DsRNA compound auxiliary agent, method for preparing RNA biopesticide by dsRNA compound auxiliary agent and application of dsRNA compound auxiliary agent
By forming micelles with dsRNA using the zinc salt adjuvant BI18, the stability and insect sensitivity issues of dsRNA in crop pest and disease control were resolved, achieving efficient delivery of dsRNA and pest control effects, while reducing costs and maintaining environmental friendliness.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-30
- Publication Date
- 2026-05-08
AI Technical Summary
In existing technologies, double-stranded RNA (dsRNA) suffers from poor stability and varying insect sensitivities in the control of crop diseases and pests, making it difficult to effectively control some major agricultural pests when applying naked dsRNA.
Zinc salt (BioIon18, BI18) was used as a dsRNA compounding adjuvant. By mixing with dsRNA to form BI18@dsRNA micelles, the stability and loading capacity of dsRNA were enhanced, thereby improving the efficiency of pest RNAi.
BI18@dsRNA micelles are stable under extremely strong ultraviolet light, effectively resist RNase A enzymatic degradation, promote intracellular absorption, significantly improve the RNAi efficiency of pests, reduce pesticide production costs, and are environmentally friendly.
Smart Images

Figure CN121991955A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine and relates to the protection of dsRNA, a core component of RNA biopesticides, and the improvement of its application effectiveness. Background Technology
[0002] The deteriorating climate has severely impacted the adequate supply of food to meet the global population's needs. Simultaneously, the worsening climate has led to irregular outbreaks of certain pests and diseases. It is estimated that pests and diseases cause up to 40% of global crop losses annually, resulting in economic losses of up to $300 billion. Coupled with food shortages and rapid, high-density population growth, new or recurring outbreaks of pests and diseases are expected in crop-growing areas. While the use of plant genetic resistance and / or genetic modification, chemical / biological agents, and natural enemies has significantly increased crop yields, it has also brought about problems such as soil degradation, resistance development, residues, and disruption of the food chain, threatening food security and ecological security at the individual, national, and even global levels. However, even with these measures, a safe and sufficient supply of crops cannot be effectively guaranteed.
[0003] RNA biopesticides have brought about another revolution in pesticide history. They are a novel type of biopesticide developed based on RNA interference technology, with double-stranded RNA as its core component. After exogenous double-stranded RNA enters the organism, it is cleaved into small interfering RNA (SRNA). SRNA binds to a multi-molecule RNA-induced silencing complex. Its antisense strand finds and cleaves the complementary signaling RNA sequence, affecting the normal translation of the target protein and disrupting the organism's functions, leading to growth retardation and even death, thus achieving pest and disease control. Furthermore, with the assistance of computational biology, synthetic biology, and materials science, RNA pesticides, with their novel mechanism of action, focus on precise control, low cost, ease of operation, and ecological safety, essentially meeting most of the expectations for the core elements of green pesticides and providing a new solution for high-quality and sustainable agricultural pest and disease control. The application of RNA interference technology in agricultural pest and disease control mainly includes plant-derived RNA pesticides and sprayable RNA pesticides. Plant-derived RNA pesticides, also known as plant-incorporated RNA pesticides (PIPs), are dsRNAs that express target genes of pests and diseases in plants. In contrast, sprayable RNA pesticides are called non-PIPs, which are based on exogenously synthesized dsRNAs effective against certain pests and diseases, and are formulated and sprayed directly. Application CN121065189A discloses a dsRNA for controlling clover leafminer and its pesticide complex. This pesticide combines the dsRNA for controlling clover leafminer with SPc star-shaped cationic nanocarriers for controlling clover leafminer populations.
[0004] Despite its widespread use and in-depth research into RNAi mechanisms, the nature of double-stranded RNA (dsRNA) uptake, systemic dissemination, and differences in insect sensitivity to dsRNA have made the application of naked dsRNA difficult to be effective against some major global agricultural pests (such as the cotton bollworm). Therefore, there is an urgent need for new dsRNA stabilizers and delivery aids to promote the field application of RNAi technology. Summary of the Invention
[0005] To address the technical issues of dsRNA stability and efficacy, this invention proposes a dsRNA compound adjuvant, a method for preparing RNA biopesticides, and their applications.
[0006] The technical solution of this invention is implemented as follows:
[0007] On the one hand, this application provides a dsRNA complexing aid, wherein the dsRNA complexing aid BioIon18 (BI18) is a zinc salt, including but not limited to zinc nitrate (Zn(NO3)2), zinc sulfate (ZnSO4), zinc chloride (ZnCl2), etc.
[0008] Secondly, this invention provides a method for preparing RNA biopesticides using the aforementioned dsRNA complex adjuvant. The steps are as follows: mixing the dsRNA complex adjuvant with dsRNA under solution conditions to obtain the RNA biopesticide. BI18 can effectively load dsRNA. Through the intercalation, outer globule coordination, and inner globule coordination of BI18, and the pH buffering effect of Tris-HCl, the stability and drug loading of the BI18-dsRNA complex are increased. BI18 can further compress dsRNA to obtain BI18@dsRNA micelles with a certain rigidity.
[0009] The complex was in a molar ratio of 1:10 -6 –1:10 -3 Within the specified range, it can protect dsRNA from RNase A digestion, at a molar ratio of 1:10. -3 –1:10 -1 It is resistant to extremely strong ultraviolet light within a certain range. It also possesses the ability to enhance the efficiency of pest RNAi. The above ratio ensures the effective loading of BI18 onto dsRNA while improving its stability and bioavailability to optimize pest control.
[0010] Furthermore, during the preparation process, the mass fraction of the zinc salt used as a dsRNA compounding agent is 0.03-30%; the concentration of dsRNA is 0.5-10 mg / mL.
[0011] Preferably, the above-mentioned dsRNA is synthesized using a gene with biocontrol effects as a template.
[0012] Thirdly, the present invention provides an RNA biopesticide prepared using the above method, wherein the RNA biopesticide is a cationic polyelectrolyte formed by zinc salt and dsRNA, namely dsRNA micelles.
[0013] The present invention has the following beneficial effects:
[0014] 1. This invention discovers that BI18, as a coordination material for dsRNA, can enhance the rigidity of the dsRNA chain, reduce the single-molecule particle size, and improve its electrical properties. Simultaneously, BI18 binds to dsRNA through a binding process driven by both entropy and enthalpy, potentially forming specific binding sites on the edges of nucleic acid bases or atoms on the ribose-phosphate backbone, thus forming a BI18@dsRNA complex. The micellar-like BI18@dsRNA can promote intracellular uptake. In future applications of RNA pesticides, this could provide effective pest and disease control.
[0015] 2. This invention proposes a novel delivery material, BioIon18 (BI18). It is primarily delivered via Zn... 2+ The cationic polyelectrolyte dsRNA micelles formed by salt and dsRNA possess biocompatibility, degradability, and mild preparation conditions. Furthermore, as an important plant nutrient source, dsRNA has a long history of coexistence and mutual reinforcement with humans and the ecological environment. The structural characteristics and RNAi enhancement effects in insects and plants were further explored, providing solutions for the future multi-scenario application of RNA pesticides in the field.
[0016] 3. This complex is effective at a molar ratio of 1:10. -6 – 1 : 10 -3 Within a certain range, it can protect dsRNA from RNase A digestion, at a molar ratio of 1:10. -3 – 1 : 10 -1 It is resistant to extremely strong ultraviolet light within a certain range. It also possesses the ability to enhance the efficiency of insect RNAi. In summary, this invention establishes a novel dsRNA stabilization scheme. We constructed the BioIon18@dsRNA (BI18@dsRNA) complex to solve the stability problems faced by dsRNA-based pesticides in field application. This scheme, while addressing crop protection, also promotes plant growth, significantly reduces the production cost of dsRNA-based pesticides, and does not introduce additional risk factors, achieving the goal of green and environmentally friendly agricultural management. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 Comparison of the structures of dsRNA and BI18@dsRNA under transmission electron microscopy (TEM) and cryo-electron microscopy (Cryo-EM).
[0019] Figure 2 The particle size distribution, PDI plot, and zeta potential plot of the dsRNA and BI18@dsRNA complex are shown for comparison.
[0020] Figure 3 The results show the ITC results for the BI18@dsRNA complex formed by the interaction between BI18 and dsRNA.
[0021] Figure 4 This enhances the ability of BI18@dsRNA to resist RNase A enzymatic degradation.
[0022] Figure 5 Enhance the ability of BI18@dsRNA to resist strong ultraviolet radiation.
[0023] Figure 6 BI18@dsRNA promotes intracellular uptake of dsRNA.
[0024] Figure 7 To enhance RNAi efficiency in cotton bollworm larvae using BI18@dsRNA.
[0025] Figure 8 To enhance the uptake of dsRNA in rice leaves by another BI18@dsRNA complex. Detailed Implementation
[0026] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0027] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.
[0028] Example 1: Preparation of dsRNA materials
[0029] (1) Insect rearing: The cotton bollworm was the species reared in our laboratory. It was reared in an artificial climate chamber with a photoperiod of 14 h:10 h, a temperature of 25 ± 1℃, and a relative humidity of 75%. The feed formula used for rearing the larvae is as follows:
[0030] Soybean flour (120.0 g), corn grits (120.0 g), corn flour (32.0 g), yeast powder (72.0 g), glucose (60.0 g), vitamin C (4.0 g), agar powder (12.0 g), sorbic acid (4.0 g), water (1000 mL).
[0031] One hundred newly hatched larvae were introduced into each culture bottle and raised until the end of the fifth instar. Once the cotton bollworm larvae reached the second instar, they were separated and reared individually. Mature larvae were transferred to plastic boxes for pupation and emergence, and the environment inside the boxes was kept dry. Adults were promptly removed after emergence and fed a 10% honey solution until mating and egg-laying. For bioassays, larvae were classified into instars based on head capsule width, and larvae of uniform growth were selected for processing and sampling.
[0032] (2) Insect microinjection and sample collection
[0033] Three types of larvae that have reached the fifth instar were selected for injection. First, select larvae of uniform size from each type of larvae.
[0034] Individual larvae were injected with the appropriate amount of dsRNA based on their body weight, at a ratio of 0.04 mg dsRNA per gram of insect. Before injection, the larvae were starved for 1 hour, then placed on ice for 20 minutes, and the dsRNA was injected into the insects using a microinjector. Four hours after treatment, three cotton bollworms were collected as a sample.
[0035] Larvae not injected with dsRNA were used as a control. Each treatment group was processed in triplicate. Samples were immediately flash-frozen in liquid nitrogen after collection and then stored at -80°C until use.
[0036] (3) RNA extraction and amplification of full-length cDNA
[0037] To eliminate individual differences, each experimental group consisted of a sample pool formed from 3 surviving larvae after treatment. Total RNA extraction was performed using TRIzol® Reagent (Invitrogen) strictly according to the instructions (strictly low temperature and REase-free conditions):
[0038] ① Sample grinding: The sample, which has been flash-frozen in liquid nitrogen, is ground thoroughly with a grinding column (sterilized at high temperature), 1 mL of TRIzol is added, mixed well, and left to stand on ice for 5 min.
[0039] ②Chloroform extraction: Add 200 μL of chloroform, shake to mix thoroughly, and let stand on an ice box for 5 minutes (chloroform must be stored in a sealed, cool, and dark place, as it is easy to generate highly toxic phosgene when exposed to light in the air. This step must be carried out in a fume hood).
[0040] ③ Precipitation: Centrifuge the mixture from step ② at 4°C and 12,000 rpm for 15 min in a low-temperature centrifuge. After centrifugation, the mixture will separate into three phases (lower layer: organic phase such as phenol / chloroform; middle layer: white interface; upper layer: colorless aqueous phase). All RNA will be dissolved in the upper aqueous phase. Transfer the upper aqueous phase to another new centrifuge tube, add 500 μL of pre-chilled isopropanol (anhydrous ethanol), vortex to mix, and incubate the sample at -80°C for 30 min to allow RNA precipitation.
[0041] ④ Remove the sample and place it on ice to thaw. Centrifuge at 4°C, 12,000 rpm for 10 min and carefully discard the supernatant.
[0042] ⑤ Washing the precipitate: Wash with 500 μL of pre-cooled RNase-free 75% ethanol, and gently vortex on a vortex mixer to suspend the RNA precipitate and fully dissolve the salt ions in the RNA precipitate.
[0043] ⑥ Dissolve the precipitate: Centrifuge at 12,000 rpm for 5 min at 4℃, carefully discard the supernatant (you can centrifuge the centrifuge tube briefly and use a pipette to remove the residual liquid), and then dry the centrifuge tube at room temperature for 5 min (be careful not to dry it too much, otherwise the RNA precipitate will not dissolve easily). Add an appropriate amount of deionized nuclease-free water to dissolve it, and you will get the total RNA sample.
[0044] ⑦ The absorbance was measured using a spectrophotometer (Nanodrop), and the quality of the extracted total RNA was determined by 1% agarose gel electrophoresis. The qualified RNA samples were stored at -80℃ for later use.
[0045] (4) cDNA synthesis
[0046] Use the ReverTra Ace® qPCR RT Master Mix with gDNA Remover (TOYOBO) kit and follow the instructions for the experimental procedure:
[0047] ① For first-time use, mix the 4×DNA Master Mix and gDNA Remover in the kit at a ratio of 50:1.
[0048] ② RNA denaturation: 2 µg of RNA sample was denatured in a 65℃ water bath for 5 min and immediately placed on ice to cool.
[0049] ③ gDNA removal reaction: Prepare the following reaction solution on ice, mix the reaction solution gently, and incubate at 37°C for 5 min.
[0050]
[0051] ④ Reverse transcription reaction: Prepare the following reaction solution on ice:
[0052]
[0053] ⑤ After gently mixing the reaction solution, proceed with the reverse transcription reaction according to the following procedure: 37°C for 15 min, 50°C for 5 min, 98°C for 5 min, and hold at 4°C. After the reaction is complete, dilute the sample 3 times and store at -20°C for later use.
[0054] (5) Purification of PCR products
[0055] Samples with a single amplified band can be directly purified by affinity chromatography, while samples with multiple amplified bands can be recovered by gel extraction.
[0056] (6) dsRNA synthesis
[0057] dsRNA was synthesized using the T7 RNA Transcription Kit Plus (Zhisheng Yougu, SJ001V2), and the experimental procedures were performed according to the instructions.
[0058] The T7 RNA Polymerase Mix and NTP Mix should be thawed on ice, while the remaining components should be thawed at room temperature.
[0059] Prepare the reaction system according to the following formula:
[0060]
[0061] Gently mix the reaction solution thoroughly and incubate at 37°C for 2-4 hours to allow the reaction to proceed completely. For samples with a length of less than 400 nt, the reaction time can be appropriately extended, but should not exceed 16 hours.
[0062] (7) dsRNA purification
[0063] Use the RNA magnetic bead purification kit (MagBeads RNA Purification Kit, PU002) to vortex or invert the binding magnetic beads several times to thoroughly mix them.
[0064] ① Add an equal volume of binding magnetic beads to the sample to be purified, mix thoroughly with a pipette, and incubate at room temperature for 8 min.
[0065] ② Place the sample on the magnetic rack and magnetically attract it for 5 minutes. After the magnetic beads have completely gathered, remove the supernatant (the centrifuge tube is still placed on the magnetic rack).
[0066] ③ Rinse the magnetic beads with wash buffer, incubate at room temperature for 30 seconds, and carefully aspirate the supernatant;
[0067] ④ Repeat the previous step, rinsing twice in total;
[0068] ⑤ Keep the sample on the magnetic rack and open the lid to dry the magnetic beads at room temperature for 3-5 minutes to allow any residual ethanol or other liquids to evaporate completely.
[0069] ⑥ Remove the sample from the magnetic rack, add 50µL of deionized nuclease-free water, gently mix with a pipette, and incubate at room temperature for 3 min;
[0070] ⑦ Place the sample on a magnetic rack and wait for the magnetic beads to completely aggregate (approximately 2 minutes). Carefully aspirate the supernatant into a new deionized nuclease-free water centrifuge tube. This solution is the purified RNA sample. The purified RNA can be directly used in the next step of the experiment or stored at -20°C.
[0071] (8) Real-time quantitative PCR (qRT-PCR)
[0072] The kit used for the qRT-PCR reaction was 2 × Universal SYBR Green qPCR Master Mix (Zhisheng Yougu, QM001). All reagents were kept on ice throughout the entire procedure. Because the fluorescent dye needs to be protected from light, the 96-well PCR plates used for the reaction were specifically designed for quantitative real-time PCR.
[0073] ① Prepare the reaction solution according to the following components. The entire operation should be carried out on ice. Mix gently to avoid generating bubbles.
[0074]
[0075] Primer 1: TGATTTCATTCATGGTATAATCCAA;
[0076] Primer 2: CCCAAATCATCTGCTCGAAT.
[0077] ②A two-step PCR procedure is generally used for Real-Time PCR reactions.
[0078]
[0079] Example 2: Preparation of BioIon18@dsRNA
[0080] Zinc solution: 40~50% w / v Zn 2+ Solutions (including but not limited to zinc nitrate (Zn(NO3)2), zinc sulfate (ZnSO4), zinc chloride (ZnCl2), etc.) are prepared by dissolving in deionized water and heating with stirring until completely dissolved. The solution is then titrated with Tris-HCl until the pH reaches 7.0.
[0081] To prepare the lyophilized dsRNA powder: Add approximately 2% w / v trehalose and 2-20% mannitol to dsEGFP and dsHaND3 at a concentration of 10 mg / ml, mix well, and freeze-dry in a freeze dryer.
[0082] Compounding method:
[0083] (1) Dissolve 1 mg of dsRNA lyophilized powder in 10 mL of nuclease-free water. Add the dsRNA solution to a 30 kDa ultrafiltration centrifuge tube, centrifuge at high speed for 2-5 minutes, and discard the waste liquid. Add an appropriate amount of fresh nuclease-free water to the upper chamber, mix well, and then centrifuge to concentrate to the target volume. Repeat this step 2-3 times to remove other inorganic salts remaining during dsRNA synthesis and purification.
[0084] (2) Subsequently, the dsRNA solution was adjusted to the desired concentration, such as 10 mg / ml or 1 mg / ml, and then mixed with zinc solutions of different concentrations to achieve a zinc salt to dsRNA mass concentration ratio of 5000:1 (molar ratio 1:10). -6 ) or 5:1 (molar ratio 1:10) -3 ), to obtain the BI18@dsRNA complex solution.
[0085] (3) Then, 5000 : 1 (molar ratio 1 : 10) -6 The BI18@dsRNA solution was serially diluted 6 times to obtain 7 different mass ratios of BI18@dsRNA for different efficacy exploration.
[0086] Example 3: Binding of dsRNA with the dsRNA auxiliary BI18
[0087] (1) TEM results showed that naked dsRNA crystallized in linear clusters close to each other, but after the introduction of BI18, dsRNA crystallized into curved and folded shapes. Figure 1 (Right); and the Cryo-EM image shows that BI18@dsRNA, at the edge of the pore where the complex concentration is high, undergoes a aggregation phenomenon, changing from the original free linear shape to a star-shaped cluster. Figure 1 (Left) This indicates that the introduction of BI18 affects the structure of dsRNA. Using DLS dynamic photodiffraction experiments, we obtained a particle size of 401.9 ± 32.8 nm for BI18@dsRNA, which is smaller than the particle size of naked dsRNA (544.3 ± 64.9 nm). Figure 2 Top left). The PDI of BI18@dsRNA increased by 0.26 compared to dsRNA, indicating that BI18@dsRNA is less uniformly dispersed in solution than dsRNA. Figure 2 (Top right). Meanwhile, zeta potential analysis showed that, compared to the negatively charged naked dsRNA, the BI18@dsRNA had a potential of 4.75 mV, making the dsRNA complex as a whole positively charged. Figure 2 (See below). Therefore, the presence of BI18 can reduce the electrostatic repulsion between phosphate groups of dsRNA fragments, which in turn causes the dsRNA to first compress and shorten, and then tend to aggregate. At the same time, the smaller size of BI18@dsRNA and the change in electronegativity from negative to positive facilitate the endocytosis of dsRNA by negatively charged cell membranes, thereby facilitating its transport in vivo.
[0088] (2) ITC results ( Figure 3 The results showed that BI18 and dsRNA can interact, and the dissociation constant Kd for their interaction is 1.07 × 10⁻⁶. -4 M, BI18 and dseGFP K d The sensitivity of their binding is on the order of millimoles, with ΔG < 0, indicating that both binding processes can occur spontaneously. ΔH = -0.492 kcal / mol indicates that the binding process is exothermic, and BI18 may form specific hydrogen bonds with atoms at the edges of nucleic acid bases or on the ribose-phosphate backbone, thus causing exothermic reactions. -TΔS = -4.93 kcal / mol indicates that the process is significantly endothermic and involves a significant increase in entropy. This suggests that the formation of the BI18@dsRNA complex is a binding process driven by both entropy and enthalpy, but entropy-driven factors are dominant.
[0089] Example 4: Enhanced resistance of BI18@dsRNA to RNase A degradation
[0090] BI18@dsRNA was incubated with RNase A for 30 min, and agarose gel electrophoresis was used to obtain the results. The molar ratio of BI18@dsRNA was 1:10. -6 – 1 : 10 -3 The main band was significantly preserved compared to naked dsRNA. Figure 4 a). We determined the "critical load" for BI18@dsRNA major band degradation to be 1:10. -3 Naked dsRNA, immediately after being mixed with RNase A and added to the gel wells for electrophoresis, showed significant degradation of the main band at time 0, with complete degradation of the main band at 1 hour. Figure 4 b). This demonstrates that BI18@dsRNA possesses a very strong protective ability against degradation of dsRNA under RNase A conditions.
[0091] Example 5: Improved resistance of BI18@dsRNA to degradation by strong ultraviolet light
[0092] The ultraviolet irradiation experiment used a 254nm low-pressure mercury lamp as the experimental light source, with an irradiance of approximately 75 μW / cm². 2 The experimental sample was placed 2 cm away from the light source, and after irradiation for 30 minutes, agarose gel electrophoresis was performed. The results are as follows: Figure 5 As shown, this indicates that BI18@dsRNA at a molar ratio of 1:10 -3 – 1 : 10 -1 The BI18@dsRNA exhibits significant main band retention within its range compared to the control group's naked dsRNA, thus demonstrating its UV stability.
[0093] Example 6: BI18@dsRNA promotes intracellular uptake of dsRNA
[0094] After BI18@dsRNA achieved a certain level of environmental stability, we explored its effects in vivo. The naked dsRNA control group was prepared by adding dsRNA-Cy3 to BmN cell culture medium, while the BI18@dsRNA group received BI18@dsRNA-Cy3 simultaneously. After 24 hours, the results were observed under a stereomicroscope. Figure 6 As shown in the figure, we found that the amount of intracellular dsRNA entering the cells of the BI18@dsRNA group was significantly greater than that of the control group, indicating that BI18@dsRNA can promote cellular uptake of dsRNA.
[0095] Example 7: BI18@dsRNA can improve the efficiency of RNAi in pests
[0096] Having demonstrated the intracellular uptake ability of BI18@dsRNA, we further investigated its impact on the RNAi efficacy at the target site. We selected the HaND3 gene from cotton bollworm larvae as the target site for RNAi. The results showed that, compared to dsHaND3, BI18@dsHaND3 reduced the relative expression level of HaND3 from 0.61 to 0.38, resulting in a 58.7% increase in target interference efficiency. Figure 7 This indicates that the BI18@dsRNA delivery system enhances RNAi in cotton bollworm larvae, thus possessing significant potential for application in agricultural pest and disease control.
[0097] Example 8: BI18@dsRNA complex prepared using zinc chloride as a raw material
[0098] (1) The preparation method is the same as in Example 2, except that the raw material for dsRNA is replaced with ZnCl2; at the same time, in the process of preparing the biological compound composition, only the molar ratio of dsRNA protectant to dsRNA solution stock solution is set to 1:10. -3 The group.
[0099] (2) Rice plants with stable eGFP transformation in stomata were selected as experimental materials and cultured hydroponically. When the plants reached the four-leaf stage, the second-to-last leaf was selected for smear treatment. Three parallel rice plants were set up for each treatment group: water treatment (blank control group), dsHaACE (negative control group), BI18.2 group, dseGFP group, and BI18.2@dseGFP group. 48 hours after treatment, fluorescence microscopy was used for observation. The results showed that the eGFP fluorescence level in the leaves of the BI18.2@dseGFP group was significantly lower than that in the dseGFP group. Figure 8 This indicates that BI18@dseGFP promotes the absorption of dsRNA by plants.
[0100] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. Application of zinc in the preparation of dsRNA compound formulations.
2. A dsRNA compounding adjuvant, characterized in that: The dsRNA compounding aid is a zinc salt.
3. The dsRNA compounding agent according to claim 1, characterized in that: The zinc salt is one or more of zinc nitrate, zinc sulfate, and zinc chloride.
4. A method for preparing RNA biopesticides using the dsRNA compound adjuvant as described in claim 2 or 3, characterized in that, The steps are as follows: dsRNA complex adjuvant and dsRNA are mixed in solution to form RNA micelle biopesticide.
5. The method for preparing RNA biopesticides using dsRNA compound adjuvants according to claim 4, characterized in that: The molar ratio of the dsRNA compounding agent to dsRNA is 1:
10. -6 -1 :
1.
6. The method for preparing RNA biopesticides using the dsRNA compound adjuvant according to claim 5, characterized in that: Zn in the dsRNA compounding adjuvant 2+ The content is 0.03-30% w / v.
7. The method for preparing RNA biopesticides using dsRNA compound adjuvants according to claim 5, characterized in that: The dsRNA content in the dsRNA compound adjuvant is 0.5-10 mg / mL.
8. The method for preparing RNA biopesticides using dsRNA compound adjuvants according to claim 5, characterized in that: The dsRNA is synthesized using a gene with biocontrol effects as a template.
9. An RNA biopesticide prepared using the method according to any one of claims 5-8, characterized in that: The RNA biopesticide is a cationic polyelectrolyte formed by zinc salt and dsRNA, namely dsRNA micelles.
10. The application of the RNA biopesticide according to claim 9 in the preparation of products for controlling agricultural pests.
Citation Information
Patent Citations
DsRNA for preventing and treating liriomyza sativae and pesticide compound thereof
CN121065189A