Application of disulfiram in preparation of medicine for treating lysosomal storage disease
By using the small molecule compound disulfiram to enhance SNX8 gene expression and lysosomal function, the limitations of existing LSD treatment methods have been overcome, achieving broad-spectrum treatment for a variety of lysosomal storage diseases.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-25
- Publication Date
- 2026-04-07
AI Technical Summary
Existing LSD treatments mainly target a single or similar pathogenesis, making them unsuitable as universal treatments for most cases of LSD. They also suffer from high costs, low efficiency, and high safety risks.
The small molecule compound disulfiram is used to enhance lysosomal function by increasing the expression level of the SNX8 gene, thereby providing broad-spectrum treatment for various lysosomal storage diseases caused by different primary storage substances.
It significantly reduces lysosomal storage, restores lysosomal function, alleviates damage, inhibits disease progression, reduces cell death, and achieves broad-spectrum treatment for various LSDs.
Smart Images

Figure CN121796367A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biological medicine, and particularly relates to application of disulfiram in preparation of a drug for treating lysosomal storage disease. BACKGROUND
[0002] Lysosomal storage disease (LSD) is a collective term for a group of genetic diseases caused by mutations in genes related to lysosome. There are about 50 types of lysosomal storage disease in human, each with an average incidence of less than 1 in 100,000, but the total incidence is about 1 in 5500 to 1 in 5000.
[0003] The pathogenesis of LSD varies according to the different mutated genes. The mutated genes can be enzymes responsible for degradation in lysosomes, proteins responsible for transporting substances on the lysosomal membrane, proteins related to lysosomal membrane transport, and enzymes responsible for post-translational modification of lysosome-related proteins, etc. Although the pathogenesis is different, the onset of all LSDs is accompanied by the accumulation of a certain lysosome-related substance. LSDs can be generally classified into the following categories according to the primary accumulated substance: 1. Lipid storage disease, which is further divided into sphingolipidosis, gangliosidosis and leukodystrophy, etc.; 2. Mucopolysaccharidosis; 3. Glycoprotein storage disease; 4. Mucolipidosis.
[0004] In addition, there are glycogen storage diseases such as Pompe Disease, and cystinosis, which are not classified into the above categories. Due to the complex interaction between the accumulated substances in lysosomes and the transport and function of lysosomal membranes, all the above types of LSDs will eventually lead to secondary accumulation of various lysosome-related metabolites, causing similar effects of metabolite accumulation.
[0005] Due to the accumulation of similar substances, in addition to the phenotypes directly related to the function of the mutated gene itself, the main pathological phenotypes of LSD at both cellular and human levels are similar. Among them, the phenotypes at the human level are mainly caused by damage to long-lived terminally differentiated cells (mainly neurons and muscle fibers), including developmental delay, muscle spasm, muscle hypokinesia, low intelligence, visual and auditory impairment, etc. At the cellular level, the phenotypes mainly include swollen lysosomes, accumulation of various lysosome-related metabolites (cholesterol, sphingomyelin, ceramide, various polysaccharides, etc.), decreased lysosome degradation and transport function, blocked lysosome regeneration, etc. Depending on the severity of the pathogenic mutation, the severity of the phenotype of LSD also varies. However, even relatively mild mutations will mostly cause the disease to occur in childhood and cause death usually before the age of thirty, and severe mutations will cause the disease to occur in infants and children and die within a few years.
[0006] LSD is caused by mutations at the gene level, which cannot be completely cured by current biological and medical technologies. Although the CRISPR gene editing technology can directly edit the target gene sequence in living cells and higher animals, it cannot be applied to clinical experiments and treatment in the short term due to its unresolved off-target effects and ethical issues. So far, the treatment for LSD is mainly to reduce the intake of related storage substances to alleviate the phenotype. Such a solution is time-consuming for patients and their families, and is only suitable for primary storage substances that are external intake substances or their direct metabolites. LSD caused by the storage of substances synthesized in the body, such as glycoprotein storage disease and mucopolysaccharidosis, cannot be treated by adjusting the intake of substances.
[0007] In addition, there are currently few reports of treatment methods, including gene therapy and protein replacement therapy. The former treatment plan is to deliver the wild type of the mutant gene into the patient's body through a virus and express it to replace the mutant gene to perform its function. The latter treatment plan is to synthesize normal proteins and inject them into the patient's body to directly replace the diseased proteins to perform their functions. Gene therapy is limited by the efficiency of viral transfection and expression, and the DNA fragment inserted by the virus into the chromosome can cause mutations in other genes, chromosomal instability, and other problems, which can easily cause other diseases and increase the risk of cancer. Protein replacement therapy is generally only suitable for LSD caused by mutations in enzymes in lysosomes, and is very ineffective for brain cells due to the presence of the blood-brain barrier. Protein replacement therapy requires regular injections of synthetic proteins, which is expensive.
[0008] In addition to the above-mentioned shortcomings, the current treatment methods for LSD all have another limitation, i.e., they are only suitable for a single or same type of LSD and cannot be used as a universal treatment for most LSDs. However, the incidence of a single LSD is very low, which results in very low efficiency and minimal benefits of further optimization of the above-mentioned treatment methods.
[0009] The doctoral dissertation "SNX8 alleviates lysosomal storage disease phenotype by enhancing lysosome biogenesis" published online on February 23, 2023, discloses that SNX8, as a major SNX-BAR protein, regulates lysosome biogenesis. The absence of SNX8 can damage lysosome biogenesis, leading to lysosome dysfunction and causing LSD phenotype. Overexpression of SNX8 can alleviate lysosomal storage disease phenotype in multiple LSD model cell lines by enhancing lysosome biogenesis, and can alleviate LSD symptoms in Sandhoff disease mice at the animal level.
[0010] Disulfiram, also known as disulfiram, disulfiram, and tetraethylthiuram disulfide (TETD), has the molecular formula C 10 H20 N2S4, whose molecular structure is shown in formula I, is usually used as an alcoholism treatment drug, and can also be used as a fungicide and insecticide.
[0011]
[0012] However, up to now, there is no report on the function of disulfiram in lysosomal storage diseases and lysosome-related diseases such as neurodegenerative diseases. SUMMARY
[0013] Based on the above problems in the treatment of LSD, the present application provides a drug which can treat LSD in a broad spectrum and is relatively low in cost. The present application provides the use of disulfiram in the preparation of a drug for treating lysosomal storage diseases.
[0014] The use of a small molecule compound disulfiram or a pharmaceutically acceptable salt thereof in the preparation of a drug for treating lysosomal storage diseases. The small molecule compound disulfiram can increase the expression amount of SNX8 gene. The SNX8 protein can mediate lysosome tubulation and enhance the function of lysosomes, thereby achieving broad-spectrum treatment of lysosomal storage diseases caused by various primary storage substances.
[0015] Preferably, the lysosomal storage disease is Fabry disease, and the primary storage substance is GM2 ganglioside.
[0016] Preferably, the lysosomal storage disease is Niemann-Pick disease type C, and the primary storage substance is cholesterol.
[0017] Preferably, the lysosomal storage disease is GM2 gangliosidoses, and the primary storage substance is a galactose-containing glycolipid or polysaccharide.
[0018] Preferably, the lysosomal storage disease is Gaucher disease, and the primary storage substance is glucocerebroside.
[0019] Preferably, the drug is an injection, a tablet or a capsule. The injection is an intravenous injection.
[0020] The present application further provides a drug for treating lysosomal storage diseases, wherein the active ingredient is a small molecule compound disulfiram or a pharmaceutically acceptable salt thereof.
[0021] The drug disulfiram screened by the present application can inhibit the phenotype of lysosomal storage diseases, including inhibiting the increase in lysosome volume, inhibiting cholesterol accumulation, significantly restoring inhibited lysosome tubulation, significantly restoring tolerance to repeated starvation and reducing cell mortality, thereby achieving the purpose of reducing damage and inhibiting disease progression. Therefore, disulfiram has the prospect of being developed into a broad-spectrum lysosomal storage disease treatment drug. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 Flow chart for screening of small molecule drugs.
[0023] Figure 2 Figure for detection of the effective reduction of cholesterol accumulation in various LSD model cell lines by disulfiram.
[0024] Figure 3 Figure for detection of the effective recovery of lysosome tubulation in various LSD model cell lines by disulfiram.
[0025] Figure 4 Figure for detection of the effective recovery of tolerance to repeated starvation in various LSD model cell lines by disulfiram. DETAILED DESCRIPTION
[0026] The SNX8-GFP knock-in cell line in which GFP protein is fused to the endogenous SNX8 was constructed by CRISPR-Cas9 technology for preliminary screening of small molecule drugs. The knock-in scheme is that GFP is fused to the stop codon before the last exon of SNX8, and about 1 kb of original chromosomal sequence is carried before and after the fusion fragment, and then the fusion fragment is inserted and replaced with the original SNX8 gene sequence on the chromosome by CRISPR-Cas9 mediated homologous recombination. The primer sequences used for GFP fusion SNX8 are as follows:
[0027] GFP upstream: CAGCACCCTGACCCCAGGAATGGTGAGCAAGGGC, GFP downstream: GACGAGCTGTACAAGTAAGCTCCCCGCCGGAGG;
[0028] Homologous arm upstream: CGGTAGACAGCCGCCGTGTTAG,
[0029] Homologous arm downstream: GCAAGTGCGTGACGGGAGGC;
[0030] Cas9 cleavage gRNA: CCTCCGGCGGGGAGCACGGT,
[0031] The GFP knock-in sequence fused to the genome is shown in SEQ ID No. 1, wherein 1081-1803 bp is the GFP sequence; 1-1080 bp and 1804-2768 bp on both sides are the original SNX8 genomic sequence, i.e. the homologous arm sequence for recombination.
[0032] And the SNX8 knockout cell line is constructed as a negative control, and four different types of LSD mode knockout cell lines, respectively, GBAKO (GBA knockout), GLAKO (GLA gene knockout), HEXAKO (HEXA gene knockout), and NPC1KO (NPC1 gene knockout). The DNA sequence for transcription into corresponding gRNA during gene knockout is as follows:
[0033] SNX8: CTGCGGCATCTGCATTCGAC;
[0034] GBA: ATCATCAGGGGTGTCTGCAT;
[0035] GLA: GCTCCCCAAAGAGATTCAGA;
[0036] HEXA: TTTCCCCGCTTTCCTCACCG;
[0037] NPC1: CTGGACACAGTAGCAGCAGG.
[0038] Among them, the knockout of GBA causes a two-base deletion at the 550th exon of the gene on both chromosomes, and the WB confirms that the expression of GBA protein is completely lost; the knockout of GLA causes a 7-bp base loss at the 234th exon of the gene on both chromosomes, which causes a frame shift, and the WB confirms that the expression of GLA protein is completely lost; the knockout of HEXA causes an additional one-base at the 539th exon of the gene on both chromosomes, which causes a frame shift, and the WB confirms that the expression of HEXA protein is completely lost; the knockout of NPC1 causes a 1-bp base loss at the 36th exon of the gene on one chromosome, and an additional one-base at the site on the other chromosome, both of which cause a frame shift, and the WB confirms that the expression of NPC1 protein is completely lost.
[0039] where the deletion of GBA leads to Gaucher’s Disease, the deletion of GLA leads to GM2 gangliosidosis, the deletion of HEXA leads to Fabry’s Disease, and the deletion of NPC1 leads to Niemann-Pick type C (Platt, F. M., et al., Lysosomal storage diseases. Nat Rev Dis Primers, 2018. 4(1): p. 27.). The four diseases have completely different primary storage substances, where the deletion of GBA leads to the accumulation of glucocerebrosides, the deletion of GLA leads to the accumulation of galactose-containing glycolipids or polysaccharides, the deletion of HEXA leads to the accumulation of GM2 gangliosides, and the deletion of NPC1 leads to the accumulation of cholesterol. Therefore, the four knockout models can effectively test the broad-spectrum of small molecule drugs for different LSD diseases.
[0040] Example 1
[0041] Screening of small molecule drugs that up-regulate SNX8 expression by SNX8-GFP knock-in cell lines.
[0042] Construction of SNX8-GFP knock-in cell lines with GFP protein fused to the endogenous SNX8 by CRISPR-Cas9 technology.
[0043] The screening process of small molecule drugs is shown in Figure 1 The fluorescence intensity of GFP was used as the readout to quickly screen small molecule drugs that enhance the fluorescence intensity of GFP (using concentrations of 1 μM and 10 μM). Three repetitions were performed to select groups with significantly enhanced fluorescence stability, and further cell toxicity was detected by PI staining of dead cells and observation of cell morphology under white light. Drugs with no significant increase in PI staining compared to the control group (DMSO) and no significant changes in cell morphology, such as enlargement, curling, fragmentation, multinucleation, etc., were selected as short-term non-toxic drugs.
[0044] As a result, the small molecule compound disulfiram was screened, and the relevant data are shown in Table 1.
[0045] Table 1
[0046] Screening molecules Disulfiram SNX8 expression (control = 1) 9.3±1.78 Cell death rate (control subtracted) 1%±2%
[0047] Thereafter, the initial screening drugs were further tested for their effects on the three phenotypes of cholesterol accumulation, lysosome tubulation, and starvation tolerance in LSD model cell lines (data shown in Examples 2-4). Finally, LSD candidate drugs targeting SNX8 were screened.
[0048] Example 2
[0049] Cells were treated with disulfiram to inhibit cholesterol accumulation in LSD cells. GBA, GLA, HEXA or NPC1 were knocked out in HeLa cells to construct four LSD model cell lines. Wild type HeLa cells and these cell lines were treated with 10 mM disulfiram (with equal volume of DMSO as control). After 24 hours, cells were fixed with 3% PFA for 30 minutes, washed with PBS for three times, neutralized residual PFA with PBS containing 1.5 mg / mL glycine for 10 minutes, then treated with PBS containing 50 mg / L filipin and 1% fetal bovine serum for 2 hours in the dark, washed with PBS for three times, and observed under confocal fluorescence microscope with DAPI channel or UV channel to compare the filipin fluorescence intensity and distribution in cells. Then, the punctate filipin fluorescence in cells was circled by ImageJ software, and the filipin fluorescence intensity was calculated and compared among different experimental groups after deducting the background fluorescence intensity.
[0050] Results are shown in Figure 2 Wild type, SNX8 knockout, and four different types of LSD model cell lines (GBA knockout, GLA knockout, HEXA knockout, NPC1 knockout) were treated with DMSO or 10 mM disulfiram for 48 hours, and then fixed cells were detected for intracellular cholesterol accumulation by filipin staining. Disulfiram significantly reduced cholesterol accumulation in all LSD model cell lines, but had no effect in SNX8 knockout cells, suggesting that disulfiram acts through SNX8.
[0051] Example 3
[0052] Cells were treated with disulfiram to restore lysosome tubulation in LSD model cell lines. GBA, GLA, HEXA or NPC1 were knocked out in HeLa cells to construct four LSD model cell lines. Wild type HeLa cells and these cell lines were treated with 10 mM disulfiram (with equal volume of DMSO as control) and transfected with Lamp1-mCherry. After 24 hours, cells were serum starved for 6 hours, and then placed on a confocal microscope with a 37-degree constant temperature compartment. After temperature equilibration, the Lamp1-mCherry in cells was continuously photographed for 1 minute at 2-second intervals in a live cell imaging mode. After photographing, the number of Lamp1-mCherry-positive tubular structures appearing in cells within 1 minute was counted.
[0053] Results are shown in Figure 3As shown, wild-type, SNX8 knockout, and four different LSD cell lines (GBA knockout, GLA knockout, HEXA knockout, and NPC1 knockout) were treated with DMSO or 10 μM disulfiram for 24 hours, followed by serum starvation for 6 hours. The number of lysosomal tubules within the cells was then photographed and counted. Lysosomal tubule formation was significantly inhibited in all LSD cell lines, while disulfiram significantly restored the number of lysosomal tubules in all LSD cell lines, but had no effect in SNX8 knockout cells, suggesting that disulfiram acts through SNX8.
[0054] Example 4
[0055] Cells were treated with disulfiram to restore the tolerance of LSD (Low-Sitostered Deprivation) cell lines to repeated starvation. Four LSD cell lines were constructed by knocking out GBA, GLA, HEXA, or NPC1 in HeLa cells. Wild-type HeLa cells and these cell lines were treated with 10 μM disulfiram (with an equal volume of DMSO as a control), and simultaneously treated with serum-free, deglutamined DMEM medium for 12 hours. The medium was then replaced with normal DMEM medium containing 10% fetal bovine serum for 12 hours, and this process was repeated three times. Afterward, the nuclei of dead cells were labeled with 1 mg / L PI, and the images were imaged under a microscope using the TRITC channel. The proportion of PI-labeled cells in the images was then counted using ImageJ software, and the different experimental groups were compared.
[0056] The results are as follows Figure 4 As shown, wild-type, SNX8 knockout, and four different types of LSD cell lines (GBA knockout, GLA knockout, HEXA knockout, and NPC1 knockout) were treated with DMSO or 10 μM disulfiram for 24 hours, followed by treatment with serum-depleted and glutamine-depleted medium for 12 hours, and then recovery with complete medium (containing DMSO or 10 μM disulfiram) for 12 hours. This process was repeated three times. Dead cell nuclei were stained with PI (propydium iodide), and cell death rates were recorded. Disulfiram reduced cell death under repeated starvation conditions in all LSD cell lines, indicating a restoration of cell tolerance to repeated starvation. However, it had no effect in SNX8 knockout cells, suggesting that disulfiram works through SNX8.
Claims
1. The use of disulfiram, a small molecule compound, or its pharmaceutical salt in the preparation of drugs for the treatment of lysosomal storage diseases.
2. The application according to claim 1, characterized in that, The small molecule compound disulfiram can increase the expression level of the SNX8 gene.
3. The application according to claim 1, characterized in that, The lysosomal storage disease is Fabry disease, and the primary storage substance is GM2 ganglioside.
4. The application according to claim 1, characterized in that, The lysosomal storage disease is Niemann-Pick type C disease, and the primary storage substance is cholesterol.
5. The application according to claim 1, characterized in that, The lysosomal storage disease is GM2 ganglioside storage disease, and the primary storage substance is glycolipids or polysaccharides containing galactose chains.
6. The application according to claim 1, characterized in that, The lysosomal storage disease is Gaucher disease, and the primary storage substance is glucocerebroside.
7. The application according to claim 1, characterized in that, The drugs mentioned are injections, tablets, or capsules.
8. The application according to claim 7, characterized in that, The injection is an intravenous injection.
9. A drug for treating lysosomal storage diseases, characterized in that, The active ingredient is the small molecule compound disulfiram or its pharmaceutical salt.