Detection primer, detection product, detection method and application of EPSPS mutant plant

By designing specific PCR primers and detection methods, the problem of rapid identification of EPSPS mutant genes in rice has been solved, enabling accurate detection of EPSPS mutant plants and supporting the breeding and commercial application of glyphosate-tolerant rice.

CN122038633APending Publication Date: 2026-05-15SICHUAN GEVOTO BIOTECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SICHUAN GEVOTO BIOTECH CO LTD
Filing Date
2026-03-16
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately identify whether rice contains specific EPSPS mutant genes, which affects the breeding and commercial application of transgenic rice.

Method used

Design specific PCR primers (such as SEQ ID NO: 3 and SEQ ID NO: 4) to detect EPSPS mutant plants, distinguish wild-type and mutant EPSPS genes through PCR reaction and sequencing analysis, and provide detection products such as kits, chips or detectors.

Benefits of technology

It enables rapid and accurate detection of EPSPS mutant plants, and can identify mutations such as K274R, K313E and V403A, supporting glyphosate-tolerant rice breeding and simplifying the identification process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122038633A_ABST
    Figure CN122038633A_ABST
Patent Text Reader

Abstract

The invention discloses a detection primer, a detection product, a detection method and application of an EPSPS mutant plant, and relates to the technical field of plant biological molecular biology. The detection primer comprises primers as shown in SEQ ID NO: 3 and SEQ ID NO: 4. The primer can realize rapid and accurate detection of EPSPS mutant plants. The invention provides a simpler and quicker technical method for quickly detecting the glyphosate herbicide-resistant 4KO89 and / or 4KO44 plants.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant biomolecular biology, particularly to crop breeding in agricultural biotechnology research, and specifically to a detection primer, detection product, detection method, and application for EPSPS mutant plants. Background Technology

[0002] Rice is one of the world's most important food crops, especially in Asia, where it serves as the staple food for more than half the population. Its cultivation and supply are of profound significance to food security and social stability. In agricultural production, rice, due to its strong adaptability and diverse planting patterns (such as paddy fields and dry land), has become a key product in different agroecological zones. However, rice production also faces many challenges, among which competition from weeds is a significant factor restricting rice yield and quality. Weeds compete with rice for sunlight, water, nutrients, and growing space, affecting rice growth and leading to reduced yields. Therefore, weed control is a crucial aspect of rice production.

[0003] To address weed problems, traditional methods mainly rely on manual weeding or chemical herbicides. However, the former is labor-intensive and inefficient, while the latter may lead to environmental pollution, pesticide residues, and weed resistance. Against this backdrop, developing herbicide-tolerant genetically modified crops through genetic engineering has become an important strategy. Glyphosate, a non-selective herbicide, has rapidly gained dominance in the global herbicide market due to its broad-spectrum, low-toxicity, safety, and lack of soil residue. Glyphosate is produced by the extraction of 5-hydroxychloroplasts from plant chloroplasts. Enolacetone Shikimic acid 3 Herbicides targeting phosphophosphate synthase (EPSPS) are currently the most commonly used glyphosate-resistant gene on the market. This gene, isolated from Agrobacterium by Monsanto, confers strong resistance to glyphosate. The introduction of the CP4 gene into crops to acquire glyphosate resistance through transgenic technology is now widely used, with corn and soybean varieties containing the CP4 gene being extensively promoted over the past 20 years. This technology has not only significantly improved weed control efficiency and reduced weeding costs but also reduced the excessive use of chemical pesticides, helping to mitigate agricultural non-point source pollution and protect the ecological environment. However, the acceptance of genetically modified crops worldwide remains low. Even in the Americas, where the largest area of ​​genetically modified crop cultivation is located, genetic modification is mainly limited to a few crops such as corn, soybeans, and cotton; there are currently no commercially available genetically modified rice products. Therefore, developing non-Glyphosate-resistant rice is particularly important.

[0004] The applicant's two previously filed patents, ZL 202411257192.4 and ZL 202411257199.6, protect two rice EPSPS mutants that provide glyphosate resistance, expression cassette nucleic acid molecules, and their applications in rice. Using these patents in rice, transformation events that meet the agronomical and functional requirements for production applications have been screened. The ideal transformation events obtained through screening can be backcrossed into other genetic backgrounds using conventional breeding methods such as sexual hybridization. Offspring produced through this hybridization method retain the target characteristics and traits of the original event.

[0005] Identifying the presence of target genes or expression cassettes in transformants is of significant value for hybridization breeding, production applications, commercial registration, and patent protection. Therefore, designing primers based on the nucleic acid information of target genes or expression cassettes to rapidly detect their presence in test plants is particularly important.

[0006] In view of this, the present invention is proposed. Summary of the Invention

[0007] The purpose of this invention is to provide a detection primer, detection product, detection method and application for EPSPS mutant plants, so as to accurately and rapidly identify whether biological samples contain specific DNA molecules.

[0008] This invention is implemented as follows: In a first aspect, the present invention provides a detection primer for EPSPS mutant plants, comprising primers as shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0009] Secondly, the present invention provides a detection product comprising the detection primers for the aforementioned EPSPS mutant plants, wherein the detection product is a reagent, kit, chip, or detector.

[0010] Thirdly, the present invention provides a method for detecting EPSPS mutant plants, comprising the following steps: mixing the nucleic acid sample to be tested with the detection primers for EPSPS mutant plants, performing nucleic acid amplification in an amplification system to obtain amplification products, and detecting the amplification products to obtain EPSPS mutation results.

[0011] Fourthly, this invention provides the application of detection primers for EPSPS mutant plants in the preparation of detection products for EPSPS mutant plants, which are reagents, kits, chips, or detectors.

[0012] The present invention has the following beneficial effects: This invention utilizes primers designed based on the EPSPS mutant gene sequence of EPSPS mutant plants to achieve rapid and accurate detection of EPSPS mutant plants. The primers shown in SEQ ID NO: 3 and SEQ ID NO: 4 can accurately detect EPSPS mutant plants carrying K274R, K313E, and V403A mutations, as well as EPSPS mutant plants carrying K274R, K311Q, and V403A mutations.

[0013] The detection primers provided in this invention can be used to detect differential bases in nucleic acid molecules via PCR reaction to distinguish between specific EPSPS mutant genes and wild-type EPSPS coding genes, establishing a rapid detection method for identifying specific EPSPS mutant genes. This method uses specific EPSPS mutant gene sequences as target sequences. Through PCR detection and sequencing, it can accurately detect whether the tested plant contains specific EPSPS mutant genes, i.e., whether it contains the coding genes for 4KO89 and / or 4KO44 mutants. It exhibits good specificity and provides a simpler and faster technical method for the rapid detection of glyphosate-resistant 4KO89 and / or 4KO44 plants. Attached Figure Description

[0014] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0015] Figure 1 Electrophoresis diagram of PCR products for detecting the A131G+G172A+P177S mutation site; Figure 2 Electrophoresis images of PCR products used to detect K274R, K313E and V403A or K274R, K311Q and V403A mutation sites; Figure 3 The image shows the bimodal sequencing results of mutant sites for the two expression cassettes 4KO89 (A) and 4KO44 (B); Figure 4 The image shows the results of the repeatability and stability verification of primers SEQ ID NO:1-4. Detailed Implementation

[0016] Reference will now be made to detailed embodiments of the present invention, one or more of which are described below. Each example is provided for explanation and not for limitation of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the invention without departing from its scope or spirit. For example, features described or illustrated as part of one embodiment may be used in another embodiment to produce further embodiments.

[0017] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0018] In a first aspect, the present invention provides a detection primer for EPSPS mutant plants, comprising primers as shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0019] The nucleotide sequence of SEQ ID NO: 3 is as follows: AAGTGCAACTCTTCTTGGGGAAC; The nucleotide sequence of SEQ ID NO: 4 is as follows: GTCACAATGCTAAGCAGTAATTGCTAG.

[0020] The target fragment amplified by SEQ ID NO: 3 and SEQ ID NO: 4 is 1513 bp in size. The mutation sites detected in SEQ ID NO: 3 and SEQ ID NO: 4 are K274R, K313E, and V403A, or K274R, K311Q, and V403A. The mutation information of the nucleotides corresponding to the K274R, K313E, and V403A mutation sites is: A to G at position 3886, A to G at position 4002, and T to C at position 4582. The mutation information of the nucleotides corresponding to the K274R, K311Q, and V403A mutation sites is: A to G at position 3886, A to C at position 3996, and T to C at position 4582.

[0021] The detection principle is as follows: The EPSPS mutant gene (i.e., the 4KO89 mutant coding gene) in patent ZL 202411257192.4 has multiple base mutations in its exons compared with the wild-type rice EPSPS (4KOWT) coding gene nucleotide sequence. Specifically, the 3096th base from the 5' end to the 3' end of the nucleic acid sequence of mutant 4KO89 is mutated from C to G, the two consecutive bases at positions 3219 and 3220 are mutated from GA to CG, position 3233 is mutated from C to T, position 3235 is mutated from A to C, position 3886 is mutated from A to G, position 4002 is mutated from A to G, and position 4582 is mutated from T to C. The corresponding amino acid sequences, compared with those of wild-type rice EPSPS, are as follows: amino acid residue 131 from the N-terminus to the C-terminus is mutated from A to G; amino acid residue 172 is mutated from G to A; amino acid residue 177 is mutated from P to S; amino acid residue 274 is mutated from K to R; amino acid residue 313 is mutated from K to E; and amino acid residue 403 is mutated from V to A.

[0022] The EPSPS mutant gene (i.e., the 4KO44 mutant coding gene) in ZL 202411257199.6 has multiple base mutations in its exons compared to the wild-type rice EPSPS coding gene fragment (4KOWT). Specifically, the 4KO44 mutant nucleotide sequence has the following mutations: position 3096 (5' to 3') is changed from C to G; positions 3219 and 3220 are changed from GA to CG; position 3233 is changed from C to T; position 3235 is changed from A to C; position 3886 is changed from A to G; position 3996 is changed from A to C; and position 4582 is changed from T to C. Its amino acid sequence also shows multiple site mutations in amino acid residues compared to the wild-type rice EPSPS amino acid sequence. The mutations are as follows: the 131st amino acid residue from the N-terminus to the C-terminus is changed from A to G (A131G); the 172nd amino acid residue is changed from G to A (G172A); the 177th amino acid residue is changed from P to S; the 274th amino acid residue is changed from K to R; the 311th amino acid residue is changed from K to Q; and the 403rd amino acid residue is changed from V to A.

[0023] Therefore, PCR can be used to detect the differential bases between the EPSPS mutant and wild-type EPSPS nucleic acid molecules to distinguish the 4KO89 or 4KO44 expression cassette from the 4KOWT encoding gene. The primers shown in SEQ ID NO: 3 and SEQ ID NO: 4 can detect both the 4KO89 and 4KO44 expression cassettes.

[0024] This invention designs PCR primers using the nucleotide sequence difference regions of two genes as templates to ensure that the amplified products are nucleic acid fragments containing mutation sites. Based on the sequencing results of the nucleic acid fragments, the mutation sites are compared. As long as the sequencing peak diagram shows the peak value of the mutation site in each expression cassette, it can be confirmed that the expression cassette is contained.

[0025] Furthermore, because PCR primers are non-specific, they can simultaneously amplify the nucleic acid sequence of the mutant expression cassette and the nucleotide sequence of the 4KOWT encoding gene. Therefore, when the test material is heterozygous, the sequencing peak at the mutation site will show both wild-type and mutant peaks, resulting in a double peak. When the test material is homozygous, it will show a single peak at the mutation site. Therefore, the presence of the mutation site contained in the expression cassette and the aforementioned expression cassette nucleic acid molecules can be determined based on the peak pattern of the sequencing results.

[0026] In a preferred embodiment of the present invention, the detection primers further include primers as shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0027] SEQ ID NO: 1: CAAGCAGTGCTTTCTCCCAAAATTATG; SEQ ID NO: 2: AATGCTAATTCAAAAGAAGACATCAAGACC. Primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 are used to detect mutation sites A131G, G172A, and P177S. The amplified products are sequenced, and the presence of the target EPSPS mutant gene is determined by the sequencing peak diagram. SEQ ID NO: 1 and SEQ ID NO: 2, in combination with SEQ ID NO: 3 and SEQ ID NO: 4, can detect 6-site mutations in the EPSPS enzyme.

[0028] Secondly, the present invention provides a detection product comprising the detection primers for the aforementioned EPSPS mutant plants, wherein the detection product is a reagent, kit, chip, or detector.

[0029] Those skilled in the art can easily embed or immobilize the aforementioned detection primers for EPSPS mutant plants on the surface of substrates such as microfluidic chips, thereby facilitating detection.

[0030] In a preferred embodiment of the present invention, the kit further includes: dye, PCR Mix, DNA polymerase, positive control, and negative control.

[0031] The preferred DNA polymerase is a hot-start DNA polymerase, such as Tth DNA polymerase or Taq DNA polymerase.

[0032] PCR Mixes include buffer system reagents, including but not limited to PB series, Tris series, etc. These can also be purchased commercially. In one embodiment, DNA polymerase and dye can be added to the Mix to create a PCR Mix.

[0033] In one embodiment, an anti-PCR inhibitor factor, such as spermidine, trehalose, betaine, etc., may also be added to the PCR Mix.

[0034] In a preferred embodiment of the present invention, the dye is selected from any one of SYBRGreenI, EvaGreen, SytoxGreen, EtBr, SYBRGreenII, SYBRGold, SYBRSafe, LCGreen, GelGreen, GelRed, DAPI, Syto9, SytoxBlue, SytoxRed, SytoxOrange, and ThiazoleOrange.

[0035] The detection products (such as kits) provided by the present invention may optionally include any reagents and / or consumables acceptable in the art for PCR reactions or for preparing PCR reaction systems. Specific embodiments may include, but are not limited to, one or more of dNTPs, salts or salt solutions, blank controls, calibrators, and PCR reaction containers.

[0036] Thirdly, the present invention provides a method for detecting EPSPS mutant plants, comprising the following steps: mixing the nucleic acid sample to be tested with the detection primers for EPSPS mutant plants, performing nucleic acid amplification in an amplification system to obtain amplification products, and detecting the amplification products to obtain EPSPS mutation results.

[0037] The samples that the nucleic acid product to be tested can detect include, but are not limited to, samples from plant roots, stems, leaves, flowers, seeds, or mixed samples from multiple plant parts.

[0038] In a preferred embodiment of the present invention, the nucleic acid amplification procedure includes: 95℃ for 3 min; 95℃ for 10 s, 56.7℃ (SEQ ID NO: 3 and SEQ ID NO: 4) for 15 s or 56.8℃ (SEQ ID NO: 1 and SEQ ID NO: 2) for 15 s, 72℃ for 15 s, for 30-40 cycles.

[0039] It is obvious to those skilled in the art that the desired band can generally be obtained by varying the TM value by a few degrees. In this invention, the TM value is available in the range of 55-58°C.

[0040] In a preferred embodiment of the present invention, the amplification product is sequenced, and the sequencing results are compared to obtain the genotype of the EPSPS mutant plant.

[0041] In a preferred embodiment of the present invention, the final concentration of primers in the amplification system is 10 μM ± 0.5 μM.

[0042] Fourthly, this invention provides the application of detection primers for EPSPS mutant plants in the preparation of detection products for EPSPS mutant plants, wherein the detection products for EPSPS mutant plants are reagents, kits, chips, or detectors. In a preferred embodiment of the present invention, the plant is rice, tobacco, soybean, corn, cotton, sorghum, wheat, or rapeseed.

[0043] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0044] Example 1 This embodiment provides primers for detecting rice EPSPS mutants, including primers SEQ ID NO: 1-10 for detecting the coding gene of the 4KO89 / 4KO44 mutant. SEQ ID NO: 1-2 and SEQ ID NO: 5-8 are used to detect the A131G+ G172A+P177S mutation site in the 4KO89 / 4KO44 mutant. SEQ ID NO: 3-4 and SEQ ID NO: 9-10 are used to detect the K274R+K313E+V403A mutation site in the 4KO89 mutant and the K274R+K311Q+V403A mutation site in the 4KO44 mutant. The primer sequence listing is shown in Table 1.

[0045] Table 1 Primer Information Table

[0046] Example 2 This embodiment provides a method for detecting EPSPS mutants in rice. The detection principle is as follows: The EPSPS mutant gene (i.e., the 4KO89 mutant coding gene) in ZL 202411257192.4 has multiple base mutations in its exons compared to the wild-type rice EPSPS (4KOWT) coding gene nucleotide sequence. Specifically, the 4KO89 mutant nucleotide sequence has the following mutations: the base at position 3096 from the 5' end to the 3' end is changed from C to G; the two consecutive bases at positions 3219 and 3220 are changed from GA to CG; position 3233 is changed from C to T; position 3235 is changed from A to C; position 3886 is changed from A to G; position 4002 is changed from A to G; and position 4582 is changed from T to C. The corresponding amino acid sequences, compared with those of wild-type rice EPSPS, are as follows: amino acid residue 131 from the N-terminus to the C-terminus is mutated from A to G; amino acid residue 172 is mutated from G to A; amino acid residue 177 is mutated from P to S; amino acid residue 274 is mutated from K to R; amino acid residue 313 is mutated from K to E; and amino acid residue 403 is mutated from V to A.

[0047] The EPSPS mutant gene (i.e., the 4KO44 mutant coding gene) in ZL 202411257199.6 has multiple base mutations in its exons compared to the wild-type rice EPSPS coding gene fragment (4KOWT). Specifically, the 4KO44 mutant nucleotide sequence has the following mutations: position 3096 (5' to 3') is changed from C to G; positions 3219 and 3220 are changed from GA to CG; position 3233 is changed from C to T; position 3235 is changed from A to C; position 3886 is changed from A to G; position 3996 is changed from A to C; and position 4582 is changed from T to C. Its amino acid sequence also shows multiple site mutations in amino acid residues compared to the wild-type rice EPSPS amino acid sequence. The mutations are as follows: the 131st amino acid residue from the N-terminus to the C-terminus is changed from A to G (A131G); the 172nd amino acid residue is changed from G to A (G172A); the 177th amino acid residue is changed from P to S; the 274th amino acid residue is changed from K to R; the 311th amino acid residue is changed from K to Q; and the 403rd amino acid residue is changed from V to A.

[0048] Therefore, PCR reactions can be used to detect differential bases in nucleic acid molecules to distinguish between the 4KO89 or 4KO44 expression cassettes and the 4KOWT encoding gene. The method of this invention uses the nucleotide sequence difference regions of the two genes as templates to design PCR primers, ensuring that the amplified product is a nucleic acid fragment containing the mutation site. Based on the sequencing results of the nucleic acid fragment, mutation site alignment is performed; if the sequencing peak diagram shows the peak value of the mutation site in each expression cassette, the presence of that expression cassette can be confirmed.

[0049] Furthermore, because PCR primers are non-specific, they can simultaneously amplify the nucleic acid sequence of the mutant expression cassette and the nucleotide sequence of the 4KOWT encoding gene. Therefore, when the test material is heterozygous, the sequencing peak at the mutation site will show both wild-type and mutant peaks, resulting in a double peak. When the test material is homozygous, it will show a single peak at the mutation site. Therefore, the presence of the mutation site contained in the expression cassette and the presence of the EPSPS mutant expression cassette nucleic acid molecule can be determined based on the peak pattern of the sequencing results.

[0050] The specific steps of the detection method are as follows: 1. Experimental reagents 1 M Tris-HCl (pH 8.5): Dissolve 121.14 g Tris in 750 mL ddH2O. After complete dissolution, adjust the pH to 8.5 with concentrated hydrochloric acid, add ddH2O to 1 L, and incubate at 121℃ for 20 min.

[0051] 0.5 M EDTA (pH 8.0): Dissolve 186.12 g disodium ethylenediaminetetraacetate dihydrate in 750 mL ddH2O, stir vigorously, and add solid NaOH while stirring (EDTA only dissolves completely under alkaline conditions), adjust the pH to 8.0, add ddH2O to 1 L, incubate at 121℃ for 20 min.

[0052] CTAB extract (500 mL): CTAB 10 g, 5 M NaCl 40.93 g, 0.5 M EDTA 20 mL, 1 M Tris-HCl (pH=8.0) 50 mL, β-mercaptoethanol 5 mL (add fresh before use), dd H2O added to 500 mL.

[0053] Taq enzyme premix Mix: Nanjing Novizan Biotechnology Co., Ltd. 2X Rapid Taq Master Mix (Catalog No.: P222-03).

[0054] 2. DNA template preparation Take young plant leaves into a 2mL centrifuge tube, add a small steel ball, mark the tube cap and tube wall, place it in liquid nitrogen for quick freezing, and grind it into fine powder using a ball mill.

[0055] After adding 500 mL of CTAB extract, mix quickly and incubate in a 65°C water bath for 60 min, inverting the container to mix every 15 min.

[0056] After cooling to room temperature, add 500 μL of DNA extraction buffer, invert and mix well, then let stand at room temperature for 2 min. Centrifuge at 10000 g for 10 min, and transfer the supernatant to a new 1.5 mL centrifuge tube.

[0057] Add an equal amount of isopropanol and mix well. Precipitate at -20℃ for 30 min; centrifuge at 10000 g for 10 min and discard the supernatant.

[0058] Wash the precipitate twice with 1 mL of 75% ethanol, centrifuge at 10000 g for 2 min, and remove excess ethanol with a pipette tip; air-dry the precipitate at room temperature. Add an appropriate amount of ddH2O and wait for the DNA to completely dissolve.

[0059] 3. DNA concentration determination The concentration of DNA was measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific), and the DNA solution was appropriately diluted to serve as a template.

[0060] 4. Primer design Based on sequence alignment of the rice wild-type EPSPS coding gene and the 4KO89 / 4KO44 mutant coding gene, differential sites that can distinguish between the rice wild-type EPSPS coding gene and the 4KO89 / 4KO44 mutant coding gene were selected. Primers were designed at appropriate upstream and downstream positions to amplify specific DNA fragments containing differential sites, and the PCR primers listed in Table 1 above were obtained.

[0061] 5. PCR detection PCR reaction system: Prepare the PCR reaction system according to the recommended system in Table 2. When adding the sample, ensure that the sample DNA solution is completely added to the reaction solution and does not adhere to the tube wall. After adding the sample, tighten the tube cap as soon as possible. After adding the sample, mix the sample thoroughly and perform a brief centrifugation to ensure that the sample is evenly distributed at the bottom of the reaction tube.

[0062] Table 2 PCR reaction system

[0063] PCR amplification parameters: 95℃ for 3 min; 95℃ for 10 s, TM for 15 s, 72℃ for 15 s, 38 cycles; 72℃ for 1 min; store at 4℃. TM values ​​are as follows: SEQ ID NO: 1 and SEQ ID NO: 2 TM value is 55.8℃, SEQ ID NO: 3 and SEQ ID NO: 4 TM value is 56.7℃, SEQ ID NO: 5 and SEQ ID NO: 6 TM value is 56℃, SEQ ID NO: 5 and SEQ ID NO: 7 TM value is 53℃, SEQ ID NO: 5 and SEQ ID NO: 8 TM value is 53℃, SEQ ID NO: 9 and SEQ ID NO: 10 TM value is 55℃, and SEQ ID NO: 9 and SEQ ID NO: 4 TM value is 55.8℃.

[0064] 6. Electrophoresis detection Electrophoresis was performed using a 1.5% agarose gel at 180 V for 15 min. DL2000 marker was added during electrophoresis.

[0065] 7. Results Analysis 7.1 Quality Control Electrophoresis results as follows Figure 1 and Figure 2 The blank control was a reaction sample using pure water as a template, and the target band was not detected. A positive control is a reaction sample that uses DNA from a positive plant as a template to detect the target band.

[0066] The negative control is a reaction sample using wild rice plant DNA as a template. The target band was detected, which is consistent with the above-mentioned PCR primers which are not specific and can simultaneously amplify the nucleic acid sequence of the mutant expression cassette and the nucleotide sequence of the wild-type EPSPS encoding gene.

[0067] 7.2 Electrophoresis Results Analysis and Sequencing according to Figure 1 and Figure 2 Electrophoresis results analysis showed that among the primer combinations for detecting the A131G+ G172A+P177S mutation site, the combination of primers SEQ ID NO:1 (R96A5) and SEQ ID NO:2 (R96A3) produced a singler and brighter PCR band, indicating better PCR performance. Similarly, among the primer combinations for detecting the K274R+K313E+V403A or K274R+K311Q+V403A mutation sites, the combination of primers SEQ ID NO:3 (4KO89DI-GS6-F3209) and SEQ ID NO:4 (4KO89DI-GS7-R4722) produced a singler and brighter PCR band, indicating better PCR performance.

[0068] PCR product samples amplified using primers SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4 were sent to a sequencing company for sequencing (Sanger sequencing). The primers used for sequencing were SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, respectively. Nucleic acid sequence analysis was performed based on the peak diagram results provided by the sequencing company.

[0069] 8. Result Judgment and Expression 8.1 Result Determination If the target band is amplified in all samples and the sequencing results show only the wild-type 4KOWT peak at the mutation site, it can be determined that the sample does not contain the specific EPSPS mutant gene sequence mentioned above, namely ZL 202411257192.4 and ZL202411257199.6.

[0070] All samples amplified the target band, and the sequencing results showed a peak at the 4KO89 mutation site in the sequencing peak diagram. Figure 3 Figure A in the diagram indicates that the sample contains mutation sites, namely A131G, G172A, P177S, K274R, K313E, and V403A.

[0071] All tested samples amplified the target band, and the sequencing results showed a peak at the 4KO44 mutation site in the sequencing peak diagram at the mutation site. Figure 3 Figure B in the diagram indicates that the sample contains mutation sites, namely A131G, G172A, P177S, K274R, K311Q, and V403A.

[0072] 8.2 Conclusion: If the sample detects the 4KOWT wild-type locus, it does not contain the EPSPS mutant gene sequences of A131G, G172A, P177S, K274R, K313E and V403A.

[0073] The sample was found to contain the 4KO89 mutation site, which is an EPSPS mutant (i.e., 4KO89) gene sequence containing A131G, G172A, P177S, K274R, K313E and V403A.

[0074] The sample was found to contain the 4KO44 mutation site, which is an EPSPS mutant (i.e., 4KO44) gene sequence containing A131G, G172A, P177S, K274R, K311Q and V403A.

[0075] Example 3 To verify the stability of the detection primers, PCR was performed three more times using primers SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, following the PCR conditions in Table 2. The PCR products were then electrophoresed on a 1.5% agarose gel at 180 V for 15 min. DL2000 marker was added during electrophoresis.

[0076] Electrophoresis results are shown Figure 4As shown in the figure, the test samples, positive plants, and negative plants all yielded the same expected target bands as in Example 2. Sequencing of the results revealed that the PCR products of the positive plants and the PCR results of the negative plants were consistent with expectations. The positive plants showed detectable mutations of A131G, G172A, P177S, K274R, K313E, and V403A, or A131G, G172A, P177S, K274R, K311Q, and V403A, while the negative plants did not show any corresponding mutations.

[0077] The above results indicate that the two primer pairs selected can stably perform PCR amplification, and the detection primers have good repeatability, making them suitable for identifying EPSPS mutant plants.

[0078] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A primer for detecting EPSPS mutant plants, characterized in that, It includes primers as shown in SEQ ID NO: 3 and SEQ ID NO:

4.

2. The detection primers for EPSPS mutant plants according to claim 1, characterized in that, The detection primers also include primers as shown in SEQ ID NO: 1 and SEQ ID NO:

2.

3. A testing product, characterized in that, It includes the detection primers for EPSPS mutant plants as described in any one of claims 1-2, wherein the detection product is a reagent, kit, chip, or detector.

4. The testing product according to claim 3, characterized in that, The kit also includes: dye, PCR Mix, DNA polymerase, positive control, and negative control.

5. The testing product according to claim 4, characterized in that, The dye is selected from any one of SYBR Green I, Eva Green, Sytox Green, EtBr, SYBR Green II, SYBR Gold, SYBR Safe, LC Green, Gel Green, Gel Red, DAPI, Syto9, Sytox Blue, Sytox Red, Sytox Orange, and Thiazole Orange.

6. A method for detecting EPSPS mutant plants, characterized in that, It includes the following steps: mixing the nucleic acid sample to be tested with the detection primers for EPSPS mutant plants as described in any one of claims 1-2, performing nucleic acid amplification in the amplification system, obtaining amplification products, and detecting the amplification products to obtain EPSPS mutation results.

7. The method according to claim 6, characterized in that, The nucleic acid amplification procedure includes: 95℃ for 3 min; 95℃ for 10 s, 55-58℃ for 15 s, 72℃ for 15 s, for 30-40 cycles.

8. The method according to claim 6, characterized in that, The amplified products were sequenced, and the sequencing results were compared to obtain the genotype of the EPSPS mutant plant.

9. The method according to claim 6, characterized in that, The final concentration of primers in the amplification system is 10 uM ± 0.5 uM.

10. The application of the detection primers for EPSPS mutant plants as described in any one of claims 1-2 in the preparation of detection products for EPSPS mutant plants, characterized in that, The EPSPS mutant plant detection product is a reagent, kit, chip, or detector; Preferably, the plant is rice, tobacco, soybean, corn, cotton, sorghum, wheat, or rapeseed.