Method for enhancing synthesis capability of yeast total protein and dipeptide tripeptide

By replacing the TATA box-binding protein-coding gene in yeast, a recombinant yeast engineered strain was constructed, which solved the problem of insufficient total protein and bioactive peptide synthesis capacity in yeast in the existing technology. It achieved a significant increase in total protein content and a significant enhancement in dipeptide and tripeptide accumulation, simplified the operation process, and provided global regulatory advantages.

CN122081371APending Publication Date: 2026-05-26TIANJIN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
TIANJIN UNIV
Filing Date
2026-03-18
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Existing technologies lack methods to simultaneously and efficiently enhance the synthesis capacity of total yeast protein and bioactive peptides, and there is insufficient attention paid to the systemic changes in dipeptides and tripeptides.

Method used

By replacing the endogenous TATA box-binding protein encoding gene ScSPT15 of Saccharomyces cerevisiae with the TATA box-binding protein encoding gene YlSPT15 of Yersinia lipolytica, a recombinant yeast engineered strain was constructed to achieve global transcriptional regulation.

Benefits of technology

It significantly increased the total protein content and dipeptide and tripeptide accumulation levels in yeast, simplified the operation process, synergistically regulated multiple physiological processes, and enhanced the protein synthesis capacity and peptide metabolite library of the strain.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122081371A_ABST
    Figure CN122081371A_ABST
Patent Text Reader

Abstract

The invention discloses a method for enhancing the synthetic ability of yeast total protein and dipeptide tripeptide. Relates to the technical field of synthetic biology and metabolic engineering. According to the invention, the saccharomyces cerevisiae engineering strain with high protein synthesis capability and high endogenous dipeptide and tripeptide accumulation level is successfully constructed. The metabonomics analysis reveals the unique peptide fragment accumulation spectrum, especially the generation of a large amount of lysine-rich tripeptide at the C terminal, and proposes a potential mechanism of metabolic pathway'bottleneck 'caused by peptidase activity down-regulation in combination with proteome data. The recombinant strain has important application potential in the fields of single-cell protein, functional peptide products and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of synthetic biology and metabolic engineering, and more specifically to a method for enhancing the synthesis capacity of total yeast protein and dipeptides and tripeptides. Background Technology

[0002] Yeast, as a crucial protein production platform, is typically engineered to increase the content of a single target protein or the total protein content. Traditional strategies, such as enhancing amino acid supply and optimizing secretion pathways, are often complex and disruptive to the cellular metabolic network. In recent years, modifying core transcription factors to regulate global gene expression has emerged as a new approach to improving the overall performance of the cell factory. TATA box-binding protein (TBP) is a core component of the eukaryotic transcription initiation complex, and its replacement has been shown to reshape the cellular transcriptome.

[0003] However, existing technologies primarily focus on changes in the content of macroscopic products such as proteins and ethanol, paying insufficient attention to the systemic alterations in the deep cellular metabolic network after modification, particularly small-molecule peptide metabolites. Dipeptides and tripeptides are not only intermediate products of protein degradation but also possess important biological activities such as antioxidant and signal transduction. Currently, there are no yeast metabolic engineering methods with the specific aim of directionally enhancing the synthesis of endogenous dipeptides and tripeptides within cells.

[0004] Therefore, whether a method can be provided to enhance the synthesis capacity of total yeast protein and dipeptides and tripeptides is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a method for enhancing the synthesis capacity of total yeast protein and dipeptides and tripeptides. Addressing the lack of existing methods for simultaneously and efficiently improving the synthesis capacity of total yeast protein and bioactive peptides, the present invention is a yeast modification method that is simple to operate, allows for global regulation at the transcriptional level, and simultaneously and significantly increases the total protein content and the accumulation levels of dipeptides and tripeptides. The core of this method lies in replacing the endogenous TATA box-binding protein encoding gene (ScSPT15) of *Saccharomyces cerevisiae* with the TATA box-binding protein encoding gene (YlSPT15) derived from *Yacinthia lipolytica*.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A method for enhancing the synthesis capacity of total yeast protein and dipeptides and tripeptides includes the following steps: The endogenous TATA box-binding protein encoding gene in the Saccharomyces cerevisiae genome was replaced with the TATA box-binding protein encoding gene YlSPT15 from Yersinia lipolytica to obtain a recombinant yeast engineered strain.

[0008] Preferred: The nucleotide sequence encoding the gene YlSPT15 is shown in SEQ ID NO: 1.

[0009] Preferably, the replacement is achieved through homologous recombination. The integrating DNA fragment used for transformation includes, sequentially along the 5' to 3' direction: (1) Left homologous arm: DNA fragment homologous to the upstream sequence of the SPT15 locus in the Saccharomyces cerevisiae genome; (2) Target gene: encoding gene YlSPT15; (3) Selection marker expression cassette: an expression cassette containing selection marker genes and their regulatory elements; (4) Right homologous arm: DNA fragment homologous to the downstream sequence of the SPT15 locus in the Saccharomyces cerevisiae genome.

[0010] Preferred: The nucleotide sequence of the left homologous arm is shown in SEQ ID NO.2; The nucleotide sequence of the expression cassette is shown in SEQ ID NO.4; the nucleotide sequence of the right homologous arm fragment is shown in SEQ ID NO.3.

[0011] The present invention also provides an engineered strain of *Saccharomyces cerevisiae*, which is prepared by any of the methods described above.

[0012] This invention also provides any of the above methods, or the application of the above engineered strains in the following fields: (1) Production of recombinant protein products; (2) Producing bioactive peptide products rich in lysine dipeptides or tripeptides; (3) Preparation of single-cell proteins and functional peptide products.

[0013] As can be seen from the above technical solution, compared with the prior art, this invention discloses a method to enhance the synthesis capacity of total yeast protein and dipeptides and tripeptides. The technical effect achieved is as follows: This invention successfully constructed a *Saccharomyces cerevisiae* engineered strain with both high protein synthesis capacity and high endogenous dipeptide and tripeptide accumulation levels by replacing the transcription factor "TATA-box binding protein" (derived from the yeast gene SPT15, hereinafter referred to as SPT15 or TBP). Metabolomics analysis revealed its unique peptide accumulation profile, especially the large-scale production of C-terminal lysine-rich tripeptides, and combined with proteomics data, proposed a potential mechanism of metabolic pathway "bottleneck" caused by the downregulation of peptidase activity. The recombinant strain has important application potential in the fields of single-cell protein and functional peptide products; specifically: 1. Simple and efficient operation: This invention involves the replacement of only a single gene locus, SPT15. The genetic operation is simple and clear, and there is no need for multi-point rational design of complex metabolic networks, which greatly shortens the strain construction cycle.

[0014] 2. Global regulatory advantages: By replacing core transcriptional machinery components, gene expression across the cell can be reprogrammed from the transcriptional source, enabling the synergistic regulation of multiple physiological processes related to protein synthesis, such as amino acid metabolism, energy allocation, and protein folding and degradation, thereby achieving a systemic increase in production.

[0015] 3. One factor, multiple effects, simultaneous enhancement: By replacing a single core transcription factor, it simultaneously enhances total protein synthesis capacity and significantly expands the peptide metabolite library.

[0016] 4. Novel mechanism and clear direction: This invention links TBP replacement with the activation / reprogramming of intracellular small peptide metabolic pathways, providing a new perspective for understanding the impact of global transcriptional engineering on deep metabolic networks.

[0017] 5. High product value: The obtained high peptide content strains are not only excellent protein production substrates, but their cells or extracts can also serve as potential sources of natural bioactive peptides, with broad application prospects.

[0018] 6. This invention uses detailed proteomic and metabolomic data to quantitatively demonstrate the increase in total protein and the specific accumulation of dipeptides and tripeptides (especially lysine-rich tripeptides). Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0020] Figure 1 The attached figures are schematic diagrams of the technical solution and core phenotypic diagrams provided by the present invention; wherein, A: schematic diagram of YlSPT15 replacing endogenous ScSPT15; B: comparison of total soluble protein content between Sc-YlTBP and Sc-Ctrl; C: comparison of total protein content between Sc-YlTBP and Sc-Ctrl.

[0021] Figure 2 The attached figure shows a comparison between the recombinant strain Sc-YlTBP provided by this invention and the original strain, illustrating the fold change in the content of the dipeptide.

[0022] Figure 3The attached figure is a statistical diagram showing the distribution of amino acid positions of the tripeptide compared with the original strain Sc-YlTBP provided by the present invention. It shows an extreme enrichment of lysine at the third position (C-terminus) (accounting for more than 70%), suggesting that it comes from protein ubiquitination degradation.

[0023] Figure 4 The attached figure shows the downregulation data of some peptidase expression levels in the recombinant strain Sc-YlTBP provided by the present invention. Detailed Implementation

[0024] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0025] This invention discloses a method for enhancing the synthesis capacity of total yeast protein and dipeptides and tripeptides.

[0026] Source of experimental materials in the examples: Yersinia lipolytica ATCC201249: American Type Culture Collection (ATCC) strain, number ATCC201249; Wild-type Saccharomyces cerevisiae S288c: American Type Culture Collection (ATCC) strain, accession number 204508; Saccharomyces cerevisiae BY4741: American Type Culture Collection (ATCC) strain, accession number 201388; All other experimental materials used in the examples were commercially available, standard products. Experimental methods not mentioned are conventional and will not be described further here.

[0027] Example 1 Construction of recombinant strains and determination of total soluble protein content. 1. Construction of integrated DNA fragments (1) Using the genome of Yersinia lipolytica ATCC201249 as a template, the open reading frame (ORF) fragment of the YlSPT15 gene was obtained by PCR amplification using primers 1F (5'-CATAAACAGGTGTATCAAGAGAAACTTTTTTAATTATGGATGCCCTCTCTGCCCCCACCA-3', as shown in SEQ ID NO.5) and 1R (5'-ATGATGAATTGAATTGAAAAGCTGTGGCTACCCCTTTCTAAACTCGTTCAAC-3', as shown in SEQ ID NO.6). The nucleotide sequence is as shown in SEQ ID NO.1.

[0028] (2) Using the genome of Saccharomyces cerevisiae BY4741 as a template, primer pairs 2F (5'- GAATTTGTACTTCTTTCGAAATCGTTCAATTTCTAC-3', as shown in SEQ ID NO.7) and 2R (5'- AATTAAAAAAGTTTCTCTTGATACACCTGTTTATG-3', as shown in SEQ ID NO.8) and 3F (5'- TGGGGAAGGAGTAGACGAAAAG-3', as shown in SEQ ID NO.9) and 3R (5'- GATGAGCGTGAACATAGATTCAAGCTGG-3', as shown in SEQ ID NO.8) were used respectively. As shown in NO.10, the left homologous arm fragment upstream of the SPT15 locus is amplified (nucleotide sequence: GAATTTGTACTTCTTTCGAAATCGTTCAATTTCTACCAATACTGATTCCCCTCTGATAGCTGAGATGTCGGGATTCCCTTTGCTGATAGATCTAACTCATCTCTTTACGTATTTTAATTGTGAAGCCGTAAATAGTTATCTTCCAAGTTTCTCTTACGCGAGCTTTTTGGGAAAAGAAAAAAATTTGAAGATCTACATATAAAACATGGCTTCA). AAGGATTACTAATGACTTTTTTTACCTTGATAGGTATTCTTGATGGTAAGAGTAAACAAGGGACGTGAAAATTACAGTAGTTACTGTTTTTTTTGGACTATAAGATCGGGGGAAAGATAACACATAAGAAATAAAACGACTACTAGTTAGACTGCTCTGCGGAAGAAGCAAGGAAGTAAAGGCTGCATTTTATTTTTCTTTTCTAGTCCAACATAAACAGGTGTATCAAGAGAAACTTTTTTAATT, such as SEQ ID NO.(As shown in SEQ ID NO. 3) and the downstream right homologous arm fragment (nucleotide sequence: TGGGGAAGGAGTAGACGAAAAGAAAAAAAGGTTTTCTATTTGTTCCATTTTCTCAATTATTAATGGTCCTCAAAGAAATAAAAGAAAAGGAAGAAGAAGTAATTGTAATATCAAACGGTTTTTTATAGTATATTCTTCTTATTCTATATTTATATCAATGTTTTATAATAAGATGTTTATTCATAGCATATCTGGTGGATCGTCTCTATTAAGCGCCAGCGAGGTGTTTGCCTCTGCATTTTTCAGCAAAGCAAGCTCCCTTTCCAGCTTGAATCTATGTTCACGCTCATC, as shown in SEQ ID NO. 3).

[0029]

[0030] (4) Using overlap-extension PCR, the purified left homologous arm fragment, YlSPT15 ORF fragment, "(YlC-)URA3" fragment, and right homologous arm fragment were assembled sequentially to obtain a complete integrated DNA fragment. The fragment was purified and set aside. The overlap-extension PCR system was configured as follows: 2 μL of each DNA fragment to be assembled was added to a 50 μL total volume, along with 25 μL of 2 × KOD One enzyme mix, and the remainder was brought to a total volume of 50 μL with ddH2O. The overlap-extension PCR procedure was the same as conventional PCR: heating at 95 ℃ for 3 minutes, followed by 30 cycles of "95 ℃ for 30 seconds, 55 ℃ for 30 seconds, 72 ℃ for 30 seconds", then extension at 72 ℃ for 5 minutes, followed by cooling to room temperature to complete the reaction.

[0031] 2. Transformation and Recombinant Strain Screening of Saccharomyces cerevisiae (1) Brewing yeast BY4741 was cultured in YPD liquid medium to mid-log growth.

[0032] (2) Using lithium acetate chemical conversion method: Yeast cells were collected, treated with 0.1 M LiAc, and then co-incubated with the integrated DNA fragment obtained in Example 1, salmon sperm vector DNA and PEG / LiAc conversion mixture. After heat shock, the yeast cells were spread on SC-Ura solid plates.

[0033] (3) Invert the plate at 30℃ for 2-4 days until clear transformed single clones appear on the plate.

[0034] (4) Randomly select several single clones from SC-Ura plates and perform colony PCR using the verification primers vF / vR located outside the integration region. Perform agarose gel electrophoresis on the amplification products, and it is expected that a band containing the size of the integration fragment (about 3 kb) will be amplified.

[0035] (5) The amplification products of the PCR-verified clones were sent for sequencing to confirm that the YlSPT15 gene had been accurately integrated into the correct genomic site without any unexpected mutations. The obtained recombinant strain was named Sc-YlTBP. Figure 1 A).

[0036] 3. Determination of total soluble protein content (1) The Sc-YlTBP strain and the control strain Sc-Ctrl (the strain with the Ura3 tag inserted only downstream of the original SPT15) were inoculated into 50 mL of SC-Ura liquid medium and cultured at 30℃ and 220 rpm for 72 hours.

[0037] (2) Collect cells from an equal volume of culture medium and wash them with PBS buffer.

[0038] (3) Extraction of total soluble protein: Collect yeast cells cultured for 72 hours and centrifuge at 12,000 rpm for 30 seconds per round. Add 3 ml of yeast lysin at a concentration of 10 mg / ml to each 1 gram of wet yeast cell pellet. Incubate the suspended yeast cells at 30°C for 60-90 minutes, centrifuging every 20 minutes and replacing with fresh yeast lysin to resuspend the cells. After centrifugation, add 5 ml of washing buffer (containing 50 mM Tris, pH 7.4, and 150 mM NaCl) to each 1 gram of wet yeast cell pellet to wash the cells. After centrifugation, discard the washing buffer. Add 6 mL of protease lysis buffer (containing 50 mM Tris, pH 7.4, 150 mM NaCl, 1% Triton X-100, 1 mM sodium fluoride, 1 mM EDTA, and 1 mM PMSF) to each 1 gram of wet yeast cell pellet (this lysis buffer has been pre-mixed with 0.2 volumes of 50% glycerol), and add 50 μL of 100× protease inhibitor solution to resuspend the cells. Place the centrifuge tube containing the cells at 30°C with gentle shaking for 10–20 minutes. Finally, centrifuge the tube at 12,000 g for at least 10 minutes. The resulting supernatant is the crude soluble protein extract.

[0039] (4) Use the BCA protein quantification kit to measure the protein concentration in the supernatant. Set up at least three biological replicates for each strain.

[0040] (5) Results calculation and statistical analysis: The total soluble protein yield of the Sc-YlTBP strain was increased by an average of 28% compared with the Sc-Ctrl control strain, and the difference was statistically significant (p<0.0001).

[0041] The above results demonstrate that the method of replacing transcription factors provided by this invention successfully constructed an engineered strain of *Saccharomyces cerevisiae* with significantly enhanced total soluble protein synthesis capacity, increasing the total protein content of the yeast by 28%. Figure 1 B).

[0042] 4. Determination of total protein content (including soluble and insoluble protein) (1) The Sc-YlTBP strain and the control strain Sc-Ctrl (the strain with the Ura3 tag inserted only downstream of the original SPT15) were inoculated into 50 mL of SC-Ura liquid medium and cultured at 30℃ and 220 rpm for 72 hours.

[0043] (2) Collect yeast cells from an equal volume of culture medium, dry them in an oven at 70 ℃, and measure the change in dry weight every 4 hours until the dry weight of the cells changes no longer after three consecutive measurements.

[0044] (3) Accurately weigh 0.2 g - 1 g (accurate to 0.1 mg) of the dried and pulverized yeast sample and place it in a digestion tube. At the same time, weigh out equal amounts of copper sulfate and potassium sulfate as catalysts.

[0045] (4) Add about 12 mL of concentrated sulfuric acid to the digestion tube, shake gently, and place it on the digestion apparatus. Set the temperature for digestion (usually pre-digest at a lower temperature to prevent foaming, and then raise the temperature to 400℃-420℃ and keep it for 60-120 minutes) until the liquid turns into a clear blue-green color.

[0046] (5) After the digestion tube has cooled, place it into the Kjeldahl nitrogen analyzer. The instrument automatically adds sodium hydroxide to make the solution alkaline, and the ammonia is released by steam distillation and absorbed by the boric acid solution. The ammonia in the absorption solution is titrated with a standard sulfuric acid (or hydrochloric acid) titrant, and the endpoint is determined by the color change (e.g., from blue-green to gray-red).

[0047] (6) The Kjeldahl nitrogen analyzer will automatically calculate the nitrogen content based on the amount of titrant consumed, and then multiply it by the protein conversion factor (6.25 is usually used for yeast) to finally obtain the crude protein content of the sample.

[0048] The above results demonstrate that the method of replacing transcription factors provided by this invention successfully constructed an engineered strain of *Saccharomyces cerevisiae* with significantly enhanced total protein synthesis capacity, increasing the total protein content of the yeast by 8.4%. Figure 1 C).

[0049] Example 2 Metabolomics analysis of intracellular dipeptides and tripeptides 1. Sample preparation: Cells of the Sc-YlTBP strain and the Sc-Ctrl control strain cultured to the stationary phase in Example 1 were rapidly frozen and then subjected to metabolite extraction using methanol / water solution, specifically for enrichment of small molecule peptides.

[0050] 2. LC-MS / MS Analysis: Analysis was performed using an ultra-high performance liquid chromatography-tandem high-resolution mass spectrometry system. A C18 column was used for chromatography, and positive ion mode and data-dependent acquisition mode were employed for mass spectrometry.

[0051] 3. Data Analysis and Identification: Qualitative and quantitative analysis of dipeptides and tripeptides was performed using database comparison and secondary spectral analysis.

[0052] 4. Results: Overall accumulation: In the Sc-YlTBP strain, the concentrations of 18 dipeptides and 73 tripeptides were significantly upregulated compared to the Sc-Ctrl strain. Among them, the maximum accumulation of dipeptides reached 10-fold (…). Figure 2 The maximum accumulation of tripeptides can reach 49 times.

[0053] Sequence feature analysis: Sequence analysis of the significantly upregulated tripeptide revealed that its amino acid composition distribution was extremely uneven. Figure 3 Of particular note is that at the third position (C-terminus) of the peptide, lysine (Lys) accounts for 70.0% and histidine (His) accounts for 27.4%, totaling over 97%. This constitutes a very distinctive molecular feature.

[0054] Key peptidase expression: Parallel analysis of proteomic data showed that in the Sc-YlTBP strain, the expression of several peptidases responsible for the final hydrolysis of oligopeptides into amino acids was downregulated, including vacuole aminopeptidase Ape1p (encoded by the APE1 gene) and methionine aminopeptidase Map1p (encoded by the MAP1 gene), with expression levels decreasing by more than 35%. Figure 4 This explains, mechanistically, why downstream blockages in protein degradation pathways lead to the accumulation of dipeptide and tripeptide intermediates.

[0055] Example 3 Validation of the in vitro antioxidant activity of high peptide-producing strains To assess the potential bioactivity of the dipeptides and tripeptides accumulated by the Sc-YlTBP strain, this example tested the in vitro free radical scavenging capacity of its cell extracts, specifically using a hydroxyl radical (·OH) scavenging experiment.

[0056] 1. Sample Preparation Cells of the Sc-YlTBP engineered strain and the Sc-Ctrl control strain cultured to the stationary phase (72 h) in Example 1, 1 g each (wet weight). After washing the cells with pre-chilled PBS buffer, 2 mL of pre-chilled deionized water was added, and the cells were sonicated using a high-efficiency cell disruptor (such as the JN series) under ice bath conditions (300W power, 3s operation time, 5s interval, total time 10min). The disrupted solution was centrifuged at 12,000 rpm for 20 minutes at 4°C, and the supernatant was collected. The supernatant was concentrated and desalted using an ultrafiltration centrifuge tube with a molecular weight cutoff of 3 kDa, and the filtrate (i.e., the extract rich in small molecule peptides and metabolites) was collected. The total peptide concentration was determined using the Bradford method, and the solution was uniformly diluted to a total peptide concentration of 2 mg / mL as the sample solution to be tested and stored at -80°C for later use.

[0057] 2. Hydroxyl radical (·OH) scavenging experiment Principle: The Fenton reaction system generates ·OH, which oxidizes salicylic acid to 2,3-dihydroxybenzoic acid, which has a characteristic absorption at 510 nm. Antioxidants competitively scavenge ·OH, leading to a decrease in this characteristic absorption.

[0058] Method: In a test tube, add 1 mL of 9 mM salicylic acid-ethanol solution, 1 mL of sample solutions of different concentrations (0.5, 1.0, 2.0 mg / mL), and 1 mL of 9 mM FeSO4 solution sequentially. Finally, add 1 mL of 8.8 mM H2O to initiate the reaction. After mixing, incubate at 37°C for 30 minutes. Using deionized water as a reference, measure the absorbance at 510 nm (Sample A). Simultaneously, prepare a background sample tube (Background A) without H2O and a damage control tube (Damage A) without sample solution.

[0059] Scavenging rate calculation: Hydroxyl radical scavenging rate (%) = [1-(A sample - A background) / A damage]×100%.

[0060] Results: As shown in Table 1, at a concentration of 2 mg / mL, the scavenging rate of hydroxyl radicals by the extract of Sc-YlTBP strain was 52.8 ± 2.1%, which was significantly higher than that of Sc-Ctrl strain (31.6 ± 1.5%) (p<0.01). Its IC50... 50 The value was 1.82 mg / mL, which was significantly better than the control of 3.15 mg / mL.

[0061]

[0062] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0063] Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for enhancing the synthesis capacity of total yeast protein and dipeptides and tripeptides, characterized in that, Includes the following steps: The endogenous TATA box-binding protein encoding gene in the Saccharomyces cerevisiae genome was replaced with the TATA box-binding protein encoding gene YlSPT15 from Yersinia lipolytica to obtain a recombinant yeast engineered strain.

2. The method as described in claim 1, characterized in that, The nucleotide sequence of the encoding gene YlSPT15 is shown in SEQ ID NO:

1.

3. The method as described in claim 1 or 2, characterized in that, The replacement is achieved through homologous recombination. The integrating DNA fragment used for transformation includes, sequentially along the 5' to 3' direction: (1) Left homologous arm: DNA fragment homologous to the upstream sequence of the SPT15 locus in the Saccharomyces cerevisiae genome; (2) Target gene: encoding gene YlSPT15; (3) Selection marker expression cassette: an expression cassette containing selection marker genes and their regulatory elements; (4) Right homologous arm: DNA fragment homologous to the downstream sequence of the SPT15 locus in the Saccharomyces cerevisiae genome.

4. The method as described in claim 3, characterized in that, The nucleotide sequence of the left homologous arm is shown in SEQ ID NO.2; The nucleotide sequence of the expression cassette is shown in SEQ ID NO.4; the nucleotide sequence of the right homologous arm fragment is shown in SEQ ID NO.

3.

5. An engineered strain of *Saccharomyces cerevisiae*, characterized in that, It is prepared by the method described in any one of claims 1-4.

6. The application of the method according to any one of claims 1-4, or the engineered strain according to claim 5, in the following fields: (1) Production of recombinant protein products; (2) Producing bioactive peptide products rich in lysine dipeptides or tripeptides; (3) Preparation of single-cell proteins and functional peptide products.