A crisper assisted genome site-directed insertion marker system and cell editing method

Abstract

The application belongs to the technical field of gene editing, and particularly relates to a CRISPR-assisted genome site-directed insertion marker system and a cell editing method. The system comprises a first guide RNA targeting a genome site, a second guide RNA targeting a donor vector, a high-fidelity Cas9 protein, and a universal donor vector, wherein the universal donor vector contains a P2A-fluorescent protein-T2A-HSV-tk expression frame. The ribonucleoprotein complex formed by electrotransferring the above components realizes efficient and accurate insertion of an exogenous fragment. Compared with the prior art, the application significantly improves the site-directed knock-in efficiency (the positive rate of organoids under resistance screening reaches 48.28%) and fidelity in cells and organoids, realizes the double functions of fluorescent tracing and inducible clearance of target cells and visualization, simplifies the design of the donor, reduces the experimental period and cost, and is particularly suitable for complex systems such as cells and organoids with limited homologous recombination activity.

Description

Technical Field

[0001] This invention belongs to the field of gene editing technology, specifically relating to a CRISPR-assisted genome-wide insertion marker system and a cell editing method. Background Technology

[0002] With the development of gene editing technology, site-specific genome modification methods based on the CRISPR / Cas9 system have been widely applied in gene function research, protein localization analysis, cell labeling and tracing, and disease model construction. In these applications, it is often necessary to insert fluorescent proteins, selection markers, functional peptides, or other exogenous nucleic acid sequences into specific sites in the genome, especially into the coding regions of endogenous target genes, to achieve the labeling, tracking, or functional expansion of target proteins.

[0003] Traditional knock-in relies heavily on homology-directed repair (HDR). While HDR offers high precision, its activity is primarily limited to the S / G2 phase. In most mammalian cells, HDR's efficiency is far lower than that of non-homologous end joining (NHEJ), resulting in generally low knock-in efficiency in stem cells, primary cells, and organoid systems. Furthermore, HDR typically requires the pre-construction of donor vectors containing upstream and downstream homologous arms to the target site. This leads to drawbacks such as cumbersome donor construction with long homologous arms, long experimental cycles, and high pressure in positive clone screening, reducing the versatility and standardization of the technology and hindering multi-gene, large-scale, or high-throughput applications. Newly developed HDR-independent technologies, such as twin-guided primer editing (twinPE) and CRISPR-associated transposases (CAST), are limited in application due to their complex design and cumbersome construction.

[0004] CRISPaint (CRISPR-assisted insertion tagging) technology is a CRISPR / Cas system-mediated insertion technique for exogenous nucleic acid fragments. The basic principle is as follows: sgRNA guides the Cas9 endonuclease to create a double-strand break at the target genomic site. Simultaneously, a specific cutting sequence in the donor vector releases the exogenous insertion fragment from the donor plasmid. Within the cell, the exogenous fragment is inserted into the target genomic break site via the NHEJ repair mechanism. This technology allows for the integration of fluorescent tags, selection markers, reporter genes, or other functional elements into the target genomic site without relying on the design and construction of long homologous arms.

[0005] CRISPaint technology typically comprises the following components: First, a genome-targeting vector containing sgRNA targeting the target gene, used to endow Cas9 with cleavage specificity at the target genomic site; Second, a universal cleavage vector containing the Cas9 coding sequence and sgRNA targeting a specific site on the donor vector, where Cas9 is used for cleavage of the genome and the donor vector at the target site, and sgRNA-mediated cleavage of the donor vector at the specific site linearizes it and improves the reading frame fit between the donor vector fragment and the target coding sequence; Third, a universal donor plasmid containing fluorescent proteins, selection markers, or other functional sequences, used to release the exogenous insert fragment after donor cleavage and to integrate the fragment into the target site.

[0006] The DNA insertion process of CRISPaint technology relies on the NHEJ repair mechanism. Although there is a tendency for repair errors, which affects the accuracy of the insertion results, the insertion efficiency is significantly higher than that of HDR-dependent methods. The ingenious design of universal cutting vectors and donor vectors also greatly improves the adaptability and versatility of this technology. However, due to the different preferences of different cells for DNA double-strand break repair pathways, and the differences in transfection efficiency, Cas9 expression levels, and donor release efficiency, the integration efficiency of exogenous fragments in CRISPaint technology may be unstable in different cell lines, primary cells, organoids, or special cell types, limiting its universal applicability in various experimental systems. Secondly, the potential off-target effects of Cas9 may lead to insertion at non-target sites, resulting in non-specific editing. Thirdly, prior to this invention, only donor vectors expressing fluorescent proteins and molecular tags were available internationally, limiting application scenarios. For example, when studying the function of specific cell populations, a common method is to construct transgenic mouse models containing cell clearance systems that induce apoptosis. If a donor vector can be constructed that simultaneously expresses a fluorescent protein and an apoptosis-inducing system (such as HSV-tk, herpes simplex virus thymidine kinase), then the dual purpose of cell tracing and specific clearance can be achieved in human culture models.

[0007] In view of this, the present invention aims to provide a highly efficient and specific insertion technology for exogenous fragments based on the CRISPaint system, while simultaneously constructing a dual-function system of fluorescent labeling and induced cell clearance, to solve the following technical problems existing in the prior art: (1) Solve the off-target effect problem caused by insufficient fidelity of existing CRISPaint technology; (2) To solve the problem of large efficiency differences and instability of the existing CRISPaint technology in different cell lines and organoids; (3) Solve the problem that the existing CRISPaint technology cannot achieve the cell “tracking function” and “cleaning function”.

[0008] CRISPaint is a method for introducing exogenous sequences at specific gene loci. It is a three-module system consisting of a target plasmid expressing sgRNA targeting the target gene locus, a universal donor plasmid carrying the insert sequence, and a universal cutting vector specifically responsible for cutting both the genome and the donor plasmid. Its core mechanism involves simultaneously introducing Cas9 cuts into both the target genome locus and the donor vector, allowing the linearized donor to integrate at the target breakpoint via classical non-homologous end joining (NHEJ). Figure 1 Compared to traditional knock-in methods that require constructing homologous arms of 500-1000bp, CRISPaint eliminates this cumbersome cloning step and allows for more flexible tag insertion through donor cleavage sites and reading frame design. Therefore, it has high practicality in areas such as C- and N-terminal tags of endogenous proteins and reporter gene insertion.

[0009] While the introduction of universal cleavage vectors brings flexibility, it also increases the complexity of the system. The three-plasmid system requires precise proportions, which may affect transfection efficiency. More importantly, the universal cleavage vector is essentially another plasmid expressing sgRNA, increasing the total amount of sgRNA in the cell and potentially increasing the risk of off-target cleavage. Summary of the Invention

[0010] The purpose of this invention is to address existing problems by providing a CRISPR-assisted genome-wide insertion marker system and a cell editing method.

[0011] This invention is achieved through the following technical solution: A CRISPR-assisted genome-wide insertion marker system includes: (a) Genome-targeting sgRNA (first guide RNA) This sgRNA (first guide RNA) targets a specific DNA sequence of the target gene, mediating the recognition and cleavage of specific sites in the genome by the high-fidelity Cas9 protein (HiFiCas9). The original CRISPaint method expressed the first guide RNA via a plasmid vector, but continuous sgRNA expression can lead to potential off-target effects. For this module, we directly synthesized the full-length sgRNA using chemical techniques. Using synthetic sgRNA reduces the number of plasmid cloning steps and, more importantly, reduces the potential off-target effects caused by continuous sgRNA expression in plasmids. The target sequence of the first guide RNA can be designed based on the exon regions, functional domain coding regions, or expected insertion sites of the target gene to improve insertion efficiency and expression accuracy.

[0012] (b) HiFi Cas9 protein and donor-targeting sgRNA (second guide RNA) This sgRNA (second guide RNA) targets the donor vector, mediating the recognition and cleavage of specific sites on the donor by the HiFi Cas9 protein, while simultaneously regulating the reading frame through the target sequence. The HiFi Cas9 protein cleaves the target genomic site under the guidance of the first guide RNA and cleaves the donor-related site under the guidance of the second guide RNA. The original CRISPaint method expressed HiFi Cas9 protein and the second guide RNA through a universal cleavage vector; however, continuous expression of both sgRNA and HiFi Cas9 protein increases off-target effects. In this protocol, we expressed and purified the HiFi Cas9 protein using a bacterial expression system. Simultaneously, we directly synthesized the full-length sgRNA (second guide RNA) using chemical techniques. Direct transfection of the RNP formed by sgRNA and HiFi Cas9 protein reduces off-target effects caused by continuous plasmid expression, improving the accuracy and safety of this technique.

[0013] (c) Universal donor carrier A donor plasmid containing a target exogenous nucleic acid sequence for insertion into a target genomic site. The target functional fragment encodes a detectable marker or functional polypeptide. In a specific embodiment, the target functional fragment encodes a fluorescent protein or protein tag; the fluorescent protein encoding sequence may be green fluorescent protein (e.g., Clover), red fluorescent protein (e.g., mCherry), or other detectable signal proteins.

[0014] In this invention, the coding sequences of fluorescent proteins (Clover and mCherry) and the coding sequence of the cytotoxic gene HSV-tk are linked via a self-cleaving short peptide T2A. After insertion into the genome, the fluorescent protein-T2A-HSV-tk is linked to the genomic target via a self-cleaving short peptide P2A, thereby achieving parallel expression of the target protein, fluorescent protein, and HSV-tk. The HSV-tk expression can serve as a negative selection marker for subsequent cell screening or as a suicide gene for conditional cell clearance. Through the expression of the fluorescent protein, insertion events can be screened, identified, and their functions verified, thereby improving the efficiency of identifying positive clones and "visualizing" the cell clearance effect.

[0015] A method for cell editing using a CRISPR-assisted genome-directed insertion marker system includes the following steps: (1) Preparation of nucleic acid components Genomic targeting sgRNA (first guide RNA) and donor targeting sgRNA (second guide RNA) are prepared by chemical synthesis and dissolved separately in nuclease-free water to reach a predetermined concentration. The solutions are then mixed and briefly centrifuged to concentrate the liquid at the bottom of the container. The target site of the first / second sgRNA is preferably the site near the stop codon at the C-terminus of the genome. In a specific embodiment, the chemically synthesized first / second sgRNA is 110 bp in length, without any other special modifications, and the predetermined concentration is 4 ng / μL.

[0016] (2) Preparation of nuclease protein High-fidelity Cas9 protein (HiFi Cas9) was expressed using a bacterial expression system, and the expression product was purified to obtain the HiFi Cas9 protein. The protein was then dissolved in nuclease-free water to reach a predetermined concentration, and the solution was briefly centrifuged to concentrate the liquid at the bottom of the container. The predetermined concentration was 100 mg / mL.

[0017] (3) Preparation of universal donor carriers A universal donor vector was constructed by linking a fluorescent protein-coding sequence with a gene encoding an induced cytotoxicity / suicide gene via a self-cleaving 2A peptide (e.g., T2A), and simultaneously linking the fluorescent protein-coding sequence with a genomic target gene via a self-cleaving 2A peptide (e.g., P2A). The universal donor vector was then dissolved in nuclease-free water to reach a predetermined concentration, and the solution was briefly centrifuged to concentrate the liquid at the bottom of the container. The predetermined concentration was 100 ng / μL.

[0018] (4) Constructing an import composite system The nucleic acid components, nuclease protein, universal donor carrier and electroporation buffer system are mixed in a preset ratio to form an introduction system containing ribonucleoprotein complex and donor nucleic acid.

[0019] (5) Composite incubation The mixture obtained in step (4) is mixed and then centrifuged briefly to concentrate the liquid at the bottom of the container. It is then incubated for a predetermined time to promote the formation of the ribonucleoprotein complex and improve the stability of the system.

[0020] (6) Recipient cell pretreatment Recipient cells are digested, counted, and collected by centrifugation; after washing the cell pellet with buffer (such as PBS), the cells are resuspended in a suitable electroporation resuspension solution (such as Opti-MEM) to obtain the cell suspension to be introduced.

[0021] (7) Electroporation Mix the cell suspension obtained in step (6) with the system obtained in step (5) and transfer it to the electroporation reaction vessel for electroporation treatment under electroporation parameters adapted to the recipient cells.

[0022] (8) Recovery culture after importation After electroporation, pre-warmed culture medium is immediately added to restore the cells, and the treated cells are seeded into culture containers for further culture. The recovery culture stage is preferably carried out under antibiotic-free conditions, and cell state maintenance or survival promotion reagents may be added.

[0023] The culture medium is a complete recipient cell culture medium without antibiotics (such as DMEM + 10% FBS).

[0024] (9) Subsequent testing After electroporation and culture for a predetermined time, a portion of the cells are collected for genotyping, insertion identification, or other molecular tests to evaluate the target knock-in effect.

[0025] The present invention has the following advantages over the prior art: This invention is based on traditional CRISPaint technology and makes the following contributions: (1) A highly efficient system of "sgRNA + high-fidelity Cas9 protein (HiFi Cas9) + universal donor" was constructed. Through chemical synthesis of sgRNA and expression and purification of HiFi Cas9 protein, we established a strategy of co-transfection of mature sgRNA, HiFi Cas9 protein and universal donor vector to achieve more precise and specific insertion of target fragments. Direct transfection of sgRNA and HiFi Cas9 protein reduces the potential off-target cleavage of the host genome due to their continuous expression, significantly improves the overall safety and editing accuracy of the CRISPaint system, and helps to improve the quality of the final positive clones, not just the number, thereby reducing non-specific background and achieving "reduced side effects and improved system specificity".

[0026] (2) Direct and efficient electroporation of cells with sgRNA and HiFi Cas9 protein. Compared with conventional transfection methods based on expression plasmids, directly introducing sgRNA and HiFi Cas9 protein into cells via electroporation to form ribonucleoprotein complexes (RNPs) has advantages such as rapid onset, short action time, and high editing efficiency; in some embodiments, these advantages are even more pronounced when the sgRNA and HiFi Cas9 protein are co-delivered to form ribonucleoprotein complexes. Its high editing efficiency is particularly evident in difficult-to-transfect cells / organoids and difficult-to-edit genes.

[0027] (3) By linking HSV-tk to the Clover and mCherry insertion templates, a dual-function system of fluorescent labeling and induced cell clearance was constructed. We inserted a fragment expressing herpes simplex virus thymidine kinase (HSV-tk) into an existing universal donor plasmid containing Clover or mCherry fluorescence. HSV-tk can phosphorylate some nucleoside analog prodrugs (such as ganciclovir, GCV), converting them into toxic phosphorylated metabolites that inhibit DNA synthesis, ultimately leading to cell death. Combining fluorescent labeling with HSV-tk creates a dual-function system of fluorescent labeling and induced cell clearance, facilitating cell tracking and clearance, and making the clearance effect "visible." Figure 2 ).

[0028] Compared to existing genome insertion techniques that rely on homologous arm donors, this invention guides a high-fidelity Cas9 protein (HiFi Cas9) to generate double-strand breaks at the target site using chemically synthesized sgRNA. Combined with a donor fragment release and break site integration mechanism, this enables the insertion of exogenous sequences into the target site without the need to construct long homologous arm donors. Furthermore, this invention constructs a dual-function system with fluorescent labeling and induced cell clearance, integrating "clearance function" and "tracking function."

[0029] Based on the above technical features, the present invention can produce at least the following technical effects: 1) Significantly Improved Efficiency of Genome K-Into in Cells / Organoids: This invention directly introduces a ribonucleoprotein complex formed by sgRNA and HiFi Cas9 protein into cells via electroporation, offering advantages such as rapid onset of action, short duration of action, and high editing efficiency. Therefore, the "sgRNA + HiFi Cas9 protein + universal donor" system improves the efficiency of site-specific knock-in. In cell and organoid systems, especially in systems with relatively limited homologous recombination activity (such as slowly proliferating cells), this invention helps improve the overall efficiency of integrating exogenous fragments into target genomic sites, thereby increasing the probability of obtaining positive site-specific knock-in samples (with a positive rate as high as 48.28% in organoids under resistance gene screening).

[0030] 2) Significantly improves the fidelity of site-directed knock-in of cell / organoid genomes: This invention utilizes a "sgRNA + HiFiCas9 protein + universal donor" fidelity system to directly transfect chemically synthesized sgRNA and HiFiCas9 protein, achieving precise insertion at the target site and reducing the adverse effects of integration at non-target sites on experimental results. Simultaneously, by employing a HiFiCas9 protein target adaptation design guided by a second guide RNA, the likelihood of correct alignment between the inserted fragment and the target coding sequence is increased, thereby enhancing the fidelity of the site-directed knock-in product at both the structural and expression levels.

[0031] 3) Achieving dual functions of target cell labeling and specific clearance, and visualizing the cell clearance effect: By constructing a universal vector of P2A-fluorescent protein-T2A-HSV-tk, the dual functions of target cell labeling and specific clearance were achieved. The genome knock-in effect and the presence status of HSV-tk can be characterized by fluorescence signals, thus transforming the system from "detection-only" to "functional and detection-only". This inevitably improves the visual recognition and functional detection capabilities of target cells.

[0032] 4) Significantly improves the feasibility of application in complex systems such as organoids: Organoid systems typically have characteristics such as long culture cycles, limited amplification efficiency, high cost per operation, and difficulty in early identification of target cells based solely on drug response. Therefore, they require high efficiency and simplicity of operation in gene editing. This invention simplifies donor design and increases the probability of successful insertion at the target site. Furthermore, it directly locates the target population expressing HSV-tk in complex systems using fluorescence, which helps reduce the operational burden in organoid gene editing and improves its feasibility of application in complex three-dimensional culture systems.

[0033] 5) Shortened experimental cycle and reduced experimental costs: By eliminating steps such as long homologous arm design, amplification, splicing and verification, and sgRNA vector construction, this invention reduces the workload of early molecular cloning, thereby shortening the overall time from protocol design to actual transfection or delivery. In experimental scenarios requiring parallel multi-gene editing, multi-site comparison, or rapid functional verification, this technology helps improve experimental efficiency. It also reduces reagent consumption, labor input, and time costs to a certain extent. For applications requiring multi-target knock-in verification or repeated optimization of editing conditions in organoid systems, this technical solution offers good economic advantages. Attached Figure Description

[0034] Figure 1 CRISPaint components and their working principle diagram; Figure 2 This is a schematic diagram of the components and working principle of the present invention (nCRISPaint); Figure 3 P2A-Clover-T2A-HSVtk insertion in pancreatic cancer cell lines VIM Efficiency analysis of gene loci; Figure 4 P2A-Clover-T2A-HSVtk insertion in organoids KRT19 Efficiency of gene loci and cellular functional analysis of HSVtk-induced toxicity; Figure 5A flowchart illustrating the insertion of P2A-Clover-T2A-HSVtk and P2A-mCherry-T2A-HSVtk into specific gene sites in organoids. Detailed Implementation

[0035] To make the objectives, technical solutions, and effects of this invention clearer and more explicit, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0036] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0037] The biological sequence information involved is as follows: ① The first guide RNA sequence: VIM-sgRNA (SEQ ID NO. 2) used in Example 1 described below: 5'-GGTTGAGACCAGAGATGGACAGG-3'; In Example 2, KRT19-sgRNA (SEQ ID NO. 3) was used: 5'-CCCAGAGCCTGCTGCCTCAG-3'.

[0038]

[0039] ③ The P2A coding sequence (SEQ ID NO. 4): 5'-gctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct-3'; The T2A coding sequence (SEQ ID NO. 5): 5'-gagggcagaggaagtcttctaacatgcggtgacgtggaggagaatcccggccct-3'.

[0040] ④ The Clover coding sequence (SEQ ID NO. 6): 5'-gtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtccgcggcgagggcgagggcgatgccaccaacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcgtggcctgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatctctttcaaggacgacggtacctacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaacttcaacagccactacgtctatatcacggccgacaagcagaagaactgcatcaaggctaacttcaagatccgccacaacgttgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagccatcagtccaagctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgcc-3'; Said mCherry coding sequence (SEQ ID NO. 7): 5'- gtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaag-3'.

[0041]

[0042] ⑥ The coding sequence of the resistance gene (SEQ ID NO). 9): 5'-atggccaagcctttgtctcaagaagaatccaccctcattgaaagagcaacggctacaatcaacagcatccccatctctgaagactacagcgtcgcc agcgcagctctctctagcgacggccgcatcttcactggtgtcaatgtatatcattttactgggggaccttgtgcagaactcgtggtgctgggcactgctgct gctgcggcagctggcaacctgacttgtatcgtcgcgatcggaaatgagaacaggggcatcttgagcccctgcggacggtgccgacaggtgcttctcgatctg catcctgggatcaaagccatagtgaaggacagtgatggacagccgacggcagttgggattcgtgaattgctgccctctggttatgtgtgggagggctaa-3'.

[0043] Example 1: This example employs a cell line electroporation knock-in method based on the co-delivery of ribonucleoprotein complexes and donor nucleic acids to knock in human type III intermediate filament protein vimentin. VIM The P2A-Clover-T2A-HSVtk and Blastidin resistance selection expression cassettes were inserted at the C-terminus of the gene, as follows: Prepared by chemical synthesis VIM The gene C-terminal targeted sgRNA (VIM-sgRNA) was selected. Based on the need for reading frame adjustment between the target insertion fragment (P2A-Clover-T2A-HSVtk) and the VIM genome coding sequence, type I second guide RNA (Sele1-sgRNA) was selected and prepared by chemical synthesis.

[0044] Preparation of a universal donor vector (KI-DNA): The Clover coding sequence and the coding sequence of the cytotoxic gene HSV-tk were linked by a self-cleaving short peptide T2A. Simultaneously, a self-cleaving short peptide P2A was added to the N-terminus of Clover so that after insertion into the genome, Clover-T2A-HSVtk could bind to the gene via P2A. VIM C-terminus ligation of the gene. Amplification of the constructed KI-DNA plasmid.

[0045] The protein was expressed using a high-fidelity bacterial expression system (HiFi Cas9), and the expression product was purified.

[0046] Take 4 ng VIM-sgRNA, 4 ng Sele1-sgRNA, 200 ng KI-DNA, 4 ng HiFi Cas9 protein and 2.5 μL 10X electroporation buffer (LONZA 4D-Nucleofector kit) and mix them in a 1.5 mL centrifuge tube. After a short centrifugation, let it stand at room temperature for 30 min.

[0047] Human pancreatic cancer cell lines in good growth condition were collected by centrifugation after digestion and counting, yielding approximately 2 × 10⁻⁶ cells / year. 6 Cells were washed with 500 μL of PBS, centrifuged, and the supernatant was discarded. The cells were then resuspended in 20 μL of cell resuspension solution to prepare a cell suspension for transfer. The cell suspension was then thoroughly mixed with a pre-prepared editing component mixture and transferred to an electroporation reactor. Electroporation was immediately performed using a LONZA 4D-Nucleofector cell transducer with the CM138 program selected. After electroporation, 180 μL of preheated (37°C) cell culture medium (antibiotic-free and containing ROCK inhibitors) was immediately added to the reaction system. The treated cells were then evenly seeded into cell culture dishes and cultured further. Specific results are shown below. Figure 3 As shown. Figure 3 AD displays P2A-Clover-T2A-HSVtk at VIM Successful insertion at the gene locus resulted in a positive rate of up to 35% without drug screening. Compared to traditional site-specific genome insertion technology, both insertion efficiency and fidelity were significantly improved. Figure 3 EG data showed that the positive rate could be increased to 65% after drug screening. Therefore, this technology can significantly improve the efficiency and fidelity of targeted knock-in of the cell genome, while also significantly improving the identification efficiency of positive clones.

[0048] Example 2: This example employs an organoid electroporation knock-in method based on the co-delivery of ribonucleoprotein complexes and donor nucleic acids, for human... KRT19 (CK19) The P2A-Clover-T2A-HSVtk and Blastidin resistance selection expression cassettes were inserted at the C-terminus of the gene, as follows: Prepared by chemical synthesis KRT19The C-terminal target sgRNA (KRT19-sgRNA) was selected. Based on the requirement for reading frame adjustment between the target insertion fragment (P2A-Clover-T2A-HSVtk) and the KRT19 genome coding sequence, type II second guide RNA (Sele2-sgRNA) was selected and prepared by chemical synthesis.

[0049] Preparation of a universal donor vector (KI-DNA): The Clover coding sequence and the coding sequence of the cytotoxic gene HSV-tk were linked by a self-cleaving short peptide T2A. Simultaneously, a self-cleaving short peptide P2A was added to the N-terminus of Clover so that after insertion into the genome, Clover-T2A-HSVtk could bind to the gene via P2A. KRT19 C-terminus ligation of the gene. Amplification of the constructed KI-DNA plasmid.

[0050] The protein was expressed using a high-fidelity bacterial expression system (HiFi Cas9), and the expression product was purified.

[0051] Take 4 ng KRT19-sgRNA, 4 ng Sele2-sgRNA, 200 ng KI-DNA, 4 ng HiFi Cas9 protein and 2.5 μL 10X electroporation buffer (LONZA 4D-Nucleofector kit) and mix them in a 1.5 mL centrifuge tube. After a short centrifugation, let it stand at room temperature for 30 min.

[0052] Organoids in good growth condition were collected, digested, counted, and then centrifuged to collect approximately 1 × 10⁻⁶ units. 6 Cells were washed with 500 μL of PBS, centrifuged, and the supernatant was discarded. The cells were resuspended in 20 μL of cell resuspension solution to prepare the organoid cell suspension to be transformed. The organoid cell suspension was then thoroughly mixed with the pre-prepared editing component mixture and transferred to an electroporation reactor. Electroporation was immediately performed using a LONZA 4D-Nucleofector cell transducer with the CM138 program selected. After electroporation, the cells were incubated at room temperature for 30 min, centrifuged, and the supernatant was discarded. The organoid cells were resuspended in 25 μL of matrix gel and seeded into cell culture dishes. The dishes were incubated at 37°C for 30 min using CO2. Then, 500 μL of organoid culture medium preheated to 37°C (containing no antibiotics and a ROCK inhibitor) was added to the cell culture dishes, and the culture was continued. Specific results are shown below. Figure 4 As shown. Figure 4 AB shows P2A-Clover-T2A-HSVtk in KRT19The insertion at the gene locus was successful, and the positive insertion rate reached 6.83% without drug screening, while the positive insertion rate increased to 48.28% after drug screening. Figure 4 In a specific implementation, CD shows that cell clearance is achieved using a prodrug (ganciclovir, GCV). After GCV treatment, the green-marked organoids are significantly cleared. Therefore, this technology can significantly improve the knock-in efficiency and fidelity of organoids that are difficult to knock into the genome, while also significantly improving the identification efficiency of positive clones and "visualizing" the cell clearance effect.

[0053] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A CRISPR-assisted genome-wide insertion marker system, characterized in that, include: (a) A first guide RNA that targets a specific genomic site; (b) A second guide RNA that targets a specific site on a universal donor vector; (c) The high-fidelity Cas9 protein encoded by SEQ ID NO. 1; (d) A universal donor vector comprising an exogenous nucleic acid sequence, wherein the exogenous nucleic acid sequence comprises, from the 5' end to the 3' end, a sequence encoding a first self-cleaving peptide P2A, a sequence encoding a fluorescent protein, a sequence encoding a second self-cleaving peptide T2A, and a sequence encoding herpes simplex virus thymidine kinase (HSV-tk).

2. The system according to claim 1, characterized in that, Both the first guide RNA and the second guide RNA are chemically synthesized full-length sgRNAs.

3. The system according to claim 1, characterized in that, The high-fidelity Cas9 protein was obtained by expression and purification using a bacterial expression system.

4. The system according to claim 1, characterized in that, The first guide RNA, the second guide RNA, and the high-fidelity Cas9 protein together form a ribonucleoprotein complex (RNP).

5. The system according to claim 1, characterized in that, The fluorescent protein is either green fluorescent protein Clover or red fluorescent protein mCherry.

6. A method for cell editing using the system according to any one of claims 1 to 5, characterized in that, Includes the following steps: (1) Preparation of nucleic acid components: chemical synthesis of the first guide RNA and the second guide RNA; (2) Preparation of nuclease protein: The high-fidelity Cas9 protein was obtained by expression and purification; (3) Preparation of universal donor vector: Construct and amplify a universal donor vector containing the exogenous nucleic acid sequence; (4) Constructing the introduction complex system: The first guide RNA and the second guide RNA obtained in step (1) are mixed with the high-fidelity Cas9 protein obtained in step (2) and incubated to form a ribonucleoprotein complex (RNP); then the RNP is mixed with the universal donor vector and electroporation buffer system obtained in step (3) to obtain the introduction system; (5) Electroporation: The importation system obtained in step (4) is mixed with the pretreated recipient cell suspension and subjected to electroporation. (6) Recovery culture: After electroporation, add culture medium for cell recovery culture; (7) Screening and identification: Successfully edited cells were enriched using resistance screening or fluorescent labeling, and / or treated with ganciclovir (GCV) to verify HSV-tk-mediated cell clearance function.

7. The method according to claim 6, characterized in that, The amount of the first guide RNA and the second guide RNA is 4 ng each, the amount of the high-fidelity Cas9 protein is 4 ng, and the amount of the universal donor vector is 200 ng.

8. The method according to claim 6, characterized in that, The electro-spinning process uses the LONZA 4D-Nucleofector system with the CM138 program.

9. The method according to claim 6, characterized in that, The recovery culture was carried out in a culture medium free of antibiotics and containing ROCK inhibitors.

10. The method according to claim 6, characterized in that, The recipient cells are mammalian cell lines or organoid cells.

Images