Composition for detecting embryonic stem cell exosome and kit thereof

By using cholesterol-labeled probe T and CRISPR-Cas12a cascade signal amplification reaction, combined with Annexin V functionalized particles and DNA nanospheres, the sensitivity and cost issues of embryonic stem cell exosome detection have been resolved, achieving efficient qualitative and quantitative analysis.

CN121852515APending Publication Date: 2026-04-14SHANGHAI STEM CELL TECH +8
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-08
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Current technologies for detecting embryonic stem cell exosomes are susceptible to interference, require advanced experimental techniques and are costly, and involve cumbersome data processing, making it difficult to achieve efficient qualitative and quantitative analysis.

Method used

The study employed cholesterol-labeled probe T, CRISPR-Cas12a-mediated cascade signal amplification reaction, and Annexin V-functionalized particles to capture exosomes. Combined with DNA nanospheres and strand displacement reaction, efficient qualitative and quantitative analysis was achieved through fluorescence signal detection.

Benefits of technology

It significantly improves the sensitivity and accuracy of embryonic stem cell exosome detection, reduces detection costs, and achieves highly specific and efficient qualitative and quantitative analysis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852515A_ABST
    Figure CN121852515A_ABST
Patent Text Reader

Abstract

The invention relates to a composition for detecting embryonic stem cell exosomes. The composition comprises a cholesterol-labeled probe T, crRNA, double-stranded DNA and DNA nanospheres. The DNA nanosphere is composed of a linear template and a primer P nucleic acid chain and contains methylene blue. The crRNA, the double-stranded DNA and the DNA nanospheres are jointly used for a CRISPR-Cas12a mediated cascade signal amplification reaction based on strand displacement, and real-time detection is carried out. Through verification, the composition disclosed by the invention not only can realize high-sensitivity detection of the embryonic stem cell exosome and can be applied to a kit, but also widens the application scene of a nucleic acid nanoprobe and a CRISPR-Cas system in fluorescent biosensing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a composition for detection, and more particularly to a composition suitable for fluorescence detection, enabling qualitative and quantitative detection of embryonic stem cell exosomes, and a detection kit thereof. Background Technology

[0002] Embryonic stem cell exosomes contain abundant bioactive molecules, including proteins, miRNAs, mRNAs, and metabolites. These molecules can be delivered to target cells via paracrine or long-distance transport, regulating the spatiotemporal coordination of cell differentiation, tissue formation, and organogenesis during embryonic development. For example, signaling pathway-related factors such as Wnt and TGF-β in exosomes can influence the fate determination of neighboring cells. Embryonic stem cell exosomes can help recipient cells maintain an undifferentiated state or be reprogrammed into a pluripotent state by delivering specific transcription factors or non-coding RNAs. In addition, embryonic stem cell exosomes also have tissue repair and immune regulation functions; their secretion patterns and changes in contents under abnormal physiological conditions can reflect embryonic developmental defects or disease progression. Phosphatidylserine is a negatively charged phospholipid that is mainly located in the inner membrane layer of the cell membrane under normal physiological conditions. During apoptosis, activation, or exosome formation, phosphatidylserine is everted to the outer membrane surface, becoming one of the characteristic markers of exosomes. Capturing phosphatidylserine from exosomal proteins using phospholipid-binding proteins is based on the characteristic of phosphatidylserine exposure on the exosomal membrane surface. The specific binding of the two proteins enables the efficient enrichment of embryonic stem cell exosomal proteins.

[0003] Embryonic stem cell exosomes are nanoscale extracellular vesicles (30-150 nm) secreted by embryonic stem cells, rich in maternal proteins, mRNA, miRNA, and signaling molecules, serving as key mediators of intercellular communication. Their biological significance is immense: on the one hand, embryonic stem cell exosomes can deliver pluripotency-related factors, regulating the proliferation, differentiation, and tissue regeneration of recipient cells, playing a crucial role in embryonic development and organogenesis; on the other hand, they exhibit potential therapeutic value in regenerative medicine, such as promoting damage repair and reducing immune rejection through paracrine effects, without the risk of tumorigenesis, making them an ideal carrier for cell-free therapy. However, the heterogeneity, low abundance, and interference from complex biological environments of exosomes pose challenges to their capture and quantitative analysis. Developing highly specific separation technologies (such as immunomagnetic beads and microfluidic chips) and highly sensitive detection methods (such as nanoflow cytometry and surface plasmon resonance) can accurately resolve the component and functional associations of exosomes, providing key technical support for disease mechanism research, drug delivery system optimization, and clinical diagnostic biomarker screening, thus promoting their translation from basic research to clinical applications.

[0004] Currently, the detection of embryonic stem cell exosomes is not only susceptible to interference, but also has high experimental technical requirements and costs, and the data processing is cumbersome.

[0005] Fluorescent biosensors are analytical tools that detect target molecules by generating, quenching, or changing the wavelength of fluorescence signals. Their core consists of biorecognition elements (such as antibodies, aptamers, and nucleic acid probes) and fluorescence signal conversion modules (such as fluorescent dyes, quantum dots, and nanomaterials). In the field of exosome detection, fluorescent biosensors have become a research hotspot due to their high sensitivity, dynamic visualization, and multi-parameter analysis capabilities. The combined use of nanosphere probes and signal amplification strategies based on CRISPR-Cas12a trans-cleavage activity can significantly improve the detection sensitivity of exosomes and also has the potential to directly detect complex biological samples. Fluorescence methods, through flexible signal amplification strategies, overcome the sensitivity limitations of traditional exosome detection, providing an efficient tool for early cancer screening, infectious disease diagnosis, and drug delivery research.

[0006] Strand substitution reactions are biochemical processes in which DNA molecules dynamically replace existing base pairs through complementary pairing competition. It is a core tool in DNA nanotechnology and synthetic biology, widely used in molecular computing, biosensing, and nanomachine construction. It achieves signal amplification through complementary pairing of DNA strands and thermodynamically driven self-assembly, eliminating the need for enzyme catalysis and reducing experimental variability caused by enzyme instability. In recent years, due to its advantages of flexible programmability, rapid response, low background interference, low cost, and easy scalability, various biosensors suitable for complex samples (such as blood and saliva) have been developed. CRISPR-Cas12a, a gene-editing tool in the CRISPR-Cas system family, is driving innovation in gene editing, precision medicine, and point-of-care diagnostics technologies with its unique trans-cutting activity and high specificity. CRISPR-Cas12a activates its trans-cutting activity after recognizing target DNA, indiscriminately cutting surrounding single-stranded DNA and achieving exponential signal amplification. Its ultra-high sensitivity, high specificity, and multiplex detection compatibility allow it to be combined with various detection technologies such as fluorescence, colorimetry, and electrochemistry, significantly improving detection performance. Summary of the Invention

[0007] One object of the present invention is to provide a composition for detecting embryonic stem cell exosomes, comprising a plurality of nucleic acid chains, for efficient qualitative detection of embryonic stem cell exosomes.

[0008] One object of the present invention is to provide a composition for detecting embryonic stem cell exosomes, comprising a plurality of nucleic acid chains, for efficient quantitative detection of embryonic stem cell exosomes.

[0009] One object of the present invention is to provide a kit comprising several nucleic acid chains for detecting embryonic stem cell exosomes.

[0010] A composition for detecting embryonic stem cell exosomes, comprising: Cholesterol-labeled probe T, used to capture embryonic stem cell exosomes; crRNA, double-stranded DNA, and DNA nanospheres are used together for strand substitution-based CRISPR-Cas12a-mediated cascade signal amplification reactions. Double-stranded DNA consists of an A strand and a C strand; DNA nanospheres consist of a linear template and primer P nucleic acid strands containing methylene blue (MB).

[0011] The composition of the present invention comprises a nucleic acid sequence in its probe T as follows: 5'- UUAAUGCUAAUCGUGAUAGGGGU -3'. Cholesterol is modified at the 5' end.

[0012] The composition of the present invention comprises the following nucleic acid sequence in its P chain: 5'-GCTACAACGAGCGGACATCTGCTGGTTGAAGGGGAC-3'.

[0013] The composition of the present invention comprises the following nucleic acid sequence in its linear template: 5'-ATGTCCGCTCGTTGTAGCTAGCCTCCCACTATACCCGTCCCCTTCAACCAGCAG-3'. The 5' end is also modified with a phosphate group.

[0014] The composition of the present invention comprises the following nucleic acid sequence in its crRNA: 5'-UAAUUUCUACUAAGUGUAGAUUAUCAAGUUAAUGCUAAUCG-3'.

[0015] The composition of the present invention comprises the following nucleic acid sequence in its A chain: 5'-TACGGCGCTTGGGGATAGTGCTAATCGTAATT-3'.

[0016] The composition of the present invention comprises the following nucleic acid sequence in its C-strand: 5'-CACGATTAGCATTAA-3'.

[0017] The compositions of the present invention also include Annexin V functionalized particles for capturing embryonic stem cell exosomes.

[0018] The composition of the present invention is used to detect embryonic stem cell exosomes, the steps of which include: First, Annexin V functionalized particles (e.g., magnetic beads) are used to capture embryonic stem cell exosomes; Then, a cholesterol-labeled probe T binds to the exosomes of embryonic stem cells; Next, cascaded signal amplification is mediated by chain permutation-based CRISPR-Cas12a; Finally, real-time detection (e.g., fluorescence signal) is performed.

[0019] Qualitative and quantitative detection of embryonic stem cell exosomes is achieved by measuring the intensity of fluorescence signals in the test samples.

[0020] The composition of the present invention is used to prepare a kit for detecting embryonic stem cell exosomes, and also includes an instruction manual which states: Fluorescence detection of embryonic stem cell exosomes utilizes phospholipid-binding protein-functionalized magnetic beads as the capture interface for embryonic stem cells and nanosphere probes as carriers of the fluorescent signal molecule methylene blue. Subsequently, cholesterol probes inserted into the exosome membrane initiate a chain displacement reaction. The reaction product activates the trans-cleavage activity of Cas12a, cleaving the DNA nanospheres encapsulating methylene blue. The analysis of embryonic stem cell exosomes is then achieved through detection of the methylene blue fluorescence signal.

[0021] Protein-functionalized magnetic beads and the CRISPR-Cas system ensured the accuracy and feasibility of this detection, while the combined use of nanosphere probes and the CRISPR-Cas system significantly improved the sensitivity of the detection method. This method is suitable for highly sensitive qualitative and quantitative analysis of embryonic stem cell exosomes (e.g., 10⁻⁶). 4 ~10 7 (1 exosome / mL) detection.

[0022] The steps of CRISPR-Cas12a cascade signal amplification based on chain substitution reaction include: Double-stranded DNA, crRNA (200 nM), 10× reaction buffer, and DNA nanospheres were added to a solution of embryonic stem cell exosome magnetic beads containing probe T (e.g., after mixing, the reaction volume was brought up to 100 μL with DEPC water), and then placed in a metal bath (e.g., 37°C) for reaction (e.g., 1 h) to activate the strand displacement-based CRISPR-Cas12a system.

[0023] After the reaction was completed, the final fluorescence emission intensity of the solution was measured.

[0024] Compared with the prior art, the beneficial effects of the technical solution of the present invention are as follows: Compared to using traditional exosome protein markers (such as CD63, CD81, and CD9) as recognition targets, phosphatidylserine is a more common and more stable surface lipid marker. Its high affinity binding to the phospholipid-binding protein Annexin V ensures efficient exosome capture.

[0025] Chain substitution reactions, as a dynamic nucleic acid molecular tool, have significantly improved the performance of detection systems in the field of biosensing. By designing spontaneous chain substitution cascade reactions, multiple rounds of signal amplification can be achieved without relying on the participation of proteases, thus reducing detection costs.

[0026] By combining the trans-cleavage effect of the CRISPR-Cas12a system with fluorescence sensing technology, biosensing performance has been significantly improved. Furthermore, by incorporating nucleic acid strand displacement reactions, a cascade signal amplification system of "strand displacement reaction-enzyme digestion reaction" was constructed, significantly enhancing the stability, specificity, accuracy, and sensitivity of the detection.

[0027] DNA nanospheres possess extremely high sequence selectivity and probe design flexibility, serving as both highly specific molecular recognition elements and efficient signal amplification elements. The combination of nanosphere probes with CRISPR trans-cleavage activity significantly improves the sensitivity, specificity, and functionality of detection through precise target recognition, cascaded signal amplification, and intelligent controllable release, providing a new approach for the analysis of embryonic stem cell exosomes. Attached Figure Description

[0028] Figure 1 This is a schematic diagram illustrating the principle of detecting embryonic stem cell exosomes in this invention. Figure 2 Electrophoresis image of the amplified sample; Figure 3 The image shows the fluorescence spectrum of the DNA nanospheres. Figure 4 The fluorescence spectra of the CRISPR-Cas12a system before and after DNA nanosphere cleavage are shown. Figure 5 This is a graph showing the results of qualitative detection of embryonic stem cells using the composition of the present invention; Figure 6 This is a graph showing the results of quantitative detection of embryonic stem cells using the composition of the present invention. Detailed Implementation

[0029] The technical solution of the present invention will be described in detail below with reference to the accompanying drawings. The embodiments of the present invention are only used to illustrate the technical solution of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solution of the invention without departing from the spirit and scope of the technical solution of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention.

[0030] Figure 1 This is a schematic diagram illustrating the principle of detecting embryonic stem cell exosomes according to the present invention. The specific method includes: (1) Preparation of protein-functionalized magnetic beads: Annexin V was modified onto the magnetic beads by an amidation reaction between activated carboxylated magnetic beads and phospholipid-binding protein Annexin V to obtain Annexin V protein-functionalized magnetic beads for efficient capture of embryonic stem cell exosomes.

[0031] (2) Capture and labeling of embryonic stem cell exosomes: using Ca 2+ Magnetic beads are modified with the ion-dependent phospholipid-binding protein Annexin V. Phosphatidylserine (PS) residues exposed on the exosome membrane surface bind with high affinity to Annexin V protein on the magnetic beads, thereby enriching embryonic stem cell exosomes on the surface of the magnetic beads. Subsequently, cholesterol-modified probe T inserts into the exosome membrane through hydrophobic interactions between cholesterol and exosome membrane phospholipids. Nucleic acid probes that have not been inserted into exosomes are removed after magnetic separation.

[0032] (3) CRISPR system based on strand displacement reaction: T probes on exosome membranes can trigger nucleic acid strand displacement reactions. Specifically, after the double-stranded nucleic acid probe AC ​​binds to the T strand to form an AT double strand and displaces the C strand, the AT double strand can then activate the trans-cleavage activity of the Cas12a protein and release the T strand immobilized on the exosome to trigger the next round of cyclic strand displacement reaction. The activated CRISPR-Cas12a system non-specifically cleaves DNA nanospheres containing methylene blue signal molecules, releasing the electrical signal molecules into the solution.

[0033] (4) Assembly of DNA nanospheres based on rolling circle amplification: First, primer P is annealed with a linear template and ligated into circular DNA by T4 ligase. Rolling circle amplification is then performed under the action of Phi29 polymerase, and the product contains both single-stranded and double-stranded DNA structures. MB can insert into the base pairs of double-stranded DNA through intercalation, forming a stable binding. This binding hinders the free diffusion of MB, leading to a decrease in its fluorescence signal; while the single-stranded structure of the product can serve as a substrate for CRISPR-Cas12a trans-cleavage activity.

[0034] (5) Fluorescence detection of embryonic stem cell exosomes: When embryonic stem cell exosomes are present in the reaction system, the exosomes can be captured by protein-functionalized magnetic beads. Cholesterol-modified nucleic acid probes can be inserted into the exosome membrane surface, subsequently triggering a strand displacement reaction to activate the trans-cleavage activity of Cas12a. The DNA nanospheres containing the fluorescent signal disintegrate, and a significant fluorescent signal can be detected in the test solution. Therefore, sensitive detection of embryonic stem cell exosomes can be achieved by measuring the fluorescence signal of methylene blue in the test solution.

[0035] (6) When there are no embryonic stem cell exosomes in the reaction system, the added cholesterol probe is free in the detection solution. After being removed by washing, it cannot trigger the strand displacement reaction. The trans-cleavage activity of the CRISPR / Cas system cannot be activated, and the DNA nanospheres with fluorescent signals will not disintegrate. Therefore, no fluorescent signal can be detected in the final reaction system.

[0036] A method for preparing DNA nanospheres, such as: The RCA product is obtained by forming a circular template-primer heterodimer with a linear template (e.g., 2 μM) and a primer (P chain, 4 μM). The MB is then encapsulated into the double-stranded structure of the product to obtain the final product.

[0037] A method for producing double-stranded DNA, such as: DNA strands (A strand, C strand) are placed in a metal bath to form double-stranded DNA (A / C) (e.g., place DNA strands (A strand, C strand) in a metal bath (e.g., 95°C) and react (e.g., 5-10 minutes), then cool to room temperature, and then transfer to a 37°C metal bath to react for 2 hours to form 50 μL of double-stranded DNA (A / C)).

[0038] Example 1 The synthesis and lysis verification of DNA nanospheres based on rolling circle amplification are performed as follows: (a) Preparation of protein-functionalized magnetic beads: First, 100 μL of carboxylated magnetic beads with a concentration of 10 mg / mL was placed in a 1.5 mL centrifuge tube, and 1–1.5 mL of pre-cooled PBS buffer (pH 7.4) was added. The beads were resuspended in a vortex mixer for 30–40 s and then magnetically separated. This washing process was repeated three times. Subsequently, the beads were sonicated in 0.22 M EDC (N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride) / NHS (N-hydroxysuccinimide) solution for 3–5 min to ensure complete dissolution. The washed magnetic beads were resuspended in 500 μL of the above activation solution and activated at room temperature in the dark for 25–30 min. After removing the activation solution by magnetic separation and washing three times with 1 mL of pre-cooled PBS buffer (pH 7.4), the activated magnetic beads were mixed with 10 μL Annexin V (0.25 mg / mL) and incubated in a metal bath at 25°C for 2–2.5 h. Unbound proteins were removed by magnetic washing and the mixture was stored in a refrigerator at 4°C for later use.

[0039] (b) Capture and labeling of embryonic stem cell exosomes: 200 μL of the prepared Annexin V protein-functionalized magnetic beads were mixed with 200 μL of embryonic stem cell exosome solution and incubated at room temperature for 2–2.5 h, with gentle shaking several times during the incubation period. After washing twice with PBS to remove exosomes not captured by the magnetic beads, the captured exosomes were then incubated with 200 μL of cholesterol-labeled probe T (500 nM) at 25 °C for 40–45 min.

[0040] (c) Synthesis of DNA nanospheres based on rolling circle amplification: 2 μM linear template was mixed with 4 μM primer (P strand) and heated in a 95°C metal bath for 3–5 min, followed by slow cooling to room temperature. Then, it was mixed with 400 U / μL T4 DNA ligase in 1× T4 DNA ligase buffer and incubated overnight at 16°C to form a circular template-primer heterodimer. Rolling circle amplification was then performed. Specifically, the above T4 ligation system solution, 1 mM dNTP mixture, and 1 U / μL phi29 DNA polymerase were mixed in 1× phi29 DNA polymerase buffer and incubated in a 30°C metal bath for 4 h. Finally, the product solution was heated at 65°C for 8–10 min to terminate polymerization. After cooling to room temperature, 10 μM MB solution was added to the above RCA product solution and reacted at room temperature for 1 h to encapsulate MB into the double-stranded structure of the product. Finally, the final product was transferred to a 30KD ultrafiltration centrifuge tube, centrifuged at 5000 rpm for 5-10 min to remove unbound MB, and then resuspended in PBS solution for later use.

[0041] (d) In the CRISPR system based on strand displacement reaction, 500 nM DNA strands (A strand and C strand) were placed in a 95°C metal bath for 5-10 minutes and then slowly cooled to room temperature. They were then transferred to a 37°C metal bath for 2 hours to form a 50 μL double-stranded DNA (A strand / C strand) solution. Subsequently, the A / C double-stranded solution, crRNA (200 nM), 10× reaction buffer, and the DNA nanospheres from step (c) were added to the reaction solution from step (b), i.e., exosomes with probe T inserted. The reaction volume was brought up to 100 μL with DEPC water, and then the system was placed in a 37°C metal bath for 1 hour to activate the CRISPR-Cas12a system based on strand displacement. We used agarose gel electrophoresis to verify the formation of the DNA nanospheres. Specifically, 8 μL of each sample was mixed with 2 μL of 5× loading buffer and added to a 2% agarose gel lane. Place the gel in 1×TAE buffer and perform electrophoresis at 80 V for 8-10 min. After all the samples have exited the wells, adjust the voltage to 120 V and continue electrophoresis for 40-45 min. Finally, use a GelDocXR+ System gel imaging system to image and photograph the gel.

[0042] (e) Detection of fluorescence signal: After magnetically removing unbound cholesterol probes from the reaction solution obtained in step (b), a CRISPR system reaction solution based on chain displacement reaction is added to the centrifuge tube according to step (d). After the reaction is completed, the final fluorescence emission intensity of the solution is measured to detect embryonic stem cell exosomes.

[0043] in: The sequence of probe T used in step (b) is as follows: 5'-cholesterol-UUAAUGCUAAUCGUGAUAGGGGU -3'.

[0044] The nucleic acid sequences used in step (c) are as follows: P chain: 5'-GCTACAACGAGCGGACATCTGCTGGTTGAAGGGGAC-3'; Linear template: 5'-Phosphate-ATGTCCGCTCGTTGTAGCTAGCCTCCCACTATACCCGT CCCCTTCAACCAGCAG-3'.

[0045] The DNA sequences used in step (d) are as follows: A chain: 5'-TACGGCGCTTGGGGATAGTGCTAATCGTAATT-3'; C-chain: 5'-CACGATTAGCATTAA-3'; crRNA: 5'-UAAUUUCUACUAAGUGUAGAUUAUCAAGUUAAUGCUAAUCG-3.

[0046] Experimental results are as follows Figure 2 As shown, lanes 1-4 represent the corresponding bands for primer P, linear template, T4 ligation system, and rolling circle amplification product, respectively. Lane 5 corresponds to the case where only the linear template and primer P chain are present, and T4 ligase is absent. Lane 3 indicates the formation of a circular template-primer heterodimer under the action of T4 ligase. Comparing the amplification band in lane 6 (T4 ligation system without dNTPs), the product band in lane 4 indicates the occurrence of the rolling circle amplification reaction and the formation of the amplification product.

[0047] The above results validate the formation of nucleic acid nanospheres, providing conditions for subsequent embedding of fluorescent signal molecules and analysis of embryonic stem cell exosomes.

[0048] The feasibility of encapsulating MB with this DNA nanosphere was verified using fluorescence spectroscopy. The experimental results are as follows: Figure 3 As shown in the figure, curve a represents the fluorescence signal of pure MB, and curve b represents the fluorescence signal after co-incubation of DNA nanospheres and MB. It can be seen that the MB signal is significantly reduced with only a very low emission peak, indicating that MB has successfully embedded itself into the double-stranded bases of the DNA nanospheres. These results collectively demonstrate the successful assembly of DNA nanospheres based on rolling circle amplification and the encapsulation of fluorescent signal molecules, laying the foundation for subsequent fluorescence analysis of embryonic stem cell exosomes.

[0049] The pyrolysis of nanospheres by the CRISPR-Cas12a system was further verified subsequently, and the experimental results are as follows: Figure 4 As shown in the figure, curve a represents the fluorescence signal after co-incubation of DNA nanospheres and MB. The extremely low fluorescence signal intensity indicates that MB has successfully embedded itself into the double-stranded bases of the DNA nanospheres. Curve b represents the fluorescence signal of the solution after adding the CRISPR-Cas12a system. The significantly increased MB signal indicates that the MB molecules encapsulated in the nanospheres have been released into the solution. These results not only further demonstrate the successful assembly of the DNA nanospheres and the encapsulation of fluorescent signal molecules, but also prove the cleavage of the nanospheres by the trans-cleavage activity of Cas12a. This is extremely important for subsequent fluorescence analysis of embryonic stem cell exosomes.

[0050] Example 2 The steps for the fluorescence qualitative detection of embryonic stem cell exosomes are as follows: (a) Preparation of protein-functionalized magnetic beads: First, 100 μL of carboxylated magnetic beads with a concentration of 10 mg / mL was placed in a 1.5 mL centrifuge tube, and 1–1.5 mL of pre-cooled PBS buffer (pH 7.4) was added. The beads were resuspended in a vortex mixer for 30–40 s and then magnetically separated. This washing process was repeated three times. Subsequently, the beads were sonicated in 0.22 M EDC (N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride) / NHS (N-hydroxysuccinimide) solution for 3–5 min to ensure complete dissolution. The washed magnetic beads were resuspended in 500 μL of the above activation solution and activated at room temperature in the dark for 25–30 min. After removing the activation solution by magnetic separation and washing three times with 1 mL of pre-cooled PBS buffer (pH 7.4), the activated magnetic beads were mixed with 10 μL Annexin V (0.25 mg / mL) and incubated in a metal bath at 25°C for 2–2.5 h. Unbound proteins were removed by magnetic washing and the mixture was stored in a refrigerator at 4°C for later use.

[0051] (b) Capture and labeling of embryonic stem cell exosomes: 200 μL of the prepared Annexin V protein-functionalized magnetic beads were mixed with 200 μL of embryonic stem cell exosome solution and incubated at room temperature for 2–2.5 h, with gentle shaking several times during the incubation period. After washing twice with PBS to remove exosomes not captured by the magnetic beads, the captured exosomes were then incubated with 200 μL of cholesterol-labeled probe T (500 nM) at 25 °C for 40–45 min.

[0052] (c) Synthesis of DNA nanospheres based on rolling circle amplification: 2 μM linear template was mixed with 4 μM primer (P strand) and heated in a 95°C metal bath for 3–5 min, followed by slow cooling to room temperature. Then, it was mixed with 400 U / μL T4 DNA ligase in 1× T4 DNA ligase buffer and incubated overnight at 16°C to form a circular template-primer heterodimer. Rolling circle amplification was then performed. Specifically, the above T4 ligation system solution, 1 mM dNTP mixture, and 1 U / μL phi29 DNA polymerase were mixed in 1× phi29 DNA polymerase buffer and incubated in a 30°C metal bath for 4 h. Finally, the product solution was heated at 65°C for 8–10 min to terminate polymerization. After cooling to room temperature, 10 μM MB solution was added to the above RCA product solution and reacted at room temperature for 1 h to encapsulate MB into the double-stranded structure of the product. Finally, the final product was transferred to a 30KD ultrafiltration centrifuge tube, centrifuged at 5000 rpm for 5-10 min to remove unbound MB, and then resuspended in PBS solution for later use.

[0053] (d) In the CRISPR system based on strand displacement reaction, 500 nM DNA strands (A strand and C strand) were placed in a 95°C metal bath for 5-10 minutes and then slowly cooled to room temperature. Subsequently, they were transferred to a 37°C metal bath for 2 hours to form a 50 μL double-stranded DNA (A strand / C strand). Then, the above A / C double-stranded solution, crRNA (200 nM), 10× reaction buffer, and DNA nanospheres from step (c) were added to the reaction solution from step (b), i.e., exosomes with probe T inserted. The reaction volume was brought up to 100 μL with DEPC water, and then placed in a 37°C metal bath for 1 hour to activate the CRISPR-Cas12a system based on strand displacement.

[0054] (e) Detection of fluorescence signal: After magnetically removing unbound cholesterol probes from the reaction solution obtained in step (b), a CRISPR system reaction solution based on chain displacement reaction is added to the centrifuge tube according to step (d). After the reaction is completed, the final fluorescence emission intensity of the solution is measured to detect embryonic stem cell exosomes.

[0055] in: The sequence of probe T used in step (b) is as follows: 5'-cholesterol-UUAAUGCUAAUCGUGAUAGGGGU -3'.

[0056] The nucleic acid sequences used in step (c) are as follows: P chain: 5'-GCTACAACGAGCGGACATCTGCTGGTTGAAGGGGAC-3'; Linear template: 5'-Phosphate-ATGTCCGCTCGTTGTAGCTAGCCTCCCACTATACCCGT CCCCTTCAACCAGCAG-3'.

[0057] The DNA sequences used in step (d) are as follows: A chain: 5'-TACGGCGCTTGGGGATAGTGCTAATCGTAATT-3'; C-chain: 5'-CACGATTAGCATTAA-3'; crRNA: 5'-UAAUUUCUACUAAGUGUAGAUUAUCAAGUUAAUGCUAAUCG-3.

[0058] Experimental results are as follows Figure 5As shown, compared with control system a (without MB), control system b (without cholesterol-modified probe T), and control system c (without embryonic stem cell exosomes), the fluorescence signal intensity of experimental group d was much higher than that of the three control groups, which is in line with expectations.

[0059] The above results indicate that the CRISPR-Cas reaction triggered by the chain displacement reaction can be initiated in the presence of probe T, and a significant fluorescent signal can be detected in the solution, thus enabling the fluorescence qualitative analysis of embryonic stem cells.

[0060] Example 3 The steps for quantitative fluorescence detection of embryonic stem cell exosomes are as follows: (a) Preparation of protein-functionalized magnetic beads: First, 100 μL of carboxylated magnetic beads with a concentration of 10 mg / mL was placed in a 1.5 mL centrifuge tube, and 1 mL of pre-chilled PBS buffer (pH 7.4) was added. The beads were resuspended in a vortex mixer for 30–40 s and then magnetically separated. This washing process was repeated three times. Subsequently, the beads were sonicated in 0.22 M EDC (N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride) / NHS (N-hydroxysuccinimide) solution for 3–5 min to ensure complete dissolution. The washed magnetic beads were resuspended in 500 μL of the above activation solution and activated at room temperature in the dark for 25–30 min. The activation solution was removed by magnetic separation, and the beads were washed three times with 1 mL of pre-chilled PBS buffer (pH 7.4). The activated magnetic beads were then mixed with 10 μL of Annexin V (0.25 mg / mL) and incubated in a metal bath at 25 °C for 2–2.5 h. Unbound proteins were removed by magnetic washing, and the beads were stored at 4 °C for later use.

[0061] (b) Capture and labeling of embryonic stem cell exosomes: 200 μL and 200 μL of Annexin V protein-functionalized magnetic beads prepared above at different concentrations (10... 4 ~10 7 Mix the embryonic stem cell exosome solution (number per ml) and incubate at room temperature for 2–2.5 h, gently shaking several times during this period. Wash twice with PBS to remove exosomes not captured by the magnetic beads, and then incubate the captured exosomes with 200 μL of cholesterol-labeled probe T (500 nM) at 25 °C for 40–45 min.

[0062] (c) Synthesis of DNA nanospheres based on rolling circle amplification: 2 μM linear template was mixed with 4 μM primer (P strand) and heated in a 95°C metal bath for 3–5 min, followed by slow cooling to room temperature. Then, it was mixed with 400 U / μL T4 DNA ligase in 1× T4 DNA ligase buffer and incubated overnight at 16°C to form a circular template-primer heterodimer. Rolling circle amplification was then performed. Specifically, the above T4 ligation system solution, 1 mM dNTP mixture, and 1 U / μL phi29 DNA polymerase were mixed in 1× phi29 DNA polymerase buffer and incubated in a 30°C metal bath for 4 h. Finally, the product solution was heated at 65°C for 8–10 min to terminate polymerization. After cooling to room temperature, 10 μM MB solution was added to the above RCA product solution and reacted at room temperature for 1 h to encapsulate MB into the double-stranded structure of the product. Finally, the final product was transferred to a 30KD ultrafiltration centrifuge tube, centrifuged at 5000 rpm for 5-10 min to remove unbound MB, and then resuspended in PBS solution for later use.

[0063] (d) In the CRISPR system based on strand displacement reaction, 500 nM DNA strands (A strand and C strand) were placed in a 95°C metal bath for 5-10 minutes and then slowly cooled to room temperature. Subsequently, they were transferred to a 37°C metal bath for 2 hours to form a 50 μL double-stranded DNA (A strand / C strand). Then, the above A / C double-stranded solution, crRNA (200 nM), 10× reaction buffer, and DNA nanospheres from step (c) were added to the reaction solution from step (b), i.e., exosomes with probe T inserted. The reaction volume was brought up to 100 μL with DEPC water, and then placed in a 37°C metal bath for 1 hour to activate the CRISPR-Cas12a system based on strand displacement.

[0064] (e) Detection of fluorescence signal: After magnetically removing unbound cholesterol probes from the reaction solution obtained in step (b), a CRISPR system reaction solution based on chain displacement reaction is added to the centrifuge tube according to step (d). After the reaction is completed, the final fluorescence emission intensity of the solution is measured to detect embryonic stem cell exosomes.

[0065] in: The sequence of probe T used in step (b) is as follows: 5'-cholesterol-UUAAUGCUAAUCGUGAUAGGGGU -3'.

[0066] The nucleic acid sequences used in step (c) are as follows: P chain: 5'-GCTACAACGAGCGGACATCTGCTGGTTGAAGGGGAC-3'; Linear template: 5'-Phosphate-ATGTCCGCTCGTTGTAGCTAGCCTCCCACTATACCCGT CCCCTTCAACCAGCAG-3'.

[0067] The DNA sequences used in step (d) are as follows: A chain: 5'-TACGGCGCTTGGGGATAGTGCTAATCGTAATT-3'; C-chain: 5'-CACGATTAGCATTAA-3'; crRNA: 5'-UAAUUUCUACUAAGUGUAGAUUAUCAAGUUAAUGCUAAUCG-3.

[0068] Experimental results are as follows Figure 6 As shown. Based on verifying the feasibility of this fluorescence detection method for analyzing embryonic stem cell exosomes, studies were conducted on exosomes containing different concentrations (10... 4 ~10 7 The fluorescence intensity of the test solution containing exosomes (1 exosome / mL) was measured. Figure 6 As shown, the higher the concentration of exosomes in the sample, the stronger the detected fluorescence signal. This is because more exosomes are captured by phospholipid-binding protein-functionalized magnetic beads, which in turn binds more cholesterol probes to the exosome membrane. This more effectively initiates the chain displacement reaction and the combined signal amplification strategy of CRISPR-Cas12a, resulting in more methylene blue molecules released in the solution and a stronger detected fluorescence signal.

Claims

1. A composition for detecting embryonic stem cell exosomes, comprising: Cholesterol-labeled probe T, used to capture embryonic stem cell exosomes; crRNA, double-stranded DNA, and DNA nanospheres are used together for strand substitution-based CRISPR-Cas12a-mediated cascade signal amplification reactions. Double-stranded DNA consists of an A strand and a C strand; DNA nanospheres consist of a linear template and primer P nucleic acid strands, which contain methylene blue.

2. The composition according to claim 1, characterized in that: The nucleic acid sequence contained in the A chain is as follows: 5'-TACGGCGCTTGGGGATAGTGCTAATCGTAATT-3'; The C-chain contains the following nucleic acid sequence: 5'-CACGATTAGCATTAA-3'.

3. The composition according to claim 1, characterized in that... The nucleic acid sequence contained in crRNA is as follows: 5'-UAAUUUCUACUAAGUGUAGAUUAUCAAGUUAAUGCUAAUCG-3'.

4. The composition according to claim 1, characterized in that... The nucleic acid sequence contained in probe T is as follows: 5'- UUAAUGCUAAUCGUGAUAGGGGU -3'.

5. The composition according to claim 1, characterized in that... The 5' end of probe T is also modified with cholesterol.

6. The composition according to claim 1, characterized in that... DNA nanospheres are prepared by forming a circular template-primer heterodimer from a linear template and primer P chain, and then generating RCA products by rolling circle amplification. Finally, methylene blue is encapsulated into the double-stranded structure of the product.

7. The composition according to claim 1, characterized in that... The linear template contains the following nucleic acid sequences: 5'-ATGTCCGCTCGTTGTAGCTAGCCTCCCACTATACCCGTCCCCTTCAACCAGCAG-3'.

8. The composition according to claim 7, characterized in that... The 5' end of the linear template is also modified with a phosphate group.

9. The use of the composition according to any one of claims 1 to 8 in the preparation of a kit for detecting embryonic stem cell exosomes.

10. A kit for detecting exosomes from embryonic stem cells, characterized in that... The composition includes any one of claims 1 to 8.

11. The kit for detecting embryonic stem cell exosomes according to claim 10, characterized in that... It also includes the instruction manual, which states: The fluorescence detection of embryonic stem cell exosomes uses phospholipid-binding protein-functionalized magnetic beads as the capture interface for embryonic stem cells and nanosphere probes as carriers of the fluorescent signal molecule methylene blue. Subsequently, cholesterol probes inserted into the exosome membrane initiate a chain displacement reaction, and the reaction products activate the trans-cleavage activity of Cas12a to cleave the DNA nanospheres encapsulating methylene blue. The analysis of embryonic stem cell exosomes is then achieved by detecting the fluorescence signal of methylene blue.

12. The kit for detecting exosomes of embryonic stem cells according to claim 10, characterized in that... It also includes the instruction manual, which states: The steps of CRISPR-Cas12a cascade signal amplification based on chain substitution reaction include: Double-stranded DNA, crRNA (200 nM), 10× reaction buffer, and DNA nanospheres were added to a solution of embryonic stem cell exosome magnetic beads containing probe T (e.g., after mixing, the reaction volume was made up to 100 μL with DEPC water), and then placed in a metal bath (e.g., 37°C) for reaction (e.g., 1 h) to activate the strand displacement-based CRISPR-Cas12a system. After the reaction was completed, the final fluorescence emission intensity of the solution was measured.