A lateral flow chromatographic nucleic acid detection platform based on functionalized gold nanoparticles containing oligonucleotides targeting dermatophyte and applications thereof

Abstract

The application discloses a lateral flow chromatography nucleic acid detection platform based on gold nanoparticles functionalized with oligonucleotides for targeting dermatophyte and application thereof, and discloses that specific oligonucleotide sequences for detecting Microsporum canis are screened, such as SEQ ID NO:1-12, and then the functionalized gold nanoparticles and the lateral flow chromatography nucleic acid detection platform are combined, so that detection is not required to be equipped with special equipment or a large number of training; the TEF-1 alpha gene is used as a target to overcome the limitation based on ITS identification, so that rapid, visual and specific detection is realized.

Description

Technical Field

[0001] This invention relates to microbial detection, and in particular to a lateral flow chromatography nucleic acid detection platform based on functionalized gold nanoparticles containing oligonucleotides targeting dermatophytes and its applications. Background Technology

[0002] Microsporum canis is a zoonotic dermatophyte and the leading cause of common dermatophyte infections (commonly known as ringworm) in domestic cats and dogs. This fungus can colonize animal hair, epidermis, and nail tissue, inducing highly contagious superficial fungal infections. The pathogen can be transmitted through direct contact with infected animals and through contaminated environmental media. [1] While most infections in immunocompetent individuals resolve spontaneously, *Microsporum canis* poses a zoonotic risk, thus holding significant clinical and public health importance. Numerous reports of this fungus infecting humans have been documented, with children and immunocompromised individuals being particularly susceptible, potentially leading to various tinea infections. [2] .

[0003] Currently, the diagnosis of Microsporum canis infection relies on a variety of methods, each with significant limitations. Fungal culture remains the gold standard, but it requires 7–14 days to obtain results and may fail to detect low-level infections. [3] Direct microscopic examination combined with potassium hydroxide (KOH) slide preparation offers rapid detection but suffers from low sensitivity and cannot achieve species-level identification. Wood's lamp examination can be used for rapid screening, but its sensitivity and specificity are insufficient because not all *Microsporum canis* strains fluoresce, and false positives are frequent. Molecular biological methods (such as PCR) offer high sensitivity and specificity, but require specialized equipment and trained personnel, limiting their application in primary veterinary clinics. [4] .

[0004] Advances in molecular diagnostic technology have driven the development of PCR-based dermatophyte detection methods, which offer higher sensitivity and specificity compared to traditional culture-based methods. [5] In addition to conventional PCR, these methods also include real-time quantitative PCR and post-PCR analysis techniques, such as restriction fragment length polymorphism (RFLP) and internal transcribed spacer (ITS) sequencing, which enable species-level identification. [6] However, these methods are costly, time-consuming, and require specialized equipment and expertise. Furthermore, the high phylogenetic correlation among dermatophytes necessitates the use of highly variable target sequences to achieve reliable species-level identification. [7] .

[0005] A significant challenge in molecular detection of dermatophytes is the difficulty in identifying probe sequences that can distinguish Microsporum canis from phylogenetic species and commensal flora present in skin and hair samples.[8] Probe design often faces challenges due to the high sequence homology among dermatophytes and the lack of sufficiently polymorphic target regions. Traditional probe development methods rely on experimental screening of large sequence libraries, a laborious and resource-intensive process. Furthermore, most molecular detection methods for dermatophytes remain confined to laboratory environments, as they depend on thermal cycling equipment and specialized techniques.

[0006] The market needs a device and method for rapid, visual, and specific detection of dermatophytes that is not dependent on experimental screening of large sequence libraries and is not limited by experimental environment. This invention addresses this problem. Summary of the Invention

[0007] To address the shortcomings of existing technologies, the present invention aims to provide a lateral flow chromatography nucleic acid detection platform based on oligonucleotide-functionalized gold nanoparticles and its application. By screening to obtain specific oligonucleotide sequences for detecting Microsporum canis, and then combining functionalized gold nanoparticles and the lateral flow chromatography nucleic acid detection platform, it achieves rapid, visualized, and specific detection without relying on experimental screening of large sequence libraries and without being limited by the experimental environment.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: The oligonucleotides targeting dermatophyte detection are 20 nucleotides in length, targeting the translation elongation factor 1-α (TEF-1α) gene of Microsporum canis. The oligonucleotides have the following thermodynamic parameters: MFE > -1 kcal / mol, O_TdG < -6.5 kcal / mol, and O_OdG > -3.5 kcal / mol. The oligonucleotides exhibit no secondary structure when using a DNA model at 25°C. They have a 10 T spacer sequence at the 5' end. The sequences of the oligonucleotides are shown in SEQ ID NO: 1~12.

[0009] The aforementioned oligonucleotides targeting dermatophyte detection, preferably the combination of oligonucleotides targeting adjacent regions within 150 bp on the HWP1 gene, are the combination of SEQ ID NO: 5 and 6.

[0010] Functionalized gold nanoparticles, the formulation of which includes: a certain number of molar amounts of thiolated oligonucleotides as described above, a certain number of molar amounts of gold nanoparticles with a particle size of 40-80 nm, 0.03-0.07 mol / L phosphate buffer containing 0.003-0.007 % sodium dodecyl sulfate SDS, and the final NaCl concentration of the system being 0.06-0.10 mol / L.

[0011] Functionalized gold nanoparticles, the formulation of which includes: a certain number of molar amounts of thiolated oligonucleotides as described above, a certain number of molar amounts of gold nanoparticles with a particle size of 40-80 nm, 0.03-0.07 mol / L phosphate buffer containing 0.003-0.007 % sodium dodecyl sulfate SDS, and the final NaCl concentration of the system being 0.06-0.10 mol / L.

[0012] The aforementioned functionalized gold nanoparticles are prepared by: resuspending 60 nm diameter gold nanoparticles in 0.05 mol / L phosphate buffer (PBS, pH=7.0) containing 0.005% sodium dodecyl sulfate (SDS); adding thiol-modified probes SEQ ID NO.4 and SEQ ID NO.6 in equimolar amounts (this description is not clear; it would be best to specify the exact values); slowly adding sodium chloride solid to adjust the final NaCl concentration to 0.08 mol / L to ensure stable modification of the probes on the surface of the gold nanoparticles; washing the coupled gold nanoparticles and storing them at 4°C for later use.

[0013] A lateral flow chromatography nucleic acid detection platform based on oligonucleotide-functionalized gold nanoparticles targeting dermatophytes, comprising: functionalized gold nanoparticles as described in claims 3-5, a sample pad, a binding pad containing oligonucleotide-functionalized gold nanoparticles, a nitrocellulose membrane immobilized with a detection line and a control line, and an absorption pad; wherein the detection line is immobilized with a capture probe.

[0014] An application of a lateral flow chromatography nucleic acid detection platform based on gold nanoparticles containing oligonucleotides targeting dermatophytes, wherein the detection platform as described in claim 6 is used to identify and detect Microsporum canis.

[0015] The aforementioned applications include, but are not limited to: Trichophyton rubrum, Trichophyton mentagrophytes, Epidermophyton floccosum, Microsporum gypseum, Trichophyton concentricum, Microsporum canis, and Microsporum davidii; preferably Microsporum canis.

[0016] The advantages of this invention are: This invention does not rely on experimental screening of large oligonucleotide libraries. The probes of this invention are determined through a rational design strategy based on the Microsporum canis translation elongation factor 1α (TEF-1α) gene, a molecular target that has not been previously used for lateral flow chromatography detection of this pathogen. This design process integrates thermodynamic parameters to predict probe-target stability and specificity, thereby significantly reducing the number of experimental iterations typically required. The resulting probes are coupled with gold nanoparticles and used in lateral flow chromatography test strips to provide visual results that can be quickly interpreted without instruments. This invention can provide results within 15 minutes, avoiding the 7-14 day delay required for fungal culture, and enabling same-day clinical decision-making; The detection method of this invention can be performed directly on crude samples such as hair or dander, without the need for DNA extraction or thermal cycling equipment, and is simple to operate. The probe targeting TEF-1α in this invention ensures specific detection of Microsporum canis, minimizes cross-reactivity with other dermatophytes and skin commensal fungi, avoids false positives, and has high accuracy; This invention is not limited to the experimental environment and is suitable for veterinary point-of-care testing; This invention helps in the early identification of infected animals, facilitates timely treatment and biosafety measures, and reduces the risk of zoonotic diseases being transmitted to humans. Attached Figure Description

[0017] Figure 1 This is the comparison result of the TEF-1α gene of different Microsporum canis strains in this invention; Figure 2 This is the evaluation result of the affinity of the candidate oligonucleotides of the present invention for the TEF-1α gene of Microsporum canis; Figure 3 These are the sensitivity measurement results of this invention; Figure 4 This invention utilizes the intensity analysis of detection limit experiments using a decreasing concentration target. Figure 5 This invention presents the performance verification results of the lateral chromatographic test strip (LFA) for the quality control line and the detection line. Detailed Implementation

[0018] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0019] 1. Oligonucleotide design and screening: This invention designs a specific oligonucleotide sequence for targeting the translation elongation factor 1-α (TEF-1α) gene of *Microsporum canis*, a reliable molecular marker for species-specific identification of this dermatophyte. The oligonucleotide sequence is 20 nucleotides in length, with a 10-thymidine nucleotide (10 T) spacer at its 5' end to ensure stability when coupled to the surface of gold nanoparticles.

[0020] 1.1 Oligonucleotides were screened using bioinformatics methods and the following thermodynamic criteria were applied: The minimum free energy (MFE > -1 kcal / mol), target binding energy (O_TdG < -6.5 kcal / mol), self-binding energy (O_OdG > -3.5 kcal / mol), and absence of secondary structure at 25°C are all specified. When two probes are used together, the target binding regions of the two probes on the TEF-1α gene are no more than 150 bp apart; and the free energy of the dimer formed between the probes is ≥ -5 kcal / mol.

[0021] 1.2 Screening for highly conserved regions of this gene: Figure 1 It's unclear. Please provide a different image where all the text is clearly visible. (Additional explanation) Figure 1 What instrument and process were used to obtain the result? Figure 1 The comparison results shown demonstrate the sequence variability of the TEF-1α gene in *Microsporum canis* isolates. Highly conserved regions of this gene were screened as nucleic acid binding target sites for the probes of this invention. The use of these conserved regions ensures that the probes can bind to target sequences in different *Microsporum canis* strains, thereby reducing the probability of false negative results.

[0022] 1.3 Assessment of the affinity of candidate oligonucleotides for the Microsporum canis TEF-1α gene: Provide supplementary information on the materials and processes used in the affinity experiment.

[0023] The binding performance of candidate oligonucleotide probes to the TEF-1α gene target was evaluated using affinity analysis. Figure 2 The results showed that the selected probe exhibited strong and specific hybridization with the target sequence, confirming its suitability for the detection of Microsporum canis.

[0024] The filtered sequences are shown below: SEQ ID NO: 1 (TTTTTTTTTTGTGTTGTTGGTGGGGGTTGC); SEQ ID NO:2 (TTTTTTTTTTTGTTGTTGGTGGGGGTTGCA); SEQ ID NO:3 (TTTTTTTTTTGTTGTTGGTGGGGGTTGCAG); SEQ ID NO:4 (TTTTTTTTTT TGGTGGGGGTTGCAGATTTT); SEQ ID NO:5 (TTTTTTTTTTTTGTTGGTGGGGGTTGCAGA); SEQ ID NO:6 (TTTTTTTTTTTGTGGTGATGGCGGTGTTGT); SEQ ID NO:7 (TTTTTTTTTTTGTTGGTGGGGGTTGCAGAT); SEQ ID NO:8 (TTTTTTTTTTTGTTGGTGGGGGTTGCAGATT); SEQ ID NO:9 (TTTTTTTTTTTTGGTGGGGGTTGCAGATTT); SEQ ID NO:10 (TTTTTTTTTTGGTGGGGGTTGCAGATTTTG); SEQ ID NO:11 (TTTTTTTTTCGCCAAGCCACATCCCACCG); SEQ ID NO: 12 (TTTTTTTTTTTGTGGTGATGGCGGTGTTGT).

[0025] The combination of SEQ ID NO: 4 and SEQ ID NO: 6 was selected for the preparation of the detection platform for the following validation.

[0026] Oligonucleotide synthesis: The selected sequence was modified with a thiol group at the 5' end to achieve coupling with gold nanoparticles.

[0027] Functionalization of gold nanoparticles with Microsporum canis-specific probes: 60 nm gold nanoparticles were resuspended in 0.05 mol / L phosphate buffer (PBS, pH 7.0) containing 0.005% sodium dodecyl sulfate (SDS). Equimolar amounts of thiol-modified probes SEQ ID NO.4 and SEQ ID NO.6 were added to a final concentration of 1.5 μmol / L. Sodium chloride solid was slowly added in a gradient to adjust the final NaCl concentration to 0.08 mol / L, ensuring stable modification of the probes onto the gold nanoparticle surface. The coupled gold nanoparticles were washed and stored at 4°C for later use.

[0028] II. Detection effect verification experiment: 2.1 Evaluation of the sensitivity of the lateral flow chromatography strips using serial dilutions of the target synthesized by the Microsporum canis TEF-1α gene: Please provide a detailed description of the specific materials and procedures used in the experiment. like Figure 3As shown, the sensitivity measurement results reveal the limit of detection (LOD) of functionalized gold nanoparticles in the side-flow chromatography apparatus. The detection line remains clearly visible even at target nucleic acid concentrations as low as 10 pM. The detection line intensity gradually weakens as the target concentration decreases, confirming that this detection method exhibits a concentration-dependent response.

[0029] 2.2 Strength analysis of the detection limit experiment using decreasing concentration targets. The prepared test strips and targets all correspond to the detection of Microsporum canis.

[0030] Please provide a detailed description of the specific materials and procedures used in the experiment. The RGB signal intensities of the detection line (T line) and control line (C line) were measured at different target concentrations. Figure 4 As shown, the intensity of the T line gradually decreases as the target concentration decreases, while the C line remains consistent under all conditions, confirming the specificity and reliability of the detection method.

[0031] 2.3 Performance verification of the lateral chromatographic test strips (LFA) for the quality control line and the detection line was carried out.

[0032] In the control line experiment, functionalized gold nanoparticles (AuNP) were immobilized on the binding pad; the control line set up two experimental systems, namely pure water and TE buffer.

[0033] Please provide a detailed description of the specific materials and procedures used in the experiment. Experimental results are as follows Figure 5 As shown in Figure A.

[0034] 2.4 Conduct a combined experiment of quality control line and testing line: Two control systems were set up: a buffer containing distal oligonucleotides but without the target, serving as a negative control (NC); and a buffer containing distal oligonucleotides and... Mcanis The target buffer was used as a positive control (PC).

[0035] Please provide a detailed description of the specific materials and procedures used in the experiment. Experimental results confirm that oligonucleotide-functionalized gold nanoparticles have the effect of Mcanis The target sequence has specific recognition capabilities, see Figure 5 B is on the left.

[0036] Simultaneously, experiments were conducted to verify the reproducibility of this detection method. Target samples at the limit of detection (LOD) concentration were used for testing, and the results of three parallel replicate experiments are as follows: Figure 5 As shown on the right side of B.

[0037] All the above experiments used an 80 μL TE buffer system, and the test strip results were interpreted within 15 min.

[0038] In summary, the experiments demonstrate that this invention, through the screening of oligonucleotides, combined with functionalized gold nanoparticles and lateral flow chromatography test strips, provides a rapid, highly specific, and easy-to-use diagnostic tool that requires no specialized equipment or extensive training. Using the TEF-1α gene as a target overcomes the limitations of ITS-based identification, improving specificity for *Microsporum canis* without cross-reactivity with closely related dermatophytes. Therefore, this invention contributes to the timely management of dermatophytes, facilitates rapid treatment of infected animals, and supports the implementation of biosafety measures to reduce transmission to other animals and humans.

[0039] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any way, and all technical solutions obtained by equivalent substitution or equivalent transformation fall within the protection scope of the present invention.

Claims

1. An oligonucleotide targeting dermatophyte detection, characterized in that, The oligonucleotide targets the Microsporum canis translation elongation factor 1-α (TEF-1α) gene and is 20 nucleotides in length. The oligonucleotide's thermodynamic parameters are MFE > -1 kcal / mol, O_TdG < -6.5 kcal / mol, and O_OdG > -3.5 kcal / mol. The oligonucleotide exhibits no secondary structure when using a DNA model at 25°C. The oligonucleotide has a 10 T spacer sequence at its 5' end. The sequence of the oligonucleotide is shown in SEQ ID NO: 1~12.

2. The oligonucleotide for targeted dermatophyte detection according to claim 1, characterized in that, The preferred combination of oligonucleotides targeting adjacent regions within 150 bp of the HWP1 gene is the combination of SEQ ID NO: 5 and 6.

3. Functionalized gold nanoparticles, characterized in that, The formulation includes: a certain number of molar amounts of thiolated oligonucleotides as described in claims 1-2, a certain number of molar amounts of gold nanoparticles with a particle size of 40-80 nm, a 0.03-0.07 mol / L phosphate buffer containing 0.003-0.007% sodium dodecyl sulfate (SDS), and a final NaCl concentration of 0.06-0.10 mol / L.

4. Functionalized gold nanoparticles, characterized in that, The formulation includes: a certain number of molar amounts of thiolated oligonucleotides as described in claims 1-2, a certain number of molar amounts of gold nanoparticles with a particle size of 40-80 nm, a 0.03-0.07 mol / L phosphate buffer containing 0.003-0.007% sodium dodecyl sulfate (SDS), and a final NaCl concentration of 0.06-0.10 mol / L.

5. The functionalized gold nanoparticles according to claim 4, characterized in that, The preparation method includes: resuspending 60 nm gold nanoparticles in 0.05 mol / L phosphate buffer (PBS, pH=7.0) containing 0.005% sodium dodecyl sulfate (SDS); adding thiol-modified probes SEQ ID NO.4 and SEQ ID NO.6 in equimolar amounts (this description is not clear; it would be best to specify the exact values); slowly adding sodium chloride solid to adjust the final NaCl concentration to 0.08 mol / L to ensure stable modification of the probes on the surface of the gold nanoparticles; washing the coupled gold nanoparticles and storing them at 4°C for later use.

6. A lateral flow chromatography nucleic acid detection platform based on gold nanoparticles functionalized with oligonucleotides targeting dermatophytes, characterized in that, It comprises: functionalized gold nanoparticles as described in claims 3-5, a sample pad, a binding pad containing oligonucleotide functionalized gold nanoparticles, a nitrocellulose membrane with a detection line and a control line immobilized, and an absorption pad; wherein the detection line is immobilized with a capture probe.

7. An application of a lateral flow chromatography nucleic acid detection platform based on gold nanoparticles containing oligonucleotides targeting dermatophytes, characterized in that, The detection platform as described in claim 6 is used to identify and detect Microsporum canis.

8. The application according to claim 7, characterized in that, The dermatophytes include, but are not limited to: Trichophyton rubrum, Trichophyton mentagrophytes, Epidermophyton floccosum, Microsporum gypseum, Trichophyton concentricum, Microsporum canis, and Microsporum davidii; preferably Microsporum canis.

Images