linkers bound to the target protein was improved. Furthermore, the shorter the branched strand length of the adapter, the higher the above recovery rate, indicating that by selecting an appropriate branched strand length of the adapter, the recovery rate of mRNA-adapter-peptide linkers bound to the target protein was improved. This can be attributed to the increased binding affinity to the target protein derived from the affinity effect of the multiple peptides linked to the aforementioned adapters.

[0488] [Example 14: Screening of target-binding peptides using a randomized peptide library]

[0489] Example 14-1 Preparation of aminoacyl-tRNA

[0490] The aminoacyl-tRNAs available for translation reactions in a cell-free translation system are prepared as described below.

[0491] As an amino acid-activated ester used in the aminoacylation of tRNA based on the acylation catalyst RNA (ARS ribozyme), (2,6-dichloropyridin-4-yl)methylmethyl-L-alanine hydrochloride (MeA-DCPE), (2,6-dichloropyridin-4-yl)methyl-L-cysteine ​​hydrochloride (Cys-DCPE), 2,2,2-trifluoroethylmethyl-L-phenylalanine hydrochloride (MeF-TEE), and (2,6-dichloropyridin-4-yl)methyl N-methylglycine hydrochloride (MeG-DCPE), 2,2,2-trifluoroethyl (2-chloroacetyl)-L-phenylalanine hydrochloride (ClAc-F-TEE), (2,6-dichloropyridin-4-yl)methyl(S)-2-(methylamino)hexanoate hydrochloride (MeNle-DCPE), 2,2,2-trifluoroethyl L-tryptophan hydrochloride (Trp-TEE) (prepared by the method disclosed in WO2023 / 234425 (Patent Document 11)).

[0492] To ligate MeF-TEE, ClAc-F-TEE, and Trp-TEE to tRNA as ARS ribozymes, enhanced flexible enzymes were used (Table 4, eFx, WO2007 / 066627 (Patent Document 9)). For MeA-DCPE, Cys-DCPE, MeG-DCPE, and MeNle-DCPE, dinitrobenzyl flexible enzymes were used (Table 4, dFx, WO2007 / 066627 (Patent Document 9)).

[0493] At this point, in order to assign ClAc-F to the codon of AUG, MeA to the codon of GCC, Cys to the codon of TGG, MeF to the codon of UUC, MeG to the codon of AUC, MeNle to the codon of ACC, and Trp to the codon of TGC, Ini-tRNAs with CAU in their anticodon portions (Table 4, WO2012 / 026566 (Patent Document 7)) and tRNAs with GGC were used, respectively. GGC tRNAs with CCA CCA tRNAs with GAA GAA tRNAs with GAU GAU tRNAs with GGU GGU tRNA with GCA GCA (Table 4, WO2019 / 077887 (Patent Document 10)).

[0494] For ClAc-F-TEE (final concentration: 5 mM), the corresponding ARS ribozyme (final concentration: 25 μM), Ini-tRNA (final concentration: 25 μM), bicine (final concentration: 50 mM, pH 9.0), MgCl2 (final concentration: 50 mM), and DMSO (final concentration: 20%) were added, and the reaction was carried out overnight at 0 °C for aminoacylation. For Cys-DCPE (final concentration: 5 mM), the corresponding ARS ribozyme (final concentration: 25 μM), the corresponding tRNA (final concentration: 25 μM), HEPES-KOH (final concentration: 50 mM, pH 7.5), MgCl2 (final concentration: 20 mM), DMSO (final concentration: 20%), and DTT (final concentration: 5 mM) were added, and the reaction was carried out overnight at 0 °C for aminoacylation. For other amino acid-activated esters (final concentration: 5 mM), the corresponding ARS ribozyme (final concentration: 25 μM), the corresponding tRNA (final concentration: 25 μM), HEPES-KOH (final concentration: 50 mM, pH 7.5), MgCl2 (final concentration: 50 mM), and DMSO (final concentration: 20%) were added, and the amination reaction was carried out overnight at 0 °C. After amination, an equal volume of 3 M NaOAc (pH 5.2) was added to the above amination-acylated sample, followed by ethanol precipitation.

[0495] Next, the particles were redissolved with 0.3M NaOAc (pH 5.2) and ethanol precipitation was performed again. Finally, the particles were washed once with 70% ethanol containing 0.1M NaOAc (pH 5.2) and once with 70% ethanol. The resulting aminoacyl-tRNA particles were dissolved in 0.2% acetic acid.

[0496] Table 4 shows a list of ARS ribozymes and tRNA sequences (SEQ ID NO. 28-31, 53-59) used in the examples. Uppercase letters indicate the commonly used abbreviation system for each RNA.

[0497] Example 14-2 Construction of mRNA-adaptor-peptide linker library

[0498] For the mRNA G containing a random region prepared in Example 3, the following experiments were performed using mRNA-adaptor linkers that were hybridized with adapter 1 or adapter 4, respectively.

[0499] For the cell-free translation system constructed in Example 5, the above-mentioned mRNA-adaptor linker (final concentration: 1 μM), 7 aminoacyl-tRNAs (final concentration 10 μM ClAc-F Ini-tRNA, MeF tRNA) were added. GAA MeG tRNA GAU MeNletRNA GGU MeA tRNA GGC W tRNA GCA , C tRNA CCA The reaction was performed at 37°C for 30 minutes, using 10 amino acids (final concentration 0.2 mM Leu, Val, Ser, Pro, Tyr, His, Asn, Asp, Arg, Gly) and 10 aminoacyl-tRNA synthetases (final concentrations 0.04 μM LeuRS, 0.02 μM ValRS, 0.04 μM SerRS, 0.16 μM ProRS, 0.02 μM TyrRS, 0.02 μM HisRS, 0.38 μM AsnRS, 0.13 μM AspRS, 0.03 μM ArgRS, 0.09 μM GlyRS) and Mg(OAc)2 (final concentration: 1 mM). After the reaction, EDTA was added to bring the final concentration to 12.5 mM, and the mixture was incubated on ice for 10 minutes to denature the ribosomes.

[0500] Furthermore, for the reaction solution used in the first translation reaction described above, the following solutions were added: Mg(OAc)2 (final concentration: 13.5 mM), translation-related solutions (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL total tRNA from E. coli (Roche), 0.47 mM DTT), and aminoacyl-tRNA (final concentration: 10 μM ClAc-F Ini-tRNA, MeFtRNA). GAA MeG tRNA GAU MeNle tRNA GGU MeA tRNA GGC W tRNA GCA , C tRNA CCA The translation reaction was carried out at 37°C for 30 minutes using ribosomes (final concentration: 1.2 μM). After the reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0501] Next, a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl2, 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, 3 μM TGG-ssG4S2.R23RT (SEQ ID NO.9)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42 °C for 30 minutes.

[0502] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) was added, and desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column replaced with HBS-T (0.05% (v / v) Tween20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0503] Example 14-3 Screening of target-binding peptides from a library using mRNA-adaptor-peptide linkers

[0504] The desalted sample obtained in step 2 above was mixed with recombinant human IgG1 Fc protein (final concentration: 250 nM, 110-HG, R&D Systems) and magnetic beads (final concentration: 3 mg / mL, Dynabeads Protein G, Thermo). The binding reaction was carried out at 4°C for 60 minutes. After the binding reaction, magnetic separation was performed to remove the supernatant. Then, the magnetic beads were resuspended using HBS-T (1.5 mg / mL), transferred to a new sample tube, and mixed at 4°C for 1 minute. This process of magnetic separation / supernatant removal / HBS-T resuspension / 1 minute mixing at 4°C was repeated twice. Finally, after magnetic separation / removal of the supernatant, the sample was resuspended in PCR mix solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100, dNTPs (final concentration: 0.25 mM), MgCl2 (final concentration: 2 mM), T7g10M.F52 (0.25 μM), TGG-ssG4S2.R44 (SEQ ID NO.8) (0.25 μM)) (3.0 mg / mL) and heated at 95 °C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was recovered. The above procedure will be used for positive screening.

[0505] The amount of DNA in the liquid before the addition of the desalted target protein and the amount of DNA recovered using magnetic beads (positive screening) were quantified using real-time PCR. A LightCycler 96 (Roche Applied Science) was used for real-time PCR. The reaction solution, prepared by adding Taq polymerase, SYBR Green I (diluted 100,000 times, Invitrogen), and the sample solution to the PCR mix solution, was used for measurement. Furthermore, for the DNA recovered using the magnetic beads, PCR (T100 thermal cycler, BioRad, 94℃ for 60 seconds, {94℃ for 40 seconds, 61℃ for 40 seconds, 72℃ for 40 seconds}) was performed based on the Threshold Cycle (Cq value) obtained by real-time PCR to amplify the DNA. The reaction products were purified using AMPure XP (Beckman Coulter). mRNA was synthesized from purified DNA via a transcription reaction based on T7 RNA polymerase. The resulting product was purified using RNAClean XP (Beckman-Coulter). After purification, the mRNA concentration was determined based on UV absorbance at 260 nm and diluted to 20 μM.

[0506] Using the mRNA obtained above, a peptide library was constructed using the same method as in Examples 13-2. The desalted sample was mixed with magnetic beads (final concentration: 3 mg / mL, Dynabeads Protein G, Thermo Scientific) and the binding reaction was performed at 4°C for 10 minutes. After the binding reaction, the magnetic beads were removed by magnetic separation. This mixing with the magnetic beads and magnetic separation-based bead removal was performed twice. This step was used for negative screening. The magnetic beads after magnetic separation were resuspended using HBS-T (3.0 mg / mL) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was recovered to prepare the negative screening sample for real-time PCR. The supernatant after magnetic separation was further subjected to the above-described positive screening, and the DNA content of the obtained sample was quantified using the real-time PCR method. Based on the Threshold Cycle (Cq value) obtained from the real-time PCR method, DNA amplification and mRNA preparation were performed only on the positively screened samples in the same manner as above. Furthermore, a total of three rounds of the above-mentioned negative screening, positive screening, real-time PCR, PCR-based DNA amplification, and mRNA production were performed.

[0507] The results of the above screening process are as follows Figure 14 As shown. Here, recovery rate (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the liquid before the addition of the target protein. In the screening of target-binding peptides using Fc as a model protein, when screening was performed using a monovalent adapter (Adapter 1), no significant difference was found between the recovery rate of DNA derived from binding to the target protein (obtained in positive screening) and the recovery rate of DNA derived from non-specific binding (obtained in negative screening). On the other hand, when screening was performed using a bivalent adapter (Adapter 4), the recovery rate of DNA derived from binding to the target protein was significantly improved compared to the recovery rate of DNA derived from non-specific binding. This can be attributed to the fact that, for the monovalent adapter (Adapter 1), the binding of the target-binding peptide to the Fc protein was not maintained during the washing operation in the screening process due to its weak binding ability, while for the bivalent adapter (Adapter 4), the binding ability to the target protein was improved through the affinity effect of the multiple peptides linked to the adapter, thus maintaining the binding of the target-binding peptide to the Fc protein during the washing operation.

[0508] Example 14-4 Gene Sequence Analysis Based on Next-Generation Sequencing (NGS)

[0509] After adding the desired sequence to the DNA from each round, NGS analysis was performed. The specific experimental method is shown below.

[0510] For the final round of PCR samples, in order to add the hybridization region and index region of the forward / reverse primers for sequencing in the NGS analysis, PCR samples (final concentration: 2% (v / v)) and 50 μL of 1st PCR reaction solution (final concentration: 1×Phusion HF buffer, 200 μM dNTPs, 250 nM forward primers (F70-ID12-07-4 (SEQ ID NO.46) for screening samples using monovalent adapters, and F70-ID12-07-5 (SEQ ID NO.47) for screening samples using bivalent adapters), 250 nM R38-3UTR-SBS-R (SEQ ID NO.48), and 20 U / mL Phusion DNA polymerase) were performed using a thermal cycler (T100 thermal cycler, BioRad) based on 95℃ for 120 seconds, 6 cycles {95℃ for 20 seconds, 61℃ for 30 seconds, 72℃ for 30 seconds}. Next, to add hybridization regions for the nucleic acid sequences immobilized on the flow cell in NGS analysis to the PCR-prepared samples, the PCR-prepared samples (final concentration: 2% (v / v)) and 50 μL of 2nd PCR reaction solution (final concentration: 1×Phusion HF buffer, 200 μM dNTPs, 250 nM F63-P5-SBS-F (SEQ ID NO.49), 250 nM R58-SBSR-P7 (SEQ ID NO.50), 20 U / mL Phusion DNA polymerase) were prepared and reacted using a thermal cycler (T100 thermal cycler, BioRad) at 95°C for 120 seconds, for 6 cycles {95°C for 20 seconds, 61°C for 30 seconds, 72°C for 30 seconds}. The reaction products were purified using AMPure XP (Beckman Coulter). For the purified samples, gene sequence analysis was performed using the Miseq (registered trademark) System and Miseq Regent Micro Kit v2.

[0511] Example 14-5 Evaluation of Binding Ability Based on Demonstration Experiments

[0512] In each NGS analysis using the aforementioned monovalent and divalent adapters, the peptide sequences translated from the read gene information were analyzed, and only the fixed sequences of the peptides designed using the gene information and the sequences that retained the randomized number of peptides were extracted. Furthermore, the 15 most frequent sequences were selected from the extracted peptide sequences, and mRNA was prepared according to Example 2. After preparation, for the mRNAs with the 15 most frequent sequences selected from the screening using monovalent and divalent adapters respectively, adapter 1 or adapter 4 was hybridized separately to create mRNA-adaptor linkers.

[0513] For the cell-free translation system constructed in Example 5, the above-mentioned mRNA-adaptor linker (final concentration: 1 μM), 7 aminoacyl-tRNAs (final concentration 10 μM ClAc-F Ini-tRNA, MeF tRNA) were added. GAA MeG tRNA GAU MeNletRNA GGU MeA tRNA GGC W tRNA GCA , C tRNA CCA The reaction was performed at 37°C for 30 minutes, using 10 amino acids (final concentration 0.2 mM Leu, Val, Ser, Pro, Tyr, His, Asn, Asp, Arg, Gly) and 10 aminoacyl-tRNA synthetases (final concentrations 0.04 μM LeuRS, 0.02 μM ValRS, 0.04 μM SerRS, 0.16 μM ProRS, 0.02 μM TyrRS, 0.02 μM HisRS, 0.38 μM AsnRS, 0.13 μM AspRS, 0.03 μM ArgRS, 0.09 μM GlyRS) and Mg(OAc)2 (final concentration: 1 mM). After the reaction, EDTA was added to bring the final concentration to 12.5 mM, and the mixture was incubated on ice for 10 minutes to denature the ribosomes.

[0514] Furthermore, for the reaction solution used in the first translation reaction described above, the following solutions were added: Mg(OAc)2 (final concentration: 13.5 mM), translation-related solutions (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL total tRNA from E. coli (Roche), 0.47 mM DTT), and aminoacyl-tRNA (final concentration: 10 μM ClAc-F Ini-tRNA, MeFtRNA). GAAMeG tRNA GAU MeNle tRNA GGU MeA tRNA GGC W tRNA GCA , C tRNA CCA The translation reaction was carried out at 37°C for 30 minutes using ribosomes (final concentration: 1.2 μM). After the reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0515] Next, a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl2, 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, 3 μM TGG-ssG4S2.R23RT (SEQ ID NO.9)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42 °C for 30 minutes.

[0516] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) was added, and desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column replaced with HBS-T (0.05% (v / v) Tween20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0517] The desalted sample was mixed with recombinant human IgG1 Fc protein (final concentration: 250 nM, 110-HG, R&D Systems) and magnetic beads (final concentration: 3 mg / mL, Dynabeads Protein G, Thermo), or mixed only with magnetic beads (final concentration: 3 mg / mL, Dynabeads Protein G, Thermo), and the mixture was incubated at 4°C for 30 minutes for binding reaction. After binding reaction, magnetic separation was performed, and the supernatant was removed. Then, the magnetic beads were resuspended using HBS-T (1.5 mg / mL) and transferred to a new sample tube. Further, the above magnetic separation / supernatant removal / HBS-T resuspension was performed a total of 3 times. Finally, after magnetic separation / supernatant removal, the sample was resuspended using HBS-T (3.0 mg / mL) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was recovered.

[0518] The amount of DNA in the liquid before the addition of the desalted target protein and the amount of DNA recovered using magnetic beads were quantified by real-time PCR. A LightCycler 96 (Roche Applied Science) was used for the real-time PCR assay. The reaction solution prepared by adding Taq polymerase, SYBR Green I (diluted 100,000 times, Invitrogen), and the sample solution to the above PCR mix solution was used for the assay.

[0519] The results of the above demonstration experiment are as follows Figure 15 As shown. Here, recovery rate (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the liquid before the addition of the target protein. In the screening of target-binding peptides using Fc as a model protein, for the 15 most frequent sequences selected from the screening using a monovalent adapter (Adapter 1), no significant difference was found between the recovery rate of DNA derived from binding to the target protein and the recovery rate of DNA derived from non-specific binding, regardless of whether a monovalent or bivalent adapter was used in the demonstration experiment. On the other hand, for the 15 most frequent sequences selected from the screening using a bivalent adapter (Adapter 4), in the demonstration experiment using a bivalent adapter, a large number of sequences showed a significantly higher recovery rate of DNA derived from binding to the target protein compared to the recovery rate of DNA derived from non-specific binding. This can be attributed to the fact that, in the screening using a randomized peptide library, when using a bivalent adapter (Adapter 4), binding to Fc is maintained through the affinity effect of multiple peptides linked to this adapter, and sequences with target binding capacity are selected as the most frequent sequences.

[0520] [Example 15: Demonstration based on mRNA-adaptor linker (covalent conjugate)]

[0521] Example 15-1 Preparation of Linkage-Based mRNA-Adapter Linker (Covalent Complex)

[0522] The mRNAs prepared using the template DNA of mRNA display format Strep-tag II in Example 2 (final concentration: 1.0 μM) and adapter 7 or adapter 8 prepared in Example 1 (final concentration: 1.5 μM) were reacted in a ligation solution (10% DMSO (v / v), 1x ligation buffer (TAKARA), 5 U / μL T4 RNA ligase) at 37°C for 1 hour. After the reaction, NaCl (final concentration: 0.3 M) and EDTA (5 mM) were added to stop the reaction. After phenol / chloroform extraction, ethanol precipitation was performed. After drying, the mixture was dissolved in ultrapure water to prepare a 5 μM mRNA-adaptor linker (covalent complex).

[0523] Example 15-2 Demonstration of mRNA-adaptor-peptide linkers based on Strep-tagII as a model peptide

[0524] Using the mRNA-linker-peptide linker (covalent complex) obtained by the ligation reaction in section 1 above, the following demonstration experiment was performed to evaluate the recovery rate associated with binding to streptavidin.

[0525] For the cell-free translation system constructed in Example 5, the above-mentioned mRNA-adaptor linker (final concentration: 1 μM), one aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine amino acids (final concentrations: 0.2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp) and nine aminoacyl-tRNA synthetases (final concentrations: 0.09 μM GlyRS, 0.02 μM M IsRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM M LysRS, 0.03 μM TrpRS) were added, and a translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, EDTA was added to the sample to be subjected to artificial cyclic translation to achieve a final concentration of 12.5 mM, and the sample was placed on an ice bath for 10 minutes to denature the ribosomes.

[0526] For the reaction solution used in the first translation reaction described above, Mg(OAc)₂ (final concentration: 12.5 mM), translation-related solutions (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL total tRNA from E. coli (Roche), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (second translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0527] Next, a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl2, 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, 3 μM RT-Strep-tag II (SEQ ID NO.14)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42 °C for 30 minutes.

[0528] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) was added, and desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column replaced with HBS-T (0.05% (v / v) Tween20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0529] After desalting, magnetic beads immobilized with streptavidin (final concentration: 1 mg / mL, Dynabeads M-280 streptavidin, Thermo Scientific) were added, and the binding reaction was carried out at 4°C for 1 hour. As a negative control, magnetic beads immobilized with Protein G (final concentration: 1 mg / mL, Dynabeads Protein G for Immunoprecipitation, Thermo Scientific) were added to the desalted sample, and the mixture was incubated at 4°C for 1 hour for the binding reaction. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. The beads were then resuspended using HBS-T (0.5 mg / mL), transferred to a new sample tube, and mixed at 4°C for 5 minutes. This process of magnetic separation / supernatant removal / HBS-T resuscitation / 5-minute mixing at 4°C was repeated twice. Finally, after magnetic separation / removal of the supernatant, the sample was resuspended in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (2 mg / mL) and heated at 95 °C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was recovered.

[0530] The amount of DNA in the liquid before the addition of the desalted target protein and the amount of DNA recovered using magnetic beads were quantified by real-time PCR. A LightCycler 96 (Roche Applied Science) was used for the real-time PCR assay. The reaction solution prepared by adding Taq polymerase, SYBR Green I (diluted 100,000 times, Invitrogen), dNTPs (final concentration: 0.25 mM), MgCl2 (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_mRNA display_Strep-tag II (SEQ ID NO.45) (0.25 μM), and the sample solution was used for the assay.

[0531] The results of the above demonstration experiment were as follows: Figure 16As shown. Here, the recovery rate (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the liquid before the addition of the target protein. In the evaluation of the binding affinity of the model peptide and the model target protein using Strep-tag II and streptavidin, respectively, the recovery rate of DNA derived from the binding to the target protein was significantly increased compared to the monovalent adapter (Adapter 7) by using a bivalent adapter (Adapter 8). Furthermore, the increase in the recovery rate was also confirmed in artificial cyclic translation. Based on these results, it can be concluded that, similar to Example 10, the binding affinity to the target protein was improved by the affinity effect derived from the multiple peptides linked to the above adapter.

[0532] Based on the results of Examples 10 and 15-2 above, it is demonstrated that, independent of the mRNA-adaptor ligation method, multiple peptides can be displayed by using a bivalent adapter, thereby enhancing the binding affinity to the target protein through affinity effects.

[0533] [Example 16: Construction of a RAPID linker in which an amino acid is covalently bonded to the 3' ribose via an ester bond, and demonstration experiments using it]

[0534] Example 16-1 Acylation of the 3' ends of linkers 9 and 10 based on ARS ribozymes

[0535] As the amino acid activating esters used in the aminoacylation of the 3' ends of linkers 9 and 10 of ARS ribozymes, methyl 2,2,2-trifluoroethyl L-phenylaminopropionate hydrochloride (NMe-Phe-TEE) was prepared (prepared by the method disclosed in WO2023 / 234425 (Patent Document 11)). eFx was used as the ARS ribozyme to link the 3' ends of linkers 9 and 10 to each amino acid activating ester separately. For NMe-Phe-TEE (final concentration: 5 mM), eFx (final concentration: 25 μM), linker 9 or linker 10 (final concentration: 25 μM), HEPES-KOH (final concentration: 50 mM, pH 7.5), MgCl2 (final concentration: 50 mM), and DMSO (final concentration: 20%) were added, and the aminoacylation reaction was carried out overnight at 0°C. After aminoacylation, an equal volume of 3 M NaOAc (pH 5.2) was added, followed by ethanol precipitation.

[0536] Next, the particles were redissolved with 0.3M NaOAc (pH 5.2) and precipitated again with ethanol. Finally, the particles were washed once with 70% ethanol containing 0.1M NaOAc (pH 5.2) and once with 70% ethanol. The resulting ammony-acylated sample particles were dissolved in 0.2% acetic acid. The ammony-acylated sample was dissolved in 2.64 times the volume of loading buffer (final concentration: 41mM sodium acetate, 23% formamide, 2.7mM EDTA) and separated under acidic conditions by 20% denaturing polyacrylamide gel electrophoresis (50mM sodium acetate (pH 5.2), 6M urea) (electrophoresis solution: 50mM sodium acetate (pH 5.2)). The gel after electrophoresis was analyzed by SYBR Green II (Invitrogen, SYBR molecular probes Inc.) fluorescence staining.

[0537] The results obtained are as follows Figure 17 As shown in a. Figure 17 Image a is obtained when detecting fluorescence from SYBR Green I (Invitrogen, SYBRhaMolecular Probes Inc.). When acylation is performed using a monovalent adapter (Adapter 9), a band shifted to the higher molecular weight side compared to the unacylated band position appears. This band shift can be attributed to the increase in molecular weight resulting from the acylation of one amino acid in the adapter. When a bivalent adapter (Adapter 10) is used, two bands shifted to the higher molecular weight side compared to the unacylated band position appear. This band shift can be attributed to the increase in molecular weight resulting from the acylation of one or two amino acids in the bivalent adapter (Adapter 10), which has two CCA recognition sites at the ends for ARS ribozymes, respectively.

[0538] Example 16-2 Demonstration of mRNA-adaptor-peptide linkers based on Strep-tagII as a model peptide

[0539] A demonstration experiment was conducted using an mRNA-adaptor-peptide linker with Strep-tagII as the model peptide to evaluate the recovery rate associated with binding to streptavidin.

[0540] The following experiment was performed on the mRNA encoding Strep-tagII prepared in Example 3, in which the MePhe-acylated adapter 9 or adapter 10 from Example 16-1 was hybridized in a 1 mM sodium acetate solution.

[0541] For the cell-free translation system constructed in Example 5, the above-mentioned mRNA-adaptor linker (final concentration: 1 μM), one aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine amino acids (final concentrations: 0.2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp) and nine aminoacyl-tRNA synthetases (final concentrations: 0.09 μM GlyRS, 0.02 μM M IsRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM M LysRS, 0.03 μM TrpRS) were added, and a translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, EDTA was added to the sample to be subjected to artificial cyclic translation to achieve a final concentration of 12.5 mM, and the sample was placed on an ice bath for 10 minutes to denature the ribosomes.

[0542] For the reaction solution used in the first translation reaction described above, Mg(OAc)₂ (final concentration: 12.5 mM), translation-related solutions (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL total tRNA from E. coli (Roche), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (second translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0543] Next, a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl2, 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, 3 μM RT-Strep-tag II (SEQ ID NO.14)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42 °C for 15 minutes.

[0544] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) was added, and then desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column replaced with HBS-T (0.05% (v / v) Tween20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0545] After desalting, magnetic beads immobilized with streptavidin (final concentration: 1 mg / mL, Dynabeads M-280 streptavidin, Thermo Scientific) were added, and the binding reaction was carried out at 4°C for 1 hour. As a negative control, magnetic beads immobilized with Protein G (final concentration: 1 mg / mL, Dynabeads Protein G for Immunoprecipitation, Thermo Scientific) were added to the desalted sample, and the mixture was incubated at 4°C for 1 hour for the binding reaction. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. The beads were then resuspended using HBS-T (0.5 mg / mL), transferred to a new sample tube, and mixed at 4°C for 5 minutes. This process of magnetic separation / supernatant removal / HBS-T resuscitation / 5-minute mixing at 4°C was repeated twice. Finally, after magnetic separation / removal of the supernatant, the sample was resuspended in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (2 mg / mL) and heated at 95 °C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was recovered.

[0546] The amount of DNA in the liquid before the addition of the desalted target protein and the amount of DNA recovered using magnetic beads were quantified by real-time PCR. A LightCycler 96 (Roche Applied Science) was used for the real-time PCR assay. The reaction solution prepared by adding Taq polymerase, SYBR Green I (diluted 100,000 times, Invitrogen), dNTPs (final concentration: 0.25 mM), MgCl2 (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_Strep-tag II (SEQ ID NO.10) (0.25 μM), and the sample solution was used for the assay.

[0547] The results of the above demonstration experiment were as follows: Figure 18As shown. Here, the recovery rate (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the liquid before the addition of the target protein. In the evaluation of the binding affinity of the model peptide and the model target protein using Strep-tag II and streptavidin, respectively, the recovery rate of DNA derived from the binding to the target protein was significantly increased compared to the monovalent adapter (Adapter 9) by using a bivalent adapter (Adapter 10). Furthermore, the increase in the recovery rate was also confirmed in artificial cyclic translation. Based on these results, it can be considered that, similar to Example 10, the binding affinity to the target protein was improved by the affinity effect derived from the multiple peptides linked to the above adapter.

[0548] Based on the results of Examples 10, 16-1, and 2 above, it can be concluded that when amino acids are covalently bonded to the ribose at the 3' end of the linker via ester bonds to become puromycin-like substances, multiple peptides can be displayed by using a divalent linker, thereby improving the binding ability to the target protein through affinity effects.

[0549] [Example 17: Demonstration test using a trivalent connector]

[0550] Example 17-1 Demonstration of mRNA-adaptor-peptide linkers based on Strep-tagII as a model peptide 1

[0551] A demonstration experiment was conducted using an mRNA-adaptor-peptide linker with Strep-tagII as the model peptide to evaluate the recovery rate associated with binding to streptavidin.

[0552] The following experiments were conducted using mRNA-adaptor linkers formed by hybridizing adapter 1 and adapter 11 with the mRNA encoding Strep-tagII prepared in Example 3.

[0553] For the cell-free translation system constructed in Example 5, the above-mentioned mRNA-adaptor linker (final concentration: 1 μM), one aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine amino acids (final concentrations: 0.2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp) and nine aminoacyl-tRNA synthetases (final concentrations: 0.09 μM GlyRS, 0.02 μM M IsRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM M LysRS, 0.03 μM TrpRS) were added, and a translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, for samples that were not subjected to artificial cyclic translation, EDTA was added to bring the final concentration to 16.7 mM. For samples that were to undergo a second translation via artificial cyclic translation, EDTA was added to bring the final concentration to 12.5 mM. The samples were then placed on an ice bath for 10 minutes to denature the ribosomes.

[0554] Furthermore, a second translation reaction was performed on the samples that underwent artificial cyclic translation.

[0555] For the reaction solution used in the first translation reaction described above, the following solutions were added: Mg(OAc)2 (final concentration: 12.5 mM), translation-related solution (final concentration: 23.5 mM HEPES-KOH (pH 7.6)), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL total tRNA from E. coli (Roche), 0.47 mM DTT, and aminoacyl-tRNA (final concentration: 10 μM W). Ini-tRNA and ribosomes (final concentration: 1.2 μM) were subjected to a translation reaction at 37 °C for 30 minutes (second translation reaction). After the reaction, for samples that were not to undergo a third translation reaction via artificial cyclic translation, EDTA was added to a final concentration of 16.7 mM, and for samples to undergo a third translation reaction via artificial cyclic translation, EDTA was added to a final concentration of 12.5 mM. The samples were then incubated on ice for 10 minutes to denature the ribosomes.

[0556] Furthermore, a third translation reaction was performed on the samples that underwent artificial cyclic translation.

[0557] For the reaction solution used in the second translation reaction described above, Mg(OAc)₂ (final concentration: 12.5 mM), translation-related solutions (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL total tRNA from E. coli (Roche), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM WIni-tRNA), and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (the third translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0558] Next, a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl2, 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, 3 μM RT-Strep-tag II (SEQ ID NO.14)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42 °C for 30 minutes.

[0559] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) was added, and then desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column replaced with HBS-T (0.05% (v / v) Tween20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0560] After desalting, magnetic beads immobilized with streptavidin (final concentration: 1 mg / mL, Dynabeads M-280 streptavidin, Thermo Scientific) were added, and the binding reaction was carried out at 4°C for 1 hour. As a negative control, magnetic beads immobilized with Protein G (final concentration: 1 mg / mL, Dynabeads Protein G for Immunoprecipitation, Thermo Scientific) were added to the desalted sample, and the mixture was incubated at 4°C for 1 hour for the binding reaction. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. The beads were then resuspended using HBS-T (0.5 mg / mL), transferred to a new sample tube, and mixed at 4°C for 30 minutes. This process of magnetic separation / supernatant removal / HBS-T resuscitation / 30-minute mixing at 4°C was repeated twice. Finally, after magnetic separation / removal of the supernatant, the sample was resuspended in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (2 mg / mL) and heated at 95 °C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was recovered.

[0561] The amount of DNA in the liquid before the addition of the desalted target protein and the amount of DNA recovered using magnetic beads were quantified by real-time PCR. A LightCycler 96 (Roche Applied Science) was used for the real-time PCR assay. The reaction solution prepared by adding Taq polymerase, SYBR Green I (diluted 100,000 times, Invitrogen), dNTPs (final concentration: 0.25 mM), MgCl2 (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_Strep-tag II (SEQ ID NO.10) (0.25 μM), and the sample solution was used for the assay.

[0562] The results of the above demonstration experiment were as follows: Figure 19 As shown. Here, recovery rate (%) represents the proportion of DNA recovered from the magnetic beads relative to the amount of DNA in the liquid before the addition of the target protein. In the evaluation of the binding affinity of the model peptide and the model target protein using Strep-tag II and streptavidin, respectively, the recovery rate of DNA derived from the binding of the target protein increased significantly depending on the number of artificial cycle translations compared to the monovalent adapter (Adapter 1). This can be attributed to the enhanced binding affinity to the target protein derived from the affinity effects of the multiple peptides linked to the aforementioned adapter.

[0563] Example 17-2 Demonstration of mRNA-adaptor-peptide linkers based on Strep-tagII as a model peptide 2

[0564] A demonstration experiment was conducted using an mRNA-adaptor-peptide linker with Strep-tagII as the model peptide to evaluate the recovery rate associated with binding to streptavidin.

[0565] The following experiments were conducted using mRNA-adaptor linkers formed by hybridizing adapter 1 and adapter 15 with the mRNA encoding Strep-tagII prepared in Example 3.

[0566] For the cell-free translation system constructed in Example 5, the above-mentioned mRNA-adaptor linker (final concentration: 1 μM), one aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine amino acids (final concentrations: 0.2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp) and nine aminoacyl-tRNA synthetases (final concentrations: 0.09 μM GlyRS, 0.02 μM M IsRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM M LysRS, 0.03 μM TrpRS) were added, and a translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, EDTA was added to the sample to be subjected to artificial cyclic translation to achieve a final concentration of 12.5 mM, and the sample was placed on an ice bath for 10 minutes to denature the ribosomes.

[0567] For the reaction solution used in the first translation reaction described above, Mg(OAc)₂ (final concentration: 12.5 mM), translation-related solutions (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL total tRNA from E. coli (Roche), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (second translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0568] Next, a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl2, 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, 3 μM RT-Strep-tag II (SEQ ID NO.14)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42 °C for 30 minutes.

[0569] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) was added, and then desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column replaced with HBS-T (0.05% (v / v) Tween20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0570] After desalting, magnetic beads immobilized with streptavidin (final concentration: 1 mg / mL, Dynabeads M-280 streptavidin, Thermo Scientific) were added, and the binding reaction was carried out at 4°C for 1 hour. As a negative control, magnetic beads immobilized with Protein G (final concentration: 1 mg / mL, Dynabeads Protein G for Immunoprecipitation, Thermo Scientific) were added to the desalted sample, and the mixture was incubated at 4°C for 1 hour for the binding reaction. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. The beads were then resuspended using HBS-T (0.5 mg / mL), transferred to a new sample tube, and mixed at 4°C for 30 minutes. This process of magnetic separation / supernatant removal / HBS-T resuscitation / 30-minute mixing at 4°C was repeated twice. Finally, after magnetic separation / removal of the supernatant, the sample was resuspended in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (2 mg / mL) and heated at 95 °C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was recovered.

[0571] The amount of DNA in the liquid before the addition of the desalted target protein and the amount of DNA recovered using magnetic beads were quantified by real-time PCR. A LightCycler 96 (Roche Applied Science) was used for the real-time PCR assay. The reaction solution prepared by adding Taq polymerase, SYBR Green I (diluted 100,000 times, Invitrogen), dNTPs (final concentration: 0.25 mM), MgCl2 (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_Strep-tag II (SEQ ID NO.10) (0.25 μM), and the sample solution was used for the assay.

[0572] The results of the above demonstration experiment were as follows: Figure 20 As shown. Here, recovery rate (%) represents the proportion of DNA recovered from the magnetic beads relative to the amount of DNA in the liquid before the addition of the target protein. In the evaluation of the binding affinity of the model peptide and the model target protein using Strep-tag II and streptavidin, respectively, the recovery rate of DNA derived from binding to the target protein was significantly increased compared to the monovalent adapter (Adapter 1) when using a trivalent adapter (Adapter 15). This can be attributed to the enhanced binding affinity to the target protein derived from the affinity effects of the multiple peptides linked to the aforementioned adapter.

[0573] Industrial applicability

[0574] Regarding the "linker formed by the binding of multiple translation products to a genetic information material via a puromycin-like substance" of the present invention, the target protein can be identified through multiple translation products. Therefore, for example, by using it in cell-free translation system display (mRNA display, etc.), the recovery rate of peptide-nucleic acid linkers bound to the target protein can be significantly improved, and peptide-bound substances with weaker binding affinity to the aforementioned peptides can be obtained. By providing such a novel display, excellent development of peptide medicines, for example, can be expected.

Claims

1. A linker comprising: a binding portion having a structure capable of binding to a desired genetic information substance, and at least two or more puromycin-like substances, the puromycin-like substances being capable of covalently bonding to the C-terminus of a desired peptide.

2. The linker according to claim 1, wherein the binding portion having a structure capable of binding to a desired genetic information substance comprises a nucleic acid capable of binding to the desired genetic information substance.

3. The linker according to claim 1 or 2, which is used for linking the genetic information substance to a peptide encoded by the genetic information substance.

4. The linker according to any one of claims 1 to 3, wherein the genetic information substance is a nucleic acid.

5. The linker according to any one of claims 1 to 3, wherein the puromycin-like substance is puromycin.

6. Use of a linker comprising: a binding portion having a structure capable of binding to a desired genetic information substance, and at least two or more puromycin-like substances, the puromycin-like substances being capable of covalently bonding to the C-terminus of a desired peptide, for linking the genetic information substance to a peptide encoded by the genetic information substance.

7. A genetic information substance-linker conjugate comprising: (a) the linker according to any one of claims 1 to 3, and (b) the genetic information substance bound to the binding portion of the linker of (a).

8. A genetic information substance-linker-peptide conjugate comprising: (a) the linker according to claim 1 or 3, (b) the genetic information substance bound to the binding portion of the linker of (a), and (c) a peptide encoded by the genetic information substance bound to the at least two or more puromycin-like substances of the linker of (a).

9. A method for producing a genetic information substance-linker-peptide conjugate, the method comprising: (1) a step of subjecting the genetic information substance-linker conjugate according to claim 7 to translation of the genetic information substance in a cell-free translation system, wherein the puromycin-like substance in the linker binds to the translated peptide to obtain the genetic information substance-linker-peptide conjugate.

10. The method according to claim 9, which comprises, prior to the step of (1): (0) a step of binding the linker according to any one of claims 1 to 3 to a desired genetic information substance to obtain the genetic information substance-linker conjugate.

11. The method according to claim 9 or 10, which comprises: (2) a step of repeating the step of (1) two or more times.

12. A library comprising at least two of the genetic information substance-linker-peptide conjugates according to claim 8.

13. A screening method for a peptide that binds to a desired target substance, the method comprising: a step of contacting a library comprising at least two of the genetic information substance-linker-peptide conjugates according to claim 8 with the target substance.

14. An evaluation method for evaluating the binding ability of a desired target substance to a peptide, the method comprising: a step of contacting the genetic information substance-linker-peptide conjugate according to claim 8 with the target substance.

15. A method for producing a genetic information substance-linker-peptide conjugate, the method comprising: (1-i) a step of subjecting a genetic information substance-linker conjugate, in which a linker comprising at least two or more puromycin-like substances is bound to a desired genetic information substance, to translation of the genetic information substance in a cell-free translation system, wherein the puromycin-like substances in the linker bind to a translated peptide to obtain a genetic information substance-linker-peptide conjugate; and (2-i) a step of repeating the step of (1-i) two or more times.

16. A method for producing a genetic information substance-linker-peptide conjugate, the method comprising: (1-ii) a step of subjecting a genetic information substance-linker conjugate, in which a linker comprising at least two or more puromycin-like substances is bound to a desired genetic information substance, to translation of the genetic information substance in a cell-free translation system, wherein the puromycin-like substances in the linker bind to a translated peptide to obtain a genetic information substance-linker-peptide conjugate.

17. A method for displaying two or more peptides encoded by a desired genetic information substance from the genetic information substance, wherein the peptides are each linked to the genetic information substance via a functional group capable of covalent bonding to the C-terminal end of the peptide.

18. The display method according to claim 17, the method comprising: a step of subjecting the genetic information substance-linker conjugate of claim 7 to translation of the peptides from the genetic information substance in a cell-free translation system, wherein a step of binding the puromycin-like substances to the translated peptides is included.

Images