A preparation method of mycoplasma synoviae delta ha-l recombinant protein, an elisa detection kit, a colloidal gold test strip and a preparation method thereof

Abstract

The application discloses a preparation method of Mycoplasma synoviae △HA-L recombinant protein, an ELISA detection kit, a colloidal gold test strip and a preparation method thereof. The prokaryotic expressed Mycoplasma synoviae △HA-L recombinant protein is used as a coating antigen to establish the ELISA detection kit, and the Mycoplasma synoviae antibody can be rapidly detected, and the ELISA detection kit has good specificity. The clinical sample is detected, and the result shows that the accuracy rate of the ELISA detection kit for detecting the diagnosed serum sample reaches 98%, and the antigen sensitivity and specificity are high. The double-antigen sandwich principle is used, the purified Mycoplasma synoviae △HA-L recombinant protein is used as a gold-labeled antigen and a coating antigen, and the coating antigen is coated on a gold-labeled pad and a detection line to prepare the MS colloidal gold test strip. The performance of the colloidal gold test strip is evaluated, and the result shows that the colloidal gold test strip can make a judgment in a short time, can effectively meet the clinical rapid detection demand, and can provide support for early diagnosis and monitoring of MS.

Description

Technical Field

[0001] This invention relates to the field of rapid diagnostic technology for animal disease pathogens, and in particular to a method for preparing Mycoplasma synoviae ΔHA-L recombinant protein, an ELISA detection kit, a colloidal gold test strip, and the preparation method thereof. Background Technology

[0002] Mycoplasma synoviae (MS) is a cell-wall-less, independently surviving, minimal prokaryotic microorganism that primarily infects poultry such as chickens and turkeys. It exhibits tissue tropism, and clinical manifestations mainly include arthritis-like infections affecting joints, synovial bursae, tendon sheaths, and keel bursae, as well as respiratory infections affecting the respiratory tract or air sacs. In laying hens, MS infection leads to decreased egg production and eggshell apex abnormalities (EAA). Mixed infections with various viruses, bacteria, and parasites are common clinically. With the expansion of the poultry industry and increasingly frequent trade, the spread of Mycoplasma synoviae in my country is accelerating and expanding. Once infected, a host remains a carrier for life and cannot be eradicated; therefore, prevention is the best approach to controlling this disease.

[0003] With the large-scale development of chicken farms, those farms that previously relied solely on drugs to control Mycoplasma synoviae disease have been plagued by this disease in recent years. As a crucial aspect of integrated disease control, the development of a simple MS detection method applicable to large-scale chicken farms is urgently needed. Currently, integrated MS control in my country mainly involves immunizing chicken flocks and cleaning up chicken farms. Accurate diagnosis of MS is vital for its control and eradication. To effectively control Mycoplasma synoviae disease, efficient detection methods are needed to conduct epidemiological investigations.

[0004] Currently, diagnostic methods for MS mainly include pathogen isolation and identification, molecular biology methods, and serological methods. Pathogen isolation and identification is currently the "gold standard" for MS detection, providing authoritative evidence for breeder farm purification certification and disease eradication effectiveness assessment. However, the detection cycle is long, rapid diagnosis is not possible, and it is only suitable for accurate diagnosis of a small number of samples, not for batch testing, resulting in significant limitations in clinical application. Molecular biology detection methods, such as PCR, qPCR, LAMP, and RPA, are widely used in poultry disease detection. These methods can be used for early diagnosis of latent and subclinical infections in chicken flocks, rapidly blocking transmission, but they can only detect nucleic acids and require specialized equipment and technicians. Compared to serological testing, the detection cost is higher, and it cannot assess the immune status of the flock. Serological methods, such as SPA, HI, and ELISA, are commonly used methods for disease screening and monitoring in poultry farms. The detection cost is low, but it requires sealing, incubation, and plate washing, which is time-consuming and labor-intensive. The methods described above all have good sensitivity and specificity for laboratory testing and the results are reliable. However, MS culture cycles are long and the operation is cumbersome, making them unsuitable for rapid clinical diagnosis. Furthermore, most of these methods require a laboratory environment, specialized culture equipment, and skilled technicians, making them difficult to promote at the grassroots level.

[0005] Therefore, it is necessary to develop corresponding MS-specific antibodies to establish ELISA detection methods and colloidal gold immunochromatography techniques, thereby improving the sensitivity and accuracy of MS serological detection and providing strong technical support for the prevention and control of MS in China. However, existing ELISA kits can produce false positives when detecting Mycoplasma synoviae, and there are currently no commercially available ELISA kits or colloidal gold test strips for Mycoplasma synoviae in my country.

[0006] In summary, in order to control the spread of this disease in my country as soon as possible, there is an urgent need in this field for rapid, efficient and accurate serological diagnostic methods for Mycoplasma synoviae, which is of great significance for carrying out research on the diagnosis, treatment and prevention of Mycoplasma synoviae infection. Summary of the Invention

[0007] The purpose of this application is to provide a method for preparing Mycoplasma synoviae ΔHA-L recombinant protein, an ELISA detection kit, a colloidal gold test strip and its preparation method, which can rapidly and effectively detect Mycoplasma synoviae antibodies, so as to diagnose, treat and prevent Mycoplasma synoviae infection.

[0008] To address the aforementioned technical problems, this application provides a method for preparing recombinant Mycoplasma synoviae ΔHA-L protein, comprising: By comparing multiple Mycoplasma synoviae strains, the conserved domains shared by Mycoplasma synoviae hemagglutinin protein were identified and screened. Using a partial fragment of the Mycoplasma synoviae hemagglutinin genome as a template, the pET-30a expression vector was ligated with EcoRV and SacI to construct the recombinant expression plasmid pET-30a-△HA-L. The recombinant expression plasmid pET-30a-△HA-L was transformed into BL 21 competent cells and induced with isopropyl thiogalactoside. The induction conditions were: IPTG 0.1 mM, 25 ℃, 8 h. The obtained expression product was purified using Ni-NTA affinity chromatography medium to obtain the long-chain recombinant protein of Mycoplasma synoviae hemagglutinin. The concentration of the purified long-chain recombinant protein was determined using a BCA protein concentration assay kit and stored at -80 ℃ for later use. It was named Mycoplasma synoviae ΔHA-L recombinant protein. The amino acid sequence of the Mycoplasma synoviae ΔHA-L recombinant protein is as follows: MPKIVVEDYQAHETANQTKLQ AWFNANANWEKLS EQ LTKKLGSDKFKNVTLTNPTVS YEEVPKVTFNLAAKEG YE LASDSTETVTLTIRVLYKSAN PNQNLLATQGASIKKV NV YLNYTGPSIVLDAALPTVGGQ ENTSINGTSNVTGDFN TK FKKLLVTNRAENSLLQAVINY VNKFDPKFRAAFVTNG VT ITKVQSGTQLRPGTLDDLNNN NVFLQQIKGDTEAVYF AV TAIASNGWLNTFLIRIPLTKF VRPLTVF.

[0009] To address the aforementioned technical problems, this application also provides a Mycoplasma synoviae antibody indirect ELISA detection kit, wherein the detection kit uses the Mycoplasma synoviae ΔHA-L recombinant protein prepared by the above preparation method as the coating antigen of the ELISA enzyme-labeled plate.

[0010] As a preferred embodiment, a Mycoplasma synoviae antibody indirect ELISA detection kit includes an enzyme-labeled plate coated with Mycoplasma synoviae ΔHA-L recombinant protein, serum standard solution, enzyme-labeled antibody, TMB substrate chromogenic solution, sample dilution solution, washing solution, and termination reaction solution.

[0011] To address the aforementioned technical problems, this application also provides a method for preparing a colloidal gold test strip for Mycoplasma synoviae antibody detection. The colloidal gold test strip includes a PVC base plate, an NC membrane adhered to the center of the PVC base plate, a detection line and a control line fixed on the NC membrane, a gold-labeled pad adhered to the left side of the NC membrane, and an absorbent pad adhered to the right side of the NC membrane. The method further includes: Colloidal gold solution was prepared by the trisodium citrate reduction method; After adding K2CO3 solution to the colloidal gold solution and reacting, Mycoplasma synoviae ΔHA-L recombinant protein solution prepared by the preparation method described in claim 1 is added. After standing at room temperature, BSA solution is added to block the reaction. After centrifugation, the supernatant is discarded, and the solution is resuspended in resuspension solution to obtain the gold-labeled antigen solution. Spray the gold-labeled antigen solution onto the gold-labeled pad to use Mycoplasma synoviae ΔHA-L recombinant protein as the gold-labeled antigen, and use the Mycoplasma synoviae ΔHA-L recombinant protein as the coating antigen to coat the detection line, and use AntiHis-Tag mAb as the coating antibody to coat the control line. Attach the sample pad to the left side of the gold-labeled pad to obtain the colloidal gold test strip.

[0012] To address the aforementioned technical problems, this application also provides a colloidal gold test strip for detecting Mycoplasma synoviae antibodies, which is prepared using the aforementioned colloidal gold test strip preparation method.

[0013] Compared with the prior art, the method for preparing Mycoplasma synoviae ΔHA-L recombinant protein, the ELISA detection kit, the colloidal gold test strip, and the preparation method thereof provided by the present invention have at least the following beneficial effects: 1. This invention utilizes the recombinant Mycoplasma synoviae ΔHA-L protein expressed in prokaryotes as a coating antigen to establish an indirect ELISA kit for detecting serum antibodies against Mycoplasma synoviae disease. This kit can rapidly detect Mycoplasma synoviae antibodies with good specificity. Clinical sample testing showed that the indirect ELISA kit prepared using the purified Mycoplasma synoviae ΔHA-L recombinant protein of this invention as the coating antigen achieved an accuracy of 98% in detecting confirmed serum samples, demonstrating high antigen sensitivity and specificity.

[0014] 2. This invention utilizes the double-antigen sandwich principle, using purified Mycoplasma synoviae ΔHA-L recombinant protein as both the gold-labeled antigen and the coating antigen, coating the gold-labeled pad and the detection line (T line). Anti His-Tag mAb is used as the coating antibody to coat the control line (C line). The coating concentration was optimized to prepare an MS colloidal gold test strip, and the performance of the colloidal gold test strip was evaluated. Results show that the colloidal gold test strip has good sensitivity, specificity, repeatability, and stability, with a high clinical detection concordance rate. It can make judgments in a short time, effectively meeting the needs of rapid clinical testing and providing technical support for the early diagnosis, epidemic monitoring, and comprehensive prevention and control of MS. Attached Figure Description

[0015] To more clearly illustrate the technical solution of this application, the drawings used in the embodiments will be briefly introduced below. Obviously, for those skilled in the art, other drawings can be obtained based on these drawings without any creative effort.

[0016] Figure 1 A schematic diagram of SDS-PAGE analysis of the purification of recombinant Mycoplasma synoviae ΔHA-L protein provided in an embodiment of this application; Figure 2 A schematic diagram of Western blotting analysis of a recombinant Mycoplasma synoviae ΔHA-L protein provided in an embodiment of this application; Figure 3 This is a schematic diagram of a specificity test for an ELISA detection kit provided in an embodiment of this application; Figure 4 This is a schematic diagram of a sensitivity test for an ELISA detection kit provided in an embodiment of this application; Figure 5 This is a schematic diagram illustrating the preparation result of a colloidal gold solution provided in an embodiment of this application; Figure 6 This is a schematic diagram illustrating the determination of the optimal pH for colloidal gold-labeled antigens, provided in an embodiment of this application. Figure 7 This is a schematic diagram illustrating the determination of the optimal amount of colloidal gold-labeled antigen provided in an embodiment of this application. Figure 8 This is a schematic diagram illustrating the result interpretation of a test strip provided in an embodiment of this application; Figure 9 This is a schematic diagram illustrating the optimization of T-line coating concentration provided in an embodiment of this application; Figure 10 This is a schematic diagram illustrating the optimization of C-line coating concentration provided in an embodiment of this application; Figure 11This is a schematic diagram of the sensitivity detection result of a test strip provided in an embodiment of this application; Figure 12 This is a schematic diagram of the specific detection result of a test strip provided in an embodiment of this application; Figure 13 This is a schematic diagram of the intra-batch repeatability test results of a test strip provided in an embodiment of this application; Figure 14 This is a schematic diagram of inter-batch repeatability test results for a test strip provided in an embodiment of this application; Figure 15 This is a schematic diagram of the stability test results of a test strip provided in an embodiment of this application. Detailed Implementation

[0017] To enable those skilled in the art to better understand the technical solutions in this application, the technical solutions in the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings.

[0018] The core of this application is to provide a method for preparing Mycoplasma synoviae ΔHA-L recombinant protein, an ELISA detection kit, a colloidal gold test strip, and the preparation method thereof, which can rapidly and effectively detect Mycoplasma synoviae antibodies, so as to diagnose, treat and prevent Mycoplasma synoviae infection.

[0019] Figure 1 This is a schematic diagram of SDS-PAGE analysis of the purification of Mycoplasma synoviae ΔHA-L recombinant protein provided in an embodiment of this application. Figure 2 This is a schematic diagram of Western blotting analysis of a recombinant Mycoplasma synoviae ΔHA-L protein provided in an embodiment of this application. Figure 3 This is a schematic diagram of a specificity test for an ELISA detection kit provided in an embodiment of this application. Figure 4 This is a schematic diagram of a sensitivity test for an ELISA detection kit provided in an embodiment of this application. Figure 5 This is a schematic diagram illustrating the preparation result of a colloidal gold solution provided in an embodiment of this application. Figure 6 This is a schematic diagram illustrating the determination of the optimal pH for colloidal gold-labeled antigens, provided in an embodiment of this application. Figure 7 This is a schematic diagram illustrating the determination of the optimal amount of colloidal gold-labeled antigen provided in an embodiment of this application. Figure 8 This is a schematic diagram illustrating the result interpretation of a test strip provided in an embodiment of this application. Figure 9 This is a schematic diagram illustrating the optimization of T-line coating concentration provided in an embodiment of this application. Figure 10 This is a schematic diagram illustrating the optimization of C-line coating concentration provided in an embodiment of this application. Figure 11 This is a schematic diagram of the sensitivity detection result of a test strip provided in an embodiment of this application. Figure 12This is a schematic diagram of the specific detection result of a test strip provided in an embodiment of this application. Figure 13 This is a schematic diagram of the intra-batch repeatability test results of a test strip provided in an embodiment of this application. Figure 14 This is a schematic diagram of inter-batch repeatability test results for a test strip provided in an embodiment of this application. Figure 15 This is a schematic diagram of the stability test results of a test strip provided in an embodiment of this application. See also... Figures 1 to 15 As shown.

[0020] Example 1 A method for preparing recombinant Mycoplasma synoviae ΔHA-L protein includes the following steps: Step 1: Compare multiple Mycoplasma synoviae strains to identify and screen the conserved domains shared by the Mycoplasma synoviae hemagglutinin (HA) protein. Using a partial fragment of the Mycoplasma synoviae hemagglutinin genome as a template, the pET-30a expression vector is ligated with EcoRV and SacI to construct the recombinant expression plasmid pET-30a-△HA-L.

[0021] Step 2: The recombinant expression plasmid pET-30a-△HA-L was transformed into BL 21(DE3) competent cells and induced to express the plasmid using isopropyl thiogalactoside. The induction conditions were: IPTG 0.1 mM, 25 ℃, 8 h.

[0022] Step 3: The obtained expression product was purified using Ni-NTA affinity chromatography medium to obtain the long-chain recombinant protein of Mycoplasma synoviae hemagglutinin. The concentration of the purified long-chain recombinant protein was determined using a BCA protein concentration assay kit and stored at -80℃ for later use. It was named Mycoplasma synoviae ΔHA-L recombinant protein.

[0023] The amino acid sequence of the Mycoplasma synoviae ΔHA-L recombinant protein is as follows: MPKIVVEDYQAHETANQTKLQ AWFNANANWEKLS EQ LTKKLGSDKFKNVTLTNPTVS YEEVPKVTFNLAAKEG YE LASDSTETVTLTIRVLYKSAN PNQNLLATQGASIKKV NV YLNYTGPSIVLDAALPTVGGQ ENTSINGTSNVTGDFN TK FKKLLVTNRAENSLLQAVINY VNKFDPKFRAAFVTNG VT ITKVQSGTQLRPGTLDDLNNN NVFLQQIKGDTEAVYF AV TAIASNGWLNTFLIRIPLTKF VRPLTVF.

[0024] In this embodiment, preferably, the coating amount of Mycoplasma synoviae ΔHA-L recombinant protein antigen is 0.125 μg / mL / well.

[0025] Specifically, the preparation of the coating antigen: 1.1 Specific primer design and synthesis: Primers were designed based on the conserved structural regions in the whole gene sequence of Mycoplasma synoviae NX-7. The primers have EcoRV and SacI restriction sites at both ends, respectively, and it is expected that a gene fragment of 792 bp can be amplified.

[0026] The nucleic acid sequence of the Mycoplasma synoviae ΔHA-L recombinant protein is as follows: GATATC ATGCCGAAAATCGTTGTTGAAGATTACCAGGCGCACGAAACCGCGAACCAGACCAAACTGCAGGCGTGGTTCAACGCGAACGCGAACTGGGAAAAACTGTCTGAACAGCTGACCAAAAAACTGGGTAGCGATAAATTCAAAAACGTTACCCTGACCAACCCGACCGTTAGCTACGAAGAAGTTCCGAAAGTGACCTTCAACCTGGCGGCGAAAGAAGGCTACGAACTGGCGTCCGATAGCACCGAAACCGTTACCCTGACCATCCGTGTTCTGTACAAATCTGCGAACCCGAACCAGAACCTGCTGGCGACCCAGGGCGCGTCTATCAAAAAAGTTAACGTGTACCTGAACTACACCGGTCCGAGCATCGTTCTGGATGCGGCGCTGCCGACCGTTGGCGGTCAGGAAAACACCTCTATCAACGGTACCAGCAACGTTACCGGTGATTTCAACACCAAATTCAAAAAACTGCTGGTTACCAACCGTGCGGAAAACAGCCTGCTGCAGGCGGTTATCAACTACGTTAACAAATTCGATCCGAAATTCCGTGCTGCGTTCGTTACCAACGGTGTTACCATCACCAAAGTTCAGAGCGGTACCCAGCTGCGTCCGGGTACCCTGGATGATCTGAACAACAACAACGTTTTCCTGCAGCAGATCAAAGGTGATACCGAAGCGGTTTACTTCGCGGTTACCGCGATCGCGTCTAACGGTTGGCTGAACACCTTCCTGATCCGTATCCCGCTGACCAAATTCGTTCGTCCGCTGACCGTTTTCTAA GAGCTC.

[0027] 1.2 Construction of pET30a-△HA-L prokaryotic expression vector: The Mycoplasma synoviae ΔHA-L gene fragment was amplified using specific upstream and downstream primers via overlap. The purified fragment was then combined with the pET-30a vector. The recombinant plasmid was double-digested with EcoRV and SacI restriction endonucleases (purchased from NEB), and the digestion products were ligated using T4 ligase (purchased from NEB). The ligation products were transformed into BL 21(DE3) competent cells, and positive colonies were picked and cultured to extract the recombinant plasmid. Positive clones were identified by double enzyme digestion and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0028] After selecting a single positive clone colony for enrichment culture, plasmid was extracted and identified by restriction endonuclease digestion. The digestion bands were correct. Sequencing results of the positive clone showed that the gene insertion position, insertion direction, and reading frame were correct, indicating that the recombinant plasmid pET30a-△HA-L was successfully constructed.

[0029] 1.3 Induced expression and identification of recombinant protein pET30a-ΔHA-L: BL 21(DE3) bacteria containing the recombinant plasmid were streaked onto LB agar plates containing kanamycin and incubated upside down at 37 °C for 12 h. Single colonies were picked and transferred to 2 mL of LB liquid medium containing antibiotics and cultured at 37 °C with shaking at 220 r / min for 12 h. The overnight culture was then transferred to LB liquid medium containing antibiotics at a ratio of 1:100 and cultured at 37 °C with shaking for approximately 2 h. When the OD600 of the bacterial culture reached approximately 0.7, 0.1 mM IPTG was added to induce expression for 5 h. The culture was then centrifuged at 12000 r / min for 1 min at 4 °C, the supernatant was discarded, and the bacterial pellet was collected. The pellet was resuspended in PBS buffer and stored at -20 °C for later use. Note: The uninduced bacterial culture was used as a control group to verify successful expression. Take 20 µL of the bacterial culture suspended in PBS into an EP tube, then add 5 µL of 5× protein loading buffer, mix well, boil for 10 min, and perform SDS-PAGE electrophoresis. Compare the uninduced bands to identify whether the recombinant protein is successfully expressed. Take 35 mL of the induced expression product, centrifuge at 10000 r / min, wash with PBS three times, and finally resuspend in 350 µL. Then sonicate and disrupt the protein under the following conditions: on for 3 s, off for 5 s, ice bath disruption for 40 min; centrifuge at 12000 r / min for 1 min, and collect the precipitate and lysis supernatant separately. Resuspend the precipitate in a certain amount of PBS, take 20 µL of the bacterial culture suspended in PBS into an EP tube, then add 5 µL of 5× protein loading buffer, mix well, boil for 10 min, and perform SDS-PAGE electrophoresis to identify the recombinant protein expression form.

[0030] 1.4 Protein purification: Large-scale induction was performed according to the protein induction conditions in section 1.3. The obtained expression product was purified using Ni-NTA affinity chromatography medium, and the concentration of the purified protein was determined using a BCA protein concentration assay kit. The protein was stored at -80 °C for later use.

[0031] SDS-PAGE analysis showed that the Mycoplasma synoviae ΔHA-L recombinant protein was successfully expressed in BL 21(DE3) competent cells, mainly in the form of inclusion bodies. The target protein band had a molecular weight of 33.9 kDa. (See attached image) Figure 1 As shown, the protein bands are of the correct size and there are no other obvious impurities after purification, so they can be used for subsequent experiments. Figure 1 In the text, M represents the molecular weight standard of the protein; 1 to 4 represent the uninduced bacterial culture, the induced bacterial culture, the unpurified protein, and the purified protein, respectively.

[0032] 1.5 Western Blotting Analysis: The purified recombinant protein was subjected to Western blotting using a fully automated chemiluminescence analyzer. The results showed an immune band at a position consistent with the size of the purified protein, indicating that the Mycoplasma synoviae ΔHA-L recombinant protein can undergo a specific antigen-antibody reaction with antibodies in positive serum. Figure 2 As shown.

[0033] Example 2 A Mycoplasma synoviae antibody indirect ELISA detection kit, wherein the Mycoplasma synoviae ΔHA-L recombinant protein prepared by the preparation method of Example 1 is used as the coating antigen of the ELISA enzyme-labeled plate.

[0034] Preferably, a Mycoplasma synoviae antibody indirect ELISA detection kit includes an enzyme-labeled plate coated with Mycoplasma synoviae ΔHA-L recombinant protein, serum standard solution, enzyme-labeled antibody, TMB substrate chromogenic solution, sample dilution solution, washing solution, and termination reaction solution. The ELISA kit also includes a blocking buffer, which is 1% BSA-PBST. The ELISA kit further includes a coating buffer, which is 0.01M pH 9.6 carbonate buffer. The ELISA kit also includes a serum dilution solution, which is 1% BSA-PBST. The enzyme-labeled antibody is horseradish peroxidase-labeled rabbit anti-chicken antibody.

[0035] For the indirect ELISA detection of Mycoplasma synoviae, the selection of the coating antigen is crucial, directly determining the specificity of the detection method. To optimize the coating antigen, this invention selects gene fragments with common conserved structural domains in the Mycoplasma synoviae gene sequence, constructs a recombinant expression vector, transforms it into competent cells, and induces expression with IPTG. After denaturation and renaturation, the expression product is purified to obtain the recombinant protein. This recombinant protein is used as the coating antigen to establish an indirect ELISA detection kit. The specificity of indirect ELISA detection kits prepared with different coating antigens was investigated using clinically diagnosed serum samples. The results show that the indirect ELISA detection kit prepared using the purified Mycoplasma synoviae ΔHA-L recombinant protein of this invention as the coating antigen achieves an accuracy of 98% in detecting diagnosed serum samples, demonstrating high antigen sensitivity and specificity.

[0036] To enable those skilled in the art to better understand this protocol, the detection method of the Mycoplasma synoviae antibody indirect ELISA detection kit is described in detail below, including the following steps: 1) Coating: 0.125 μg / mL Mycoplasma synoviae ΔHA-L recombinant protein was used as the coating antigen. 100 μL was added to each well of a 96-well plate and incubated overnight at 4 °C. The plate was then washed 5 times with PBST. 2) Blocking: Block with 100 μL / well of 1% BSA diluted with PBST, incubate at 37 ℃ for 2 h, spin dry, and wash with PBST 5 times, 5 min each time; 3) Serum reaction conditions: Dilute the serum to be tested with serum diluent at a ratio of 1:200, 100 μL per well, incubate at 37 ℃ for 0.5 h, then spin dry, wash 5 times with PBST, 5 min each time; 4) Secondary antibody incubation conditions: Dilute enzyme-labeled goat anti-chicken IgG at 1:10000, add 100 μL to each well, incubate at 37 ℃ for 1.5 h, then spin dry, wash 5 times with PBST, 5 min each time; 5) Substrate color development: 100 μL of TMB substrate color development solution per well, incubated at 37 °C in the dark for 15 min; 6) Termination of reaction: Add 50 μL of stop solution to each well to terminate the colorimetric reaction, and read the data using an ELISA reader at an absorbance of 450 nm; 7) Determination of the positive / negative cutoff value: According to the formula (positive / negative cutoff value = standard deviation of the mean OD450 of negative samples 3SD), the positive / negative cutoff value is obtained; when OD450 is above 0.219, it is judged as MS positive; 8) Specificity: Cross-reaction test showed that the ELISA kit only reacted positively with Mycoplasma synoviae positive serum, indicating that the ELISA kit has good specificity.

[0037] Unless otherwise specified, all experimental materials used in the embodiments of this invention are conventional experimental materials in the art and can be purchased commercially. Some of the reagents and components used in this invention are as follows: Coating buffer CBS: Weigh 1.59 g Na2CO3 and 2.93 g NaHCO3, pour them into an Erlenmeyer flask, add 400 mL of distilled water to the Erlenmeyer flask to completely dissolve and mix, adjust the pH to 9.6, make up to 500 mL, and store at 4℃.

[0038] PBS buffer: Dissolve 8.5 g NaCl, 0.2 g KCl, 0.27 g KH2PO4, and 1.42 g Na2HPO4 in 800 mL of distilled water, adjust the pH to 7.4, bring the volume to 1000 mL, and store at 4°C.

[0039] PBST washing solution: Add 0.05 mL of Tween20 to 1000 mL of PBS, mix thoroughly, and store at 4 °C.

[0040] Blocking solution: Dissolve 0.5 g BSA in 50 mL PBST diluent. Store at 4 °C for short-term storage and at -20 °C for long-term storage.

[0041] Termination solution: Add concentrated sulfuric acid to ultrapure water at a volume ratio of 1:5, mix well and cool to room temperature to obtain the termination solution (concentration of 2 M H2SO4).

[0042] Unless otherwise specified in the embodiments of this invention, the experimental conditions and methods are generally performed according to conventional conditions.

[0043] Based on the detection method of Example 2, a verification test was conducted, and the results are as follows: (1) Repeatability test: The calculated intra-assay coefficient of variation for 10 serum samples containing Mycoplasma synoviae ΔHA-L was 0.32%–5.90%, and the inter-assay coefficient of variation was 0.40%–6.43%. Both intra-assay and inter-assay coefficients of variation were within 10%, indicating that the method established in this study is relatively stable and has good reproducibility.

[0044] (2) Specificity test: An indirect ELISA detection kit based on Mycoplasma synoviae ΔHA-L recombinant protein was established. The detection results are as follows: Figure 3As shown, only MS-positive serum had an OD450 value greater than 0.219, while other serum OD450 values ​​were all less than 0.219, indicating that the method does not cross-react with other sera and has good specificity.

[0045] (3) Sensitivity test: An indirect ELISA detection kit based on Mycoplasma synoviae ΔHA-L recombinant protein was established. The experimental results are as follows: Figure 4 As shown, when the serum was diluted to 1:3200, the OD450 value was still greater than the critical value of 0.219, indicating a positive reaction; this shows that the method has good sensitivity and a low detection threshold.

[0046] (4) Comparison rate with commercially available reagent kits from abroad: The results showed that the indirect ELISA detection kit based on the recombinant Mycoplasma synoviae ΔHA-L protein had a high concordance rate with commercially available kits from abroad.

[0047] Example 3 A method for preparing a colloidal gold test strip for Mycoplasma synoviae antibody detection, the colloidal gold test strip comprising a PVC base plate, an NC membrane adhered in the middle of the PVC base plate, a detection line (T line) and a control line (C line) fixed on the NC membrane, a gold label pad adhered to the left side of the NC membrane, and an absorbent pad adhered to the right side of the NC membrane, comprising the following steps: Step 3.1: Prepare colloidal gold solution using the trisodium citrate reduction method.

[0048] Add 250 mL of double-distilled water to a clean Erlenmeyer flask and heat to boiling on a magnetic stirrer. Add 3 mL of 1% chloroauric acid solution dropwise, and after boiling again, slowly add 8 mL of 1% trisodium citrate solution. Continue heating until the solution turns wine-red and the color no longer changes. Take the prepared colloidal gold solution and scan the absorbance at wavelengths of 400–600 nm using a microplate reader to obtain the maximum absorbance and absorption peak of the colloidal gold solution. In this example, the concentration of Mycoplasma synoviae ΔHA-L recombinant protein was 0.73 mg / mL.

[0049] Step 3.2: After adding K2CO3 solution to the colloidal gold solution and reacting, add the Mycoplasma synoviae ΔHA-L recombinant protein solution prepared by the method of claim 1. After standing at room temperature, add BSA solution to block, centrifuge, discard the supernatant, add resuspension solution to resuspend, and obtain the gold-labeled antigen solution.

[0050] Specifically, 1) Determination of the optimal pH for colloidal gold-labeled antigen: Take eight 200 μL EP tubes and add 100 μL of colloidal gold solution to each EP tube. Add 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, and 0.7 μL of K₂CO₃ solution sequentially, react for 15 min, then add sufficient Mycoplasma synoviae ΔHA-L recombinant protein solution (1.3), and after 20 min, add 10 μL of 10% NaCl solution and let stand for 1 h. When the solution stabilizes and turns wine-red, the amount of K₂CO₃ solution in the EP tube is the optimal amount, and the pH value of the solution at this point is the optimal pH.

[0051] 2) Determination of the optimal amount of colloidal gold-labeled antigen: Take eight 200 μL EP tubes and add 100 μL of colloidal gold solution to each EP tube. Add the optimal amount of K2CO3 solution mentioned above. After 15 min, add 0, 1, 1.5, 2, 2.5, 3, 3.5, and 4 μL of Mycoplasma synoviae ΔHA-L recombinant protein solution sequentially. React for 20 min, then add 10 μL of 10% NaCl solution and let stand for 1 h. When the solution stabilizes and turns wine red, the amount of Mycoplasma synoviae ΔHA-L recombinant protein solution in the EP tube is the optimal amount of antigen added.

[0052] 3) Preparation of gold-labeled antigen: Take a clean 1.5 mL centrifuge tube, add 1 mL of colloidal gold solution, add the above-mentioned optimal K2CO3 solution volume and optimal antigen volume, let stand at room temperature for 20 min, then add 150 μL of 10% BSA solution to block for 10 min, centrifuge and slowly discard the supernatant to obtain a dark red fluid precipitate, add resuspension buffer to resuspend to 100 μL, the obtained solution is the gold-labeled antigen solution.

[0053] Step 3.3: Spray the gold-labeled antigen solution onto the gold-labeled pad to use the Mycoplasma synoviae ΔHA-L recombinant protein as the gold-labeled antigen, and use the Mycoplasma synoviae ΔHA-L recombinant protein as the coating antigen to coat the test line, and use Anti His-TagmAb as the coating antibody to coat the control line. Attach the sample pad to the left side of the gold-labeled pad to obtain the colloidal gold test strip.

[0054] A colloidal gold test strip for detecting Mycoplasma synoviae antibodies was prepared using the method described in Example 3.

[0055] In this embodiment, the expression plasmid pET30a-Mycoplasma synoviae △HA-L containing the conserved domain sequence of the MS hemagglutinin gene was constructed by our laboratory, and the expression strain containing this plasmid was preserved by our laboratory; MS positive serum, SPF chicken negative serum, and MG, AIV, NDV, PD, and IBDV positive serum used for specific tests were all prepared and preserved by the Preventive Veterinary Laboratory of the College of Animal Science and Technology of Ningxia University; the 30 serum samples used for clinical testing were donated by Ningxia Xiaoming Agriculture and Animal Husbandry Co., Ltd.

[0056] In this embodiment, chloroauric acid was purchased from Sigma-Aldrich, Inc. (USA); trisodium citrate was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.; anhydrous potassium carbonate was purchased from Shanghai Guangnuo Chemical Technology Co., Ltd.; NC membrane, sample pad, absorbent pad, glass fiber membrane, and PVC base plate were purchased from Shanghai Jieyi Biotechnology Co., Ltd.; IPTG (isopropyl-β-D-thiogalactoside) was purchased from Beijing Solarbio Technology Co., Ltd.; Anti His-Tag mAb was purchased from Wuhan Aibote Biotechnology Co., Ltd.; commercial MS antibody detection kit was purchased from Beijing IDS Biotechnology Co., Ltd.; microplate reader was purchased from Bertek Instruments, Inc. (USA); and ultraviolet spectrophotometer was purchased from Eppendorf GmbH (Germany).

[0057] Specifically, 1) Treatment of sample pads and gold-labeled pads: Cut the sample pads and gold-labeled pads (binding pads) into sizes of 1.5cm×30cm and 0.6cm×30cm respectively, place them in a container containing treatment solution (treatment of sample pads and gold-labeled pads), soak the sample pads and gold-labeled pads for 15 minutes, and then dry them in an oven at 37℃.

[0058] 2) Test strip assembly: Take out a PVC base plate, peel off the middle release paper to expose the adhesive on the PVC base plate, and stick the smooth side of the NC membrane to the PVC base plate. After peeling off the upper release paper, overlap the absorbent pad (1.6 cm × 30 cm) with the NC membrane by 1-2 mm and stick it on. After peeling off the lower release paper, overlap the gold-coated pad (gold-labeled antigen solution) with the NC membrane by 1-2 mm and stick the sample pad with the gold-labeled pad by 1-2 mm. Finally, cut the test strip to a size of 4 mm × 6 cm.

[0059] 3) Performance test: After the test strip is assembled, PBS buffer, negative sample and positive sample are added respectively to test the performance of the test strip.

[0060] 4) Determination of the optimal coating concentration for T-line: With the C-line coating concentration fixed, the T-line antigen was diluted to 0.6 mg / mL, 0.5 mg / mL, 0.4 mg / mL, 0.3 mg / mL, 0.2 mg / mL, 0.1 mg / mL, and 0.05 mg / mL for coating.

[0061] 5) Determination of the optimal coating concentration for C line: Using the optimal coating concentration for T line determined above, T line coating was performed. The C line antibody concentration was diluted to 2 mg / mL, 1 mg / mL, 0.5 mg / mL, 0.25 mg / mL, 0.1 mg / mL, and 0.05 mg / mL for coating.

[0062] 6) Test strip detection method and result interpretation: After coating the test strip with the optimal coating concentrations for the T and C lines as determined above, assemble the test strip. Add 150–200 μL of sample to the sample pad and interpret the results within 10–20 minutes. A negative result is indicated when only the C line is visible and the T line is not visible; a positive result is indicated when both the T and C lines are visible; and an invalid test strip is indicated if the C line is not visible.

[0063] 7) Performance testing of test strips 7.1 Sensitivity: MS positive samples were diluted at 1:25, 1:50, 1:100, 1:200, 1:300, 1:400, 1:800, and 1:1600, respectively. The diluted serum was then dropped onto the sample pad, and the results were interpreted within 10–20 min.

[0064] 7.2 Specificity: MS positive serum, MG positive serum, PD positive serum, IBDV positive serum, NDV positive serum, and AIV positive serum were respectively added to the sample pad, and cross-reaction was observed. The results were interpreted within 10 to 20 minutes.

[0065] 7.3 Repeatability: Intra-batch repeatability and inter-batch repeatability tests were performed. Intra-batch repeatability tests were conducted on different MS positive samples using test strips from the same batch; inter-batch repeatability tests were conducted on the same MS positive sample using test strips from different batches.

[0066] 7.4 Stability: The test strips were stored at room temperature away from light, and their stability was tested at different times.

[0067] 7.5 Clinical application testing of the test strip: The colloidal gold test strip studied in this embodiment was compared with a commercial MS antibody detection kit to test 30 collected clinical samples and compare the concordance rate of the two detection methods.

[0068] result The colloidal gold solution prepared in step 3.1: Visually, the prepared colloidal gold solution appears wine-red, clear, and without precipitate. Figure 5 A. No change was observed after 48 hours at 4℃. The absorbance was measured using a microplate reader, and the results are as follows: Figure 5B. The colloidal gold solution obtained a maximum absorbance of 1.100 at a wavelength of 520 nm, indicating that the colloidal gold solution was prepared successfully and can be used for subsequent experiments. Figure 5 In the diagram, A represents the colloidal gold solution; B represents the absorption spectrum of the colloidal gold solution.

[0069] Using the gold-labeled antigen solution prepared in step 3.2: When 0.2 μL of K2CO3 solution and 3.5 μL of antigen were added, the colloidal gold solution in the EP tube maintained its wine-red color and did not change further. Therefore, the amounts of 0.2 μL of K2CO3 solution and 3.5 μL of antigen added to 100 μL of colloidal gold solution were taken as the optimal amounts. Figure 6 and Figure 7 . Figure 6 In the numbers 1 to 8, it represents the addition of 0 μL, 0.1 μL, 0.2 μL, 0.3 μL, 0.4 μL, 0.5 μL, 0.6 μL, and 0.7 μL of K2CO3 solution, respectively. Figure 7 In the numbers 1 to 8, 0 μL, 1 μL, 1.5 μL, 2 μL, 2.5 μL, 3 μL, 3.5 μL, and 4 μL of Mycoplasma synoviae ΔHA-L recombinant protein solution were added, respectively. Interpretation of test strip results Add PBS solution, MS negative serum, and MS positive serum to the prepared test strips respectively. Figure 8 When PBS solution and MS negative serum were added, only the C line showed color, indicating a negative result, which was in line with expectations. When MS positive serum was added, both the C line and the T line showed color, indicating a positive result, which was in line with expectations. Figure 8 Tables 1-3 represent PBS buffer, MS negative serum, and MS positive serum, respectively.

[0070] Optimization of coating concentration T-line coating concentration optimization: The T-line coated antigen was gradually diluted, and the results are as follows: Figure 9 The results showed that when the T-line antigen coating concentration was 0.2 mg / mL, the T-line still showed normal color development. Figure 9 1 represents the protein dilution solution; 2 to 8 represent the protein being diluted to 0.6 mg / mL, 0.5 mg / mL, 0.4 mg / mL, 0.3 mg / mL, 0.2 mg / mL, 0.1 mg / mL, and 0.05 mg / mL, respectively.

[0071] C-line coating concentration optimization: The C-line coated antibody was gradually diluted, and the results are as follows. Figure 10 The results showed that when the antibody coating concentration of C line was 0.5 mg / mL, C line still showed normal color development. Figure 101 represents antibody dilution; 2 to 7 represent antibody diluted to 2 mg / mL, 1 mg / mL, 0.5 mg / mL, 0.25 mg / mL, 0.1 mg / mL, and 0.05 mg / mL, respectively.

[0072] Performance test results of the test strips Sensitivity: MS-positive serum was stepwise diluted and tested using this test strip. The results are as follows: Figure 11 This indicates that when positive serum is diluted 1:400, the T and C lines still show normal color development, indicating that the test strip has good sensitivity. Figure 11 1 represents serum diluent; 2-9 represent serum diluted at ratios of 1:25, 1:50, 1:100, 1:200, 1:300, 1:400, 1:800, and 1:1600, respectively. Specificity: MS-negative serum, MS-positive serum, MG-positive serum, PD-positive serum, IBDV-positive serum, NDV-positive serum, and AIV-positive serum were tested using the test strip. Results are as follows: Figure 12 The test strip only reacts specifically with MS-positive serum, but does not react specifically with other positive serum, indicating that the test strip has good specificity. Figure 12 In the table, 1 to 7 represent MS negative serum, MS positive serum, MG positive serum, PD positive serum, IBDV positive serum, NDV positive serum, and AIV positive serum, respectively.

[0073] Repeatability: Repeatability tests were performed on test strips from the same batch and different batches. The results are as follows: Figure 13 and Figure 14 This indicates that the test strip has good repeatability. Figure 13 In the table, 1-3 represent MS-positive serum; 4-6 represent MS-negative serum. Figure 14 In the table, 1-2 represent MS-positive serum; 3-4 represent MS-negative serum. Stability: The prepared test strips were stored at room temperature in the dark for 1 month, 2 months, and 3 months before testing. The results were as follows: Figure 15 This indicates that the test strip has good stability. Figure 15 In the table, A corresponds to 1 month; B corresponds to 2 months; C corresponds to 3 months; 1 represents MS-negative serum; 2 represents MS-positive serum.

[0074] Clinical application test results: The colloidal gold test strip studied in this embodiment was used to test 30 clinical samples. The results showed 20 positive samples and 10 negative samples. The results of testing with commercial ELISA kits showed 21 positive samples and 9 negative samples. The concordance rate between the two detection methods reached 93.33%.

[0075] Other embodiments of this application will readily occur to those skilled in the art upon consideration of the specification and practice of the application disclosed herein. This application is intended to cover any variations, uses, or adaptations of this application that follow the general principles of this application and incorporate common knowledge or customary techniques in the art disclosed herein. The specification and examples are to be considered exemplary only, and the true scope of this application is indicated by the claims.

[0076] It should be understood that this application is not limited to the precise structure described above and shown in the accompanying drawings, and various modifications and changes can be made without departing from its scope. The above embodiments of this application do not constitute a limitation on the scope of protection of this application.

Claims

1. A method for preparing a Mycoplasma synoviae ΔHA-L recombinant protein, characterized by, include: By comparing multiple Mycoplasma synoviae strains, the conserved domains shared by Mycoplasma synoviae hemagglutinin protein were identified and screened. Using a partial fragment of the Mycoplasma synoviae hemagglutinin genome as a template, the pET-30a expression vector was ligated with EcoRV and SacI to construct the recombinant expression plasmid pET-30a-△HA-L. The recombinant expression plasmid pET-30a-△HA-L was transformed into BL 21 competent cells and induced with isopropyl thiogalactoside. The induction conditions were: IPTG 0.1 mM, 25 ℃, 8 h. The obtained expression product was purified using Ni-NTA affinity chromatography medium to obtain the long-chain recombinant protein of Mycoplasma synoviae hemagglutinin. The concentration of the purified long-chain recombinant protein was determined using a BCA protein concentration assay kit and stored at -80 ℃ for later use. It was named Mycoplasma synoviae ΔHA-L recombinant protein. The amino acid sequence of the Mycoplasma synoviae ΔHA-L recombinant protein is as follows: MPKIVVEDYQAHETANQTKLQ AWFNANANWEKLSEQ LT KKLGSDKFKNVTLTNPTVSYE EVPKVTFNLAAKEGYE LA SDSTETVTLTIRVLYKSANPN QNLLATQGASIKKVNV YL NYTGPSIVLDAALPTVGGQEN TSINGTSNVTGDFNTK FK KLLVTNRAENSLLQAVINYVN KFDPKFRAAFVTNGVT IT KVQSGTQLRPGTLDDLNNNNV FLQQIKGDTEAVYFAV TA IASNGWLNTFLIRIPLTKFVR PLTVF.

2. An indirect ELISA test kit for Mycoplasma synoviae antibodies, characterized in that, The detection kit uses the Mycoplasma synoviae ΔHA-L recombinant protein prepared by the preparation method described in claim 1 as the coating antigen for the ELISA microplate.

3. The Mycoplasma synoviae antibody indirect ELISA detection kit according to claim 2, characterized in that, The enzyme-labeled plate coated with Mycoplasma synoviae ΔHA-L recombinant protein, serum standard solution, enzyme-labeled antibody, TMB substrate chromogenic solution, sample dilution solution, washing solution and termination reaction solution.

4. A method for preparing a colloidal gold test strip for detecting Mycoplasma synoviae antibodies, the colloidal gold test strip comprising a PVC base plate, an NC membrane adhered in the middle of the PVC base plate, a detection line and a control line fixed on the NC membrane, a gold-labeled pad adhered to the left side of the NC membrane, and an absorbent pad adhered to the right side of the NC membrane, characterized in that... include: Colloidal gold solution was prepared by the trisodium citrate reduction method; After adding K2CO3 solution to the colloidal gold solution and reacting, Mycoplasma synoviae ΔHA-L recombinant protein solution prepared by the preparation method described in claim 1 is added. After standing at room temperature, BSA solution is added to block the reaction. After centrifugation, the supernatant is discarded, and the solution is resuspended in resuspension solution to obtain the gold-labeled antigen solution. Spray the gold-labeled antigen solution onto the gold-labeled pad to use Mycoplasma synoviae ΔHA-L recombinant protein as the gold-labeled antigen, and use the Mycoplasma synoviae ΔHA-L recombinant protein as the coating antigen to coat the test line, and use Anti His-TagmAb as the coating antibody to coat the control line. Attach the sample pad to the left side of the gold-labeled pad to obtain the colloidal gold test strip.

5. A colloidal gold test strip for detecting Mycoplasma synoviae antibodies, characterized in that, It is prepared by the preparation method described in claim 4.

Images