Reagent, kit for detecting leptospira nucleic acid and application thereof

Abstract

The application provides a reagent for detecting leptospira nucleic acid, a kit and application thereof. The reagent comprises a reagent for detecting a first region of leptospira, wherein the first region is selected from any fragment in SEQ ID NO: 1. By applying the reagent or the kit, accurate, rapid and sensitive identification of leptospira can be achieved.

Description

Technical Field

[0001] This application relates to the field of Leptospira detection, and more specifically, to a reagent, kit, and application for detecting Leptospira nucleic acid. Background Technology

[0002] Leptospirosis is a zoonotic disease caused by pathogenic leptospires. It is one of the most widespread zoonotic infectious diseases in the world, and severe cases can lead to multiple organ failure and even death. Leptospires belong to the phylum Spirochetes, including saprophytic leptospires and pathogenic leptospires. Leptospires infect a wide range of animals; humans or animals can become infected through contact with leptospir-contaminated environments or soil via broken skin or mucous membranes. In susceptible animals, such as humans or golden hamsters, infection with leptospires can cause fever and jaundice; if left untreated, it can lead to multiple organ failure and even death.

[0003] Human infection primarily occurs through contact with water or soil contaminated by leptospires from rodents, livestock, dogs, and wild animals. Leptospires are distributed worldwide, but are particularly prevalent in tropical climates. It is estimated that approximately 1.03 million people are infected with leptospirosis annually, resulting in 58,900 deaths. Canine leptospirosis is caused by common canine pathogenic leptospires such as the canine type, the icteric hemorrhagic type, and the Tarasov type. In recent years, the number of pet dogs and working dogs has been increasing. Dogs are susceptible to leptospirosis, affecting the health of both the dogs and their owners. PCR testing methods can be widely applied to the early detection of canine leptospirosis, preventing its further development and spread.

[0004] Leptospires belong to the order Spirochaetales and family Spirochaetaceae. There are two species: *Leptospira biflexa*, a saprophytic bacterium that is not pathogenic to humans, and *Leptospira interroans*, which is pathogenic to humans and is a parasite of both humans and animals. *Leptospira interroans* is divided into 18 serogroups, each with over 160 serotypes. Among these, the Pomona group, *Leptospira canicola*, *Leptospira tarassovi*, *Leptospira icterohemorrhaiae*, *Leptospira rippotyphosa*, and *Leptospira hebdomadis* are important pathogens in livestock. Some herds can be infected with several serogroups and serotypes simultaneously; this is most common in dogs, but the icterohemorrhaiae group is the most lethal. This disease is prevalent in countries around the world, including China, where it is more common in coastal provinces and provinces south of the Yangtze River.

[0005] The purpose of this invention is to solve the above-mentioned problems, enabling accurate detection of pathogenic leptospires, saving time and effort, with excellent specificity and sensitivity, and can be used for the early diagnosis of leptospires. Summary of the Invention

[0006] This application aims to provide a reagent, method, and application for detecting Leptospira, in order to solve the technical problem of missed detection of Leptospira in the prior art.

[0007] To achieve the above objectives, according to one aspect of this application, a reagent for detecting Leptospira is provided. The reagent comprises a first region for detecting Leptospira, wherein the first region is selected from any segment of SEQ ID NO: 1.

[0008] Furthermore, the first region is selected from any segment between bases (1-50) to (131-155) in SEQ ID NO: 1.

[0009] Furthermore, the reagent includes a primer pair for detecting the nucleic acid sequence of SEQ ID NO: 1, wherein the nucleotide sequence of the primer pair has a nucleotide sequence that is complementary to or identical to 16 to 26 consecutive nucleotides between bases (1 to 50) to (131 to 155) in SEQ ID NO: 1.

[0010] Furthermore, the reagent primer pairs are selected from the nucleotide sequences shown in SEQ ID NOs:3 and 6, or from the nucleotide sequences shown in SEQ ID NOs:4 and 7;

[0011] Preferably, the reagent further includes a probe selected from the nucleotide sequence shown in SEQ ID NO:2;

[0012] Among them, SEQ ID NO: 2 is 5'-ACGGGGGATAAGCTCCGTGGTCA-3'.

[0013] SEQ ID NO: 3 is 5'-CGTAACTCCAGAGACTGGCAGTCA-3'.

[0014] SEQ ID NO: 4 is 5'-ACCGTAACTCCAGAGACTGGCA-3',

[0015] SEQ ID NO: 6 is 5'-CCTTAAACGACGGTCTGGGC-3'.

[0016] SEQ ID NO: 7 is 5'-TTGGGGCCTTAAACGACGG-3'.

[0017] Furthermore, the 5' end and 3' end of the probe have a fluorescent reporter group and a fluorescent quencher group, respectively;

[0018] Preferably, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5 or Cy7; the fluorescent quencher group is selected from BHQ, TAMRA, Dabcyl or Eclipse;

[0019] More preferably, the 5' end of the probe is a VIC group and the 3' end is a BHQ group.

[0020] According to another aspect of this application, a kit is provided, comprising any of the reagents described above for detecting Leptospira nucleic acids in a sample to be tested.

[0021] Furthermore, the kit also includes at least one of the following: Real-time PCR reaction reagents, including qPCR Mix, Taq polymerase, and water, preferably, the concentration of Taq polymerase is 5 U / μL.

[0022] According to another aspect of this application, a method for detecting Leptospira by real-time PCR is provided, wherein the reagent or kit for detecting Leptospira nucleic acid in the sample to be tested is used for real-time PCR detection.

[0023] Furthermore, the conditions for quantitative real-time PCR detection are as follows: pre-denaturation at 92–98℃ for 30–90 seconds; denaturation at 92–98℃ for 2–8 seconds; annealing at 58–62℃ for 27–33 seconds, followed by collection and processing of fluorescence signals, for a total of 35–45 cycles.

[0024] According to another aspect of this application, a reagent or kit for detecting Leptospira nucleic acid in a sample is provided for use in Leptospira detection.

[0025] By applying the technical solution of this application, the reagent for detecting Leptospira nucleic acid of this application has high specificity for Leptospira, and therefore has a significant advantage in high specificity in the identification of Leptospira compared with existing detection reagents. Attached Figure Description

[0026] To more clearly illustrate the technical solutions of the embodiments of this application, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of this application and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1 The amplification curves of the 2-2 primer-probe system for the U-Lo-Kang 6-in-1 vaccine are shown.

[0028] Figure 2 The amplification curves of the 2-2 primer-probe system for the Weijiaba vaccine are shown.

[0029] Figure 3 The amplification curves of blood samples from dogs diagnosed with Leptospira using a 2-2 primer-probe system are shown.

[0030] Figure 4 The amplification curves of a 2-2 primer-probe system on blood samples from healthy dogs are shown.

[0031] Figure 5 The amplification curves of 2-2 primer-probe system for Babesia, Caterpillarella, Trichomonas fetus, Giardia lamblia, Ehrlichtonus canis, and blood samples from healthy dogs are shown. Detailed Implementation

[0032] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to the accompanying drawings and embodiments.

[0033] Currently, the main methods for diagnosing leptospirosis include virus isolation, immunochromatographic assays, and molecular genetic diagnostic methods. Virus isolation is time-consuming and cumbersome, making it difficult to achieve rapid and efficient results. Immunochromatographic assays utilize the principle of specific antigen-antibody binding and are easy to perform, but their specificity is low, easily leading to false positives. Molecular biological detection methods, such as quantitative real-time PCR, are increasingly being applied to pathogen detection. This method achieves detection through the specific amplification of the pathogen's genetic material (nucleic acid). Due to its high sensitivity and specificity, it has become the mainstream and new standard for laboratory diagnosis.

[0034] To this end, the inventors designed primers and probes based on the 23S rRNA of Leptospira registered in Genbank as the target gene, which can detect Leptospira with high specificity and has no cross-reaction with other common pathogens.

[0035] According to a typical embodiment of the present invention, a reagent for detecting Leptospira is provided. The reagent comprises: a reagent for detecting a first region of Leptospira, wherein the first region is selected from any segment of SEQ ID NO: 1.

[0036] By applying the technical solution of this invention, hook-tip spirals can be accurately detected.

[0037] Due to the uniqueness of the first region, detection of Leptospira can be achieved by selecting a segment of any length from it. To further improve the specificity of the detection, in some preferred embodiments, the first region is selected from any segment between bases (1-50) to (131-155) in SEQ ID NO: 1.

[0038] For any length of fragment in the above-mentioned region, suitable primers or primer-probe combinations can be designed for detection. In some preferred embodiments, the reagents include primer pairs, which consist of an upstream primer and a downstream primer, and the nucleotide sequences of the primer pairs have a nucleotide sequence that is complementary to or identical to 16 to 26 consecutive nucleotides between bases (1 to 50) to (131 to 155) in SEQ ID NO: 1.

[0039] In some preferred embodiments, the primer pairs are selected from nucleotide sequences such as those shown in SEQ ID NOs:3 and 6, or from nucleotide sequences such as those shown in SEQ ID NOs:4 and 7.

[0040] In some preferred embodiments, the reagent further includes a probe selected from the nucleotide sequence shown in SEQ ID NO:2. Specifically, the primer and probe form a primer-probe combination.

[0041] Forward primer 1: 5'-CGTAACTCCAGAGACTGGCAGTCA-3' (SEQ ID NO: 3)

[0042] Forward primer 2: 5'-ACCGTAACTCCAGAGACTGGCA-3' (SEQ ID NO: 4);

[0043] Reverse primer 1: 5'-CCTTAAACGACGGTCTGGGC-3' (SEQ ID NO: 6);

[0044] Reverse primer 2: 5'-TTGGGGCCTTAAACGACGG-3' (SEQ ID NO: 7);

[0045] Probe: 5'-ACGGGGGATAAGCTCCGTGGTCA-3' (SEQ ID NO: 2).

[0046] The primer-probe combination of this application has the advantages of high specificity and high detection accuracy in the detection of Leptospira.

[0047] In the aforementioned primer-probe combination, the 5' and 3' ends of the probes respectively possess a fluorescent reporter group and a fluorescence quencher group. The presence of both fluorescent reporter and fluorescence quencher groups facilitates accurate and rapid detection using quantitative real-time PCR. Therefore, any group that emits fluorescence and absorbs fluorescence at a corresponding wavelength is suitable for this application.

[0048] In some preferred embodiments, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5, or Cy7; the fluorescent quencher group is selected from BHQ, TAMRA, Dabcyl, or Eclipse. The fluorescent reporter group and fluorescent quencher group are selected and combined appropriately based on the wavelength of fluorescence emission and the wavelength of fluorescence absorption in specific applications.

[0049] Considering cost, effectiveness, and the breadth and convenience of application, in some preferred embodiments, the 5' end of the probe is selected as a VIC group, and the 3' end is selected as a BHQ group (specifically, it can be BHQ1, BHQ2 or BHQ3).

[0050] In a second typical embodiment of this application, a kit is provided that includes any of the reagents described above. Using this kit for Leptospirosis detection offers advantages such as high specificity and high accuracy.

[0051] To further improve the convenience of this kit, in some preferred embodiments, the kit further includes at least one of the following: a real-time PCR reaction reagent, including qPCR Mix, Taq polymerase, and water, preferably with a Taq polymerase concentration of 5 U / μL. Specific qPCR buffers can be selected from existing known products. Details are not provided here. It should be noted that the DNA polymerase used in this qPCR premix is ​​Taq DNA polymerase manufactured by Feipeng Biotechnology; however, the use of other DNA polymerases with similar efficacy is not excluded.

[0052] The positive control in the kit is typically a gene fragment containing the target gene. In a preferred embodiment of this application, the positive control is a 155bp gene fragment containing Leptospira, as shown in SEQ ID NO: 1.

[0053] SEQ ID NO: 1:

[0054] AGGACTAGGGGGCCCACAAGCTTACCAAACCCTATCAAACTTCGAATACCGTAACTCCAG AGACTGGCAGTCAGACTACGGGGGATAAGCTCCGTGGTCAAAAGGGAAACAGCCCAGACCGT CGTTTAAGGCCCCAAAGTTCATGCTAAGTGGCA.

[0055] The negative control in the kit is a plasmid that does not contain the target gene fragment and will not be amplified. Preferably, the negative control is deionized water.

[0056] In a third typical embodiment, a method for detecting Leptospira by real-time PCR is provided, the method comprising using the above-described primer-probe composition or the above-described kit for real-time PCR detection.

[0057] Preferably, the above-mentioned primer pair and probe composition are used to perform real-time quantitative PCR detection on the 155bp target gene fragment to be tested.

[0058] In some preferred embodiments, the conditions for quantitative real-time PCR detection are as follows: pre-denaturation at 92–98°C (preferably 95–98°C) for 30–90 s (preferably 30–60 s); denaturation at 95–98°C for 2–8 s (preferably 2–5 s); annealing at 58–62°C (preferably 59–61°C) for 27–33 s or collection of fluorescence signal, for a total of 35–45 cycles.

[0059] In some preferred embodiments, the conditions for quantitative real-time PCR detection are: pre-denaturation at 95°C for 1 min; denaturation at 95°C for 5 s, annealing at 60°C for 30 s or collecting fluorescence signal processing, for a total of 40 cycles.

[0060] In a fourth typical embodiment, the application of the above-described reagents or kits in the detection of Leptospira is provided. This application, by applying primers or primer-probe combinations capable of identifying Leptospira, can amplify the target fragment in animal blood, urine, cerebrospinal fluid, and tissue samples, accurately achieving the identification of Leptospira.

[0061] The beneficial effects of this application will be further explained in detail below with reference to specific embodiments. It should be noted that the primers in the following embodiments were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Unless otherwise specified, all related reagents are commercially available products.

[0062] Example 1 Primer and probe design

[0063] Primers and probes were designed based on highly conserved fragments in the 23S rRNA gene of Leptospira. In addition to species traditionally considered pathogenic, the study also covered some newly reported species, including *Leptospira interrogans* (CP048830.1), *Leptospira kirschneri* (CP085133.1), *Leptospira noguchii* (CP091967.1), *Leptospira weilii* (CP040843.1), *Leptospira borgpetersenii* (CP026671.1), *Leptospira santarosai* (CP028377.1), *Leptospira kmetyi* (CP033614.1), *Leptospira mayottensis* (CP030142.1), and *Leptospira interrogans*. sp.: JX130691.1 etc.

[0064] To achieve rapid amplification, the target fragment range of 80-200 bp was selected for screening. This enables the detection of Leptospira DNA in animal samples. The amplification region selected was: AGGACTAGGGGGCCCACAAGCTTACCAAACCCTATCAAACTTCGAATACCGTAACTCCAGAGA CTGGCAGTCAGACTACGGGGGATAAGCTCCGTGGTCAAAAGGGAAACAGCCCAGACCGTCGT TTAAGGCCCCAAAGTTCATGCTAAGTGGCA. Primers and probes were then designed for it.

[0065] In the design of primers and probes, primer and probe fragments with fewer hairpin structures, intraprimer dimers, interprimer dimers, and mismatches were selected as much as possible. The designed primer and probe sequences were then compared and analyzed in the NCBIBlast online database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to avoid non-specific binding and amplification with other pathogens or human genes.

[0066] After multiple rounds of screening and optimization on a conventional real-time quantitative PCR instrument, and then performance comparison and confirmation using a real-time quantitative PCR analyzer, a set of primer and probe combinations with optimal sensitivity and specificity was finally determined. SEQ ID NO: 2 is the probe sequence targeting the target, and SEQ ID NO: 3–8 are the primer sequences targeting the target.

[0067] Table 1 Primer and probe sequence information for real-time quantitative PCR detection of Leptospira.

[0068]

[0069]

[0070] Example 2: Screening of Optimal Primer Combinations

[0071] To further verify the effectiveness of different primer combinations, nine combinations were made from three upstream primers and three downstream primers; and a primer-probe combination disclosed in patent CN114262742A was used as a control, which is as follows:

[0072] The forward primer has the following sequence: 5'-CGTTCCTGTTTCTTCGGTTCA-3';

[0073] The reverse primer has the sequence 5'-CGTCTATGGTCTTCGACAACTAA-3';

[0074] The probe has the following sequence: 5'-AGGAGATTCTTCGGAAAGGGGAACCATAG-3'.

[0075] Using Leptospira synthetic plasmid as a template, the solution was diluted to 10% of the original solution with molecularly purified water. 5 times, 10 6 times, 10 7 times, 10 8 times, 10 9 times, 10 10 The multiples are denoted as A5, A6, A7, A8, A9, and A10.

[0076] Nucleic acid extraction was performed using Phypon's proprietary nucleic acid extraction reagents, and the qPCR amplification system was prepared according to Table 2. The amplification system consisted of 25 μL of qPCR mixture, and the 2×qPCR Mix and Taq polymerase listed in the table were Phypon Biotechnology's proprietary raw materials. qPCR amplification was performed using the procedure in Table 3, with an ABI 7500 instrument.

[0077] Table 2 Leptospira qPCR amplification system

[0078] Element Dosage / μL Item number 2×qPCR Mix 15 RK1110 5 μ / μl Taq enzyme 0.3 MD099 50μM LS-P 0.08 / 50μM LS-F 0.15 / 50μM LS-R 0.15 / template 10 / Sterile purified water Make up to 30 μl /

[0079] Table 3 Real-time PCR amplification program

[0080]

[0081] The target detection signal is VIC;

[0082] The amplification results are shown in Table 4:

[0083]

[0084] The results showed that the 1-1 system and the 2-2 system had better overall amplification effects and higher signal values.

[0085] Example 3: Real Samples and Vaccine Testing (Accuracy)

[0086] One vial of Yolekang 6-in-1 vaccine (containing canine leptospirosis and icteric hemorrhage leptospirosis), one vial of Weijia 8 vaccine (containing canine leptospirosis (canine type, icteric hemorrhage)), one vial of blood sample from a dog diagnosed with leptospirosis, and one vial of blood sample from a healthy dog ​​were used. 200 μL of each sample was extracted using the viral DNA / RNA rapid extraction reagent (magnetic bead method) developed by our company. The selected 2-2 primer-probe system was then used for detection.

[0087] The results are shown in Table 5. Figures 1-4 As shown in the image. Based on the results, both vaccine and leptospirosis samples were detected, while the blood sample from the healthy dog ​​was not. The results were as expected, confirming that the primer probe or kit has good amplification capability in detecting real samples.

[0088] Table 5

[0089] Sample Name Ct value Uro-Kang 6-in-1 Vaccine 20.81 Vaccine 20.51 Blood samples from dogs diagnosed with leptospirosis 23.29 Blood samples from healthy dogs Noct

[0090] Example 4 Specificity Experiment

[0091] Specific tests were performed on laboratory-preserved blood samples of Babesia, Rickettsia felis, Tritrichomonas foetus, Giardia lamblia, Ehrlichia canis, and healthy dogs. Nucleic acid was detected after sample extraction. The results are shown in Table 6 and Appendix. Figure 5 As shown in the figure. Based on the results, no Leptospira were detected. The results are in line with expectations, confirming the good specificity of the 2-2 primer-probe system.

[0092] Table 6

[0093] Sample Name Ct value Babesia Noct Rickettsia felis Noct Trichomonas fetus Noct Giardia lamblia Noct Ehrlichia canis Noct Blood samples from healthy dogs Noct

[0094] In summary, the embodiments described above achieve the following technical effects: the primer-probe composition of this application exhibits high specificity, thus enabling efficient and accurate identification of Leptospira. The target fragment is accurately amplified in clinical samples.

[0095] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A reagent for detecting Leptospira nucleic acid, characterized in that, The reagent includes a first region for detecting Leptospira, wherein the first region is selected from any segment of SEQ ID NO:

1.

2. The reagent according to claim 1, characterized in that, The first region is selected from any segment between bases (1-50) to (131-155) in SEQ ID NO:

1.

3. The reagent according to claim 2, characterized in that, The reagent includes a primer pair having a nucleotide sequence that is complementary to or identical to 16 to 26 consecutive nucleotides between bases (1 to 50) to (131 to 155) in SEQ ID NO:

1.

4. The reagent according to claim 3, characterized in that, The primer pairs are selected from the nucleotide sequences shown in SEQ ID NOs:3 and 6, or from the nucleotide sequences shown in SEQ ID NOs:4 and 7; Preferably, the reagent further includes a probe selected from the nucleotide sequence shown in SEQ ID NO:2; Among them, SEQ ID NO: 2 is 5'-ACGGGGGATAAGCTCCGTGGTCA-3'. SEQ ID NO: 3 is 5'-CGTAACTCCAGAGACTGGCAGTCA-3'. SEQ ID NO: 4 is 5'-ACCGTAACTCCAGAGACTGGCA-3', SEQ ID NO: 6 is 5'-CCTTAAACGACGGTCTGGGC-3'. SEQ ID NO: 7 is 5'-TTGGGGCCTTAAACGACGG-3'.

5. The reagent according to claim 4, characterized in that, The probe has a fluorescent reporter group and a fluorescent quencher group at its 5' and 3' ends, respectively; Preferably, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5, or Cy7; the fluorescent quencher group is selected from BHQ, TAMRA, Dabcyl, or Eclipse. More preferably, the 5' end of the probe is a VIC group and the 3' end is a BHQ group.

6. A reagent kit, characterized in that, The kit includes the reagent for detecting Leptospira nucleic acid in the sample to be tested as described in any one of claims 1 to 5.

7. The reagent kit according to claim 6, characterized in that, The kit further includes at least one of the following: Real-time PCR reaction reagent, which includes qPCR Mix, Taq polymerase, and water, preferably, the concentration of Taq polymerase is 5 U / μL.

8. A method for detecting Leptospira by real-time quantitative PCR, characterized in that, The fluorescence quantitative PCR detection is performed using the reagent for detecting Leptospira nucleic acid in the sample according to any one of claims 1 to 5 or the kit according to claim 6 or 7.

9. The method according to claim 8, characterized in that, The conditions for the quantitative real-time PCR detection are as follows: pre-denaturation at 92–98℃ for 30–90 seconds; denaturation at 92–98℃ for 2–8 seconds; annealing at 58–62℃ for 27–33 seconds, followed by collection and processing of fluorescence signals, for a total of 35–45 cycles.

10. The application of the reagent for detecting Leptospira nucleic acid in a sample according to any one of claims 1 to 5, or the kit according to claim 6 or 7, in the detection of Leptospira.

Images