Core protein loop for targeted killing of CMS2 colon cancer cells and related biological material and application thereof
By constructing a single transcript protein circuit and utilizing chimeric protein design and protease cleavage mechanism, the precision and safety issues in the treatment of CMS2 colon cancer in existing technologies have been solved, achieving highly efficient killing of CMS2 colon cancer cells.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-08
- Publication Date
- 2026-04-24
AI Technical Summary
There is a lack of safe and effective precise targeted therapies for colorectal cancer, especially for CMS2 type colorectal cancer cells. Multi-target therapy has significant side effects, and existing gene circuits are difficult to function stably in the body.
We constructed a single transcript protein circuit that targets and kills CMS2 colon cancer cells, including activating and killing elements. By using chimeric protein design and protease cleavage mechanism, we can kill cells only when the MYC and WNT signaling pathways are activated simultaneously, thus avoiding the impact on normal cells.
It achieves precise targeted killing of CMS2 colon cancer cells, reduces side effects on normal cells, and improves the safety and effectiveness of treatment.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to the core protein circuits that target and kill CMS2 type colon cancer cells and related biomaterials and applications. Background Technology
[0002] Colorectal cancer (carcinoma of the colon and rectum) is a common malignant tumor of the gastrointestinal tract. Early symptoms are often subtle, but as the tumor grows, changes in bowel habits, rectal bleeding, diarrhea, alternating diarrhea and constipation, and localized abdominal pain may appear. In later stages, systemic symptoms such as anemia and weight loss may develop. Its incidence and mortality rates are second only to gastric cancer, esophageal cancer, and primary liver cancer among malignant tumors of the digestive system, posing a serious threat to human health. In the field of tumor molecular classification, colorectal cancer can be divided into four consensus molecular subtypes (CMS), each possessing several unique molecular characteristics. For example, CMS2 colorectal cancer cells are characterized by abnormal activation of the WNT and MYC signaling pathways. Different CMS subtypes of colorectal cancer exhibit significant heterogeneity in prognosis and drug responsiveness. In recent years, although the number of drugs used for targeted therapy of colorectal cancer has increased, most of these drugs only work against a single signaling pathway or a single target. When multi-target therapy is required, combination therapy becomes necessary, which inevitably increases the risk of side effects. Therefore, one of the most pressing challenges in colorectal cancer treatment is the lack of safe and effective precise targeted therapies.
[0003] In the process of natural evolution, in order to maintain survival, cells must sense complex and diverse signals inside and outside the body, complete information processing and perform corresponding functions. The signal transduction pathways that realize this process are composed of molecules that are naturally present in the cell. In the field of synthetic biology, a kind of artificial signal transduction pathway customized based on diagnostic or therapeutic goals has been created by constructing gene circuits. Its core components are biomolecules that have been engineered or designed from scratch. A well-designed gene circuit has a unique function: it can sense tumor-related input signals, accurately identify and eliminate tumor cells while protecting normal cells. The development of this type of gene circuit can be divided into three stages: (1) Single sensor circuit: This circuit consists of only two parts: a sensor element that can sense a single tumor feature and a killing element that is regulated by the sensor. (2) Multi-sensor circuit: It can sense and logically integrate multiple tumor features, which significantly improves the specificity of tumor identification. (3) In order to further enhance the selectivity and stability of gene circuits, researchers have introduced cybernetics principles into the design and added regulatory elements to achieve feedforward regulation function. Customizing gene circuits based on tumor characteristics has become a research hotspot in the field of precision targeted therapy for tumors, demonstrating extremely high scientific research value and clinical application potential.
[0004] The biomolecules that constitute gene circuits are also called biological elements. Most gene circuits contain biological elements that depend on transcriptional and translational regulation, such as synthetic promoters, miRNA binding sites, and riboswitches. These biological elements regulate an entire downstream transcript, and other elements that should not be regulated by these biological elements must be located on different transcripts. Furthermore, the stable functioning of multi-transcriptome gene circuits depends on a certain quantitative relationship between the transcripts. Currently, it is not possible to achieve efficient and required delivery of each transcript in vivo, leading to unstable functioning of multi-transcriptome circuits in the complex in vivo environment and limiting the future clinical translation of related research. Solving this problem requires constructing highly integrated single-transcriptome circuits, and the key to achieving single-transcriptome circuits is to eliminate dependence on transcriptional and translational regulatory elements.
[0005] Protein elements are special biological elements that regulate function only at the post-translational level. Protein circuits are gene circuits composed solely of protein elements. Compared with gene circuits based on transcription and translation regulation, protein circuits have the following advantages: (1) the regulatory process does not involve transcription and translation, and the response speed is fast; (2) they exert a transient therapeutic effect at the protein level and do not cause permanent gene changes; (3) multiple protein elements in a protein circuit can be linked through self-cleaving polypeptide 2A or internal ribosome entry sites (IRES) to form a polycistronic single transcript structure, achieving relatively controllable expression intensity of each protein element and exhibiting excellent integration.
[0006] In summary, gene circuits possess excellent precision targeting capabilities, while protein circuits, compared to gene circuits that rely on transcriptional and translational regulation, exhibit significant advantages in integration, making them more conducive to clinical translation. Therefore, constructing a single-transcript protein circuit capable of targeting and killing CMS2 colon cancer cells has important application value. Summary of the Invention
[0007] The technical problem to be solved by this invention is to provide a core protein circuit (protein complex) for targeted killing of CMS2 type colon cancer cells and its related biomaterials (such as modRNA) and applications.
[0008] In a first aspect, the present invention claims protection for a protein complex that targets and kills CMS2 type colon cancer cells.
[0009] The protein complex for targeting and killing CMS2 colon cancer cells claimed in this invention may include two chimeric proteins (or be composed of two chimeric proteins): an activating element and a killing element. These two chimeric proteins are the core protein complex for targeting and killing CMS2 colon cancer cells.
[0010] In the aforementioned protein complex, the activating element activates the killing element only through cleavage in cells where both the MYC and WNT signaling pathways are activated. CMS2 colorectal cancer is a type of colorectal cancer primarily driven by the aberrant activation of the WNT and MYC signaling pathways.
[0011] The activation elements include NES (nuclear output signal), WNT signaling pathway sensing protein, WDR5 protein, and modified protease A.
[0012] Wherein, the NES is a polypeptide capable of transporting the activating element to the cytoplasm; the WNT signaling pathway sensing protein can degrade the activating element when the WNT signaling pathway is inactivated, and stabilize the activating element when the WNT signaling pathway is activated; the modified protease A is obtained by adding a cleavage site recognition sequence of protease B to the interior of protease A, and adding a leucine zipper CZ to the N-terminus. The modified protease A retains the original cleavage activity of protease A, and loses its cleavage activity after being cleaved by protease B.
[0013] The killing element includes a modified Casp3 protein, a cleavage site recognition sequence of the protein B, a BIN1 protein, and NES.
[0014] The modified Casp3 protein is obtained by adding the cleavage site recognition sequence of protease A between the large and small subunits of the Casp3 protein. In the cytotoxic element, the cleavage site recognition sequence of protease B is located between the modified Casp3 protein and the BIN1 protein. The modified Casp3 protein is activated upon cleavage by protease A; the NES is a polypeptide capable of transporting the activating element to the cytoplasm.
[0015] The protease A and the protease B are two different enzymes that catalyze the hydrolysis of proteins. The protease A can only cleave the substrate when it is co-localized with the substrate, and this co-localization requires the assistance of protein-protein interactions. The protease B can cleave the substrate in a free state.
[0016] Both the WDR5 protein and the BIN1 protein can interact with both Myc and Myc-nick proteins.
[0017] Furthermore, the protein A may be HCVp protease. In one embodiment of the present invention, the protein A is HCVp protease. Further, the recognition sequence of the protein B is 7 amino acids. The protein B can be a TEVp protease, PPVp protease, TVMVp protease, SbMVp protease, or SuMMVp protease. In one embodiment of the present invention, the protein B is a TEVp protease.
[0018] Furthermore, the WNT signaling pathway sensing protein may be a β-catenin protein. In one embodiment of the present invention, the WNT signaling pathway sensing protein is a β-catenin protein.
[0019] Furthermore, in the activation element, the modified protease A is obtained by adding the cleavage site of the TEVp protease (i.e., tevS) to the hinge linking NS4A within the HCVp protease, and adding the leucine zipper CZ to the N-terminus.
[0020] Furthermore, in the activation element, the NES is located at the N-terminus or C-terminus of the chimeric protein. In one embodiment of the invention, the NES is located at the N-terminus of the activation element.
[0021] Furthermore, in the activation element, the WNT signaling pathway sensing protein is linked to the NES and located at the N-terminus or C-terminus of the NES. In one embodiment of the present invention, the WNT signaling pathway sensing protein is linked to the NES in the activation element and located at the C-terminus of the NES.
[0022] Furthermore, in the activation element, the WDR5 protein is linked to the modified protease A, located at the N-terminus or C-terminus of the modified protease A. In one embodiment of the invention, the WDR5 protein is located at the N-terminus of the modified protease A.
[0023] Furthermore, in the killing element, the NES is located at the N-terminus or C-terminus of the chimeric protein; in one embodiment of the invention, the NES is located at the C-terminus of the killing element.
[0024] Furthermore, the amino acid sequence of the leucine zipper CZ is positions 1158-1187 of SEQ ID NO:1.
[0025] In one embodiment of the present invention, the amino acid sequence of the NES in the activation element is shown in positions 1-14 of SEQ ID NO:1. The WNT signaling pathway sensing protein is β-catenin, and its amino acid sequence is shown in positions 27-807 of SEQ ID NO:1. The amino acid sequence of the WDR5 protein is shown in positions 815-1147 of SEQ ID NO:1. The amino acid sequence of the modified protease A is shown in positions 1158-1420 of SEQ ID NO:1. The protease B is a TEVp protease with a cleavage site of tevS, and the amino acid sequence of tevS is shown in positions 1211-1217 of SEQ ID NO:1; the amino acid sequence of the leucine zipper CZ is shown in positions 1158-1187 of SEQ ID NO:1.
[0026] In one embodiment of the present invention, the amino acid sequence of the modified Casp3 protein in the killing element is shown in positions 4-287 of SEQ ID NO:2, wherein the protease A is an HCVp protease with a cleavage site of hcvS, and the amino acid sequence of hcvS is shown in positions 177-186 of SEQ ID NO:2. The protease B is a TEVp protease with a cleavage site of tevS, and the amino acid sequence of tevS is shown in positions 293-299 of SEQ ID NO:2. The amino acid sequence of the BIN1 protein is shown in positions 305-743 of SEQ ID NO:2. The amino acid sequence of the NES is shown in positions 749-757 of SEQ ID NO:2.
[0027] Specifically, the activation element is a chimeric protein composed, from the N-terminus to the C-terminus, of the NES, linker peptide (RSGGGGSGGGGS), the β-catenin protein, linker peptide (EAAAKGS), the WDR5 protein, linker peptide (GGGGSGGGGS), and the modified protease A.
[0028] Specifically, the killing element is a chimeric protein composed, from the N-terminus to the C-terminus, of the modified Casp3 protein, the linker peptide (GGGGS), the cleavage site tevS of the TEVp protease, the linker peptide (GGGGS), the BIN1 protein, the linker peptide (GGGGS), and the NES.
[0029] More specifically, in one embodiment of the present invention, the amino acid sequence of the activating element is shown in SEQ ID NO:1.
[0030] More specifically, in one embodiment of the present invention, the amino acid sequence of the killing element is shown in SEQ ID NO:2.
[0031] Secondly, the present invention claims protection for nucleic acid molecules capable of encoding the protein complex described in the first aspect above.
[0032] The nucleic acid molecule may be RNA (such as mRNA or modRNA) or DNA. Further, the nucleic acid molecule may be a polycistronic modRNA capable of expressing the aforementioned activating element, cytotoxic element, and regulatory element, or a DNA molecule capable of preparing the modRNA.
[0033] Furthermore, the sequence of the modRNA, from the 5' end to the 3' end, includes (or consists of) a 5' UTR, the coding sequence of the activation element, an IRES sequence, the coding sequence of the cytotoxic element, a 3' UTR, and poly(A); wherein the IRES sequence is an IRES sequence with a relative expression intensity of 67-90% (e.g., 83%), with the wild-type IRES expression intensity being 100%.
[0034] More specifically, in the modRNA, the coding sequence of the activating element is shown in positions 58-4335 of SEQ ID NO:3. The IRES sequence is shown in positions 4340-4929 of SEQ ID NO:3. The coding sequence of the killing element is shown in positions 4939-7212 of SEQ ID NO:3.
[0035] In one embodiment of the present invention, the sequence of the modRNA is shown in SEQ ID NO:3. In the sequence, C represents cytidine or 5-methylcytidine (m5c), and T represents uridine or pseudouridine.
[0036] In one embodiment of the invention, the 5' end of the modRNA is capped with an anti-recap structural analog 3'-O-Me-m. 7 G plus a cap.
[0037] Furthermore, the sequence of the DNA molecule is shown in SEQ ID NO:4.
[0038] Further, the DNA molecule is a template DNA containing the Poly(A) sequence required for in vitro transcription, generated by PCR amplification of the plasmid shown in SEQ ID NO:4 using a forward primer containing the T7 promoter (such as Cagtgaattgtaatacgactcactatagggc) and a reverse primer containing Poly(T) (such as TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTACTCAGGCTTTATTCA).
[0039] In one embodiment of the present invention, the modRNA is obtained through in vitro transcription; during the in vitro transcription process, GTP and Anti-Reverse Cap Analog (3'-O-Me-m) are used. 7 G) Replace GTP with a mixture of 1:4 molar ratio, replace CTP with a mixture of 5-methylcytidine triphosphate and CTP in a molar ratio of 1:2, and replace UTP with a mixture of pseudouridine triphosphate and UTP in a molar ratio of 1:2.
[0040] Thirdly, the present invention claims protection for expression cassettes, recombinant vectors, recombinant microorganisms, or recombinant cells containing the DNA molecules described in the second aspect above.
[0041] The expression cassette comprises a promoter, the DNA molecule, and a transcription termination sequence; the promoter is functionally linked to the DNA molecule, and the DNA molecule is linked to the transcription termination sequence.
[0042] The recombinant vector may be a recombinant plasmid carrying the DNA molecule. In one embodiment of the present invention, the recombinant vector is specifically pBb-A-I83-K, the full sequence of which is shown in SEQ ID NO:4.
[0043] The recombinant microorganism may be recombinant Escherichia coli or the like used for propagating / preserving the recombinant plasmid. The recombinant cell may be a recombinant cell used for propagating / preserving the recombinant plasmid.
[0044] Fourthly, the present invention claims protection for the use of the protein complex described in the first aspect above, or the nucleic acid molecule described in the second aspect above, or the expression cassette or recombinant vector or recombinant microorganism or recombinant cell described in the third aspect above in the preparation of a product that targets and kills CMS2 type colon cancer cells.
[0045] In one embodiment of the present invention, the CMS2 type colorectal cancer cells are HCT-116 cells (Reference: Yang, J. and S. Ding, Engineering L7Ae for RNA-Only Delivery Kill SwitchTargeting CMS2 Type Colorectal Cancer Cells. ACS Synth Biol, 2021. 10(5): p.1095-1105.).
[0046] Based on the characteristics of abnormal activation of the WNT and MYC signaling pathways in CMS2 colon cancer cells, this invention constructs a protein circuit capable of single-transcriptosome delivery to target and kill CMS2 colon cancer cells. This circuit can simultaneously sense the status of both WNT and MYC signaling pathways, killing only colon cancer cells with simultaneous activation of both pathways. To make the protein circuit structure more compact and further reduce the difficulty of delivery, this invention proposes a highly coupled chimeric protein design theory and applies this theory to complete the overall design of the protein circuit targeting CMS2 colon cancer cells. The single-transcriptosome delivery protein circuit constructed in this invention can effectively target and kill CMS2 colon cancer cells, providing a safe and effective means for precise targeted therapy of CMS2 colon cancer. Attached Figure Description
[0047] Figure 1 The core protein circuit structure and regulatory mechanism for targeting CMS2 colon cancer cells are shown. A represents the primary structure of the activating element; B represents the primary structure of the cytotoxic element; and C represents the regulatory mechanism of the core protein circuit.
[0048] Figure 2This is an example of the cell reduction index calculation process. A is a histogram of fluorescence signals detected in the mCherry channel of a flow cytometer for untransfected HCT-116 cells; B is a histogram of fluorescence signals detected in the mCherry channel of a flow cytometer for HCT-116 cells transfected only with mCherry modRNA; C is a histogram of fluorescence signals detected in the mCherry channel of a flow cytometer for HCT-116 cells transfected with both mCherry and core loop (IRES relative expression intensity of 13%) modRNAs; the blue and red dashed lines are the Gaussian distribution curves fitted to untransfected and transfected cells, respectively, and the purple dashed line is the sum of the blue and red dashed lines. The light blue area represents the area under the blue dashed line, and the light red area is the total area (gray histogram) minus the area of the light blue area (not the area under the red dashed line); D is the formula for calculating the reduction index.
[0049] Figure 3 This study focuses on the optimization of the core circuit modRNA. A shows a schematic diagram of the core circuit modRNA structure; B compares the killing effect of the core circuit on four different cell types under conditions where the relative expression level of IRES1 is 4-13%.
[0050] Figure 4 This study focuses on the optimization of modRNAs for the core circuit. Specifically, A compares the killing effect of the core circuit on four different cell types under conditions where the relative IRES1 expression level is 45-83%; B compares the killing effect of the core circuit on four different cell types under conditions where the relative IRES1 expression level is 90-100% (wild-type). Detailed Implementation
[0051] Technical terms involved in this invention: MYC protein: a transcription factor belonging to a protein family (including c-MYC, N-MYC, and L-MYC). It regulates the expression of numerous genes, integrates intracellular and extracellular signals, and ultimately determines whether a cell proliferates, differentiates, metabolizes, or undergoes apoptosis. Myc-nick protein is a truncated, cytoplasm-localized fragment of the c-MYC protein.
[0052] Nuclear export signal (NES): A polypeptide that directs the transport of proteins carrying this signal from the nucleus through the nuclear pore complex into the cytoplasm. NES typically consists of 4 to 20 amino acid residues.
[0053] WDR5 (WD repeat-containing protein 5) is a nuclear protein that acts as an important scaffold protein, regulating gene expression and thus influencing cell fate by participating in the assembly of various important protein complexes. WDR5 itself has no enzymatic activity; instead, it serves as an assembly platform or adapter, "pulling" different functional proteins together to form complexes.
[0054] Leucine zipper: a protein dimerization motif (dimer) composed of heptapeptide repeats (i.e., each repeating unit consists of 7 amino acids and the 7th position is leucine), which mediates protein dimerization (homogeneous or heteromeric).
[0055] Casp3 protein, also known as Caspase-3, is a protease that exhibits catalytic activity at a cysteine residue and specifically cleaves target proteins after aspartic acid. It is a heterotetramer composed of two large subunits and two small subunits.
[0056] BIN1 (Bridging Integrator 1) is a multi-domain scaffold protein that senses and induces cell membrane bending. It acts like a "molecular glue" or "platform," bringing together different proteins and lipids to form functional complexes at specific cellular sites.
[0057] HCVp protease: A protein with NS3 / 4A serine protease activity of hepatitis C virus. NS3 / 4A serine protease is a heterodimer formed by NS3 (catalytic subunit) and NS4A (essential cofactor).
[0058] TEVp protease: A protein with tobacco erosion virus protease activity. The tobacco erosion virus protease is a protein that recognizes the sequence Glu-Asn-Leu-Tyr-Phe-Gln- (Gly, Ser, or Ala). It cleaves only between glutamine and glycine (or serine or alanine).
[0059] β-catenin: A protein that mainly functions as a cell-connecting component (a key structural protein on the cell membrane that acts as a cadherin-mediated intercellular adhesion junction) and a signal transduction molecule (inside the cell, it acts as a core signal transducer of the WNT signaling pathway, activating gene transcription after entering the nucleus).
[0060] Polycistronic: This refers to a messenger RNA molecule containing multiple gene sequences encoding proteins (i.e., multiple "cistronic" sequences; cistronic is an older term for gene). These genes are usually functionally related and regulated by the same promoter. This mRNA containing multiple genes can be transcribed simultaneously and then translated into multiple different proteins.
[0061] modRNA is a modified messenger RNA, synthesized in vitro, and is an mRNA molecule in which the nucleotides that make up RNA have been chemically modified. The most common modifications occur at nucleoside bases, especially the replacement of uracil with pseudouracil.
[0062] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0063] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0064] The main experimental methods, primer sequences, and related biological materials involved in the following examples are as follows: 1. Experimental Materials 1.1 Cell lines Human embryonic lung fibroblasts IMR90 (CCL-186), human pancreatic cancer cells IMR90 (CRL-1469), human cervical squamous cell carcinoma cells SiHa (HTB-35), and human colorectal cancer cells (CCL-247) are deposited at the American Type Culture Collection (ATCC).
[0065] IMR90 cells were negative for both WNT and MYC signaling pathways; PANC-1 cells were negative for both WNT and MYC signaling pathways; SiHa cells were positive for (activated) WNT signaling pathways and negative for MYC signaling pathways; HCT-116 cells were positive for both WNT and MYC signaling pathways. Reference: "Yang, J. and S. Ding, Engineering L7Ae for RNA-Only Delivery Kill Switch Targeting CMS2 Type Colorectal Cancer Cells. ACS Synth Biol, 2021. 10(5): p. 1095-1105."
[0066] 1.2 Reagents The Q5 High-Fidelity DNA Polymerase (M0491S) used for PCR reactions was a product of New England Biolabs. The restriction endonucleases DpnI, NheI, KpnI, EcoRI, BglII, BamHI, and XhoI were all products of New England Biolabs. The MegaScript T7 kit is a product of Thermo Fisher Scientific.
[0067] 1.3 Primer sequences (5'-3') (1) Primers used to amplify the pGEM-T Easy vector: KpnI-pGEM-TF: Cacctaaatagcttggcgtaatcat; NheI-pGEM-TR:gttttcccagtcacgacgttGctagcatc.
[0068] (2) Primers used to mutate IRES: mut-IRES90-F: cctttgaaaaacacgGtgataatatggccacaacc; mut-IRES90-R:ccgtgtttttcaaaggaaa; mut-IRES83-F:tgataatatggccacaaccGtggtgagcaagg; mut-IRES83-R:cggttgtggccatattatcatcgtgtttttcaaagg; mut-IRES67-F: GtgataatatggccacaaccGtggtgagcaagg; mut-IRES67-R: cggttgtggccatattatcaccgtgtttttcaaagg; mut-IRES45-F: ttgaaaaacacgatgataatCtggccacaacc; mut-IRES45-R: gattatcatcgtgtttttcaaaggaaa; mut-IRES13-F: CtgataatCtggccacaaccCtggtgagcaagg; mut-IRES13-R: gggttgtggccagattatcagcgtgtttttcaaagg; mut-IRES-09-F: tgataatCtggccacaaccCtggtgagcaagg; mut-IRES-09-R: gggttgtggccagattatcatcgtgtttttcaaagg; mut-IRES-04-F: tgataataCggccacaaccaCggtgagcaagg; mut-IRES-04-R: gtggttgtggccgtattatcatcgtgtttttcaaagg.
[0069] (3) Primers for verifying IRES sequences: T7-promoter: TAATACGACTCACTATAGGG; M13-Reverse: GTCATAGCTGTTTCCTG.
[0070] (4) Primers for amplifying IRES: IRES1-F: acgggtttgccgccagaacacaggGAATTCcgggaAGATCTtaaCCCGCCCCTCTCCCT; IRES-1-100-R: TATTTTCAGAtccCATggtggcgaaCATGGTTGTGGCCATATTATCATC; IRES-1-90-R: TATTTTCAGAtccCATggtggcgaaCATGGTTGTGGCCATATTATCACC; IRES1-83-R: TATTTTCAGAtccCATggtggcgaaCACGGTTGTGGCCATATTATCATC; IRES1-67-R: TATTTTCAGAtccCATggtggcgaaCACGGTTGTGGCCATATTATCACC; IRES1-45-R: TATTTTCAGAtccCATggtggcgaaCATGGTTGTGGCCAGATTATCAT; IRES1-13or09-R: TATTTTCAGAtccCATggtggcgaaCAGGGTTTGTGGCCAGATTATCA; IRES1-04-R: TATTTTCAGAtccCATggtggcgaaCGTGGTTGTGGCCGTATTATC.
[0071] 2. Experimental Methods 2.1 ModRNA Preparation and Transfection (1) The corresponding plasmid was amplified by PCR using a forward primer containing the T7 promoter (Cagtgaattgtaatacgactcactatagggc) and a reverse primer containing Poly(T) (TT ... 7(G) Replace GTP with a mixture of 1:4 molar ratio (the first nucleotide at the 5' end of the modRNA obtained by in vitro transcription is G in the ARCA cap structure. Except for the first G at the 5' end, all G in the RNA chain is provided by the conventional GTP in the mixture. Since ARCA only participates in the initiation of cap formation, subsequent elongation depends on GTP). Replace CTP with a mixture of 5-methylcytidine triphosphate and CTP at a molar ratio of 1:2. Replace UTP with a mixture of pseudouridine triphosphate and UTP at a molar ratio of 1:2. (3) The transcript obtained by in vitro transcription is first treated with Turbo DNase at 37°C for 30 minutes, and then purified with RNeasy MiniElute Cleanup Kit (QIAGEN, catalog number 74204). (4) The purified mRNA is purified again with Antarctic Phosphatase at 37°C for 30 minutes. (6) The purified modRNA is transfected into cells in cell experiments using TransIT-mRNA transfection kit (Mirus Bio, catalog number MIR2225).
[0072] 2.2 Flow cytometry measurement of cell fluorescence The gene circuit and the vector expressing mCherry were introduced into cells. After 24 h, the cells were digested with 0.05% trypsin, neutralized with HBSS containing 2.5 mg / mL BSA, washed three times with PBS, filtered through a 40 μm cell filter, and collected for flow cytometry analysis. Quantitative analysis was performed after collecting fluorescence signals on the flow cytometer to assess circuit function.
[0073] 2.3 Calculation of Cell Reduction Index To calculate the number of cells reduced, we used cells transfected with both modRNA and fluorescent labeling as the experimental group and cells transfected with only one fluorescent label as the negative control. After comparing the two, we calculated the effect of different treatments on the number of cells. We used the number of untransfected cells in each group as an internal standard to normalize the differences between groups. To complete this work, the following steps are required: (1) The logarithmic value of the autofluorescence generated by the control transfected cells in the mCherry detection channel of the flow cytometer is fitted with the equation N0*normcdf(x,m0,k0)*normpdf(x,m0,s0), where m0 is the mean of the Gaussian equation, k0 is the skewness coefficient, and s0 is the standard deviation. In the subsequent bimodal model fitting calculation, these three values are fixed (see Figure 2(A) ;(2)The logarithmic fluorescence values generated in the mCherry detection channel of the experimental group were fitted with the equation N1*normcdf(x,m0,k0)*normpdf(x,m0,s0)+N2*normpdf(x,m2,s2), where N1, N2,m2,s2 are free parameters, and m0,k0,s0 are values fixed in the previous step. The area under the curve of N1*normcdf(x,m0,k0)*normpdf(x,m0,s0) represents the number of untransfected cells (see A). Figure 2 The area a0 of B and Figure 2 (3) The number of untransfected cells is subtracted from the total number to obtain the total number of transfected and surviving cells (see [reference]). Figure 2 The area b0 of B in the middle and Figure 2 In the case of "area b" of C), the number of transfected and surviving cells was standardized using untransfected cells as an internal reference. There were two types of standardized cells: one type was cells that had been introduced with protein circuits (modRNA) and mCherry, and the other type was cells that had only been introduced with mCherry. The ratio of the standardized values of the two types of cells was defined as the cell survival rate. (4) The value obtained by subtracting the cell survival rate from 1 is the cell reduction index. The calculation formula is shown in Figure 2 In the middle D. The higher the cell reduction index value, the more cell death is caused by the gene circuit. A value of 1 represents that the protein circuit causes complete cell death, and a negative value means that the number of cell deaths in the experimental group with the introduction of the protein circuit is lower than that in the control group with only mCherry.
[0074] Example 1: Construction of the core protein circuit for targeted killing of CMS2 colon cancer cells I. Working principle of the core circuitry for targeted killing of CMS2 colon cancer cells The core function of a protein circuit is performed by activating and killing elements, which together constitute the core circuit. Figure 1 To investigate the core protein circuit structure and regulatory mechanism of CMS2 colon cancer cells.
[0075] The activation element is a chimeric protein comprising a nuclear export signal (NES), β-catenin protein, WDR5 protein, and a modified HCVp protease. The NES transports the activation element from the nucleus to the cytoplasm via the nuclear pore complex, ensuring that the activation element can cleave and activate cytotoxic elements in the cytoplasm. The modified HCVp protease is obtained by adding the TEVp protease cleavage site tevS (amino acid sequence ENLYFQS) to the interior of the HCVp protease and adding a leucine zipper CZ to the N-terminus. The modified HCVp protease in the activation element retains the original cleavage activity of the original HCVp protease.
[0076] The cytotoxic element is a chimeric protein comprising NES, a modified Casp3 protein, a TEVp protease cleavage site tevS, and a BIN1 protein. The modified Casp3 protein is obtained by adding the HCVp protease cleavage site hcvS (amino acid sequence DEMEEC) between the large and small subunits of the Casp3 protein. In the cytotoxic element, the TEVp protease cleavage site tevS is located between the modified Casp3 protein and the BIN1 protein.
[0077] In its natural state, the Casp3 protein exists as an inactive prozymogen, regulated by apoptosis signals, and cleaved by endogenous proteases to produce two subunits, one large and one small. These subunits then dimerize to form an activated enzyme, inducing apoptosis. After adding hcvS between the large and small subunits of the Casp3 protein, the modified Casp3 protein is no longer regulated by endogenous proteases and can be cleaved and activated by the modified HCVp protease.
[0078] Activated modified Casp3 protein promotes apoptosis in the cytoplasm. The NES at the C-terminus of the cytotoxic element ensures that the activated modified Casp3 protein is also present in the cytoplasm, promoting apoptosis.
[0079] MYC-positive cells express both c-Myc and Myc-nick proteins. c-Myc protein is primarily located in the nucleus, while Myc-nick protein, a truncated version of c-Myc, is primarily located in the cytoplasm. Both the WDR5 protein in the activating element and the BIN1 protein in the killing element can interact with the c-Myc / Myc-nick proteins.
[0080] The modified HCVp protease requires co-localization with its substrate to effectively cleave it, and this co-localization necessitates protein-protein interactions. Cytoplasm-localized proteins can only interact with another cytoplasm-localized protein. The activating element also contains NES, ensuring its localization in the cytoplasm. When the activating element, the killing element, and the Myc / Myc-nick protein form a ternary complex in the cytoplasm, leading to co-localization of the activating element and the killing element, the activating element cleaves the hcvS in the killing element. The modified Casp3 protein subunits in the killing element then separate and dimerize to form an activated enzyme, inducing apoptosis.
[0081] In MYC-negative cells, the lack of MYC protein prevents the co-localization of the activating element and the cytotoxic element, thus hindering the effective cleavage of the activating element by the cytotoxic element. In the unactivated cytotoxic element, the modified Casp3 protein exists as an inactive zymogen. In WNT-negative cells, the β-catenin protein of the activating element undergoes spontaneous phosphorylation and ubiquitination, mediating the degradation of the entire activating element. Without the regulation of the activating element, the modified Casp3 protein in the cytotoxic element exists as an inactive zymogen.
[0082] Therefore, only cells that are double-positive for both MYC and WNT meet the two conditions of stable presence of the activating element and co-localization with the killing element. In this case, the activating element cleaves and activates the killing element, inducing apoptosis.
[0083] IRES are natural translation enhancers widely found in mRNA, mediating internal translation initiation. Therefore, IRES can be engineered to produce polycistronic expression cassettes similar to those in bacterial operons, driving the translation of several protein-coding sequences located on the same mRNA. The stable functioning of gene circuits depends on specific quantitative relationships between protein elements. Different mutant types of IRES affect the translation efficiency of their downstream protein-coding sequences; this property can be utilized to modulate the expression intensity of protein elements by selecting appropriate IRES.
[0084] The gene circuit constructed in this invention is composed of protein elements and can be introduced via a single-transcript polycistronic modRNA. The core circuit modRNA sequence, from the 5' end to the 3' end, includes: a 5' UTR, an activation element coding sequence, IRES1, a cytotoxic element coding sequence, and a 3' UTR, in that order. IRES1 mediates the translation of the cytotoxic element coding sequence, producing the cytotoxic element protein.
[0085] II. Exploring the optimal proportions of different parts of the core protein circuit when using modRNA delivery. modRNA, as a stable mRNA that can be synthesized in vitro, has low immunogenicity and can be used for gene therapy. This invention explores the optimal ratio of each part of the protein circuit when using the modRNA introduction method to ensure cytotoxic function while reducing non-specific killing. To study the optimal ratio of each part of the protein circuit, this invention constructs a series of plasmids that can transcribe nucleoside-modified messenger RNA (modRNA) of the monocistronic protein circuit in vitro. The modRNA is transfected in cell lines with different WNT and MYC signaling pathway states, and the cell reduction index is calculated.
[0086] The plasmid construction process is as follows: 1. Basic plasmid pBb-mC (where p is short for plasmid, Bb is short for BglBrick, and mC is short for mCherry). pBb-mC can be used to prepare modRNA expressing mCherry protein and is also a target vector for the synthesis of other gene fragments. The construction method of pBb-mC is as follows: (1) Dilute pGEM®-T Easy vector to 1 ng / μL: 0.5 μL of pGEM®-T Easy vector and 24.5 μL of nuclease-free water.
[0087] (2) Prepare the following PCR reaction system: Q5 High-Fidelity 2X Master Mix 25μL; 10μM KpnI-pGEM-TF primer 2.5μL; 10μM NheI-pGEM-TR primer 2.5μL; 1ng / μL pGEM®-T Easy vector 1μL; nuclease-free water 19μL.
[0088] (3) Use the following settings to set the PCR program: 98℃ for 30 seconds; 98℃ for 10 seconds, 65℃ for 20 seconds, 72℃ for 1 minute and 27 seconds, 30 cycles; 72℃ for 2 minutes.
[0089] (4) Take 5 μL of PCR product and check it with 1% agarose gel electrophoresis. The band size should be 2843 bp.
[0090] (5) The reaction was purified using a PCR purification kit, and the DNA was finally washed away with 30 μL of nuclease-free water.
[0091] (6) Prepare the following enzyme digestion system: 1 μg of DNA eluted in step (5); 5 μL of rCutSmart™ Buffer; 1 μL of KpnI-HF® 20,000 units / ml; 1 μL of NheI-HF® 20,000 units / ml; and nuclease-free water to a final volume of 50 μL. Incubate at 37°C for 1 hour. (7) The enzyme digestion product was purified using a PCR purification kit and finally washed with 25 μL of nuclease-free water.
[0092] (8) The gene synthesis fragment containing the T7 promoter, 5' untranslated region, sequence encoding mCherry protein, and 3' untranslated region was ligated between the NheI and KpnI restriction sites of the vector prepared in (7) to obtain the basic plasmid pBb-mC. The full sequence of the pBb-mC plasmid is as follows:
[0093] 2. Activator plasmid pBb-A (A is short for activator).
[0094] To reduce gene synthesis costs, the nucleotide sequence encoding the activation element was split into two fragments, which were then synthesized separately and inserted between the EcoRI and BamHI restriction sites of pBb-mC, named pBb-A1 and pBb-A2.
[0095] The pBb-A1 sequence is as follows:
[0096] The pBb-A2 sequence is as follows:
[0097] The fragment between the BglII and XhoI restriction sites of pBb-A2 was directionally cloned into the space between BamHI and XhoI of pBb-A1, and the resulting plasmid was named pBb-A. pBb-A contains the complete nucleotide sequence encoding the activation element, and the amino acid sequence encoding the activation element is shown in SEQ ID NO:1. Specifically, positions 1-14 are NES, positions 27-807 are the WNT signaling pathway sensor protein β-catenin, positions 815-1147 are the WDR5 protein, and positions 1158-1420 are the modified HCVp protease (positions 1158-1187 are the leucine zipper CZ, and positions 1211-1217 are the TEVp protease cleavage site tevS).
[0098] This embodiment uses the BglBrick-Berkeley Standard method for assembly. This method utilizes the characteristic that ligation after digestion with BglII and BamHI produces matching sticky ends, and that the resulting GGATCT sequence cannot be digested. The plasmid fragment to be modified contains BamHI and XhoI cleavage sites, the pre-sequence of the insert fragment contains BglII cleavage sites, and the post-sequence contains BamHI and XhoI cleavage sites. The vector is digested with BamHI and XhoI, and the insert fragment is digested with BglII and XhoI. After ligation, a new plasmid is generated with the plasmid fragment to be modified preceding the insert fragment, and the GGATCT sequence in between. The newly constructed plasmid retains the sequence containing BamHI and XhoI cleavage sites as the post-sequence after the spliced fragment, so the previous process can be repeated to add more fragments.
[0099] The pBb-A construction method is as follows: (1) Prepare the following enzyme digestion system: 1 μg pBb-A1 plasmid; 3.15 μL NEBuffer™ r; 1 μL BamHI 20,000 units / ml; 1 μL XhoI 20,000 units / ml; add nuclease-free water to 50 μL. Incubate at 37℃ for 1 hour.
[0100] (2) Take 5 μL of the enzyme digestion product from step (1) and check it by 1% agarose gel electrophoresis. The band size should be 5373 bp.
[0101] (3) The enzyme digestion product of step (1) was purified using a PCR purification kit, and the DNA was finally washed away with 25 μL of nuclease-free water.
[0102] (4) Prepare the following enzyme digestion system: 1 μg pBb-A2 plasmid; 3.15 μL NEBuffer™ r; 1 μL BglII 10,000 units / ml; 1 μL XhoI 20,000 units / ml; add nuclease-free water to 50 μL. Incubate at 37℃ for 1 hour.
[0103] (5) Separate all enzyme digestion products from step (4) using 1% agarose gel electrophoresis. Bands of 3019bp and 1921bp should be visible.
[0104] (6) Cut the 1921bp band from step (5), recover it using a DNA gel recovery kit, and finally wash the DNA with 25μL of nuclease-free water.
[0105] (7) Prepare the following ligation system: 2 μL T4 DNA ligase Buffer; 45 ng of DNA eluted in step (3); 48 ng of DNA eluted in step (6); 0.5 μL T4 DNA ligase; add nuclease-free water to a final volume of 10 μL. Incubate overnight at 16°C.
[0106] (8) Take 5 μL of the ligation product from step (7), transform 50 μL of Trans1-T1 clonal competent cells, spread them on LB agar plates containing 100 μg / mL Carbenicillin, and incubate overnight at 37°C until visible colonies are formed.
[0107] (9) Pick several colonies and inoculate them into 4 mL of LB liquid medium containing 100 μg / mL Carbenicillin, and incubate overnight at 37°C.
[0108] (10) Use a plasmid mini preparation kit to extract plasmids from the culture in step (9).
[0109] (11) Prepare the following enzyme digestion system to identify pBb-A. Each plasmid in step (10) corresponds to one enzyme digestion system: 0.4 μg of plasmid extracted in step (10); 2 μL of rCutSmart™ Buffer; 0.4 μL of EcoRI-HF® 20,000 units / ml; 0.4 μL of XhoI 20,000 units / ml; and nuclease-free water to 20 μL.
[0110] (12) Take 20 μL of the enzyme digestion product from step (11) and check it by 1% agarose gel electrophoresis. The correctly constructed pBb-A plasmid should show bands of 4282 bp and 3010 bp.
[0111] 3. Kill element plasmid pBb-K (K is short for kill activation) After the gene encoding the nucleotide sequence of the killing element was synthesized, it was inserted between the EcoRI and BamHI restriction sites of the pBb-mC plasmid and named pBb-K.
[0112] The pBb-K plasmid contains the complete nucleotide sequence encoding the killing element.
[0113] The pBb-K sequence is as follows:
[0114] 4. Construct the IRES plasmid pBb-Ix (I is short for IRES, and x is a number representing the expression intensity relative to wild-type IRES in x%). After synthesizing the wild-type IRES-encoding nucleotide sequence gene, it was inserted between the EcoRI and BamHI restriction sites of the pBb-mC plasmid and named pBb-I100.
[0115] IRES plasmids with different expression intensities were constructed by mutating the nucleotide sequence of pBb-I100: pBb-I04, pBb-I09, pBb-I13, pBb-I45, pBb-I67, pBb-I83, and pBb-I90. The construction method is described below: (1) Prepare the following PCR reaction system. The two digits after mut-IRES in the mutant primers correspond to the two digits after pBb-I in the target IRES plasmid. For example, use mut-IRES04-F and mut-IRES04-R to construct pBb-I04: Q5 High-Fidelity 2× Master Mix 25μL; 10μM mut-IRES04-F primer 2.5μL; 10μM mut-IRES04-R primer 2.5μL; pBb-I100 plasmid 1 ng; nuclease-free water to 50μL.
[0116] (2) Use the following settings to set the PCR program: 98℃ for 30 seconds; 98℃ for 10 seconds, 68℃ for 20 seconds, 72℃ for 1 minute and 51 seconds, 30 cycles; 72℃ for 2 minutes.
[0117] (3) Take 5 μL of PCR product and check it with 1% agarose gel electrophoresis. The band size should be 3655 bp.
[0118] (4) Prepare the following enzyme digestion system: 19.6 μL of PCR product from step (2); 0.4 μL of DpnI 20,000 units / ml. Incubate at 37°C for 1 hour. (5) Take 5 μL of the enzyme digestion product from step (4), transform 50 μL of Trans1-T1 clone competent cells, spread them on LB agar plates containing 100 μg / mL Carbenicillin, and incubate overnight at 37°C until visible colonies are formed.
[0119] (6) Pick several colonies and inoculate them into 4 mL of LB liquid medium containing 100 μg / mL Carbenicillin, and incubate overnight at 37°C.
[0120] (7) Use a plasmid mini preparation kit to extract plasmids from the culture in (6).
[0121] (8) Verify the sequence mutation results by bidirectional sequencing using the T7-promoter and M13-Reverse primers.
[0122] The sequence between the T7-promoter and M13-Reverse primers in pBb-I04 is as follows: gcgaattaagagagaaaagaagagtaagaagaaatataagacaccggtcgaattcatgagatcttaacccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataataCggccacaaccaCggtgagcaaggatcctaactcgagtctagaccttctgcggggcttgccttctggccatgcccttcttctctcccttgcacctgtacctcttggtctttgaataaagcctgagtaggtac CacctaaatagcttggcgtaatcatG。; The sequence between the T7-promoter and the M13-Reverse primer in pBb-I09 is as follows: gcgaattaagagagaaaagaagagtaagaagaaatataagacaccggtcgaattcatgagatcttaacccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataatCtggccacaaccCtggtgagcaaggatcctaactcgagtctagaccttctgcggggcttgccttctggccatgcccttcttctctcccttgcacctgtacctcttggtctttgaataaagcctgagtaggtac Cacctaaatagcttggcgtaatcat。
[0123] The sequence between the T7-promoter and the M13-Reverse primer in pBb-I13 is as follows: gcgaattaagagagaaaagaagagtaagaagaaatataagacaccggtcgaattcatgagatcttaacccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgCtgataatCtggccacaaccCtggtgagcaaggatcctaactcgagtctagaccttctgcggggcttgccttctggccatgcccttcttctctcccttgcacctgtacctcttggtctttgaataaagcctgagtaggtac CacctaaatagcttggcgtaatcatG。
[0124] The sequence between the T7-promoter and the M13-Reverse primer in pBb-I45 is as follows: gcgaattaagagagaaaagaagagtaagaagaaatataagacaccggtcgaattcatgagatcttaacccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataatCtggccacaaccatggtgagcaaggatcctaactcgagtctagaccttctgcggggcttgccttctggccatgcccttcttctctcccttgcacctgtacctcttggtctttgaataaagcctgagtaggtac CacctaaatagcttggcgtaatcatG。
[0125] The sequence between the T7-promoter and the M13-Reverse primer in pBb-I67 is as follows: gcgaattaagagagaaaagaagagtaagaagaaatataagacaccggtcgaattcatgagatcttaacccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacGtgataatatggccacaaccGtggtgagcaaggatcctaactcgagtctagaccttctgcggggcttgccttctggccatgcccttcttctctcccttgcacctgtacctcttggtctttgaataaagcctgagtaggtac CacctaaatagcttggcgtaatcatG。
[0126] The sequence between the T7-promoter and the M13-Reverse primer in pBb-I83 is as follows: gcgaattaagagagaaaagaagagtaagaagaaatataagacaccggtcgaattcatgagatcttaacccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataatatggccacaaccGtggtgagcaaggatcctaactcgagtctagaccttctgcggggcttgccttctggccatgcccttcttctctcccttgcacctgtacctcttggtctttgaataaagcctgagtaggtac CacctaaatagcttggcgtaatcatG。
[0127] The sequence between the T7-promoter and the M13-Reverse primer in pBb-I90 is as follows: gcgaattaagagagaaaagaagagtaagaagaaatataagacaccggtcgaattcatgagatcttaacccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgGtgataatatggccacaaccatggtgagcaaggatcctaactcgagtctagaccttctgcggggcttgccttctggccatgcccttcttctctcccttgcacctgtacctcttggtctttgaataaagcctgagtaggtac CacctaaatagcttggcgtaatcatG。
[0128] 5. Core circuit plasmid pBb-A-Ix-K (x is a number, which controls the expression intensity of the IRES in the killing element table relative to the wild IRES, calculated as x%) The core circuit plasmids are a series of plasmids: pBb-A-I04-K, pBb-A-I09-K, pBb-A-I13-K, pBb-A-I45-K, pBb-A-I67-K, pBb-A-I83-K, pBb-A-I90-K, and pBb-A-I100-K. These plasmids are used to prepare modRNAs expressing the core circuit, and their construction method is described below: (1) Prepare the vector fragment according to the process in (1) to (3) of step 2. Replace the pBb-A1 plasmid with the pBb-A plasmid. The band size should be 7285 bp. The vector fragment needs about 500 ng. Scale up the enzyme digestion system according to the actual results.
[0129] (2) Prepare PCR reaction systems for generating a series of IRES fragments with different transcriptional activities: 25 μL of Q5 High-Fidelity 2× Master Mix; 2.5 μL of 10 μM IRES1-F primer; 2.5 μL of 10 μM IRES1-xR primer; 1 ng of pBb-Ix plasmid; and nuclease-free water to a final volume of 50 μL. The upstream primer is IRES1-F, and the downstream primer is IRES1-xR, where x is an Arabic numeral representing expression intensity. The template is the pBb-Ix plasmid, and the meaning of x is the same as that of x in the downstream primer (Note that the templates used in the construction of pBb-A-I13 and pBb-A-I09 are different, but the downstream primers are both IRES1-13 or 09-R).
[0130] Set up the PCR program using the following conditions: 98℃ for 30 seconds; 98℃ for 10 seconds, 68℃ for 20 seconds, 72℃ for 1 minute and 51 seconds, 30 cycles; 72℃ for 2 minutes.
[0131] (3) After inserting the fragment obtained in step (2) into the pBb-A vector obtained in step (1), the target plasmid pBb-A-Ix is obtained, where x represents the same meaning as x in the downstream primer.
[0132] (4) Prepare the vector fragment according to the process in (1) to (3) of step 2. Digest the pBb-A-Ix plasmid successfully constructed in step (3) with BamHI and XhoI double enzymes, and purify and recover the linearized vector fragment.
[0133] (5) Following the procedure in steps (4) to (6) of step 2, digest the pBb-K plasmid with BglII and XhoI, and recover the insert containing the coding sequence of the killing element. The band size should be 2274 bp.
[0134] (6) The killing element insertion fragment prepared in step (5) is ligated with the pBb-A-Ix vector fragment prepared in step (4) to finally obtain the target plasmid pBb-A-Ix-K.
[0135] The full sequence of the pBb-A-I83-K plasmid is shown in SEQ ID NO:4.
[0136] ModRNAs were prepared using the constructed plasmids and then transfected into cell lines with different WNT and MYC signaling pathway states. As the IRES intensity in the modRNAs increased, the killing ability of the core circuitry increased. When the IRES intensity reached 83%, further increasing the IRES intensity no longer increased the killing effect of the core circuitry on HCT-116, only increasing non-specific killing. Figure 3 , Figure 4 ).
[0137] The experimental results show that the modRNAs arranged in the following order (i.e., modRNAs transcribed in vitro from the pBb-A-I83-K plasmid) exhibit the strongest killing effect against HCT-116 colon cancer cells: HCVp chimeric protein ORF, with an intensity of 83% IRES, and Casp3 chimeric protein. The full sequence of this modRNA is shown in SEQ ID NO:3, where C represents cytidine or 5-methylcytidine (m5c), and T represents uridine or pseudouridine. In this sequence, positions 1-57 are the 5'UTR, positions 58-4335 are the coding sequence of the activating element (encoding the amino acid sequence shown in SEQ ID NO:1), positions 4340-4929 are the IRES1 sequence, positions 4939-7212 are the coding sequence of the killing element (encoding the amino acid sequence shown in SEQ ID NO:2), positions 7213-7325 are the 3'UTR, and positions 7326-7445 are poly(A).
[0138] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. A protein complex that targets and kills CMS2 colon cancer cells, containing activating and killing elements; The activation elements include NES, WNT signaling pathway sensing protein, WDR5 protein, and modified protease A; wherein, The WNT signaling pathway sensing protein is a protein that can degrade the activation element when the WNT signaling pathway is inactivated and stably exist when the WNT signaling pathway is activated; the modified protease A is obtained by adding a cleavage site recognition sequence of protease B to the inside of protease A and adding a leucine zipper CZ to the N-terminus of protease A; the modified protease A retains the original cleavage activity of protease A and loses its cleavage activity after being cleaved by protease B. The killing element comprises a modified Casp3 protein, a cleavage site recognition sequence of the protein B, a BIN1 protein, and NES; wherein the modified Casp3 protein is obtained by adding the cleavage site recognition sequence of the protein A between the large and small subunits of the Casp3 protein; in the killing element, the cleavage site recognition sequence of the protein B is located between the modified Casp3 protein and the BIN1 protein; the modified Casp3 protein is activated after cleavage by the protein A; The protease A and the protease B are two different enzymes that catalyze the hydrolysis of proteins. The protease A can only cleave the substrate when it is co-localized with the substrate, and this co-localization requires the assistance of protein-protein interactions. The protease B can cleave the substrate in a free state.
2. The protein complex according to claim 1, characterized in that: The protein A is HCVp protein; and / or The protein B is TEVp protein; and / or The WNT signaling pathway sensing protein is β-catenin protein.
3. The protein complex according to claim 1 or 2, characterized in that: In the activation element, the modified protease A is obtained by adding the cleavage site tevS of the TEVp protease to the hinge linking NS4A within the HCVp protease, and adding the leucine zipper CZ to the N-terminus. and / or In the activation element, the NES is located at the N-terminus or C-terminus of the chimeric protein; and / or In the activation element, the WNT signaling pathway sensing protein is linked to the NES and located at the N-terminus or C-terminus of the NES; and / or In the activation element, the WDR5 protein is linked to the modified protease A at either the N-terminus or the C-terminus of the modified protease A. and / or In the killing element, the NES is located at the N-terminus or C-terminus of the chimeric protein; and / or In the killing element, the BIN1 protein is linked to the NES and is located at the N-terminus or C-terminus of the NES; and / or The amino acid sequence of the leucine zipper CZ is positions 1158-1187 of SEQ ID NO:
1.
4. The protein complex according to any one of claims 1-3, characterized in that: In the activation element, the amino acid sequence of the NES is shown in positions 1-14 of SEQ ID NO:1; and / or, the amino acid sequence of the WNT signaling pathway sensing protein is shown in positions 27-807 of SEQ ID NO:1; and / or, the amino acid sequence of the WDR5 protein is shown in positions 815-1147 of SEQ ID NO:1; the amino acid sequence of the modified protease A is shown in positions 1158-1420 of SEQ ID NO:
1. and / or In the killing element, the amino acid sequence of the modified Casp3 protein is shown as positions 4-287 of SEQ ID NO:2; and / or, the amino acid sequence of the cleavage site of the protease B is shown as positions 293-299 of SEQ ID NO:2; and / or, the amino acid sequence of the BIN1 protein is shown as positions 305-743 of SEQ ID NO:2; and / or, the amino acid sequence of the NES is shown as positions 749-757 of SEQ ID NO:
2.
5. The protein complex according to any one of claims 1-4, characterized in that: The activation element is a chimeric protein composed, from the N-terminus to the C-terminus, of the NES, RSGGGGSGGGGS linker peptide, the β-catenin protein, EAAAKGS linker peptide, the WDR5 protein, GGGGSGGGGS linker peptide, and the modified protease A. and / or The killing element is a chimeric protein composed, from the N-terminus to the C-terminus, of the modified Casp3 protein, the GGGGS linker peptide, the cleavage site tevS of the TEVp protease, the GGGGS linker peptide, the B1N1 protein, the GGGGS linker peptide, and the NES.
6. The protein complex according to any one of claims 1-5, characterized in that: The amino acid sequence of the activation element is shown in SEQ ID NO:1; and / or The amino acid sequence of the killing element is shown in SEQ ID NO:
2.
7. A nucleic acid molecule capable of encoding any of the protein complexes described in claims 1-6.
8. The nucleic acid molecule according to claim 7, characterized in that: The nucleic acid molecule is a polycistronic modRNA that can express activating elements, killing elements and regulatory elements, or a DNA molecule that can be used to prepare the modRNA; Further, the modRNA sequence includes, from the 5' end to the 3' end, a 5' UTR, a coding sequence for the activation element, an IRES1 sequence, a coding sequence for the killing element, a 3' UTR, and a poly(A); wherein, the IRES sequence is an IRES sequence with a relative expression intensity of 67-90%, with the wild-type IRES expression intensity being 100%; Furthermore, the sequence of the modRNA is shown in SEQ ID NO:3; or Furthermore, the sequence of the DNA molecule is shown in SEQ ID NO:
4.
9. An expression cassette, recombinant vector, recombinant microorganism, or recombinant cell containing the DNA molecule described in claim 8.
10. The use of the protein complex of any one of claims 1-6, the nucleic acid molecule of claim 7 or 8, the expression cassette or recombinant vector of claim 9, or the recombinant microorganism or recombinant cell in the preparation of a product that targets and kills CMS2 type colon cancer cells.
Citation Information
Patent Citations
Targeted protein degradation system and application thereof
CN119487066A
Tumor stem cell targeting plasmid based on logic gating circuit, nano-carrier and preparation method and application of tumor stem cell targeting plasmid
CN119842814A
Inhibitors of the WNT / beta-catenin pathway
US20210371384A1
Tissue-specific cell depletion with two chimeric proteins
WO2015197639A1