Use of L-parabromamine in the preparation of a medicament for the prevention and / or treatment of human monocytic ehrlichiosis

Abstract

The application relates to application of L-parabanic acid in preparation of a medicine for preventing and / or treating human monocytic ehrlichiosis, and belongs to the technical field of medicines.The L-parabanic acid can inhibit survival and proliferation of Chafee ehrlichia by interfering with metabolic stability and energy acquisition of the Chafee ehrlichia.In a concentration of 1-100 muM, the L-parabanic acid has a significant inhibiting effect on the Chafee ehrlichia and has no obvious cytotoxicity.The L-parabanic acid not only has double functions of prevention and treatment, but also can reduce expression levels of infection-related inflammatory factors IL-1beta, IL-8 and TNF-alpha.The L-parabanic acid naturally exists in jack bean seeds, is safe in source, can be used as a doxycycline replacement scheme, and is suitable for patients who are contraindicated or poorly tolerated to doxycycline.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical technology, specifically relating to the use of L-paracancanine in the preparation of drugs for the prevention and / or treatment of human monocytic erythrocyte disease. Background Technology

[0002] Human monocytic ehrlichiosis (HME) is a disease caused by Ehrlich aspergillus chaffie (… Ehrlichia chaffeensis HME is a zoonotic infectious disease caused by infection with human monocytes or macrophages. Ehrlich aspergillus chafing is an obligate intracellular parasitic Gram-negative bacterium, primarily transmitted through tick bites. Early symptoms of HME are similar to those of the common cold or influenza, making it easily misdiagnosed and mistreated clinically. Patients may miss the optimal treatment window and progress to severe illness. Currently, there is no marketed vaccine for HME; prevention mainly relies on physical protection such as avoiding tick bites, lacking effective pharmacological preventative strategies.

[0003] In terms of drug treatment, doxycycline (DOX) is currently the first-line drug for treating HME in clinical practice. DOX exerts its bacteriostatic or bactericidal effect by inhibiting the function of the bacterial 30S ribosomal subunit and blocking bacterial protein synthesis. Most patients experience symptom relief after DOX treatment, but some severely affected patients do not respond well. More importantly, the clinical application of DOX is severely limited by the following: Doxorubicin (DOX) has a wide range of adverse effects. Long-term use can disrupt normal flora, induce superinfections, and may cause serious adverse reactions such as liver damage, pancreatitis, rash, and anaphylactic shock. Furthermore, DOX is clearly contraindicated in children, pregnant women, and breastfeeding women, as it can lead to skeletal and dental developmental abnormalities in fetuses and infants. These immunocompromised individuals are precisely the high-risk groups for hepatocellular carcinoma (HME). In addition, as an antibiotic, prophylactic use of DOX can easily induce bacterial resistance and exacerbate adverse effects; currently, there is no clear protocol for its use in HME prevention. Finally, DOX exhibits significant host cytotoxicity at higher concentrations, has a narrow therapeutic window, and limits the potential for dose escalation and clinical safety.

[0004] In summary, existing DOX-based HME treatment regimens suffer from significant problems, including severe side effects, broad contraindications, lack of preventative value, and marked cytotoxicity. Therefore, there is an urgent need to develop a novel HME prevention and treatment strategy with fewer side effects, high safety, applicability to specific populations, and both preventative and therapeutic potential. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies, such as significant side effects, wide contraindications, lack of effective preventative measures, and cytotoxicity at high concentrations, associated with doxycycline treatment of human monocytic erythrocyte virus (HMCV). This invention aims to provide a safer pharmaceutical solution that utilizes naturally sourced raw materials and offers both preventative and therapeutic benefits. Therefore, this invention provides the application of L-paracanavanine in the preparation of drugs for the prevention and / or treatment of HMCV.

[0006] This invention provides the use of L-paracanavanine in the preparation of medicaments for the prevention and / or treatment of human monocytic erythrocyte disease.

[0007] Preferably, the human monocytic erythropathia is caused by infection of human mononuclear cells or macrophages by Ehrlich aspergillus chafie.

[0008] Preferably, the concentration of L-paracanavalin A is 1~100 μM.

[0009] Preferably, when the drug is used to prevent human monocytic erythrozoonosis, it is administered within 24 hours before infection.

[0010] Preferably, the prevention and / or treatment of human monocytic erythropathies includes reducing the levels of inflammatory factors caused by Ehrlich ascites infection.

[0011] Preferably, the inflammatory factors include one or more of IL-1β, IL-8, and TNF-α.

[0012] Preferably, the drug has L-paracanavanine as its sole active ingredient.

[0013] Preferably, the drug further comprises pharmaceutically acceptable excipients.

[0014] Preferably, the drug is an oral preparation, an injection, or a topical preparation.

[0015] Preferably, the patients with human monocytic erythrozoonosis include those who are contraindicated or poorly tolerate doxycycline.

[0016] Beneficial effects: This invention provides the use of L-paracanavanine in the preparation of medicaments for the prevention and / or treatment of human monocytic ehrlichiosis. In this application, L-paracanavanine does not exert its effect by directly inhibiting bacterial protein synthesis as traditional antibiotics do, but rather by interfering with bacterial metabolic stability and energy acquisition, thereby inhibiting the survival and proliferation of *E. chaffield*. This mode of action, distinct from doxycycline (which blocks peptide chain synthesis by binding to the 30S subunit of the bacterial ribosome), allows it to exert its antibacterial effect without inducing bacterial resistance.

[0017] Based on the aforementioned metabolic interference mechanism, this invention achieves significant anti-Chaffiggerella chapensis effects at micromolar concentrations. Experiments show that L-paracanavanine exhibits good clearance ability against bacteria in infected cells within the concentration range of 1–100 μM, with a bacterial inhibition rate reaching 98.9% at 100 μM and an IC50 concentration of [missing value]. 50 At a concentration of 3.46 μM, the therapeutic effect was comparable to that of the clinical gold standard, doxycycline. Meanwhile, CCK-8 cell viability assays confirmed that L-paracanavanine had no significant cytotoxicity within this effective concentration range; cell viability remained at 96% after treatment with 100 μM, while doxycycline reduced cell viability to 50% of the control group at 50 μM and 100 μM. This indicates that L-paracanavanine has a higher upper limit of safe concentration and better cell compatibility.

[0018] A key feature of this invention is its dual efficacy, offering both preventative and therapeutic benefits. Therapeuticly, L-paracanavanine effectively inhibits the proliferation of *Ehrlich. chafing* in infected cells. Preventatively, pretreatment of cells with L-paracanavanine 24 hours before infection significantly prevents bacterial infection, achieving a prevention rate of 64.2% at 3.5 μM and 98.3% at 100 μM. This contrasts sharply with the clinical limitations of doxycycline, which is only suitable for post-infection treatment and whose premature use may exacerbate toxicity and induce drug resistance.

[0019] In terms of anti-inflammation, L-paracanavyline significantly reduced the expression of infection-related inflammatory factors while inhibiting bacteria. With increasing concentration, the relative expression levels of IL-1β, IL-8, and TNF-α gradually decreased, with the inflammatory factor levels after 100 μM treatment approaching or falling below those after 10 μM doxycycline treatment. Importantly, L-paracanavyline pretreatment significantly reduced TNF-α levels produced by cells during subsequent infections compared to the direct treatment group; for example, 20 μM pretreatment reduced TNF-α to 0.286, and 100 μM pretreatment further reduced it to 0.175, superior to the 0.299 achieved with 100 μM direct treatment. Since TNF-α is the earliest inflammatory mediator to appear in the inflammatory response, this result indicates that early intervention with L-paracanavyline not only blocks infection but also prevents the occurrence and spread of inflammation at its source.

[0020] From the perspectives of raw material sourcing and clinical applicability, L-paracanavalicin is naturally found in the seeds of sword bean, one of the first medicinal and edible ingredients in China. Its extraction and purification process is simple and does not require complex industrial synthesis routes. Its non-cytotoxicity at effective concentrations and its lack of significant impact on normal cell metabolism and survival, coupled with its advantages of both preventative and therapeutic effects, make it an ideal alternative to doxycycline. It is particularly suitable for special populations who are contraindicated or poorly tolerated by doxycycline, including children, pregnant women, breastfeeding women, patients with liver disease, and individuals with allergies, thus effectively alleviating the current clinical dilemma of having no available drugs for susceptible populations. Attached Figure Description To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0021] Figure 1 This is a schematic diagram of the structure of L-paracanavalin A; Figure 2 The graph shows the statistical results of cell viability under different concentrations of CAN treatment. Figure 3 A graph showing the statistical results of cell viability under different concentrations of DOX treatment; Figure 4 Statistical results of the relative number and inhibition rate of Ehrlich's chafing under different concentrations of CAN treatment; Figure 5 A nonlinear fitting curve of CAN concentration versus relative bacterial count; Figure 6 The graph shows the statistical results of the relative number and inhibition rate of Ehrlich as a chafie organism under different concentrations of DOX treatment; Figure 7 This is a nonlinear fitting curve of DOX concentration versus relative bacterial count. Figure 8 This figure shows the expression of inflammatory factors IL-1β, IL-8, and TNF-α after CAN treatment. Figure 9 The graph shows the statistical results of the relative number of bacteria and the prevention rate after cells were pretreated with different concentrations of CAN. Figure 10 This figure shows the expression of inflammatory factors IL-1β, IL-8, and TNF-α in CAN-pretreated cells. Figure 11 This figure shows the expression of inflammatory factors IL-1β, IL-8, and TNF-α after DOX treatment. Detailed Implementation

[0022] This invention provides the use of L-paracanavanine in the preparation of medicaments for the prevention and / or treatment of human monocytic erythrocyte disease.

[0023] The L-paracanavanine described in this invention (CAS No.: 496-93-5, Chemical Formula: C4H) 10 N2O3, structural formula: H2N-O-CH2-CH2-CH(NH2)-COOH), structural formula as follows: Figure 1 As shown. The L-paracanavanine described in this invention does not exert its effect by directly inhibiting bacterial protein synthesis, but rather by interfering with bacterial metabolic stability and energy acquisition, thereby inhibiting the survival and proliferation of *E. chafing*. The L-paracanavanine described in this invention is naturally found in the seeds of the legume *Canavalia gladiata*, which is among the first batch of food and medicine sources announced in China, ensuring its safety. High-purity L-paracanavanine can be obtained from *Canavalia gladiata* seeds through extraction, purification, and enzymatic hydrolysis. As one embodiment, the L-paracanavanine is dissolved in ddH2O to prepare a 10 mM stock solution, which is then filtered to remove bacteria and stored at -80℃. When used, it is diluted with water to different concentrations of stock solution as needed.

[0024] In one embodiment, the human monocytic erythropathia of the present invention is caused by Ehrlich ascites infection of human mononuclear cells or macrophages.

[0025] The *Ehrlich. chafee* described in this invention belongs to the class Alpha-Proteobacteria, order Rickettsia, family Anaplasmataceae, genus *Ehrlich*. It is Gram-negative, an obligate intracellular parasite, and is mainly transmitted to human blood through tick bites, thereby infecting human monocytes or macrophages and causing human monocytic ehrlichiosis.

[0026] In one embodiment, the concentration of L-paracanavalinine in this invention is 1~100 μM.

[0027] As one embodiment, the L-paracanavanine described in this invention exhibits no significant toxicity to host cells within the concentration range of 1-100 μM, and cell viability remains at 96% after treatment with 100 μM. As another embodiment, the L-paracanavanine described in this invention achieves a certain half-maximal inhibitory concentration (IC50) in the treatment of human monocytic ehrlichiosis. 50 The effective final concentration of L-paracanavanine in preventing human monocytic erythrozoonosis is 3.46 μM. As one embodiment, the effective final concentration of L-paracanavanine in preventing human monocytic erythrozoonosis is 3.5~100 μM.

[0028] In one embodiment, when the drug is used to prevent human monocytic erythrozoonosis, it is administered within 24 hours before infection.

[0029] In one embodiment, the pre-infection administration described in this invention involves contacting cells or the host with L-paracanavanine 24 hours before E. chrysophanol infection. In another embodiment, pretreatment with 3.5 μM L-paracanavanine for 24 hours achieves a prevention rate of 64.2% against E. chrysophanol infection. In yet another embodiment, pretreatment with 100 μM L-paracanavanine for 24 hours achieves a prevention rate of 98.3% against E. chrysophanol infection. The L-paracanavanine described in this invention can prevent bacterial infection, thereby achieving a preventative effect.

[0030] As one implementation, the prevention and / or treatment of human monocytic erythrozoonosis according to the present invention includes reducing the levels of inflammatory factors caused by Ehrlich aspergillus chafie infection.

[0031] In one embodiment, the reduction of inflammatory factor levels described in this invention is confirmed by real-time quantitative PCR detection of the expression levels of inflammatory factors in cells treated or pretreated with L-paracanostaniline. In another embodiment, as the final concentration of L-paracanostaniline increases, the relative expression levels of inflammatory factors decrease accordingly, and the inflammatory state of the cells gradually subsides.

[0032] In one embodiment, the inflammatory factors of the present invention include one or more of IL-1β, IL-8 and TNF-α.

[0033] In one embodiment, after treatment with 100 μM L-paracanavanine as described in this invention, the relative levels of IL-1β, IL-8, and TNF-α decreased to 0.074, 0.007, and 0.299, respectively. In another embodiment, after pretreatment with 100 μM L-paracanavanine as described in this invention for 24 h before infection, the relative level of TNF-α could be further reduced to 0.175, which is superior to the reduction achieved with direct treatment.

[0034] In one embodiment, the drug of the present invention uses L-paracanavanine as the sole active ingredient.

[0035] In one embodiment, the drug of the present invention does not contain doxycycline or other tetracycline antibiotics. In another embodiment, the present invention uses L-paracanavanine as the sole active ingredient, achieving antibacterial efficacy equivalent to doxycycline at micromolar concentrations, while avoiding the risk of inducing bacterial resistance common in antibiotic therapy.

[0036] As one embodiment, the drug of the present invention also includes pharmaceutically acceptable excipients.

[0037] In one embodiment, the excipients of the present invention include at least one selected from solvents, diluents, stabilizers, or buffers. In another embodiment, the drug of the present invention can be formulated into an aqueous solution. In yet another embodiment, the present invention dissolves L-paracanavanine in ddH2O to prepare a stock solution, which is then filtered to remove bacteria, dispensed, and stored. Before use, it is diluted to the required concentration.

[0038] As one embodiment, the drug described in this invention is an oral preparation, an injection, or a topical preparation.

[0039] As one embodiment, the oral preparations of the present invention include, but are not limited to, oral solutions, capsules or tablets; the injectable preparations include, but are not limited to, intravenous injections or intramuscular injections; and the topical preparations include, but are not limited to, lotions or liniments.

[0040] As one implementation, patients with human monocytic erythropathies described in this invention include those who are contraindicated for or poorly tolerate doxycycline.

[0041] As one implementation method, the patients for whom doxycycline is contraindicated or poorly tolerated according to this invention include children under 8 years of age, pregnant women, breastfeeding women, patients with liver disease, and people with allergies. Doxycycline is contraindicated in the above-mentioned populations, while the L-paracanavalicin described in this invention has no cytotoxicity at effective concentrations, and the raw material is derived from food and medicine homology, and can be used as an alternative treatment and / or preventive medication for the above-mentioned special populations.

[0042] To further illustrate the present invention, the application of L-paracannonine provided by the present invention in the preparation of medicaments for the prevention and / or treatment of human monocytic erythrocyte disease is described in detail below with reference to the accompanying drawings and embodiments, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0043] Example 1 L-paracancanavalicin cytotoxicity assay The effect of L-paracanavanine (GC14954, GlpBio, purity >95.00%) on cell viability was detected using a CCK-8 assay kit (CA1210, Solarbio). The procedure is as follows: Healthy THP-1 cells were seeded into 96-well plates at a density of 4000 cells per well, with a volume of 90 μL. Then, 10 μL of diluted L-paracanavanine stock solution (0.001, 0.005, 0.01, 0.05, 0.1, 0.2, 0.5, 1 mM) was added to achieve final L-paracanavanine concentrations of 0.1, 0.5, 1, 5, 10, 20, 50, and 100 μM, respectively. The control group received 10 μL of cell culture medium (i.e., a final L-paracanavanine concentration of 0), and a blank control group received only 100 μL of cell culture medium. Each group was tested in triplicate. After culturing 96-well plates in a cell culture incubator at 37°C and 5% CO2 for 48 h, 10 μL of CCK-8 solution was added to each well. The plates were then incubated at 37°C and 5% CO2 in the dark for at least 1 h. The absorbance at 450 nm was then measured using a multi-functional microplate reader (Varioskan Flash, ThermoScientific). Cell viability is calculated using Equation 1. Equation 1.

[0044] The statistical results of cell viability obtained under different concentrations of CAN treatment are shown in Table 1 and Figure 2 As shown in the figure. The results showed that the cell viability after treatment with 100 μM L-paracanavalin A was 96%, which was not significantly different from the control group of 100%, indicating that L-paracanavalin A at concentrations below 100 μM has no significant cytotoxicity and does not affect cell metabolism and survival.

[0045] Table 1 Cell viability under different concentrations of CAN treatment.

[0046] Comparative Example 1 Cytotoxicity testing of doxycycline The effect of doxycycline on cell viability was investigated according to the method described in Example 1. Healthy THP-1 cells were seeded into 96-well plates at a density of 4000 cells per well, with a volume of 90 μL. Then, 10 μL of diluted doxycycline stock solution (0.001, 0.005, 0.01, 0.05, 0.1, 0.2, 0.5, 1 mM) was added to achieve final doxycycline concentrations of 0.1, 0.5, 1, 5, 10, 20, 50, and 100 μM, respectively. The control group received 10 μL of cell culture medium (i.e., a final doxycycline concentration of 0), and a blank control group received only 100 μL of cell culture medium. Each group was tested in triplicate. After culturing the 96-well plates in a cell culture incubator at 37°C and 5% CO2 for 48 h, 10 μL of CCK-8 solution was added to each well, and the plates were incubated at 37°C and 5% CO2 in the dark for at least 1 h. The absorbance at 450 nm was then measured using a multi-functional microplate reader (Varioskan Flash, Thermo Scientific). The cell viability calculation formula is the same as Equation 1 in Example 1.

[0047] The cell viability results obtained under different concentrations of DOX treatment are shown in Table 2 and Figure 3 As shown in the figure. The results showed that after 48 h of treatment with 50 μM and 100 μM doxycycline, the cell viability was only 50% of that of the control group, indicating that 50 μM and 100 μM doxycycline had significant cytotoxicity.

[0048] Table 2 Cell viability under different concentrations of DOX treatment

[0049] Example 2 The therapeutic effect of L-paracanavanine on Ehrlich ascites infection and determination of its half-maximal inhibitory concentration. 1. Test Methods Ehrlich aspergillus chafing survived in THP-1 cells (FH0112, Fuheng Biotechnology) and were cultured in RPMI 1640 medium (SH30809.01, Cytiva) supplemented with 10% fetal bovine serum (3023A, Umedium). Passage was performed when the infection density exceeded 90%. Passage was performed at a rate of 0.05 mL of infected cells (approximately 1.5 × 10⁻⁵ cells). 5 0.1 mL of uninfected cells (approximately 3 × 10⁻⁶ cells) 5After mixing the cells and 0.85 mL of culture medium in a volume ratio, add 1 mL to each well of a 12-well plate. Then, 10 μL of L-paracanavantrine stock solution (0.1, 0.2, 0.5, 1, 2, 5, 10 mM) was added to the well plates at a drug volume:to-total volume ratio of 1:100, resulting in final drug concentrations of 1, 2, 5, 10, 20, 50, and 100 μM. The control group received 10 μL of sterile ddH2O. After incubating the well plates at 37℃ and 5% CO2 for 48 h, 1 mL of the liquid in each well plate was transferred to a 1.5 mL centrifuge tube and centrifuged at 500 g for 5 min. After removing the supernatant, 500 μL of TransZol (Q30704, TransGen) was added to the centrifuge tube to lyse the cell pellet. Total RNA was extracted and reverse transcriptase (R123-01, Vazyme) was used to convert the RNA into cDNA. The cDNA was then detected by real-time quantitative PCR (RT-qPCR) for Ehrlich as a 16S cell line. The expression levels of rRNA and GAPDH in THP-1 cells were determined using the following primer sequences: The upstream primer for Ehrlich aspergillus chafing is 5'→3' (SEQ ID NO.1): GGTGAGTAATGCGTAGGAATC; The downstream primer of Ehrlich aspergillus chafing is 5'→3' (SEQ ID NO.2): GCTCATCTAATAGCGATAAATC.

[0050] THP-1 cell GAPDH upstream primer 5'→3' (SEQ ID NO.3): TCAAGGCTGAGAACGGGAAG; THP-1 cell GAPDH downstream primer 5'→3' (SEQ ID NO.4): TGGACTCCACGACGTACTCA.

[0051] The bacterial count in the experimental group relative to the control group was calculated using Ct values, thereby determining the inhibition rate of L-paracanavanine on HME.

[0052] The RT-qPCR system consisted of: 8 μL PerfectStart Green qPCR SuperMix (AQ601, TransGen), 1 μL upstream primer (10 μM stock solution), 1 μL downstream primer (10 μM stock solution), 1 μL cDNA, and 5 μL ddH2O. After mixing thoroughly, the mixture was amplified using a qPCR instrument (FQD96A, Bioer Technology).

[0053] The amplification program was: 94℃ for 5 min; 94℃ for 15 s, 56℃ for 15 s, 72℃ for 20 s, for 40 cycles, with fluorescence read at 72℃. The melting curve program was: 95℃ for 15 s, 70℃ for 30 s, a 1℃ step for 5 s, and 95℃ for 15 s.

[0054] Using the relative number of bacteria in an untreated human monocytic ehrlichiosis model as a control, the relative number of bacteria in the experimental groups treated with L-paracanavanine was compared with that in the control group. The drug concentration in the control group was 0 μM, and the drug concentrations in the L-paracanavanine experimental groups were 1, 2, 5, 10, 20, 50, and 100 μM. The drug inhibition rate was defined as (1 - relative 16S rRNA content of bacteria in the control or experimental group) × 100%. A higher inhibition rate indicated a better therapeutic effect.

[0055] 2. Test Results The relative number and inhibition rate of Ehrlich as a chafing body under different concentrations of CAN treatment are shown in Table 3. Figure 4 As shown, the nonlinear fitting curves of CAN concentration versus relative bacterial count are obtained as shown in Table 4 and Figure 5 As shown in the figure. The results showed that as the final concentration of L-paracanostaniline increased, the relative content of bacterial 16S rRNA decreased, indicating a reduction in bacterial count for the same cell number. At 100 μM L-paracanostaniline treatment, the relative content of bacterial 16S rRNA was only 0.011, indicating that L-paracanostaniline achieved an inhibition rate of 98.9%, comparable to the inhibition rate (98.8%) of 10 μM doxycycline under the same conditions. This result demonstrates that L-paracanostaniline can effectively inhibit the survival and proliferation of *E. chafingensis* in cells, and that L-paracanostaniline at safe concentrations can achieve the same therapeutic effect as antibiotics. Figure 4 Simultaneously, the half-maximal inhibitory concentration (IC50) of L-paracanisine against Ehrlich ascites (the drug concentration at which 50% inhibition was achieved) was obtained through data fitting. 50 The concentration was 3.46 μM. Figure 5 ).

[0056] Table 3. Relative number and inhibition rate of Ehrlich ascites under different concentrations of CAN treatment.

[0057] Table 4. Nonlinear fitting curves of CAN concentration versus relative bacterial count

[0058] Comparative Example 2 The therapeutic efficacy of doxycycline against Ehrlich ascites infection and determination of its half-maximal inhibitory concentration. 1. Test Methods The therapeutic effect of doxycycline on Ehrlich ascites infection was tested according to the method in Example 2. 10 μL of doxycycline stock solution (0.00002, 0.00005, 0.0001, 0.0002, 0.0005, 0.001, 0.002, 0.0005, 0.001, 0.002, 0.005, 0.01, 0.1, 1 mM) was added to each well plate at a drug-to-total volume ratio of 1:100, resulting in final drug concentrations of 0.0002, 0.0005, 0.001, 0.002, 0.005, 0.01, 0.02, 0.05, 0.1, 1, and 10 μM. The control group consisted of 10 μL of sterile ddH2O. The remaining procedures were the same as in Example 2.

[0059] 2. Test Results The relative number and inhibition rate of Ehrlich as a chafing body under different concentrations of DOX treatment are shown in Table 5. Figure 6 As shown, the nonlinear fitting curves of CAN concentration versus relative bacterial count are obtained as shown in Table 6 and... Figure 7 As shown. The results showed that the relative number of *E. chafing* gradually decreased with increasing doxycycline concentration, consistent with treatment with L-paracanthosides. Figure 6 At the same time, the half-maximal inhibitory concentration (IC50) of doxycycline against Ehrlich ascites was measured. 50 The concentration was 2.51 nM, indicating that *E. chafingensis* is extremely sensitive to doxycycline, and even low concentrations of doxycycline can inhibit *E. chafingensis* infection. Figure 7 However, at concentrations above 0.01 μM, the therapeutic effect no longer increased in a dose-dependent manner. For example, the inhibition rates at 0.1 μM and 1 μM were both 98%, but when the concentration was increased to 10 μM, the inhibition rate only increased by 0.8%. Figure 6 This indicates that while bacteria are highly sensitive to doxycycline, they still possess corresponding strategies to cope with the survival pressure brought on by antibiotics, a common problem in antibiotic therapy. However, this phenomenon was not observed when L-paracanandrolone was used. Figure 4 ).

[0060] Table 5. Relative number and inhibition rate of *E. chafie* under different concentrations of DOX treatment.

[0061] Table 6. Nonlinear fitting curves of CAN concentration versus relative bacterial count

[0062] Example 3 Effects of L-paracansinine treatment on the expression of inflammatory factors 1. Test Methods The cDNA from cells treated with different concentrations of L-paracanavalin A in Example 2 was analyzed by RT-qPCR, using the same methods and procedures as in Example 2. The expression levels of IL-1β, IL-8, and TNF-α were detected using the cellular GAPDH gene as an internal control. The specific primer sequences are as follows: IL-1β upstream primer 5'→3' (SEQ ID NO.5): TTCGACACATGGGATAACGAGG; IL-1β downstream primer 5'→3' (SEQ ID NO.6): TTTTTGCTGTGAGTCCCGGAG.

[0063] IL-8 upstream primer 5'→3' (SEQ ID NO.7): CTGCGCCAACACAGAAATTA; IL-8 downstream primer 5'→3' (SEQ ID NO.8): ATTGCATCTGGCAACCCTAC.

[0064] TNF-α upstream primer 5'→3' (SEQ ID NO.9): CTCTTCTGCCTGCTGCACTTTG; TNF-α downstream primer 5'→3' (SEQ ID NO.10): ATGGGCTACAGGCTTGTCACTC.

[0065] 2. Test Results In inflammatory responses, IL-1β, IL-8, and TNF-α are the main inflammatory factors. IL-1β can induce acute inflammatory responses, promote the recruitment of inflammatory cells to the site of inflammation, and simultaneously stimulate stromal cells to release chemokines, further amplifying the inflammatory response. IL-8 can promote neutrophil degranulation, release elastase, damage endothelial cells, cause microcirculatory blood flow stasis, and further lead to tissue necrosis and organ dysfunction. TNF-α is the earliest inflammatory mediator to appear during the inflammatory response; it can activate neutrophils and lymphocytes, increase vascular endothelial cell permeability, regulate the metabolic activity of other tissues, and promote the synthesis and release of other cytokines. The higher the expression of these three inflammatory factors, the more severe the cellular inflammatory state.

[0066] The expression levels of inflammatory factors IL-1β, IL-8, and TNF-α after CAN treatment are shown in Table 7 and... Figure 8As shown in the figure, the results showed that as the final concentration of L-paracanostine gradually increased, the relative expression levels of the three inflammatory factors decreased accordingly. Specifically, the expression of IL-1β and IL-8 was significantly reduced under low-concentration L-paracanostine treatment. This indicates that the inflammatory state of cells gradually subsided after L-paracanostine treatment. Compared with the control group, the relative levels of the three inflammatory factors after 100 μM L-paracanostine treatment were: IL-1β (0.074), IL-8 (0.007), and TNF-α (0.299).

[0067] Table 7. Expression of inflammatory factors IL-1β, IL-8, and TNF-α after CAN treatment

[0068] Example 4 The preventive effect of L-paracancannonine against Ehrlich aspergillus chaffiger infection 1. Test Methods Purification of *E. chafingensis*: 15 mL of THP-1 cells with an infection density of 90% were centrifuged at 500 g for 5 min to remove the supernatant. The cells were resuspended in 6 mL of fresh culture medium and then sonicated on ice using an ultrasonic cell disruptor (UP250, Ningbo Xinzhi). The program was: sonication for 5 s, pause for 10 s, repeated 4 times at 150 W. After sonication, the cells were centrifuged at 1000 g for 5 min to remove unlysed cells and cell debris. The supernatant was then centrifuged at 10000 g for 10 min at 4°C. The supernatant was carefully discarded, and the precipitate was the purified *E. chafingensis* from the host cells. The bacterial pellet was resuspended in 650 μL of fresh culture medium preheated to 37°C.

[0069] Preventive efficacy testing: Different concentrations of L-paracanavanine stock solution were added to 950 μL of normally cultured THP-1 cells (approximately 3 × 10⁻⁶ cells). 5 In a sample of cells, after pretreatment at 37°C and 5% CO2 for 24 h, 50 μL of the purified Ehrlich ascites suspension (total cell volume 1 mL) was added to each cell. The cells were then cultured at 37°C and 5% CO2 for another 48 h. Total RNA was extracted and reverse-engineered into cDNA for RT-qPCR. The relative content of bacterial 16S rRNA was detected using the cellular GAPDH gene as an internal control. The RT-qPCR method and procedure were the same as in Example 2.

[0070] The control group consisted of cells pretreated with 0 μM L-paracanavanine for 24 h before being infected with *E. chafingii*. The experimental groups consisted of cells pretreated with 3.5, 10, 20, and 100 μM L-paracanavanine for 24 h before being infected with *E. chafingii*. The drug prevention rate was defined as (1 - relative 16S rRNA content of bacteria in the control or experimental groups) × 100%. A higher prevention rate indicated better preventative effect.

[0071] 2. Test Results The relative number of bacteria and the prevention rate after obtaining cells pretreated with different concentrations of CAN are shown in Table 8. Figure 9 As shown in the figure. The results showed that, compared to the control group, the relative number of bacteria in the cells gradually decreased with increasing L-paracanamine concentration during pretreatment, indicating a gradual increase in the preventive effect. After pretreatment with 3.5 μM L-paracanamine, the relative content of bacterial 16S rRNA was 0.358, with a prevention rate of 64.2%; while the prevention rate after pretreatment with 100 μM L-paracanamine was 98.3%, indicating that L-paracanamine can prevent bacteria from establishing infection, thus achieving a preventive effect.

[0072] Table 8. Relative number and prevention rate of bacteria after pretreatment of cells with different concentrations of CAN

[0073] Example 5 Effects of L-paracansin pretreatment on the expression of inflammatory factors 1. Test Methods The cDNA from cells pretreated with different concentrations of L-paracanavanine and infected with *Ehrlich. chaffieldii* in Example 4 was analyzed by RT-qPCR, using the same methods and procedures as in Example 2. The expression levels of IL-1β, IL-8, and TNF-α were detected using the cellular GAPDH gene as an internal control.

[0074] 2. Test Results The expression levels of inflammatory factors IL-1β, IL-8, and TNF-α after obtaining CAN pretreated cells are shown in Table 9. Figure 10As shown in the figure. The results showed that pretreatment of cells with L-paracanoutine reduced the high expression of inflammatory factors caused by bacterial infection. Pretreatment with only 20 μM L-paracanoutine reduced the relative content of TNF-α to 0.286; while pretreatment with 100 μM L-paracanoutine further reduced the relative content of TNF-α to 0.175, which was more significant than the reduction in TNF-α (0.299) observed with direct treatment with 100 μM L-paracanoutine. Since TNF-α is the earliest inflammatory mediator to appear during the inflammatory response, this result indicates that pretreatment of cells with L-paracanoutine can not only effectively inhibit bacterial infection but also prevent the occurrence and spread of inflammatory states.

[0075] Table 9. Expression of inflammatory factors IL-1β, IL-8, and TNF-α in CAN-pretreated cells.

[0076] Comparative Example 3 Effects of doxycycline treatment on the expression of inflammatory factors 1. Test Methods The effect of doxycycline treatment on the expression of inflammatory factors was investigated according to the method in Example 3. Cellular cDNA treated with different concentrations of doxycycline was analyzed by RT-qPCR, using the same methods and procedures as in Example 3. The expression levels of IL-1β, IL-8, and TNF-α were detected using the cellular GAPDH gene as an internal control.

[0077] 2. Test Results The expression levels of inflammatory factors IL-1β, IL-8, and TNF-α after DOX treatment are shown in Table 10 and... Figure 11 As shown in the figure. The results showed that after 48 h of treatment with doxycycline on THP-1 cells infected with Ehrlich aspergillus chaffi, the expression levels of the three major inflammatory factors, IL-1β, IL-8, and TNF-α, were reduced.

[0078] Table 10. Expression of inflammatory factors IL-1β, IL-8, and TNF-α after DOX treatment

[0079] As can be seen, after treatment with 10 μM doxycycline, the relative levels of the three inflammatory factors were: IL-1β (0.041), IL-8 (0.008), and TNF-α (0.204). Compared with Example 3, the reduction in IL-1β and IL-8 expression under low-concentration L-paracansin treatment was consistent with that under doxycycline treatment, and the relative levels of the three inflammatory factors after 100 μM L-paracansin treatment were close to or lower than those after 10 μM doxycycline treatment.

[0080] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The use of L-paracanavanine in the preparation of drugs for the prevention and / or treatment of human monocytic erythrocyte disease.

2. The application according to claim 1, characterized in that, The human monocytic erythropathiasis is caused by Ehrlich aspergillus chaffi ( Ehrlichia chaffeensis It is caused by infection of human monocytes or macrophages.

3. The application according to claim 1, characterized in that, The concentration of L-paracanavanine is 1~100 μM.

4. The application according to claim 1, characterized in that, When the drug is used to prevent human monocytic erythrozoonosis, it should be administered within 24 hours before infection.

5. The application according to claim 1, characterized in that, The prevention and / or treatment of human monocytic erythropathies includes reducing the levels of inflammatory factors caused by Ehrlich ascites infection.

6. The application according to claim 5, characterized in that, The inflammatory factors include one or more of IL-1β, IL-8, and TNF-α.

7. The application according to claim 1, characterized in that, The drug uses L-paracanavanine as its sole active ingredient.

8. The application according to claim 7, characterized in that, The drug also contains pharmaceutically acceptable excipients.

9. The application according to claim 1, characterized in that, The drug is an oral preparation, an injection, or a topical preparation.

10. The application according to claim 1, characterized in that, Patients with human monocytic erythrozoonosis include those who are contraindicated for or poorly tolerate doxycycline.

Images