High-efficiency pichia pastoris engineering bacteria for expressing type i+iii recombinant collagen and fermentation and purification method thereof

CN122587901APending Publication Date: 2026-08-18GUANGDONG MARUBI BIOLOGICAL TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611081080.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-07-20
Publication Date
2026-08-18

AI Technical Summary

Technical Problem

[0003]然而,现有技术多为单型胶原表达,难以模拟体内I/III型胶原蛋白共存的天然状态,活性与适配性不足;且表达量偏低、发酵控制粗放、产量不稳定,易出现完全降解或产量较低的情况,难以工业化放大

Benefits of technology

[0004] To address the shortcomings of existing technologies, the present application aims to provide a Pichia pastoris engineered strain for efficiently expressing type I+III recombinant collagen and its fermentation purification method. This strain exhibits high expression levels, is easily scaled up stably, and yields high-purity, high-recovery type I+III recombinant collagen.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122587901A_ABST
    Figure CN122587901A_ABST
Patent Text Reader

Abstract

The application relates to a high-efficiency Pichia pastoris engineering bacterium for expressing I+III type recombinant collagen and a fermentation and purification method thereof, and belongs to the technical field of genetic engineering, microbial fermentation and protein separation and purification. The high-efficiency Pichia pastoris engineering bacterium for expressing I+III type recombinant collagen is a multi-copy Pichia pastoris engineering strain, the Pichia pastoris engineering bacterium contains multiple 2-copy plasmid vectors and / or multiple single-copy plasmid vectors, the plasmid vector contains an I+III type recombinant collagen fusion gene, and the I+III type recombinant collagen fusion gene sequence is shown in SEQ ID NO: 1. The expression amount is high, the stable amplification is easy, and the I+III type recombinant collagen with high purity and high recovery rate can be obtained.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the fields of genetic engineering, microbial fermentation and protein separation and purification technology, and in particular to a Pichia pastoris engineered strain that efficiently expresses type I+III recombinant collagen and its fermentation and purification method. Background Technology

[0002] Type I collagen primarily provides tissue strength and support, while Type III collagen is responsible for elasticity and repair. When used in combination in a natural ratio, the two have irreplaceable application value in skin repair, wound healing, and anti-aging skincare.

[0003] However, existing technologies mostly express single-type collagen, which is difficult to simulate the natural state of coexistence of type I / III collagen in the body, resulting in insufficient activity and adaptability. Furthermore, the expression level is low, the fermentation control is crude, and the yield is unstable, easily leading to complete degradation or low yield, making it difficult to scale up industrially. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present application aims to provide a Pichia pastoris engineered strain for efficiently expressing type I+III recombinant collagen and its fermentation purification method. This strain exhibits high expression levels, is easily scaled up stably, and yields high-purity, high-recovery type I+III recombinant collagen.

[0005] In a first aspect, embodiments of this application provide a Pichia pastoris engineered strain that efficiently expresses type I+III recombinant collagen. The Pichia pastoris engineered strain is a multi-copy Pichia pastoris engineered strain, which contains multiple 2-copy plasmid vectors and / or multiple single-copy plasmid vectors. The plasmid vectors contain a type I+III recombinant collagen fusion gene. The sequence of the type I+III recombinant collagen fusion gene is shown in SEQ ID NO:1.

[0006] This application utilizes a multi-copy Pichia pastoris engineered strain, and the plasmid vector contained in the multi-copy Pichia pastoris engineered strain contains a type I+III recombinant collagen fusion gene, which can directly ferment and produce type I+III recombinant collagen with high expression level, easy stable scale-up, and high purity and high recovery rate type I+III recombinant collagen.

[0007] In some embodiments of this application, the Pichia pastoris engineered strain is a 5-copy Pichia pastoris engineered strain, which contains two 2-copy plasmid vectors and one 1-copy plasmid vector.

[0008] This application utilizes a 5-copy Pichia pastoris engineered strain, which has a high expression level and is easy to scale up stably, to obtain high-purity, high-recovery type I+III recombinant collagen.

[0009] In some embodiments of this application, the single-copy plasmid vector is a single-copy plasmid vector in which the type I+III recombinant collagen fusion gene is inserted into a pHKA vector with AOXm as the promoter and αCC as the signal peptide.

[0010] In some embodiments of this application, the 2-copy plasmid vector is Bgl II and Bam The expression cassette of the single-copy plasmid vector was digested with HⅠ double enzyme digestion, and the expression cassette was inserted into the single-copy plasmid vector. Bgl Two-copy plasmid vectors at site II.

[0011] In some embodiments of this application, the single-copy plasmid vector and the two-copy plasmid vector further include hygromycin as a selection marker. Int 1 is an integration site, containing Cre / lox P-system circular integrative plasmid vectors.

[0012] Secondly, embodiments of this application provide a method for constructing Pichia pastoris engineered strains as provided in the first aspect, comprising: S1, construct single-copy plasmid vectors and 2-copy plasmid vectors; S2, using the 2-copy plasmid vector Nco I. Linearization was performed, and the cells were introduced into Pichia pastoris GS115 competent cells by electroporation. After electroporation, the cells were plated on MD solid selection plates, incubated at constant temperature, and single colonies were picked for PCR verification to obtain a positive 2-copy Pichia pastoris engineered strain. S3, the hygromycin-labeled 2-copy plasmid vector was used Bcu Linearization was performed, followed by electroporation into a 2-copy Pichia pastoris engineered strain. The transformed strain was plated on YPDH-resistant plates and screened for positive transformants through incubation at an incubator. Cre / lox P-system-mediated knockout of the hygromycin resistance gene yielded a genetically stable 4-copy Pichia pastoris engineered strain without resistance markers; S4. Repeat step S3 at least once more, electroporating the hygromycin-labeled single-copy plasmid vector or 2-copy plasmid vector into a 4-copy Pichia pastoris engineered strain, and then screening to obtain a multi-copy Pichia pastoris engineered strain.

[0013] This application uses the above method to construct a multi-copy Pichia pastoris engineered strain, which has a high expression level, is easy to stabilize and scale up, and can obtain high-purity, high-recovery type I+III recombinant collagen.

[0014] Thirdly, embodiments of this application provide a fermentation and purification method for Pichia pastoris engineered strains as provided in the first aspect, comprising: inoculating Pichia pastoris engineered strains into BSM basal medium, and carrying out fermentation through a four-stage controlled process of batch growth, glycerol feeding, methanol transition, and induced expression; the induction expression temperature is 22 ℃~30 ℃; and the fermentation product is purified in an integrated manner after fermentation.

[0015] This application utilizes the aforementioned fermentation and purification method to obtain high-purity, high-recovery-rate type I+III recombinant collagen from the multi-copy Pichia pastoris engineered strain provided in the first aspect, achieving high expression levels.

[0016] In some embodiments of this application, the temperature for inducing expression is 22°C when a 500 L pilot-scale fermentation is carried out.

[0017] This application demonstrates that by adjusting the appropriate induction temperature during a 500 L pilot-scale fermentation, stable scale-up can be achieved, resulting in high expression levels and yielding high-purity, high-recovery type I+III recombinant collagen. In some embodiments of this application, the inoculum size of Pichia pastoris engineered strain is 8% to 10%.

[0018] This application utilizes an appropriate amount of engineered Pichia pastoris to facilitate efficient fermentation.

[0019] In some embodiments of this application, the integrated purification of the fermentation product after fermentation includes: S1, the fermentation product is separated by cell separation to obtain protein stock solution; S2, the protein stock solution was subjected to ultrafiltration, hydrophobic chromatography, and desalting to obtain type I+III recombinant collagen.

[0020] This application uses the above method to purify the fermentation product, which can yield high-purity, high-recovery-rate type I+III recombinant collagen.

[0021] Fourthly, embodiments of this application provide a type I+III recombinant collagen prepared by the fermentation and purification method of Pichia pastoris engineered strain as provided in the third aspect, with an expression level ≥9.5 mg / mL and a purity ≥94.7%.

[0022] The recombinant collagen of type I+III prepared by the above-mentioned fermentation and purification method has high expression level and high purity. Attached Figure Description To more clearly illustrate the technical solutions of the embodiments of this application, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of this application and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 The plasmid map is for the pHKA-AOXm-αcc-WM single-copy plasmid vector provided in Example 1 of this application.

[0024] Figure 2 The SDS-page identification results of the 5-copy strain shake-flask fermentation supernatant provided in Example 1 of this application.

[0025] Figure 3 The growth curves of Pichia pastoris engineered strains throughout the fermentation process in the fermentation methods of Pichia pastoris engineered strains provided in Examples 2-4 of Test Example 1 of this application.

[0026] Figure 4 SDS-PAGE results of the Pichia pastoris engineered strains provided in Examples 2-4 of this application during fermentation for 46-70 h.

[0027] Figure 5 SDS-PAGE results of fermentation for 70 h to 118 h in the fermentation method of Pichia pastoris engineered strains provided in Examples 2 to 3 of Test Example 1 of this application.

[0028] Figure 6 The growth curve of the Pichia pastoris engineered strain in the first batch of fermentation of the fermentation process of the Pichia pastoris engineered strain provided in Example 5 of Test Example 1 of this application.

[0029] Figure 7 The DS PAGE results of the first fermentation of the Pichia pastoris engineered strain provided in Example 5 of Test Example 1 of this application.

[0030] Figure 8 The growth curve of the second batch of Pichia pastoris engineered strains during the fermentation process of the Pichia pastoris engineered strains provided in Example 5 of Test Example 1 of this application.

[0031] Figure 9 The DS-PAGE results of the second batch fermentation in the fermentation method of Pichia pastoris engineered strain provided in Example 5 of Test Example 1 of this application.

[0032] Figure 10 This is a sample state diagram before and after ultrafiltration liquid replacement provided in Example 6 of this application.

[0033] Figure 11 The peak diagram for monitoring the hydrophobic chromatography process during the purification method of Pichia pastoris engineered strain provided in Example 6 of Test Example 2 of this application; wherein, FT-flow-through mode, impurities do not bind to the medium, and CIP-in-situ washing removes irreversibly bound proteins.

[0034] Figure 12 SDS-PAGE during the hydrophobic chromatography process in the purification method of Pichia pastoris engineered strain provided in Example 6 of Test Example 2 of this application. PAGE results.

[0035] Figure 13 The HPLC detection results of each component in the hydrophobic chromatography process during the purification method of Pichia pastoris engineered strain provided in Example 6 of Test Example 2 of this application are shown in Figure 2. Detailed Implementation

[0036] To make the objectives, technical solutions, and advantages of the embodiments of this application clearer, the technical solutions in the embodiments of this application will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0037] Currently, most existing technologies express single-type collagen, which is difficult to simulate the natural state of coexistence of type I / III collagen in vivo, resulting in insufficient activity and adaptability. Furthermore, the expression level is low, fermentation control is crude, and the yield is unstable, easily leading to complete degradation or low yield, making it difficult to scale up industrially.

[0038] On one hand, this application provides a Pichia pastoris engineered strain that efficiently expresses type I+III recombinant collagen. The Pichia pastoris engineered strain is a multi-copy Pichia pastoris engineered strain, which contains multiple 2-copy plasmid vectors and / or multiple single-copy plasmid vectors. The plasmid vectors contain a type I+III recombinant collagen fusion gene. The sequence of the type I+III recombinant collagen fusion gene is shown in SEQ ID NO:1.

[0039] This application utilizes a multi-copy Pichia pastoris engineered strain, and the plasmid vector contained in the multi-copy Pichia pastoris engineered strain contains a type I+III recombinant collagen fusion gene, which can directly ferment and produce type I+III recombinant collagen with high expression level, easy stable scale-up, and high purity and high recovery rate type I+III recombinant collagen.

[0040] In some embodiments of this application, the Pichia pastoris engineered strain is a 5-copy Pichia pastoris engineered strain, which contains two 2-copy plasmid vectors and one 1-copy plasmid vector. By using the 5-copy Pichia pastoris engineered strain, the expression level is high and it is easy to stably scale up, resulting in high-purity and high-recovery-rate type I+III recombinant collagen.

[0041] In some embodiments of this application, the single-copy plasmid vector is a single-copy plasmid vector in which the type I+III recombinant collagen fusion gene is inserted into a pHKA vector with AOXm as the promoter and αCC as the signal peptide. The nucleotide sequence of the αCC signal peptide is shown in SEQ ID NO:2, and the nucleotide sequence of the AOXm promoter is shown in SEQ ID NO:3.

[0042] In some embodiments of this application, the 2-copy plasmid vector is Bgl II and Bam The expression cassette of the single-copy plasmid vector was digested with HⅠ double enzyme digestion, and the expression cassette was inserted into the single-copy plasmid vector. Bgl Two-copy plasmid vectors at site II.

[0043] In some embodiments of this application, the single-copy plasmid vector and the two-copy plasmid vector further include hygromycin as a selection marker. Int 1 is an integration site, containing Cre / lox P-system circular integrative plasmid vectors.

[0044] This application provides a method for constructing the above-mentioned Pichia pastoris engineered strain, including: S1, construct single-copy plasmid vectors and 2-copy plasmid vectors; S2, the 2-copy plasmid vector was linearized with NcoI and introduced into Pichia pastoris GS115 competent cells by electroporation. After electroporation, the cells were plated on MD solid selection plates, incubated at constant temperature, and single colonies were picked for PCR verification to obtain positive 2-copy Pichia pastoris engineered strains. S3, the hygromycin-labeled 2-copy plasmid vector was used Bcu Linearization was performed, followed by electroporation into a 2-copy Pichia pastoris engineered strain. The transformed strain was plated on YPDH-resistant plates and screened for positive transformants through incubation at an incubator. Cre / lox P-system-mediated knockout of the hygromycin resistance gene yielded a genetically stable 4-copy Pichia pastoris engineered strain without resistance markers; S4. Repeat step S3 at least once more, electroporating the hygromycin-labeled single-copy plasmid vector or 2-copy plasmid vector into a 4-copy Pichia pastoris engineered strain, and then screening to obtain a multi-copy Pichia pastoris engineered strain.

[0045] In some embodiments of this application, the method for constructing a single-copy plasmid vector is as follows: Using seamless cloning technology, a type I+III recombinant collagen fusion gene (WM) fragment is inserted into a pHKA vector with AOXm as the promoter and αCC as the signal peptide, resulting in a pHKA-PAOXm-αCC-WM single-copy plasmid vector. Furthermore, the single-copy expression cassette PAOXm-αCC-WM-1C is also constructed using seamless cloning, with hygromycin as the selection marker... Int 1 is an integration site, containing Cre / lox The P-system cyclic integration vector was used to obtain a single-copy circular integration plasmid vector.

[0046] In some embodiments of this application, the method for constructing a 2-copy plasmid vector is as follows: using... Bgl II and Bam The PAOXm-αCC-WM expression cassette was excised from the single-copy plasmid vector by double digestion with HⅠ. The excised PAOXm-αCC-WM expression cassette was then inserted into the single-copy plasmid vector. Bgl At site II, a 2-copy plasmid vector, pHKA-PAOXm-αCC-WM-2C, was constructed. Furthermore, the 2-copy expression cassette PAOXm-αCC-WM-2C was seamlessly cloned to construct a hygromycin-based selection marker... Int 1 is an integration site, containing Cre / lox The P-system cyclic integration vector was used to obtain a 2-copy cyclic integration plasmid vector.

[0047] This application uses the above method to construct a multi-copy Pichia pastoris engineered strain, which has a high expression level, is easy to stabilize and scale up, and can obtain high-purity, high-recovery type I+III recombinant collagen.

[0048] This application provides a fermentation purification method for the above-mentioned Pichia pastoris engineered strain, comprising: inoculating the Pichia pastoris engineered strain into BSM basal medium, and carrying out fermentation through a four-stage controlled process of batch growth, glycerol feeding, methanol transition, and induced expression; the induction expression temperature is 22 ℃~30 ℃; and the fermentation product is purified in an integrated manner after fermentation. The above-mentioned fermentation purification method yields high expression levels of the multi-copy Pichia pastoris engineered strain provided in the first aspect, resulting in high-purity, high-recovery-rate type I+III recombinant collagen.

[0049] In some embodiments of this application, batch growth includes: maintaining DO at 25 ℃~30 ℃, pH 5~5.5, with dissolved oxygen (DO) and stirring in tandem, and culturing until the glycerol in the tank is depleted and DO shows a sudden increase.

[0050] In some embodiments of this application, glycerol feeding includes: adding 50% glycerol at a flow rate of 25 L / h to 30 L / h, maintaining a DO of 25% to 35%, and culturing until the bacterial cell OD reaches a certain level. 600 ≈250, stop feeding and starve the food for 50-60 minutes.

[0051] In some embodiments of this application, methanol transition and induced expression include: methanol gradient addition, with an initial flow rate of 2 g / h / L to 3 g / h / L, increasing by 1 g / h / L every 2 h; controlling the temperature at 25 ℃ to 30 ℃, pH at 5.5 to 6.0, and DO at 15% to 20%, and continuously inducing for 96 h to 120 h.

[0052] In some embodiments of this application, the induction temperature for expression was 22°C during a 500 L pilot-scale fermentation. By adjusting the appropriate induction temperature during the 500 L pilot-scale fermentation, stable scale-up can be achieved, resulting in high expression levels and obtaining high-purity, high-recovery-rate type I+III recombinant collagen.

[0053] In some embodiments of this application, the inoculum size of Pichia pastoris engineered strains is 8% to 10%. As an example, the inoculum size of Pichia pastoris engineered strains can be, but is not limited to, any value of 8%, 8.5%, 9%, 9.5%, or 10%, or a range between these values. Inoculating with an appropriate amount of Pichia pastoris engineered strains facilitates efficient fermentation.

[0054] In some embodiments of this application, the integrated purification of the fermentation product after fermentation includes: S1, the fermentation product is separated by cell separation to obtain protein stock solution; S2, the protein stock solution was subjected to ultrafiltration, hydrophobic chromatography, and desalting to obtain type I+III recombinant collagen.

[0055] In some embodiments of this application, the process of separating the fermentation material into a protein stock solution involves: centrifuging at 4°C and 10,000 rpm to 12,000 rpm for 10 to 15 minutes, discarding the bacterial cells and collecting the supernatant; the supernatant is then clarified a second time using a 700 kD to 750 kD hollow fiber column, and then filtered through a 0.35 μm to 0.45 μm filter membrane to obtain a clear protein stock solution.

[0056] In some embodiments of this application, ultrafiltration buffer replacement includes: using a 10 kD~11 kD ultrafiltration membrane to concentrate and replace the clarified protein stock solution, the replacement buffer being 20 mM PB + 0.2 M (NH4)2SO4, pH 7.0, the volume of the replacement buffer being 5~6 times the volume of the protein stock solution, to fully remove small molecule impurities and pigments; after the buffer replacement is completed, filtration is performed using a 0.35 μm~0.45 μm filter membrane.

[0057] In some embodiments of this application, hydrophobic chromatography includes: adding solid (NH4)2SO4 to the protein sample after ultrafiltration and buffer exchange to a final concentration of 1 M to 1.5 M, stirring to dissolve, fine-tuning the pH to 7.0, filtering through a 0.35 μm to 0.45 μm filter membrane, and loading the sample. The sample is purified using a Phenyl Sepharose 6FF hydrophobic chromatography column and an AKTA pure system: (1) Equilibration: 20 mM PB + 1 M (NH4)2SO4, pH 7.0, equilibrate for 10 column volumes; (2) Loading: flow rate 3 mL / min to 4 mL / min, collect the flow-through; (3) Washing: 20 mM PB + 0.8 M (NH4)2SO4, pH 7.0, wash until the UV baseline is stable; (4) Elution: 20 mM PB + 0.4 M (NH4)2SO4, pH 7.0, collect the target elution peak protein solution.

[0058] In some embodiments of this application, desalting includes: concentrating the eluted target protein solution using a 2 kD~3 kD ultrafiltration membrane to remove salt ions and small molecule impurities, and then sterilely filtering the concentrate through a 0.22 μm~0.25 μm filter membrane to obtain high-purity type I+III recombinant collagen.

[0059] This application uses the above method to purify the fermentation product, which can yield high-purity, high-recovery-rate type I+III recombinant collagen.

[0060] This application provides a method for preparing type I+III recombinant collagen using the fermentation and purification of the above-mentioned Pichia pastoris engineered strain. The collagen has an expression level ≥9.5 mg / mL and a purity ≥94.7%. The type I+III recombinant collagen prepared by the above-mentioned fermentation and purification method has a high expression level and high purity. This application provides an example of the application of the above-mentioned type I+III recombinant collagen in the preparation of cosmetics and medical materials.

[0061] The gene sequence of the recombinant collagen type I+III fusion protein is shown in SEQ ID NO:1: GGTCCACAAGGTATTGCTGGTCAAAGAGGTGTTGTTGGTTTGCCAGGTCAAAGAGGAGAGAGAGGTTTTCCAGGTTTGCCAGGACCATCTGGTGAGCCAGGTAAGCAGGGTCCATCTGGTGCTTCTGGTGAGAGAGGTCCACCAGGTCCAATGGGTCCACCAGGATTGGCTGGTCCACCAGGTGAGTCTGGTAGAGAAGGAGCCCCTGGTGCTGAAGGTTCCCCAGGTAGAGATGGTTCTCCTGGTGCTAAGGGTGATAGAGGTGAAACTGGTCCAGCTGGTCCTCCTGGTGCTCCAGGTGCTCCAGGAGCCCCTGGACCAGTTGGTCCAGCTGGAAAGTCTGGTGATAGAGGAGAAACTGGTCCTGCTGGTCCAGCTGGTGAAAGAGGTGGTCCAGGTGGTCCTGGTCCACAAGGACCACCAGGAAAGAACGGTGAAACTGGACCACAAGGACCTCCAGGTCCAACAGGTCCAGGAGGTGATAAAGGTGACACAGGTCCACCAGGTCCTCAAGGATTGCAAGGATTGCCAGGAACTGGTGGTCCACCAGGTGAAAACGGAAAGCCAGGAGAACCAGGTCCAAAAGGAGATGCTGGTGCTCCAGGTGCTCCTGGAGGTAAGGGTGATGCTGGTGCTCCTGGTGAGAGAGGACCACCAGGTTTGGCTGGTGCTCCAGGTTTGAGAGGTGGTGCTGGTCCACCTGGTCCAGAAGGTGGTAAGGGTGCTGCTGGTCCACCAGGTCCACCAGGTGCTGCTGGAACTCCAGGATTGCAAGGTATGCCAGGTCCAGGTCCATGTTGTGGTGGTTGA。

[0062] The nucleotide sequence of the αCC signal peptide is shown in SEQ ID NO:2: ATGAGATTCCCATCTATCTTTACTGCCGTTTTGTTTGCTGCTTCCTCTGCTTTGGCAGCTCCAGTTAACACAACTACTGAGGATGAAACTGCTCAAATTCCTGCTGAGGCAGTTATTGGTTACTCTGATTTGGAAGGTGACTTTGATGTTGCTGTCTTGCCTTTCTCTAACTCCACCAACAACGGTTTGTTGTTCATCAACACTACCATTGCCTCTATTGCTGCCAAGGAAGAGGGTGTTTCTTTGGAGAAGAGAGAGGCTGAAGCT。

[0063] The nucleotide sequence of the AOXm promoter is shown in SEQ ID NO:3: GATCTAACATCCAAAGACGAAAGGTTGAATGAAACCTTTTTGCCATCCGACATCCACAGGTCCATTCTCACACATAAGTGCCAAACGCAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGACCTCCACTCCTCTTCTCCTCAACACCCACTTTAGGCTACTAACACCATGACTTTATTAGCCTGTCTATCCTGGCCCCCCTGGCGAGGTTCATGTTTGTTTATTTCCGAATGCAACAAGCTCCGCATTACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTCAAATAGTTTCATGTTCCCCAAATGGCCCAAAACTGACAGTTTAAACGCTGTCTTGGAACCTAATATGACAAAAGCGTGATCTCATCCAAGATGAACTAAGTTTGGTTCGTTGAAATGCTAACGGCCAGTTGGTCAAAAAGAAACTTCCAAAAGTCGGCATACCGTTTGTCTTGTTTGGTATTGATTGACGAATGCTCAAAAATAATCTCATTAATGCTTAGCGCAGTCTCTCTATCGCTTCTGAACCCCGGTGCACCTGTGCCGAAACGCAAATGGGGAAACACCCGCTTTTTGGATGATTATGCATTGTCTCCACATTGTATGCTTCCAAGATTCTGGTGGGAATACTGCTGATAGCCTAACGTTCATGATCAAAATTTCATGATCAAAATTTAACTGTTCTAACCCCTACTTGACAGCAATATATAAACAGAAGGAAGCTGCCCTGTCTTAAACCTTTTTTTTTATCATCATTATTAGCTTACTTTCATAATTGCGACTGGTTCCAATTGACAAGCTTTTGATTTTAACGACTTTTAACGACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAA。

[0064] The features and performance of the present application will be further described in detail below in conjunction with embodiments.

[0065] The specific equipment used in the embodiments and test examples is as follows: (1) YPD liquid culture medium: glucose 2 g / L, peptone 2 g / L, yeast extract 1 g / L, sterilized at 115 ℃ for 20 min.

[0066] (2) 70% BSM basal medium: CaSO4 0.65 g / L, MgSO4 8.0 g / L, K2SO4 12.74 g / L, KOH 2.9 g / L, H3PO4 26.7 mL / L, glycerol 40 g / L, sterilized at 115 ℃ after making up to volume, and added 4.35 mL / L of PTM1 trace element solution after cooling.

[0067] (3) 50% feed glycerin: Glycerin and water are mixed in a 1:1 ratio, sterilized at 115°C, and 12 mL / L of PTM1 is added.

[0068] (4) Methanol induction solution: Add 12 mL / L of PTM1 to methanol, filter and sterilize for later use.

[0069] (5) MD solid screening plate: glucose 20 g / L, YNB 13.4 g / L, agar powder 20 g / L.

[0070] (6) YPDH resistance plate: glucose 20 g / L, peptone 20 g / L, yeast extract 10 g / L, hygromycin.

[0071] Example 1: Construction of multi-copy recombinant Pichia pastoris (1) Construction of recombinant plasmid vector: Based on the CDS sequences of human type I collagen α1 chain (Col1A1) and human type III collagen α1 chain (Col3A1), the type I+III collagen fusion gene WM was synthesized using Pichia pastoris codon optimization. Homologous arms were added to both ends of the gene by PCR amplification. Using seamless cloning technology, the type I+III recombinant collagen fusion gene (WM) fragment was inserted into the pHKA vector with AOXm as the promoter and αCC as the signal peptide, resulting in the pHKA-PAOXm-αCC-WM single-copy plasmid vector. The plasmid map is shown below. Figure 1 As shown.

[0072] use Bgl II and Bam The PAOXm-αCC-WM expression cassette was excised from the single-copy plasmid vector by double digestion with HⅠ. The excised PAOXm-αCC-WM expression cassette was then inserted into the single-copy plasmid vector. BglAt site II, a 2-copy plasmid vector pHKA-PAOXm-αCC-WM-2C was constructed; the single-copy expression cassette PAOXm-αCC-WM-1C and the 2-copy expression cassette PAOXm-αCC-WM-2C were then seamlessly cloned to construct a hygromycin-based selection marker. Int 1 is an integration site, containing Cre / lox The P-system cyclic integration vectors yielded single-copy circular integration plasmid vectors and two-copy circular integration plasmid vectors, respectively.

[0073] (2) Preparation of 2-copy Pichia pastoris engineered strain: The 2-copy plasmid vector pHKA-PAOXm-αCC-WM-2C was prepared using... Nco I. Linearization was performed, and the cells were introduced into Pichia pastoris GS115 competent cells via electroporation. After electroporation, the cells were plated on MD solid selection plates and incubated at 30 °C for 72 h. Single colonies were picked for PCR verification, and positive Pichia pastoris engineered strains with 2 copies were obtained.

[0074] (3) Preparation of 4-copy Pichia pastoris engineered strain: The hygromycin-labeled 2-copy circular integrative plasmid vector was prepared using... Bcu I. Linearization was performed, and the strain was introduced into the above-mentioned 2-copy Pichia pastoris engineered strain via electroporation; the transformed strain was plated on YPDH resistant plates and screened for positive transformants at 30°C. Cre / lox The P system mediated the knockout of the hygromycin resistance gene to obtain a genetically stable 4-copy Pichia pastoris engineered strain without resistance markers.

[0075] (4) Construction of 5-copy Pichia pastoris engineered strain: Based on the 4-copy Pichia pastoris engineered strain, a single-copy circular integration plasmid vector labeled with hygromycin was introduced again by electroporation. The integration and screening steps in step (3) were repeated to finally obtain a 5-copy Pichia pastoris engineered strain.

[0076] The obtained strain was identified by PCR, and the supernatant of the fermentation broth obtained from 30℃ shake-flask culture was verified by SDS-PAGE. The results are as follows: Figure 2 As shown.

[0077] Depend on Figure 2 The results showed that both type I and type III recombinant collagen were successfully expressed, indicating that the 5-copy Pichia pastoris engineered strain was successfully constructed.

[0078] Example 2: 5 L small-scale fermentation (1) Seed culture preparation: Five copies of Pichia pastoris engineered strain were streaked on YPD plates for activation and cultured at 30 ℃ for 72 h. Single colonies were picked and inoculated into 50 mL of YPD liquid medium and cultured at 30 ℃ and 250 rpm for 24 h to obtain primary seed culture. The culture was then transferred to 300 mL of YPD liquid medium at a ratio of 1:10 and cultured under the same conditions until OD. 600 The value is 8~10, used as the fermentation seed liquid.

[0079] (2) 5 L fermenter culture: Add the prepared BSM basal medium to a 5 L fermenter, sterilize at 115 ℃ for 30 min, cool and then inoculate with fermentation seed liquid at an inoculation amount of 8%.

[0080] (3) Batch growth stage: control the temperature at 30℃, pH at 5.5, and keep the dissolved oxygen (DO) and stirring in tandem to maintain DO at 25%~35% until the glycerol in the fermenter is depleted and DO rises sharply.

[0081] (4) Glycerol feeding stage: 50% glycerol is added at a flow rate of 30 L / h to maintain DO at 25%~35% and cultured until the cell OD reaches the target value. 600 ≈250, stop feeding and starve culture for 60 min.

[0082] (5) Methanol transition and methanol induction stage: Methanol gradient addition, initial flow rate 3 g / h / L, increased by 1 g / h / L every 2 h; temperature controlled at 25 ℃, pH 6.0, DO 15%~20%, continuous induction for 96 h~120 h.

[0083] Example 3 This embodiment provides a fermentation method for engineered Pichia pastoris, which differs from Embodiment 2 in that the methanol induction temperature is 22 ℃.

[0084] Example 4 This embodiment provides a fermentation method for engineered Pichia pastoris, which differs from Embodiment 2 in that the methanol induction temperature is 20 ℃.

[0085] Example 5: 500 L pilot-scale fermentation The 500 L pilot-scale fermentation followed the same process as the 5 L small-scale test, with the difference from Example 2 being that the methanol induction temperature was lowered from 30℃ to 22℃, the pH was 6.0, and the DO was 10%~20%, with continuous induction for 96 h~166 h. This reduced the metabolic stress on the cells, decreased protease production, and improved protein stability and expression levels. Two batches of 500 L pilot-scale fermentations were conducted.

[0086] Example 6: Purification of Fermentation Supernatant (1) Pretreatment of fermentation broth: Take 500 L of pilot-scale fermentation broth, centrifuge at 4℃ and 12000 rpm for 15 min, discard the bacterial cells and collect the supernatant. The supernatant is then clarified twice through a 750 kD hollow fiber column and filtered through a 0.45 μm filter membrane to obtain a clear protein stock solution.

[0087] (2) Ultrafiltration buffer replacement: The clarified protein stock solution was concentrated and replaced using a 10 kD ultrafiltration membrane. The replacement buffer was 20 mM PB + 0.2 M (NH4)2SO4, pH 7.0, and the volume of the replacement buffer was 5-6 times that of the protein stock solution. After the buffer replacement, the solution was filtered through a 0.45 μm filter membrane for later use; small molecule impurities and pigments were thoroughly removed. The state of the sample before and after ultrafiltration buffer replacement is as follows. Figure 10 As shown.

[0088] (3) Hydrophobic chromatography purification: Add solid (NH4)2SO4 to the protein sample after buffer replacement to a final concentration of 1 M, stir to dissolve, finely adjust the pH to 7.0, filter through a 0.45 μm filter membrane, and load the sample for purification using a Phenyl Sepharose 6FF hydrophobic chromatography column and AKTA Pure system. a. Equilibration (CIP): 20 mM PB + 1 M (NH4)2SO4, pH 7.0, equilibrate for 10 column volumes; b. Sample loading (FT): Flow rate 4 mL / min, collect the flow-through solution; c. Washing: 20 mM PB + 0.8 M (NH4)2SO4, pH 7.0, wash until UV baseline is stable; d. Elution: 20 mM PB + 0.4 M (NH4)2SO4, pH 7.0, collect the target elution peak protein solution.

[0089] (4) Desalting and product preparation: The target protein solution collected by elution is concentrated using a 3 kD ultrafiltration membrane. The concentrate is then sterile filtered through a 0.22 μm filter to remove salt ions and small molecule impurities, thereby obtaining a high-purity I+III type recombinant collagen product.

[0090] HPLC and SDS-PAGE analysis showed that the finished product had a purity of 94.7%, an active protein recovery rate of ≥90%, and intact protein structure with no degradation.

[0091] Experimental Example 1 In this experimental example, the fermentation methods of Pichia pastoris engineered strains provided in Examples 2-5 were followed by timed sampling throughout the fermentation process to determine OD. 600 The expression was then tracked using SDS-PAGE electrophoresis. The results are as follows: Figures 3-9 As shown.

[0092] Figure 3 The fermentation methods for the engineered Pichia pastoris strains provided in Examples 2-4 show the growth curves of the engineered Pichia pastoris strains throughout the fermentation process. Figure 3 The results showed that the engineered Pichia pastoris strain grew stably and continuously at different induction temperatures, demonstrating good reproductive and growth capabilities.

[0093] Figure 4 The SDS-PAGE results for fermentation of the engineered Pichia pastoris strains provided in Examples 2-4 after 46-70 h of fermentation; Figure 5 The SDS-PAGE results are for fermentation of the engineered Pichia pastoris strains provided in Examples 2-3, after 70-118 hours of fermentation. Figure 4 and Figure 5 The results showed that, under different induction temperatures, the target protein bands of the engineered Pichia pastoris were clear, the expression level continuously increased, and there were no obvious impurities or degradation, indicating that the small-scale fermentation expression effect of the engineered Pichia pastoris was good. This demonstrates that the engineered Pichia pastoris provided in this application can efficiently express type I+III recombinant collagen.

[0094] Figure 6 The growth curve of the Pichia pastoris engineered strain in the first batch of fermentation in the fermentation method of the Pichia pastoris engineered strain provided in Example 5. Figure 7 The DSPAGE results are for the first fermentation of the Pichia pastoris engineered strain provided in Example 5. Figure 8 The growth curve of the second batch of Pichia pastoris engineered strains during the fermentation process provided in Example 5. Figure 9 This is the DS-PAGE result of the second batch fermentation in the fermentation method of the engineered Pichia pastoris provided in Example 5. Figures 6-9 The results showed that in the 500 L pilot-scale fermentation, the Pichia pastoris engineered strain exhibited robust cell growth, clear fermentation broth, continuous secretion of the target protein, bright target bands, low levels of impurity proteins, and no obvious flocculation or autolysis, indicating good expression performance. Furthermore, the supernatant protein concentration at the end of the first 500 L fermentation was 9.57 mg / mL; the supernatant protein concentration at the end of the second 500 L fermentation was 10.42 mg / mL. This demonstrates that the Pichia pastoris engineered strain provided in this application can be stably scaled up from a 5 L pilot-scale to a 500 L industrial-scale fermentation, with high expression levels and good batch-to-batch consistency.

[0095] Experimental Example 2 This experimental example measures the samples obtained during the purification process of the Pichia pastoris engineered strain provided in Example 6, as follows: (1) The hydrophobic chromatography process was monitored, and the results are as follows: Figure 11 As shown; (2) The hydrophobic chromatography process was monitored by SDS-PAGE electrophoresis, and the results are as follows: Figure 12 As shown; (3) The purity of each component in the hydrophobic chromatography process was determined by HPLC, and the results are as follows: Figure 13 As shown.

[0096] Depend on Figure 11 The results show that the target protein has a high column loading rate and concentrated elution, and the washing step has a clear impurity removal effect. Overall, the separation effect of this hydrophobic chromatography method is good, and it has a good purification effect.

[0097] Depend on Figure 12 The results showed that the target protein had almost no flow-through loss; the washing step effectively removed impurities, and the elution product had high purity; the elution was thorough, with little packing material residue and good recovery rate; no significant degradation or aggregation occurred during the purification process, and the protein had good stability. Depend on Figure 13 The results showed that the purity after elution reached 94.7%, and the yield reached 90%. This indicates that the Pichia pastoris engineered strain provided in this application has a high expression level, and high-purity, high-recovery-rate type I+III recombinant collagen can be obtained by fermentation and purification using the above method.

[0098] The embodiments described above are some, but not all, of the embodiments of this application. The detailed description of the embodiments of this application is not intended to limit the scope of the claimed application, but merely to illustrate selected embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of this application without inventive effort are within the scope of protection of this application.

Claims

1. A Pichia pastoris engineering bacteria for efficiently expressing type I+III recombinant collagen, characterized in that, The Pichia pastoris engineered strain is a multi-copy Pichia pastoris engineered strain, which contains multiple 2-copy plasmid vectors and / or multiple single-copy plasmid vectors, wherein the plasmid vectors contain a type I+III recombinant collagen fusion gene; the sequence of the type I+III recombinant collagen fusion gene is shown in SEQ ID NO:

1.

2. The engineered Pichia pastoris bacterium of claim 1, wherein, The Pichia pastoris engineered strain is a 5-copy Pichia pastoris engineered strain, which contains two 2-copy plasmid vectors and one 1-copy plasmid vector.

3. The engineered Pichia pastoris bacterium of claim 2, wherein, The single-copy plasmid vector is a single-copy plasmid vector into which the type I+III recombinant collagen fusion gene is inserted into the pHKA vector with AOXm as the promoter and αCC as the signal peptide. And / or, the 2-copy plasmid vector is Bgl II and Bam The expression cassette of the single-copy plasmid vector was digested with HⅠ double enzyme digestion, and the expression cassette was inserted into the single-copy plasmid vector. Bgl Two-copy plasmid vectors at site II.

4. The engineered Pichia pastoris strain according to claim 3, characterized in that, The single-copy plasmid vector and the two-copy plasmid vector also include hygromycin as a selection marker. Int 1 is an integration site, containing Cre / lox P-system circular integrative plasmid vectors.

5. A method for constructing Pichia pastoris engineered strains as described in any one of claims 1 to 4, characterized in that, include: S1, construct single-copy plasmid vectors and 2-copy plasmid vectors; S2, using the 2-copy plasmid vector Nco I. Linearization was performed, and the cells were introduced into Pichia pastoris GS115 competent cells by electroporation. After electroporation, the cells were plated on MD solid selection plates, incubated at constant temperature, and single colonies were picked for PCR verification to obtain a positive 2-copy Pichia pastoris engineered strain. S3, the hygromycin-labeled 2-copy plasmid vector was used Bcu Linearization was performed, followed by electroporation into the 2-copy Pichia pastoris engineered strain. The transformed strain was plated on YPDH-resistant plates and screened for positive transformants through isothermal incubation. Cre / lox P-system-mediated knockout of the hygromycin resistance gene yielded a genetically stable 4-copy Pichia pastoris engineered strain without resistance markers; S4. Repeat step S3 at least once more, electroporating the hygromycin-labeled single-copy plasmid vector or 2-copy plasmid vector into the 4-copy Pichia pastoris engineered strain, and then screening to obtain a multi-copy Pichia pastoris engineered strain.

6. A fermentation and purification method for Pichia pastoris engineered strains as described in any one of claims 1 to 4, characterized in that, include: Pichia pastoris engineered strains were inoculated into BSM basal medium and fermented in four controlled stages: batch growth, glycerol feeding, methanol transition, and induced expression. The induction expression temperature was 22 ℃~30 ℃. After fermentation, the fermentation product was purified in an integrated manner.

7. The fermentation purification method according to claim 6, characterized in that, When conducting a 500 L pilot-scale fermentation, the induction temperature was 22 °C.

8. The fermentation purification method according to claim 6, characterized in that, The inoculation amount of the engineered Pichia pastoris is 8%~10%.

9. The fermentation purification method according to claim 6, characterized in that, The integrated purification of the fermentation product after fermentation includes: S1, the fermentation product is separated by cell separation to obtain protein stock solution; S2, the protein stock solution is subjected to ultrafiltration, hydrophobic chromatography, and desalting to obtain type I+III recombinant collagen.

10. A type I+III recombinant collagen prepared by the fermentation and purification method of Pichia pastoris engineered strain as described in any one of claims 6 to 9, characterized in that, Expression level ≥9.5 mg / mL, purity ≥94.7%.