Engineering bacterium J9U-PP for co-degrading phenol and p-nitrophenol as well as construction method and application of engineering bacterium J9U-PP

Abstract

The invention provides an engineering bacterium J9U-PP for co-degrading phenol and p-nitrophenol as well as a construction method and application of the engineering bacterium J9U-PP, and belongs to the technical field of genetic engineering. The engineering bacterium J9U-PP is prepared by inserting pheA1, pheA2, pnpA, pnpB, pnpC, pnpD, pnpE and pnpF into the Halomonas craagoides J9U. The engineering bacterium J9U-PP not only can stably express a phenol degradation gene and a PNP degradation gene, but also can efficiently degrade one or more of phenol, catechol, hydroquinone and p-nitrophenol, and when the engineering bacterium J9U-PP singly degrades samples containing degraded phenol, catechol, hydroquinone and p-nitrophenol, the degradation efficiency reaches up to 100%. And the engineering bacterium J9U-PP shows excellent effect and competitiveness of degrading phenol and p-nitrophenol under a high-salt condition, and has good potential in in-situ bioremediation of a polluted environment.

Description

An engineered bacterium, J9U-PP, for co-degrading phenol and p-nitrophenol, its construction method, and its application. Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to an engineered bacterium J9U-PP that co-degrades phenol and p-nitrophenol, its construction method and application. Background Technology

[0002] A large amount of phenol-containing wastewater is generated globally each year, characterized by high salinity and the coexistence of phenolic compounds. Phenol and its derivative p-nitrophenol (PNP) are toxic to higher organisms even at low doses and are frequently detected simultaneously in phenol-containing wastewater. The combined toxicity of phenol and PNP, as well as the accidental discharge of phenol-containing wastewater, poses a significant threat to human health. Physicochemical methods for wastewater treatment suffer from drawbacks such as the addition of toxic compounds and high energy consumption. In contrast, biodegradation is considered a cost-effective, environmentally friendly, and sustainable wastewater treatment technology. However, in high-salinity phenol-containing wastewater, high osmotic pressure severely inhibits the biodegradation capacity of activated sludge microbial communities.

[0003] To overcome this bottleneck, researchers explored the use of halophilic microorganisms to remove phenolic compounds from high-salinity wastewater. The salt-tolerant Candida tropicalis SDP-1 can effectively degrade phenol at NaCl concentrations of 0–50 g / L, utilizing several phenol derivatives as its sole carbon source for growth. Currently, many bacteria have been shown to have the ability to degrade phenol in high-salinity environments. A recombinant Rhodococcus erythropolis strain overexpressing phenol catabolism genes was constructed, enhancing its phenol biodegradation capacity and further demonstrating the potential of recombinant strains for the bioremediation of phenol-containing wastewater. To date, no microorganisms capable of simultaneously degrading phenol and PNP in high-salinity environments have been reported. Summary of the Invention

[0004] Therefore, the purpose of this invention is to provide an engineered bacterium J9U-PP that co-degrades phenol and p-nitrophenol, its construction method, and its application.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: The present invention provides an engineered bacterium J9U-PP that co-degrades phenol and p-nitrophenol, wherein the engineered bacterium J9U-PP comprises phenol degradation genes and PNP degradation genes inserted into Halomonas elegans J9U; the phenol degradation genes are pheA1 and pheA2; the PNP degradation genes are pnpA, pnpB, pnpC, pnpD, pnpE and pnpF.

[0006] The present invention does not have any particular limitation on the source of Halomonas clamoritidis J9U. It can be obtained by using Halomonas clamoritidis J9U or preparation methods known in the art, such as the method for preparing Halomonas clamoritidis J9U shown in CN 117802027 A.

[0007] In this invention, as a preferred embodiment, the engineered bacterium J9U-PP further includes the insertion of the gfp gene into *Haloxylon ammodendron* J9U. Therefore, the engineered bacterium J9U-PP consists of *Haloxylon ammodendron* J9U with the pnpA, pnpB, pnpC, pnpD, pnpE, pnpF, pheA1, pheA2, and gfp genes inserted. When the engineered bacterium J9U-PP is released into the wastewater environment using the gfp gene marker inserted into it, it can be tracked by fluorescence.

[0008] In this invention, a promoter is inserted upstream of the phenol degradation gene or the phenol degradation gene; a promoter is inserted upstream of the gfp gene, preferably P15, and the nucleotide sequence of P15 is the sequence from position 1 to 280 shown in SEQ ID NO.1.

[0009] This invention provides a method for constructing the above-mentioned engineered bacterium J9U-PP, comprising the following steps: obtaining a phenol degradation gene containing a promoter and homologous arm sequences by overlapping PCR of the promoter, the phenol degradation gene, and the upstream and downstream homologous arm sequences of the phenol degradation gene; obtaining a PNP degradation gene containing a promoter and homologous arm sequences by overlapping PCR of the promoter, the PNP degradation gene, and the upstream and downstream homologous arm sequences of the phenol degradation gene; and transferring the phenol degradation gene containing the promoter and homologous arm sequences and the PNP degradation gene containing the promoter and homologous arm sequences into *Haloxylon ammodendron* J9U via homologous recombination using the pKJU vector to obtain the engineered bacterium J9U-PP.

[0010] In this invention, there is no particular limitation on the method of overlapping PCR; any method known in the art can be used.

[0011] In this invention, using the pKJU vector, phenol degradation genes containing promoter and homologous arm sequences, as well as PNP degradation genes containing promoter and homologous arm sequences, are transferred into *Haloxylon ammodendron* J9U via homologous recombination to obtain the engineered bacterium J9U-PP. The phenol degradation genes containing promoter and homologous arm sequences are P15-pheA1 and P15-pheA2; the PNP degradation genes containing promoter and homologous arm sequences are P15-pnpAB, P15-pnpCD, P15-pnpE, and P15-pnpF; and P15-pheA1 is obtained by converting the upstream homologous arm sequence of pheA1, SEQ ID NO, and P15-pheA2 into P15-pheA1. The sequence shown in NO.1, the pheA1 sequence, and the downstream homologous arm sequence of pheA1 are sequentially tandem. The upstream homologous arm sequence of pheA1 is the sequence shown at positions 2824629-2825294 of the reference genome of *Haloxylon ammodendron* strain J9, and the downstream homologous arm sequence is the sequence shown at positions 2825295-2825960 of the reference genome of *Haloxylon ammodendron* strain J9. The pheA1 sequence is the sequence shown at positions 1872-3500 in GenBank accession number AJ973228.1. P15-pheA2 is obtained by tandem the upstream homologous arm sequence of pheA2, SEQ ID NO.1, and pheA1. The sequence shown in NO.1, the pheA2 sequence, and the downstream homologous arm sequence of pheA2 are sequentially tandemly; the upstream homologous arm sequence of pheA2 is the sequence shown at positions 2822008-2822265 of the reference genome of *Haloxylon ammodendron* strain J9, and the downstream homologous arm sequence is the sequence shown at positions 2822626-2823243 of the reference genome of *Haloxylon ammodendron* strain J9; the pheA2 sequence is the sequence shown at positions 1291-1860 of GenBank accession number AJ973228.1; P15-pnpAB is obtained by tandemly connecting the upstream homologous arm sequence of pnpAB, SEQ ID NO.1, and SEQ ID NO.1. The sequence shown in NO.1, the pnpA sequence, the RBS sequence, the pnpB sequence, and the downstream homologous arm sequence of pnpAB are sequentially tandem. The upstream homologous arm sequence of pnpAB is the sequence shown at positions 3835003-3835668 of the reference genome of *Haloxylon ammodendron* strain J9, and the downstream homologous arm sequence is the sequence shown at positions 3834461-3834960 of the reference genome of *Haloxylon ammodendron* strain J9. The pnpA sequence is the sequence shown at positions 2824-4035 in GenBank accession number EF577044.1. The pnpB sequence is the sequence shown at positions 4370-4993 in GenBank accession number EF577044.1. P15-pnpCD is obtained by tandem the upstream homologous arm sequence of pnpCD and SEQ ID NO.The sequence shown in Figure 1, the pnpC sequence, the RBS sequence, the pnpD sequence, and the downstream homologous arm sequence of pnpCD are sequentially tandemly; the upstream homologous arm sequence of pnpCD is the sequence shown at positions 4454-4993 of the reference genome of Pseudomonas sp. WBC-3, and the downstream homologous arm sequence is the sequence shown at positions 3834264-3834888 of the reference genome of Halomonas J9; the pnpC sequence is the sequence shown at positions 11110-11604 of GenBank accession number EF577044.1; the pnpD sequence is the sequence shown at positions 10039-11058 of GenBank accession number EF577044.1; P15-pnpE is obtained by tandemly connecting the upstream homologous arm sequence of pnpE, SEQ ID, and SEQ ID. The sequence shown in NO.1, the pnpE sequence, and the downstream homologous arm sequence of pnpE are sequentially tandem. The upstream homologous arm sequence of pnpE is the sequence shown at positions 3150121-3150799 of the reference genome of *Haloxylon ammodendron* strain J9, and the downstream homologous arm sequence is the sequence shown at positions 3150842-3151478 of the reference genome of *Haloxylon ammodendron* strain J9. The pnpE sequence is the sequence shown at positions 8481-9944 of GenBank accession number EF577044.1. P15-pnpF is obtained by tandem the upstream homologous arm sequence of pnpF, SEQ ID NO.1, and pnpE. The sequence shown in NO.1, the pnpF sequence, and the downstream homologous arm sequence of pnpF are sequentially tandemly obtained; the upstream homologous arm sequence of pnpF is the sequence shown at positions 9365-9944 of the reference genome of Pseudomonas sp. WBC-3, and the downstream homologous arm sequence is the sequence shown at positions 3150842-3151478 of the reference genome of Halomonas J9; the pnpF sequence is the sequence shown at positions 7406-8472 of GenBank accession number EF577044.1; the reference genome of Halomonas J9 is the sequence shown in GenBank accession number CP094345.1; the reference genome of Pseudomonas sp. WBC-3 is the sequence shown in GenBank accession number EF577044.1. The RBS sequence (5'-3') is TAAGGAGGTTTTCTA (SEQ ID NO.54).

[0012] In this invention, as a preferred embodiment, the method further includes using the pKJU vector to transfer the gfp gene into *Halomonas extrins* J9U via homologous recombination. Preferably, the gfp gene is obtained by overlapping PCR of the promoter, the gfp gene itself, and the upstream and downstream homologous arm sequences of the gfp gene. The gfp gene containing the promoter and homologous arm sequences is P15-gfp; P15-gfp is obtained by sequentially tandemly connecting the upstream homologous arm sequence of gfp, the sequence shown in SEQ ID NO. 1, the gfp sequence, and the downstream homologous arm sequence of gfp; the gfp sequence is the sequence shown at positions 675-1394 in GenBank accession number U57609.1, the upstream homologous arm sequence of gfp is shown in SEQ ID NO. 2, and the downstream homologous arm sequence of gfp is shown in SEQ ID NO. 3. This invention utilizes the upstream and downstream homologous arm sequences of pnpAB, pnpCD, pnpE, pnpF, pheA1, pheA2, and gfp to ensure that pnpAB, pnpCD, pnpE, pnpF, pheA1, pheA2, and gfp undergo precise and specific homologous recombination at the target sites of the Halomonas demigodius J9U genome, thereby achieving site-specific integration of each gene.

[0013] In this invention, the preferred construction method includes the following steps: ligating P15-pheA1, P15-pheA2, P15-pnpAB, P15-pnpCD, P15-pnpE, P15-pnpF, and P15-gfp to the enzyme-digested pKJU vector to obtain a pKJU recombinant vector; transforming the pKJU recombinant vector into *Haloxymonas despicatrum* J9U via conjugation transformation; selecting recombinants that have undergone the first single crossover using kanamycin resistance screening; and further screening the recombinants in 5-Fu medium to obtain a strain with the target gene inserted after the second crossover, named the engineered strain J9U-PP. The enzyme-digested pKJU vector is obtained by digesting the pKJU vector with the EcoRI restriction endonuclease. This invention does not specifically limit the source of the pKJU vector; it can be constructed using pKJU vectors or preparation methods known in the art, such as the pKJU vector construction method shown in CN 117802027 A. In this invention, the pKJU recombinant vector is a recombinant vector containing P15-pheA1, a recombinant vector containing P15-pheA2, a recombinant vector containing P15-pnpAB, a recombinant vector containing P15-pnpCD, a recombinant vector containing P15-pnpE, a recombinant vector containing P15-pnpF, and a recombinant vector containing P15-gfp, respectively named pKJU-P15pheA1, pKJU-P15pheA2, pKJU-P15pnpAB, pKJU-P15pnpCD, pKJU-P15pnpE, pKJU-P15pnpF, and pKJU-P15gfp. In this invention, the conjugation transformation method utilizes E. coli S17-1 λpir as the donor bacterium and H. cupidaJ9U as the recipient bacterium, employing an amphiphilic conjugation mode to achieve plasmid transfer between the two. In this invention, pKJU-P15pnpAB, pKJU-P15pnpCD, pKJU-P15pnpE, pKJU-P15pnpF, pKJU-P15pheA1, pKJU-P15pheA2, and pKJU-P15gfp are sequentially transformed into H. cupidaJ9U receptor cells using a conjugation transformation method.

[0014] In this invention, the engineered bacterium J9U-PP includes a phenol degradation gene containing a promoter and homologous arm sequences, and a PNP degradation gene containing a promoter and homologous arm sequences inserted into *Haloxylon ammodendron* J9U. The phenol degradation genes containing promoter and homologous arm sequences are P15-pheA1 and P15-pheA2; the PNP degradation genes containing promoter and homologous arm sequences are P15-pnpAB, P15-pnpCD, P15-pnpE, and P15-pnpF. The engineered bacterium J9U-PP also includes a gfp gene containing a promoter and homologous arm sequences, P15-gfp, inserted into *Haloxylon ammodendron* J9U. The sequences of P15-pheA1, P15-pheA2, P15-pnpAB, P15-pnpCD, P15-pnpE, P15-pnpF, and P15-gfp are as described above and will not be repeated here.

[0015] In this invention, the engineered bacterium J9U-PP constructed by this invention can stably express the genes pheA1, pheA2, pnpA, pnpB, pnpC, pnpD, pnpE, pnpF, and gfp even after multiple passages (e.g., more than 18 generations). Furthermore, it can efficiently degrade one or more of phenol, p-nitrophenol, hydroquinone, and catechol. When only one of these three compounds is present in the sample, the degradation efficiency of p-phenol, p-nitrophenol, and catechol in this invention reaches 100%. When degrading phenol alone in a sample, complete degradation can be achieved within 24 hours. When degrading catechol alone, complete degradation can be achieved within 6 hours. When degrading p-nitrophenol alone, complete degradation can be achieved within 1 hour; when degrading hydroquinone alone, complete degradation can be achieved within 9 hours. When phenol and p-nitrophenol are present in the sample, simultaneous degradation can achieve complete degradation. The engineered bacterium J9U-PP exhibited excellent efficiency and competitiveness in degrading phenol and p-nitrophenol under high-salt conditions, demonstrating promising potential for in-situ bioremediation of contaminated environments. The samples included wastewater, such as wastewater containing one or more of phenol, p-nitrophenol, hydroquinone, and catechol.

[0016] The present invention provides an application of the above-mentioned engineered bacteria J9U-PP or the engineered bacteria J9U-PP obtained by the construction method in at least one of the following: (1) degrading one or more of phenol, p-nitrophenol, hydroquinone and catechol; (2) preparing products that degrade one or more of phenol, p-nitrophenol, hydroquinone and catechol; (3) degrading one or more of phenol, p-nitrophenol, hydroquinone and catechol in high-salt wastewater.

[0017] In this invention, the high-salt wastewater is wastewater containing sodium chloride at a final concentration of 60 g / L or more, specifically wastewater containing sodium chloride at a final concentration of 60-100 g / L, such as wastewater containing sodium chloride at a final concentration of 60 g / L or wastewater containing sodium chloride at a final concentration of 100 g / L.

[0018] Compared with existing technologies, the present invention has the following beneficial effects: The present invention provides an engineered bacterium J9U-PP for co-degrading phenol and p-nitrophenol, its construction method, and its applications. The engineered bacterium J9U-PP of the present invention can not only stably express phenol degradation genes and PNP degradation genes, but also efficiently degrade one or more of phenol, catechol, hydroquinone, and p-nitrophenol. When individually degrading samples containing phenol, catechol, hydroquinone, and p-nitrophenol, the degradation efficiency is as high as 100%. Furthermore, the engineered bacterium J9U-PP exhibits excellent efficiency and competitiveness in degrading phenol and p-nitrophenol under high-salt conditions, showing good potential in in-situ bioremediation of polluted environments. Attached Figure Description

[0019] Figure 1 shows the insertion sites of the phenol-degrading gene and the PNP-degrading gene in H. cupida J9U; Figure 2 shows the electrophoretic detection results of the phenol and PNP-degrading genes and gfp in the genome of the engineered bacterium J9U-PP, M: Marker III; 1-9 represent the electrophoretic detection results of pnpA, pnpB, pnpC, pnpD, pnpE, pnpF, gfp, pheA1, and pheA2, respectively; Figure 3 shows the transcription status of nine exogenous genes in H. cupida J9U-PP detected by RT-PCR, A-I are the transcription status of exogenous genes pnpA, pnpB, pnpC, pnpD, pnpE, pnpF, gfp, pheA1, and pheA2 in H. cupida J9U-PP detected by RT-PCR, respectively. In lanes A-I, M represents the molecular weight standard marker. III, 1~4 represent different PCR reaction templates, namely cDNA, genomic DNA, mRNA and ddH2O, respectively; Figure 4 shows the results of the growth performance determination of J9U-PP, A is the comparison of the growth curves of H. cupidaJ9 and J9U-PP in LB60 liquid medium or MMG60 liquid medium, respectively, and B is H.The comparison of the maximum specific growth rates of cupidaJ9 and J9U-PP in LB60 liquid medium and MMG60 liquid medium, respectively; Figure 5 shows the PCR detection of phenol and PNP degradation genes in the engineered strain J9U-PP after 18 generations of culture in LB60 and MMG60 medium, respectively. A shows the PCR detection of phenol and PNP degradation genes in engineered strain J9U-PP in LB60 medium, with lane M representing Marker III; lanes 1-9: pnpA, pnpB, pnpC, pnpD, pnpE, pnpF, gfp, pheA1, and pheA2, respectively; B shows the PCR detection of phenol and PNP degradation genes in engineered strain J9U-PP in MMG60 medium, with lane M representing Marker III. III; Lanes 1-9: pnpA, pnpB, pnpC, pnpD, pnpE, pnpF, gfp, pheA1, and pheA2, respectively; Figure 6 shows the HPLC analysis results of the degradation of catechol by engineered strain J9U-PP at 37℃ for different culture times; Figure 7 shows the HPLC analysis results of the degradation of phenol by engineered strain J9U-PP at 37℃ for different culture times; Figure 8 shows the HPLC analysis results of the degradation of phenol by engineered strain J9U-PP at 30℃ for different culture times; Figure 9 shows the GC analysis results of the degradation of 25 mg / L PNP by engineered strain J9U-PP at different culture times; Figure 10 shows the GC analysis results of the degradation of 50 mg / L PNP by engineered strain J9U-PP at different culture times; Figure 11 shows the GC analysis results of the degradation of 100 mg / L PNP by engineered strain J9U-PP at different culture times; Figure 12 shows the degradation of 25 mg / L PNP by strain J9U. GC analysis results of PNP; Figure 13 shows the stable isotope analysis results of mineralized phenol and PNP by strain J9U-PP, where A represents the effect of strain J9U-PP on 25 mg / L MMG60. 13 C6-phenol mineralization results, B represents the effect of strain J9U-PP on 25 mg / L MMG60. 13 The results of C6-PNP mineralization, where C represents the effect of strain J9U-PP on 25 mg / L MMG100. 13 The results of C6-Phenol mineralization, D represents 25 mg / L of MMG100. 13 The results of C6-PNP mineralization; Figure 14 shows the degradation effect of strain J9U-PP in wastewater. A shows the degradation results of phenol in wastewater culture medium a by strain J9U-PP; B shows the degradation results of PNP in wastewater culture medium b by strain J9U-PP; C shows the co-degradation results of phenol and PNP in wastewater culture medium c by strain J9U-PP in wastewater; D shows the degradation results of phenol and PNP in wastewater containing 60 g / L NaCl in river water. 13 C6-phenol and 13C6-PNP co-degradation results, E represents river water containing 100 g / L NaCl. 13 C6-phenol and 13 The results of C6-PNP co-degradation; Figure 15 shows the fluorescence intensity of gfp in engineered strain J9U-PP measured by confocal microscopy, where A represents red fluorescence on the cell membrane; B represents green fluorescence inside the cell; and C represents the superimposed image of fluorescence patterns A and B. Detailed Implementation

[0020] In this invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0021] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0022] In the following embodiments, the halomonas J9U was prepared according to the method for constructing halomonas J9U and its derivatives, PHA preparation method and application (CN 117802027 A) Example 1. The construction of the pKJU vector is described in Example 2 of the patent CN 117802027 A.

[0023] The benzene ring has isotopes 13 C ( 13 C6-Phenol-labeled phenol was purchased from Shanghai Zhenzhun Biotechnology Co., Ltd., China, catalog number IR-71936. Isotopes 13 The C-marked PNP was purchased from Merck Shanghai, China, product number 768499.

[0024] The LB medium is prepared by weighing 25.0 g of LB Mix, adding 1 L of distilled water, and adjusting the pH to 9.0 with NaOH solution. For solid LB medium, add 2.0% agar powder (g / mL) to the above mixture. Autoclave at 121℃ for 20 min, then store at room temperature for later use.

[0025] LB60 liquid medium: Take 25.0 g LB Mix, add 60 g NaCl, and add 1 L distilled water. Adjust the pH to 9.0 with NaOH, and autoclave at 121℃ for 20 min to obtain LB60 liquid medium.

[0026] Inorganic salt medium (MMG60): Weigh 0.2 g yeast extract, 1.5 g KH2PO4, 9.65 g Na2HPO4·12H2O, and 60 g NaCl. Add 1 L of distilled water and adjust the pH to 9.0 with NaOH solution. Autoclave at 121℃ for 20 min, then store at room temperature for later use. When using, add NH4Cl and MgSO4 solutions at working concentrations of 2 g / L and 0.2 g / L, respectively. For every 100 mL of MMG60 medium, add 100 μL of trace element I and 10 μL of trace element II. Finally, add a 0.4% glucose solution. The 0.4% glucose solution is 0.4 g of glucose added to 100 mL of MMG60 medium.

[0027] MMG100 medium: Add 40 g NaCl to the MMG60 medium.

[0028] Trace element I: CaCl2 2 g / L, ferric ammonium citrate 5 g / L, dissolved in 1M HCl.

[0029] Trace element II: Zinc sulfate heptahydrate 0.1 g / L; boric acid 0.3 g / L; copper sulfate pentahydrate 0.1 g / L; manganese chloride tetrahydrate 0.03 g / L; nickel chloride hexahydrate 0.02 g / L; cobalt chloride hexahydrate 0.02 g / L; sodium aluminate dihydrate 0.03 g / L. The solution was dissolved in 1 M HCl, and the pH was adjusted to 9.0 with NaOH solution. Finally, the solution was filtered through a sterile membrane with a pore size of 0.22 μm to remove bacteria.

[0030] Glucose solution: Weigh 40 g of glucose and dissolve it completely in 100 mL of distilled water, then sterilize at 115℃ for 30 min.

[0031] Example 11.1 A method for constructing an engineered bacterium J9U-PP that co-degrades phenol and p-nitrophenol (PNP), the steps of which are as follows: In this example, the exogenous gene of the PNP biodegradation pathway and the key gene of the phenol biodegradation pathway are assembled into the upp deletion mutant J9U of H. cupidaJ9 (Haloxymonas J9U), and an engineered bacterium J9U (also known as a multifunctional degrader) that simultaneously degrades phenol and PNP is constructed. The detailed information of the exogenous gene and the location of its insertion into Haloxymonas J9U is shown in Table 1.

[0032] Table 1. Detailed information on exogenous genes and their chromosomal loci.

[0033] (1) Construction of recombinant gene vectors (also known as recombinant plasmids) pKJU-P15pnpAB, pKJU-P15pnpCD, pKJU-P15pnpE, pKJU-P15pnpF, pKJU-P15pheA1, pKJU-P15pheA2 and pKJU-P15gfp: S1. Gene amplification: Genscript Biotechnology Co., Ltd. in Nanjing was commissioned to synthesize the genes for the phenol degradation pathway (pheA1, pheA2), as well as the genes for the PNP degradation pathway and gfp protein (pnpAB, pnpCD, pnpE, pnpF, gfp), and the promoter P15 containing RBS was synthesized. Among them, pnpAB is a sequence composed of pnpA + RBS sequence + pnpB in tandem; pnpCD is a sequence composed of pnpC + RBS sequence + pnpD in tandem.

[0034] The nucleotide sequence of the RBS-containing promoter P15 (5'-3') is: ACGATCGTGTCGGGTAACACCAACTCACCAACACTGATGATCGCCGAAAAGGCTGCGGCCTGGATTCGTGAATCAGTGTCATCCTGCGGTCATGATTGATAATTAGTGTTGACGTGAGCGCTCAG ACCGCGCATGCTGATCGCAGTAGGTTAGCAAGTCGAACATATCTTCAGTGGTCATCGAAGCCTGATGCATCGGTTTCCCGGGGGAAGTTTCTTGTTTTACCCACTGCTACTCGGGTATTTCCCGGTAATTCAATTGCTATTCGAGGAATTCGATA TAAGGAGGTTTTTCTA (SEQ ID NO.1), where the underlined portion of the sequence shown in SEQ ID NO.1 is the RBS sequence and the ununderlined portion is the P15 sequence.

[0035] S2. Genome Extraction: The genome of *Halomonas cupida* strain J9 (H. cupida J9) was extracted according to the instructions of the Vazyme kit. The reference genome of *Halomonas cupida* strain J9 was the sequence shown in GenBank accession number CP094345.1. Upstream and downstream homologous arms pheA1, pheA2, pnpAB, pnpCD, and pnpE were designed based on this genome.

[0036] The upstream homologous arm UP of the pheA2 gene corresponds to positions 2822008–2822265 of the reference genome of *Haloxylon ammodendron* strain J9, and the downstream homologous arm DN corresponds to positions 2822626–2823243 of the reference genome of *Haloxylon ammodendron* strain J9. Similarly, the upstream homologous arm UP of the pheA1 gene corresponds to positions 2824629–2825294 of the reference genome of *Haloxylon ammodendron* strain J9, and the downstream homologous arm DN corresponds to positions 2825295–2825960 of the reference genome of *Haloxylon ammodendron* strain J9. The upstream homologous arm UP of the pnpAB gene corresponds to positions 3835003–3835668 of the reference genome of *Halomonas cupida* strain J9, and the downstream homologous arm DN corresponds to positions 3834461–3834960 of the reference genome of *Halomonas cupida* strain J9. The upstream homologous arm UP of the pnpCD gene corresponds to positions 4454–4993 of the reference genome of *Pseudomonas sp. WBC-3* strain (GenBank accession number EF577044.1), and the downstream homologous arm DN corresponds to positions 3834264–3834888 of the reference genome of *Halomonas cupida* strain J9. The upstream homologous arm UP of the pnpF gene corresponds to the reference genome of *Pseudomonas sp. WBC-3* strain (GenBank accession number EF577044).1) The sequence shown at positions 9365-9944 corresponds to the downstream homologous arm DN of the reference genome of Halomonas cupida J9 strain, positions 3150842-3151478; the upstream homologous arm UP of the pnpE gene corresponds to the sequence at positions 3150121-3150799 of the reference genome of Halomonas cupida J9 strain, and the downstream homologous arm DN corresponds to the sequence at positions 3150842-3151478; the sequence (5'-3') of the upstream homologous arm UP of the gfp gene is: (SEQ ID NO. 2).

[0037] The sequence (5'-3') of the downstream homology arm DN of the gfp gene is: TGGCCTTCGGCGCGCAGGGTCTCGACGACGTAGCCGAGGTTCAGGCCGACCACGACTTTTTCGTAGGGTTTGGAGTTCTGAGCGACTTCAAAGATGTTCGAAAATGC ATAGTGACGGGCCTCGCCACTGATGATCTCCACCGTGCCTTTGCGGAAGTTATCCAGCGAGGCGAAGACCGTATTGACTGCAACGTTACTCATTAGAAAACCTCCTTAGCCATTATCGAATTCCTCGAATAG CAATTGAATTACCGGGAAATACCCGAGTAGCAGTGGGTAAAACAAGAAACTTCCCCCGGGAAACCGATGCATCAGGCTTCGATGACCACTGAAGATATGTTCGACTTGCTAACCTACTGCGATCAGCATGCG CGGTCTGAGCGCTCACGTCAACACTAATTATCAATCATGACCGCAGGATGACACTGATTCACGAATCCAGGCCGCAGCCTTTTCGGCGATCATCAGTGTTGTGGAGTTGGTGTTACCCGACACGATCGT (SEQ ID NO.3).

[0038] Using the J9 genome as a template, the upstream homologous arm UF / UR or the downstream homologous arm DF / DR of primer pairs were used to amplify the upstream and downstream homologous arm sequences UP and DN of the pheA1, pheA2, pnpAB, pnpCD, pnpE, pnpF and gfp gene insertion sites by PCR.

[0039] The assembly sites and genome integration sites of exogenous gene expression cassettes are shown in Figure 1 and Table 1.

[0040] (3) Fragment ligation: First, using primers UF for the upstream homologous arms of pnpAB, pnpCD, pnpEF, pheA1, gfp, or pheA2 and primer P15R for the promoter P15 containing RBS, respectively, the upstream homologous arm sequence UP and the promoter P15 containing RBS of each gene (pnpAB, pnpCD, pnpEF, pheA1, gfp, or pheA2) are used as templates, and the upstream homologous arms and promoter P15 are fused into a single fragment by overlap PCR, thus obtaining the UP-P15 fragment of each gene; similarly, using primers UF for the upstream homologous arms of pnpAB, pnpCD, pnpEF, pheA1, gfp, or pheA2 and primer P15R for the promoter P15 containing RBS, the upstream homologous arms and promoter P15 are fused into a single fragment by overlap PCR, thus obtaining the UP-P15 fragment of each gene; similarly, using primers UF for the upstream homologous arms of pnpAB, pnpCD, pnpEF, pheA1, gfp, or pheA2, the upstream homologous arms and promoter P15 are fused into a single fragment by overlap PCR, thus obtaining the UP-P15 fragment of each gene; Primers DR for the downstream homologous arms of pnpEF, pheA1, gfp, or pheA2 and primer F for the inserted gene fragment (pnpAB, pnpCD, pnpE, pnpF, pheA1, gfp, or pheA2) are used as templates. The downstream homologous arm sequences DN of each gene (pnpAB, pnpCD, pnpEF, pheA1, gfp, or pheA2) and each gene (pnpAB, pnpCD, pnpEF, pheA1, gfp, or pheA2) are used as templates. The two are fused into a single fragment by overlap PCR, which yields the gene-DN fragment. Finally, using primers UF for the upstream homologous arm and DR for the downstream homologous arm of each gene, and using the UP-P15 fragment and the -DN fragment of each gene as templates, overlap PCR was used to fuse them into a single fragment, yielding P15-pnpAB, P15-pnpCD, P15-pnpE, P15-pnpF, P15-pheA1, P15-pheA2, and P15-gfp fusion fragments. Primer sequences are shown in Table 2.

[0041] The sequences of the P15-pnpAB fusion fragments are obtained by tandemly combining the upstream homologous arm UP of the pnpAB gene, the sequence described in SEQ ID NO.1, the pnpA sequence, RBS, the pnpB sequence, and the downstream homologous arm DN of the pnpAB gene. The sequences of the P15-pnpCD fusion fragments are obtained by tandemly combining the upstream homologous arm UP of the pnpCD gene, the sequence described in SEQ ID NO.1, the pnpC sequence, RBS, the pnpD sequence, and the downstream homologous arm DN of the pnpCD gene. The sequences of the P15-pnpE fusion fragments are obtained by tandemly combining the upstream homologous arm UP of the pnpE gene, the sequence described in SEQ ID NO.1, the pnpE sequence, and the downstream homologous arm DN of the pnpE gene. The sequences of the P15-pnpF fusion fragments are obtained by tandemly combining the upstream homologous arm UP of the pnpF gene, the sequence described in SEQ ID NO.1, the pnpF sequence, and the downstream homologous arm DN of the pnpF gene. The P15-pheA1 fusion fragment sequence is obtained by tandemly combining the upstream homologous arm UP of the pheA1 gene with the sequence described in SEQ ID NO.1, the pheA1 sequence, and the downstream homologous arm DN of the pheA1 gene. The P15-pheA2 fusion fragment sequence is obtained by tandemly combining the upstream homologous arm UP of the pheA2 gene with the sequence described in SEQ ID NO.1, the pheA2 sequence, and the downstream homologous arm DN of the pheA2 gene. The P15-gfp sequence is obtained by tandemly combining the upstream homologous arm UP of the gfp gene with the sequence described in SEQ ID NO.1, the gfp sequence, and the downstream homologous arm DN of the gfp gene. The RBS sequence (5'-3') is TAAGGAGGTTTTCTA (SEQ ID NO.54).

[0042] Table 2 Primer sequences

[0043] (4) Construction of recombinant vectors: To insert each gene fragment into the pKJU vector, pKJU was first linearized using EcoRI restriction endonuclease to obtain the linearized vector pKJU. Under the action of ligase, the above fusion fragments (P15-pnpAB, P15-pnpCD, P15-pnpE, P15-pnpF, P15-pheA1, P15-pheA2, or P15-gfp fusion fragments) were ligated to the linearized vector pKJU via homologous recombination to obtain the respective ligation products. Each ligation product was added to competent E. coli DH5α cells, incubated on ice for 30 min, followed by heat shock at 42℃ for 45 s, incubated on ice for 2 min, and then 900 μL LLB medium was added, followed by recovery on a shaker at 37℃ for 1 h. The bacterial cells were collected by centrifugation at 5000 rpm for 5 min, resuspended in 100 μL of LB medium, and then plated on plates containing the corresponding antibiotic (Kan) and cultured overnight. Single colonies were picked for colony PCR verification. Successful construction was indicated by selecting colonies with correct plasmid sequencing. The recombinant plasmids pKJU-P15pnpAB, pKJU-P15pnpCD, pKJU-P15pnpE, pKJU-P15pnpF, pKJU-P15pheA1, pKJU-P15pheA2, and pKJU-P15gfp were obtained.

[0044] (5) Conjugation transformation: Using E. coli S17-1 λpir as the donor and H. cupida J9U as the recipient, the plasmid was transferred between the two via a conjugation model. The specific transformation method is as follows: (5.1) Using the heat shock transformation method, a single target plasmid (recombinant plasmid pKJU-P15pnpAB, pKJU-P15pnpCD, pKJU-P15pnpE, pKJU-P15pnpF, pKJU-P15pheA1, pKJU-P15pheA2 or pKJU-P15gfp) was transformed into E. coli S17-1 λpir competent cells. After verifying the correct positive transformant, 100 μL was transferred to a test tube containing 5 mL LB medium with 50 μg / mL Kan and cultured at 37℃ and 180 rpm for 12 days. h, to obtain E. coli-derived bacterial cultures containing the above recombinant plasmids (recombinant plasmids pKJU-P15pnpAB, pKJU-P15pnpCD, pKJU-P15pnpE, pKJU-P15pnpF, pKJU-P15pheA1, pKJU-P15pheA2 or pKJU-P15gfp); (5.2) inoculate the above recombinant plasmid E. coli-derived bacterial cultures into 100 mL of LB medium containing 50 μg / mL Kan resistance at a volume fraction of 2%, and incubate at 37℃ and 180 rpm for 7 h until OD. 600 =1.0~1.4, take 1 mL of bacterial solution into a 1.5 mL EP tube, centrifuge at 5000 rpm for 5 min, wash three times with 10 mM MgSO4 to remove antibiotics and metabolites on the surface of the cells, and then resuspend the cell pellet with 100 μL 10 mM MgSO4 solution to obtain E. coli-derived donor cell pellet containing recombinant plasmids (pKJU-P15pnpAB, pKJU-P15pnpCD, pKJU-P15pnpE, pKJU-P15pnpF, pKJU-P15pheA1, pKJU-P15pheA2 or pKJU-P15gfp); (5.3) pick a single colony of recipient bacteria H. cupidaJ9U from the plate and activate it in a test tube containing 5 mL LB60 liquid medium, and culture overnight until OD 600 =1.5, activated to ideal state. Inoculate 1% (v / v) into 100 mL of LB60 liquid medium and incubate at 37°C and 180 rpm for 7 h until OD. 600=1.0~1.4, take 1 mL of bacterial solution, centrifuge at 5000 rpm for 5 min, wash three times with 10 mM salt MgSO4, and finally resuspend the cell pellet with 100 μL of fresh 10 mM salt MgSO4 solution to obtain H. cupidaJ9U recipient cell pellet; (5.4) Mix the E. coli-derived donor cell pellet containing recombinant plasmid with the H. cupidaJ9U recipient cell pellet in a 3:1 volume ratio to obtain a resuspended mixed bacterial solution. Place the cellulose membrane on LB60 solid medium without any antibiotics, drop the resuspended mixed bacterial solution onto the center of the cellulose membrane, incubate at 37℃ overnight, peel off the cellulose membrane, place the cellulose membrane in a centrifuge tube containing 1 mL of LB60 liquid medium, vortex for 2 min to obtain a suspension; (5.5) Spread 100 μL of the suspension on an LB60 agar plate containing 100 μg / mL Kan, incubate at 37℃ upside down for 36 minutes. h, pick a single colony into 400 μL of LB60 liquid medium containing 100 μg / mL Kan, incubate at 37℃ and 180 rpm for 6 h, and then perform bacterial PCR verification.

[0045] (6) Screening of engineered bacteria J9U-PP: A. The recombinant plasmids pKJU-P15pnpAB, pKJU-P15pnpCD, pKJU-P15pnpE, pKJU-P15pnpF, pKJU-P15pheA1, pKJU-P15pheA2 and pKJU-P15gfp were sequentially transformed into H. cupida J9U recipient cells in step (5). The transformed J9U was then plated on a plate containing 100 µg / mL Kan resistant LB60 medium and cultured at 37°C for 36 h.

[0046] B. After UV irradiation in a clean bench, under sterile conditions, single colonies growing on agar plates were picked up with a pipette tip and placed into 1.5 mL EP tubes containing Kan. Each tube was dispensed with 500 μL of LB60 liquid medium and placed in a shaker at 37°C for 6 h to allow the cells to amplify. The first exchange was verified using the single exchange detection primer pair UF / DR (see Table 2). Strains with verified single exchange results were obtained.

[0047] C. Transfer 200 μL of the strain whose single exchange result has been verified to LB60 liquid medium for double exchange. No antibiotics are added in this step. Incubate at 37°C in a shaker for 24 h to allow for more complete gene exchange and obtain the bacterial culture after 24 h of culture.

[0048] D. After culturing for 24 h, the bacterial culture was diluted 1000 times in LB60 medium. 100 μL of the diluted culture was then pipetted onto an LB60 plate containing 5-FU. Successful double crossover of the engineered strains was screened to obtain J9U-derived strains containing the genes pheA1, pheA2, pnpA, pnpB, pnpC, pnpD, pnpE, pnpF, and gfp. These strains were named engineered strain J9U-PP.

[0049] E. Based on the band size and sequencing verification, the engineered strains that successfully double-crossed were preserved in 80% glycerol tubes and stored at -70°C for a long time.

[0050] 1.2 Strain Validation: The genome of strain J9U-PP was extracted according to the Vazyme kit instructions. Primers were designed based on the inserted gene, and PCR was used to detect whether strain J9U-PP was successfully constructed. The detection results are shown in Figure 2.

[0051] The results in Figure 2 show that the engineered strain J9U-PP contains the genes pheA1, pheA2, pnpA, pnpB, pnpC, pnpD, pnpE, pnpF and gfp, and the nine exogenous genes were successfully inserted into the H. cupida J9U genome.

[0052] The strain was then subjected to Sanger sequencing, and PCR and Sanger sequencing confirmed that nine exogenous genes were successfully inserted into the H. cupida J9 genome, ultimately constructing the engineered strain J9U-PP.

[0053] 1.3 This example studies the transcription of the introduced exogenous gene in the engineered strain J9U-PP, and the RT-PCR was used for detection: RNA was extracted using the SPARKeasy Improved Bacterial RNA Kit (Sparkjade, catalog number: AC0402). The RNA extraction method is as follows: (1) Take 1.5 mL of H. cupida J9U-PP bacterial culture into a 1.5 mL centrifuge tube, centrifuge at 12000 r / min for 1 min, and completely discard the supernatant to obtain H. cupida J9U-PP bacterial cells; (2) Add 20 μL of 1 mg / mL lysozyme buffer to H. cupida J9U-PP bacterial cells to resuspend the bacterial cells, incubate at room temperature for 5 min to lyse the cell wall, and vortex for 10 s every 2 min to break the cell wall; (3) After breaking the cell wall, centrifuge to collect the bacterial cells, remove the supernatant, and vortex to disperse the cells to obtain the dispersed cell system; (4) Add 500 μL of lysis buffer RLT to the dispersed cell system. (5) Add the lysate to a DNA removal column (placed in a collection tube), centrifuge at 12500 r / min for 1 min, and retain the filtrate; (6) Discard the removal column, add an equal volume of 70% ethanol solution to the filtrate, and immediately mix by pipetting to obtain a mixture; (7) Immediately add the mixture from step (6) to the adsorption column RA (placed in a collection tube), centrifuge at 12500 r / min for 1 min, and discard the filtrate; (8) Add 700 μL of protein removal solution RW1 to RA, centrifuge at 12000 r / min for 30 s, and discard the filtrate; (9) Add 500 μL of washing solution RW to RA, centrifuge at 12000 r / min for 30 s, and discard the filtrate; (10) Repeat step (9); (11) Centrifuge the empty RA tube at 12500 r / min for 2 min. min, open RA and place it in a new RNase-free centrifuge tube, place at room temperature for 10 min to allow the residual ethanol to evaporate; (12) add 40 μL of RNase-free H2O to the middle part of the RA adsorption membrane, place at room temperature for 1 min, centrifuge at 12000r / min for 1 min, and immediately store the obtained RNA product at -80℃ or perform reverse transcription.

[0054] The reverse transcription method for RNA is as follows: Because some DNA may remain during the RNA extraction process, the Vazyme HiScript® II QRT SuperMix for qPCR kit is used to remove the remaining DNA in the solution more thoroughly before reverse transcription is performed.

[0055] Genomic DNA removal system: 4×gDNA wiper mix 4.0 µL, RNA 1.0 µL, add RNase-FreeH2O to 16 µL.

[0056] After gently blowing the genomic DNA removal system, incubate it in a 42 °C metal bath for 2 min to obtain the reaction system.

[0057] Add 4.0 µL of 5×HiScript II Select qRT SuperMix II to a 16.0 µL reaction system, mix thoroughly by pipetting, incubate in a 50 °C metal bath for 15 min, and then react at 85 °C for 5 s. The product is cDNA. Finally, use the cDNA product, two negative controls (mRNA and ddH2O), and one positive control (genomic DNA) as templates for PCR amplification to analyze the transcription of pheA1, pheA2, pnpA, pnpB, pnpC, pnpD, pnpE, pnpF, and gfp. The results are shown in Figure 3.

[0058] The results in Figure 3 show that the bands corresponding to cDNA and genomic DNA exhibit bands that match the expected size of the target genes, while no bands were observed in the negative control. These results indicate successful transcription of all nine exogenous genes (pheA1, pheA2, pnpA, pnpB, pnpC, pnpD, pnpE, pnpF, and gfp) in J9U-PP.

[0059] 1.4 Further studies were conducted on the growth curve and genetic stability determination of H. cupidaJ9U-PP. The steps are as follows: 1.4.1 Determination of growth curve (1) H. cupidaJ9U-PP or H. cupidaJ9U stored in a -70℃ low-temperature freezer was streaked on LB60 solid medium or MMG60 solid medium for activation; (2) After activation, a single colony was picked and placed in 5 mL of LB60 liquid medium or MMG60 liquid medium, and cultured at 37℃ and 180 rpm with shaking to obtain the bacterial solution after each culture; (3) 1 mL of the cultured bacterial solution was transferred to an Erlenmeyer flask containing 100 mL of medium, and cultured at 37℃ and 180 rpm with shaking. Three parallel experimental groups were set up for each group; (4) The absorbance (OD) of the bacterial solution was measured at each time point every 3 h starting from 0 h. 600 nm); (5) with OD 600 The measured values ​​are plotted on the ordinate, and the sampling time on the abscissa to create a curve, thus measuring the growth of the strain. The maximum absolute growth rate is calculated as dQ / dt (where dQ is the maximum OD). 600 The change value, where dt is the time when the change value occurred.

[0060] 1.4.2 Determination of genetic stability: To test the genetic stability of strain J9U-PP, J9U-PP was cultured continuously for 18 generations (12 h per generation) in LB 60 or MMG60 medium at 37℃. Then, after 18 generations, the genome was extracted from the strain and used as a template to detect 9 exogenous genes by PCR.

[0061] The results in Figure 4 show that, by measuring the growth curves of H. cupida J9 and H. cupida J9U-PP under the same conditions, there was no significant difference in the growth trend and maximum specific growth rate between the two strains, indicating that the insertion of the exogenous gene does not affect the growth of J9U.

[0062] The results in Figure 5 show that all nine exogenous genes of the 18th generation strain were stably expressed in MMG60 and LB60.

[0063] 1.5 Phenol and PNP Degradation Experiments 1.5.1 Phenol or Catechol Degradation Experiments (1) The engineered strain J9U-PP was inoculated at 1% (v / v) in 100 mL of LB60 liquid medium and cultured at 37℃ and 180 rpm / min for 16 h to obtain the culture; (2) The culture was centrifuged at 5000 rpm for 5 minutes and the centrifuged cells were collected; (3) The centrifuged cells were thoroughly washed twice in MMG60 liquid medium; and finally resuspended to OD 600 =4.0, to obtain the resuspended bacterial cells; (4) Add the resuspended bacterial cells from step (3) to 20 mL of MMG60 liquid culture medium, and add 25 mg / L phenol at the same time, so that the OD of the culture flask is 4.0. 600 1. Incubate at 30℃ or 37℃; or, add the resuspended cells from step (3) to 20 mL of MMG60 liquid medium, along with 25 mg / L catechol, so that the OD of the culture flask is 1. 600 1. Incubate at 30℃ or 37℃; (5) Take samples regularly to analyze catechol or phenol, each time taking 2 mL of culture medium containing the strain, and measuring the OD of the strain with a UV spectrophotometer. 600 Cell density was determined, and one sample was used for HPLC analysis of pollutants to determine the quantity of pollutants and their intermediates.

[0064] 1.5.2 Extraction of phenol contaminants from samples: Add an equal volume of acetonitrile to 1 mL of the culture medium containing the strain from section 1.5.1, and vortex for 2 min to extract contaminated phenol or catechol.

[0065] After standing for 5 min, centrifuge at 12000 rpm for 3 min and collect the supernatant a; (3) In order to analyze phenol by liquid chromatography (HPLC), supernatant a is passed through a 0.22 μm filter, filtrate a is collected and collected in a brown vial. The HPLC detection conditions for phenol are shown in Table 3.

[0066] Table 3 HPLC detection conditions for phenol

[0067] The detection procedure for phenol or catechol is as follows: column temperature 25℃, detection wavelength for phenol 213 nm. Water and methanol (70:30, v / v) were used as the mobile phase, with isocratic elution. Standards of phenol or catechol at different concentrations (0, 25, 50, 75, 100 mg / L) were prepared, and standard curves were plotted based on the corresponding peak areas for the quantification of phenol or catechol.

[0068] The results in Figures 6 and 7 show that the retention time of the characteristic peak of catechol is 7.9 min (see Figure 6), and the retention time of the characteristic peak of phenol is 6.4 min (see Figure 7).

[0069] To test the ability of J9U-PP to degrade phenol, J9U-PP was cultured in MMG60 containing phenol or catechol, and the degree of degradation of phenol and catechol was analyzed by HPLC.

[0070] Figure 6 shows that the catechols in the culture medium were completely converted after 6 hours. Figure 7 shows that the phenol conversion efficiency decreased significantly after 12 hours at a culture temperature of 37℃.

[0071] The results in Figure 8 show that J9U-PP can completely convert 25 mg / L of phenol within 24 hours at a culture temperature of 30 °C. This result demonstrates that temperature changes can indeed enhance the function of pheA1 and pheA2 enzymes, and the rapid consumption of the generated catechols also reflects that the endogenous degrading enzymes still have excellent conversion efficiency at 30 °C.

[0072] To improve the enzyme activities of pheA1 and pheA2, subsequent degradation experiments related to phenol were all conducted at a culture temperature of 30°C.

[0073] 1.5.3 PNP Degradation Experiment 1.5.3.1 PNP Degradation Experiment (1) Inoculate the engineered strain J9U-PP or strain J9U at an inoculum of 1% (v / v) into 100 mL of LB60 liquid medium and culture at 37℃ and 180 rpm / min for 16 h to obtain culture 1; (2) Centrifuge culture 1 at 5000 rpm for 5 min and collect the centrifuged cells 1; (3) Wash the centrifuged cells 1 thoroughly twice in MMG60 medium; and finally resuspend to OD. 600 =4.0, to obtain resuspended bacterial cell 1; (4) Add bacterial cell 1 from step (3) to 20 mL MMG60 liquid medium, and add 25 mg / L, 50 mg / L or 100 mg / L of PNP respectively, so that the OD of the culture flask is just added to the culture flask. 600 The value was 1.0, and the culture was carried out at 37℃; (5) Sampling and analysis were performed regularly. Each time, 2 mL of culture medium containing the strain was taken, and the OD of the strain was measured with a UV spectrophotometer. 600 Cell density was determined, and one sample was used for GC analysis of contaminants to determine the quantity of contaminants and their intermediates.

[0074] 1.5.4 Extraction of PNP contaminants from samples (1) Add an equal volume of ethyl acetate to 1 mL of the culture medium containing the strain obtained in 1.5.3 and vortex for 2 minutes to extract contaminated PNPs.

[0075] (2) After standing for 5 min, centrifuge at 12000 rpm for 3 min and collect the supernatant b; (3) In order to analyze PNP by gas chromatography (GC), supernatant b was passed through a 0.22 μm filter, filtrate b was collected and collected into a brown vial.

[0076] Table 4 GC detection conditions for PNP

[0077] (4) The detection procedure for PNP is as follows: The temperature of the injector and detector is raised to 300°C. The column temperature is maintained at 120°C for 2 min, then raised to 200°C (at a rate of 25°C / min) and maintained for 8 min, and finally raised to 260°C (at a rate of 30°C / min) and maintained for 5 min. The GC detection conditions for PNP are shown in Table 4.

[0078] PNP standards at different concentrations (0, 25, 50, 75, 100 mg / L) were prepared, and standard curves were plotted based on the corresponding peak areas for PNP quantification.

[0079] The results in Figures 9-11 show that the retention time of the characteristic peak of PNP was 6.4 min, and the retention time of the characteristic peak of hydroquinone (HQ) was 4.8 min. When J9U-PP degraded 25 mg / L PNP, it was able to completely degrade PNP within 1 h and hydroquinone within 9 h. This strain also showed good degradation ability at higher concentrations of PNP, with a degradation rate of 100% for 50 mg / L PNP within 1 h and a degradation rate of 95% for 100 mg / L PNP within 6 h. The results in Figure 12 show that the control group (J9U strain) did not show significant degradation of PNP.

[0080] 1.6 Stable Isotope Analysis of J9U-PP Degradation Function 1.6.1 Isotope Experiments To further demonstrate that J9U-PP will... 13 C6-phenol and 13 C6-PNP transforms into 13 The CO2 capacity was measured in 100 mL serum bottles (sealed with the matching gasket and aluminum cap) containing 25 mg / L. 13 C-phenol and 13 C-PNP in MMG60 or MMG100 medium at 180 r / min and 30°C ( 13 C-phenol incubation temperature) or 37℃ ( 13 C-PNP culture temperature: The culture was incubated for 5 days in a closed, shaker-based incubator at a constant temperature. After incubation, the culture was acidified with 10 M hydrochloric acid to a pH less than 2, and then shaken in a closed incubator for 5–7 minutes. Gas was aspirated from the top of the serum vial using a 10 mL sterile syringe and collected into a 12 mL sealed headspace vial. The gas sample was sent to the Environmental Stable Isotope Laboratory of the Chinese Academy of Agricultural Sciences to obtain the composition of the gas and the δ¹⁴ ohms in CO₂. 13 C. Using strain J9U as a control group, the strains were cultured under the same conditions.

[0081] The results are shown in Figure 13, indicating that in a solution containing 25 mg / L 13 After incubating J9U-PP in MMG60 medium for 5 days with C6-phenol, the CO2 produced by J9U-PP contained... 13 The C value (919‰) was significantly higher than that of the control group. Meanwhile, in the incubation gas of J9U-PP, 13 C / ( 12 C+ 13 The C% value increased by 192% compared to the control group. (Containing 25 mg / L) 13 After incubating J9U-PP in MMG60 medium containing C6-PNP for 5 days, the CO2 produced by J9U-PP... 13The C value (187‰) was significantly higher than that of the control group. Meanwhile, in the incubation gas of J9U-PP, 13 C / ( 12 C+ 13 The value of C)% increased by 22% compared to the control group.

[0082] The results in Figure 13 demonstrate that J9U-PP retains its ability to mineralize contaminants even under high-salt conditions. The mineralization ability of J9U-PP in MMG100 medium was also confirmed by stable isotope experiments, showing that it can perfectly mineralize phenol and PNP under high-salt conditions.

[0083] 1.7 Study on the co-degradation of phenol and PNP by J9U-PP in wastewater 1.7.1 Wastewater degradation experiment The sample for this experiment was collected from an unpolluted stream on the campus of Nankai University in Tianjin, China. NaCl was added to make the final concentration 60 g / L, and phenol was added to make the final concentration 25 mg / L to obtain wastewater culture medium a.

[0084] Alternatively, the sample for this experiment was collected from an unpolluted stream on the campus of Nankai University in Tianjin, China. NaCl was added to achieve a final concentration of 60 g / L, and PNP was added to achieve a final concentration of 25 mg / L, resulting in wastewater culture medium b. Or, the sample for this experiment was collected from an unpolluted stream on the campus of Nankai University in Tianjin, China. NaCl was added to achieve a final concentration of 60 g / L, and phenol and PNP were added to achieve a final concentration of 25 mg / L, resulting in wastewater culture medium c.

[0085] (1) The engineered strain J9U-PP was cultured in LB60 liquid medium at 37°C and 180 rpm / min for 16 h to obtain a culture; (2) The culture was centrifuged at 5000 rpm for 5 min to collect the J9U-PP cell pellet; (3) The J9U-PP cell pellet was thoroughly washed twice in wastewater medium; and finally resuspended at OD. 600 =4.0, to obtain the resuspended bacterial cells; (4) Add the resuspended bacterial cells from step (3) to 20 mL of sewage culture medium a or sewage culture medium c respectively, so that the OD of the culture flask is 4.0, and the bacterial cells are resuspended. 600 The OD600 of the culture flask was 1.0, and the culture was carried out at 30°C. The bacterial cells resuspended in step (3) were added to 20 mL of sewage culture medium b, so that the OD600 of the culture flask was 1.0, and the culture was carried out at 37°C. (5) Sampling and analysis were carried out regularly. Each time, 2 mL of culture containing the bacterial strain was taken out, one for HPLC analysis of pollutants and one for GC analysis of pollutants, in order to determine the amount of pollutants and their intermediate products.

[0086] (6) HPLC and GC measurement methods and procedures are described in sections 1.5.2 and 1.5.4.

[0087] The results in Figure 14 show that J9U-PP can completely convert phenol, PNP, and HQ in river water containing 25 mg / L phenol and / or PNP and 60 g / L NaCl within 28 h, 3 h, and 12 h, respectively (A-B in Figure 14). However, when phenol and PNP coexist, the degradation of phenol is inhibited but still occurs at a degradation rate of 83%, while the degradation of PNP is unaffected (C in Figure 14).

[0088] 1.7.2 Isotope Experiment The sample for this experiment was collected from an unpolluted stream on the campus of Nankai University in Tianjin, China. NaCl was added to achieve a final concentration of 60 g / L, and [other components] were added to achieve a final concentration of 25 mg / L. 13 C6-phenol and 25 mg / L 13 C6-PNP was used to obtain river water containing 60 g / L NaCl as wastewater culture medium 1; or, river water was collected from an unpolluted stream on the campus of Nankai University in Tianjin, China, and NaCl was added to a final concentration of 100 g / L, followed by the addition of 25 mg / L of [unspecified substance]. 13 C6-phenol and 25 mg / L 13 C6-PNP was used to obtain river water containing 100 g / L NaCl as wastewater culture medium 2.

[0089] (1) The engineered strain J9U-PP or strain J9U (control group) were cultured in LB60 liquid medium at 37℃ and 180 rpm / min for 16 h to obtain the culture; (2) The culture was centrifuged at 5000 rpm for 5 min to collect the J9U-PP cell pellet; (3) The J9U-PP cell pellet was thoroughly washed twice in sewage medium; and finally resuspended at OD. 600 =4.0, to obtain the resuspended bacterial cells; (4) add the resuspended bacterial cells from step (3) to 20 mL of sewage culture medium 1 or sewage culture medium 2 respectively, so that the OD of the culture flask is 4.0, and the bacterial cells are resuspended. 600 The value was 1.0, and the cultures were incubated at 30°C. (5) Samples were taken periodically for analysis. Each time, 2 mL of culture containing the strain was taken, one for HPLC analysis of the pollutants and one for GC analysis of the pollutants, in order to determine the quantity of the pollutants and their intermediate products.

[0090] The isotope experiment procedure is described in section 1.6.1 and will not be repeated here.

[0091] In isotope experiments, at different salt concentrations, as shown in Figures 14 (D and E), the CO2 produced by J9U-PP... 13The C values ​​were significantly higher than those of the control group, indicating that the mixed pollutants were successfully mineralized in the natural aquatic environment. Therefore, J9U-PP exhibits excellent degradation function and competitiveness under high salinity conditions, and has good potential in in-situ bioremediation of polluted environments.

[0092] 1.6.2 Confocal observation of green fluorescent protein expressed in GFP strains. The expression intensity of the strain can be directly observed using a Confocal microscope. The specific operation can be carried out according to the following steps: (1) After culturing the bacterial culture for 27 h, put it into a 1.5 mL EP tube, place it in a centrifuge at 4℃, centrifuge at 5000 rpm for 5 min, drain the supernatant, and leave the bacterial cells.

[0093] (2) The bacterial cells were washed three times with 1 mL of phosphate buffer containing 60% NaCl.

[0094] (3) Mix 400 μL of PB with the suspended bacterial cells evenly, then add FM4-64 membrane fluorescent dye with a final concentration of 10 μM, and then incubate in the dark at 37°C for 25 min to obtain the incubated bacterial solution.

[0095] (4) Drop about 2 μL of the bacterial solution taken from the previous step into a glass slide and add 2% glycerol to fix the cells.

[0096] (5) Green fluorescent protein gfp was activated with blue excitation wavelength of 488 nm, while the red fluorescence of FM4-64 was observed with a Zeiss LSM710 confocal microscope with an excitation wavelength of 543 nm.

[0097] The results in Figure 15 show that J9U-PP cells were filled with green fluorescence when observed using a laser scanning confocal microscope, indicating that the expressed egfp is fully active in the engineered strain J9U-PP. In particular, the green fluorescence of egfp was also visible under sunlight. Therefore, when the engineered strain J9U-PP carrying the egfp label is released into an aquatic environment contaminated with organic pollutants, the bioremediation process can be tracked by fluorescence.

[0098] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An engineered bacterium, J9U-PP, for co-degrading phenol and p-nitrophenol, characterized in that, The engineered bacterium J9U-PP comprises the insertion of phenol degradation genes and PNP degradation genes into Halomonas claustrophobia J9U; the phenol degradation genes are pheA1 and pheA2; the PNP degradation genes are pnpA, pnpB, pnpC, pnpD, pnpE and pnpF.

2. The engineered bacterium J9U-PP according to claim 1, characterized in that, The engineered bacterium J9U-PP also includes the insertion of the gfp gene into Halomonas claustrophobia J9U.

3. The engineered bacterium J9U-PP according to claim 2, characterized in that, A promoter is inserted upstream of the phenol degradation gene or the phenol degradation gene; a promoter is inserted upstream of the gfp gene.

4. The engineered bacterium J9U-PP according to claim 3, characterized in that, The promoter is P15, and the nucleotide sequence of P15 is the sequence from position 1 to position 280 shown in SEQ ID NO.

1.

5. The method for constructing the engineered bacterium J9U-PP according to any one of claims 1 to 4, characterized in that, Includes the following steps: The promoter, the phenol degradation gene, and the upstream and downstream homologous arm sequences of the phenol degradation gene were obtained by overlapping PCR to obtain a phenol degradation gene containing the promoter and homologous arm sequences. The promoter, the PNP degradation gene, and the upstream and downstream homologous arm sequences of the phenol degradation gene were obtained by overlapping PCR to obtain a PNP degradation gene containing the promoter and homologous arm sequences. Using the pKJU vector, a phenol degradation gene containing a promoter and homologous arm sequence and a PNP degradation gene containing a promoter and homologous arm sequence were transferred into *Haloxylon ammodendron* J9U via homologous recombination to obtain the engineered bacterium J9U-PP.

6. The construction method according to claim 5, characterized in that, It also includes using the pKJU vector to transfer the gfp gene into Halomonas cravings J9U via homologous recombination.

7. The construction method according to claim 6, characterized in that, The gfp gene is obtained by overlapping PCR of the promoter, the gfp gene, and the upstream and downstream homologous arm sequences of the gfp gene.

8. The construction method according to claim 7, characterized in that, The phenol degradation genes containing promoter and homologous arm sequences are P15-pheA1 and P15-pheA2; the PNP degradation genes containing promoter and homologous arm sequences are P15-pnpAB, P15-pnpCD, P15-pnpE, and P15-pnpF; P15-pheA1 is the upstream homologous arm sequence of pheA1, SEQ ID... The sequence shown in NO.1, the pheA1 sequence, and the downstream homologous arm sequence of pheA1 are sequentially tandem. The upstream homologous arm sequence of pheA1 is the sequence shown at positions 2824629-2825294 of the reference genome of *Haloxylon ammodendron* strain J9, and the downstream homologous arm sequence is the sequence shown at positions 2825295-2825960 of the reference genome of *Haloxylon ammodendron* strain J9. The pheA1 sequence is the sequence shown at positions 1872-3500 in GenBank accession number AJ973228.

1. P15-pheA2 is obtained by tandem the upstream homologous arm sequence of pheA2, SEQ ID NO.1, and pheA1. The sequence shown in NO.1, the pheA2 sequence, and the downstream homologous arm sequence of pheA2 are sequentially tandemly; the upstream homologous arm sequence of pheA2 is the sequence shown at positions 2822008-2822265 of the reference genome of *Haloxylon ammodendron* strain J9, and the downstream homologous arm sequence is the sequence shown at positions 2822626-2823243 of the reference genome of *Haloxylon ammodendron* strain J9; the pheA2 sequence is the sequence shown at positions 1291-1860 of GenBank accession number AJ973228.1; P15-pnpAB is obtained by tandemly connecting the upstream homologous arm sequence of pnpAB, SEQ ID NO.1, and SEQ ID NO.

1. The sequence shown in NO.1, the pnpA sequence, the RBS sequence, the pnpB sequence, and the downstream homologous arm sequence of pnpAB are sequentially tandemly; the upstream homologous arm sequence of pnpAB is the sequence shown at positions 3835003-3835668 of the reference genome of *Haloxylon ammodendron* strain J9, and the downstream homologous arm sequence is the sequence shown at positions 3834461-3834960 of the reference genome of *Haloxylon ammodendron* strain J9; the pnpA sequence is the sequence shown at positions 2824-4035 of GenBank accession number EF577044.1; the pnpB sequence is the sequence shown at positions 4370-4993 of GenBank accession number EF577044.1; the P15-pnpCD is obtained by tandemly connecting the upstream homologous arm sequence of pnpCD, SEQ ID, and SEQ ID. The sequence shown in NO.1, the pnpC sequence, the RBS sequence, the pnpD sequence, and the downstream homologous arm sequence of pnpCD are sequentially cascaded together; the upstream homologous arm sequence of pnpCD is Pseudomonassp.The sequence shown at positions 4454-4993 of the reference genome of strain WBC-3 is the downstream homologous arm sequence shown at positions 3834264-3834888 of the reference genome of strain Halomonas des Estradiolarum J9; the pnpC sequence is the sequence shown at positions 11110-11604 of GenBank accession number EF577044.1; the pnpD sequence is the sequence shown at positions 10039-11058 of GenBank accession number EF577044.1; the P15-pnpE is the sequence of the upstream homologous arm sequence of pnpE, SEQ ID... The sequence shown in SEQ ID NO.1, the pnpE sequence, and the downstream homologous arm sequence of pnpE are sequentially tandem. The upstream homologous arm sequence of pnpE is the sequence shown at positions 3150121-3150799 of the reference genome of *Haloxylon ammodendron* strain J9, and the downstream homologous arm sequence is the sequence shown at positions 3150842-3151478 of the reference genome of *Haloxylon ammodendron* strain J9. The pnpE sequence is the sequence shown at positions 8481-9944 in GenBank accession number EF577044.

1. P15-pnpF is obtained by sequentially tandem the upstream homologous arm sequence of pnpF, the sequence shown in SEQ ID NO.1, the pnpF sequence, and the downstream homologous arm sequence of pnpF. The upstream homologous arm sequence of pnpF is *Pseudomonas sp.*. The sequence shown at positions 9365-9944 of the reference genome of strain WBC-3 is the downstream homologous arm sequence shown at positions 3150842-3151478 of the reference genome of strain Halomonas despicatrum J9; the pnpF sequence is the sequence shown at positions 7406-8472 of GenBank accession number EF577044.1; the reference genome of strain Halomonas despicatrum J9 is the sequence shown at GenBank accession number CP094345.1; the reference genome of strain Pseudomonas sp. WBC-3 is the sequence shown at GenBank accession number EF577044.1; the gfp gene containing the promoter and homologous arm sequence is P15-gfp; P15-gfp is the upstream homologous arm sequence of gfp, SEQ ID The sequence shown in SEQ ID NO.1, the gfp sequence, and the downstream homologous arm sequence of the gfp are sequentially concatenated; the gfp sequence is the sequence shown in bits 675-1394 of GenBank accession number U57609.1, the upstream homologous arm sequence of the gfp is shown in SEQ ID NO.2, and the downstream homologous arm sequence of the gfp is shown in SEQ ID NO.

3.

9. The construction method according to claim 8, characterized in that, Includes the following steps: P15-pheA1, P15-pheA2, P15-pnpAB, P15-pnpCD, P15-pnpE, P15-pnpF, and P15-gfp were ligated to the enzyme-digested pKJU vector to obtain the pKJU recombinant vector. The pKJU recombinant vector was transformed into Haloxylon ammodendron J9U by conjugation transformation. Recombinants that underwent the first single crossover were selected using kanamycin resistance screening. The recombinants were then screened again in 5-FU medium to obtain the strain with the target gene inserted after the second crossover, which was named engineered strain J9U-PP.

10. The use of the engineered bacteria J9U-PP according to any one of claims 1 to 4 or the engineered bacteria J9U-PP obtained by the construction method according to any one of claims 5 to 9 in at least one of the following: (1) degrading one or more of phenol, p-nitrophenol, hydroquinone and catechol; (2) preparing products that degrade one or more of phenol, p-nitrophenol, hydroquinone and catechol; (3) degrading one or more of phenol, p-nitrophenol, hydroquinone and catechol in high-salt wastewater.

Images