Novel agar salt bridge type electrical stimulation cell culture device

By designing adjustable salt bridge positioning and electrostimulation modules, the adaptability, observation compatibility, and electric field control issues of the agar salt bridge electrostimulation cell culture device were solved. This achieved compatibility with standard cell culture dishes and electric field gradient control, improving the flexibility and reproducibility of experiments and ensuring real-time monitoring of electrostimulation parameters and stability of the electrochemical interface.

CN224280305UActive Publication Date: 2026-05-26GUANGDONG UNIV OF TECH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Utility models(China)
Current Assignee / Owner
GUANGDONG UNIV OF TECH
Filing Date
2025-06-20
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Existing agar-agar bridge-type electrostimulation cell culture devices suffer from insufficient system modularity, making them difficult to adapt to standard commercial cell culture dishes. They also lack compatibility with microscopic observation, have rigid electric field control modes, and lack the ability to programmably adjust the electric field intensity gradient in real time. These limitations restrict their application value in standardized electrophysiological research and high-throughput electrostimulation-phenotypic analysis.

Method used

A novel agar salt bridge-type electrostimulation cell culture device was designed, comprising an adjustable salt bridge positioning module and an electrostimulation module, supporting compatibility with standard commercial cell culture dishes, setting up an optical observation window, and achieving adjustable electrode columns through a threaded connection structure, allowing dynamic control of the electric field intensity gradient, and ensuring a closed cell culture environment.

Benefits of technology

It achieves physical compatibility with standard commercial cell culture dishes, supports in-situ dynamic correlation analysis of electrical stimulation parameters and cell phenotypic responses, dynamic control of electric field strength, reduces experimental costs, improves experimental flexibility and reproducibility, and ensures the stability of electrochemical interfaces and real-time microscopic imaging.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN224280305U_ABST
    Figure CN224280305U_ABST
Patent Text Reader

Abstract

The utility model discloses a novel agar salt bridge type electrical stimulation cell culture device which comprises a base, a top cover, a salt bridge positioning module and an electrical stimulation module, the top cover is mounted on the base, and a plurality of groups of optical observation windows are arranged on the top cover; each group of salt bridge positioning modules comprises a base and a salt bridge positioning buckle; an adjusting mechanism is arranged between the salt bridge positioning buckle and the base, and the adjusting mechanism is used for adjusting the height of the salt bridge positioning buckle; the electrical stimulation module comprises a PCB (Printed Circuit Board) and a plurality of groups of electrode columns; the PCB is mounted on the top cover; and the electrode column is arranged on the PCB through a threaded connection structure. The novel agar salt bridge type electrical stimulation cell culture device disclosed by the utility model can be matched with a standard commercial cell culture dish for use, the universality is wider, an experimenter can conveniently observe the cell / tissue state in the commercial cell culture dish, and meanwhile, the electric field intensity gradient can be conveniently adjusted.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of cell electrical stimulation, specifically relating to a novel agarose bridge-type electrostimulation cell culture device. Background Technology

[0002] Cellular electrical stimulation is a method of directly regulating cellular physiological activities and behaviors through electrical current. It is commonly used to promote cell proliferation and differentiation and to study their responses. Direct electrical stimulation refers to the direct application of current to cells. Unlike indirect electrical stimulation, direct electrical stimulation can more precisely affect cellular behavior. In biomedical research, the agar salt bridge technique is widely used in cellular electrical stimulation experiments, providing a stable and controllable electric field environment, thereby improving the accuracy and safety of electrical stimulation.

[0003] Currently, there are two main types of direct electrostimulation cell culture devices: one directly outputs an electric field through electrode plates / wires, and the other generates an electric field using ion movement via an agarose bridge. The latter has greater application feasibility because it avoids direct contact between the electrodes and the solution, reducing the risk of cell contamination. In this device, the electrode wires are connected to a saturated potassium chloride solution, and the electrostimulation of cells is achieved through ion flow mediated by the agarose bridge.

[0004] As a biophysical stimulation method, agarose bridge electrical stimulation has made some progress in cell research. Electrical stimulation regulates cell migration, proliferation, and differentiation by altering the mechanical properties and physiological activities of cells. Studies have shown that electrical stimulation can activate multiple intracellular signaling pathways, change the intracellular microenvironment, and thus significantly affect cell function. In tissue engineering, electrical stimulation combined with appropriate scaffold materials can effectively promote tissue regeneration and functional recovery. Particularly in cell migration, electrical stimulation guides cells to migrate and align orderly along the direction of the electric field by influencing cell polarity, intercellular interactions, and cytoskeleton reorganization. Furthermore, the parameters of electrical stimulation, such as current intensity, pulse frequency, and stimulation time, all have different effects on cell behavior. Appropriate current intensity can promote cell proliferation, while excessively high current intensity may lead to cell damage or death.

[0005] Therefore, the agar salt bridge electrostimulation cell culture device currently faces the following technical bottlenecks:

[0006] First, the system lacks modularity and is difficult to adapt to standard commercial cell culture dishes, requiring the reliance on non-standard customized cavity structures, which significantly increases experimental costs and limits experimental reproducibility.

[0007] Secondly, the lack of compatibility with microscopic observation means that the fixed electrode posts and salt bridge snap-fit ​​structure physically block the microscopic optical path, thus making it impossible to achieve in-situ real-time correlation monitoring of electrical stimulation parameters and cell dynamic response.

[0008] Third, the electric field modulation mode is rigid, and the fixed electrode layout makes it difficult to achieve dynamic electric field modulation of heterogeneous cell microenvironments, lacking the ability to programmably adjust the electric field intensity gradient in real time.

[0009] The aforementioned technical shortcomings will severely limit the application value of the agar salt bridge electrostimulation cell culture device in the construction of standardized electrophysiological research platforms and in high-throughput electrostimulation-phenotypic analysis. Utility Model Content

[0010] To overcome the shortcomings of existing technologies, this invention provides a novel agarose bridge-type electrostimulation cell culture device. This novel agarose bridge-type electrostimulation cell culture device can be used with standard commercial cell culture dishes, has wider applicability, and allows researchers to easily observe the state of cells / tissues in commercial cell culture dishes. At the same time, the electric field intensity gradient can be easily adjusted.

[0011] The technical solution of this utility model to solve the above-mentioned technical problems is:

[0012] A novel agar salt bridge-type electrostimulation cell culture device includes a top cover, a salt bridge positioning module disposed within the top cover for mounting salt bridges, and an electrostimulation module for providing electrical stimulation pulses.

[0013] The top cover is mounted on a commercial cell culture dish and is provided with multiple sets of optical observation windows.

[0014] The salt bridge positioning module is in multiple sets. Each set of salt bridge positioning modules includes a base set on the top cover and a salt bridge positioning buckle set on the base. The salt bridge positioning buckle is installed on the base, and an adjustment mechanism is provided between the salt bridge positioning buckle and the base. The adjustment mechanism is used to adjust the height of the salt bridge positioning buckle and / or the front-to-back distance and / or the left-to-right distance between two adjacent sets of salt bridge positioning buckles.

[0015] The electrical stimulation module includes a PCB circuit board and multiple sets of electrode posts disposed on the PCB circuit board, wherein the PCB circuit board is mounted on the top cover; the electrode posts are mounted on the PCB circuit board via a threaded connection structure.

[0016] Preferably, the top cover and the commercial cell culture dish are connected by an interlocking structure along the upper and lower edges to form an airtight cavity between the top cover and the commercial cell culture dish.

[0017] Preferably, the optical observation window is in two sets, and both sets of optical observation windows are circular in structure.

[0018] Preferably, the optical observation window is provided with a stepped groove, the outer diameter of which is 12.75 mm, the inner diameter is 11 mm, and the groove depth is 2.1 mm. A glass plate with an outer diameter of 2 mm is embedded in the stepped groove.

[0019] Preferably, the base is composed of two sets of parallel support plates; when the salt bridge positioning buckle is installed on the base, the salt bridge positioning buckle is clamped by the two sets of parallel support plates.

[0020] Preferably, the salt bridge positioning buckle has a U-shaped structure, and the salt bridge positioning buckle has a channel for installing the agar salt bridge. The cross-section of the channel is a rectangle with a length of 6mm and a width of 5mm.

[0021] Preferably, the salt bridge positioning buckle is provided with spherical positioning parts on both the front and rear sides, and correspondingly, the two sets of support plates are provided with positioning grooves that cooperate with the spherical positioning parts, wherein the positioning grooves extend vertically.

[0022] Preferably, a nut post is provided at each of the four corners of the top cover, and a mounting hole is provided at the position corresponding to the nut post of the PCB circuit board; the PCB circuit board is fixed to the top cover by screws passing through the mounting holes and engaging with the nut post.

[0023] Preferably, the threaded connection structure includes multiple sets of surface mount studs disposed on the PCB circuit board, each set of surface mount studs being provided with internal threads, and the electrode post being provided with external threads that mate with the internal threads.

[0024] Preferably, the side of the top cover is provided with a clearance opening for avoiding the power terminals of the PCB circuit board, wherein there are two sets of clearance openings.

[0025] Compared with the prior art, this utility model has the following advantages and beneficial effects:

[0026] 1. The novel agar salt bridge-type electrostimulation cell culture device of this utility model has a modular architecture and is physically compatible with existing standard commercial cell culture dishes (such as 6-well plates), thereby eliminating the dependence of traditional electrostimulation cell culture devices on customized cavities, thus significantly improving the universality of experiments and reducing research costs.

[0027] 2. The novel agar salt bridge-type electrostimulation cell culture device of this utility model has an optical observation window on its top cover, and the front-to-back distance and / or left-to-right distance of the salt bridge positioning buckle can be adjusted by the adjustment mechanism, thereby avoiding the obstruction and restriction of the microscopic optical path by the salt bridge positioning buckle, thus supporting the in-situ dynamic correlation analysis of electrostimulation parameters and cell phenotypic response.

[0028] 3. In the novel agar salt bridge electrostimulation cell culture device of this utility model, the electrode column and the PCB circuit board are connected by a threaded connection structure, and the front-to-back distance and / or left-to-right distance of the salt bridge positioning buckle can be adjusted by the adjustment mechanism, thereby realizing the dynamic control of the electric field intensity gradient. Combined with the construction of a closed cell culture environment, it effectively isolates external pollution while ensuring the stability of the electrochemical interface. Attached Figure Description

[0029] Figure 1 This is a schematic diagram showing the installation of the novel agarose bridge-type electrostimulation cell culture device of this invention in conjunction with a standard commercial cell culture dish.

[0030] Figure 2 This is a schematic diagram of the structure of the novel agar salt bridge-type electrostimulation cell culture device of this utility model.

[0031] Figure 3 This is a schematic diagram of the structure of a standard commercial cell culture dish.

[0032] Figure 4 This is a schematic diagram of the electrical stimulation module.

[0033] Figure 5 This is a structural diagram of the salt bridge positioning buckle.

[0034] Figure 6 This is a schematic diagram of the top cover structure.

[0035] Figure 7 The figure shows the results of q-PCR experiments on the Ptgs2 gene in RAW264.7 cells under electrical stimulation.

[0036] Figure 8 The image shows the results of a q-PCR experiment on the iNOS gene in RAW264.7 cells under electrical stimulation.

[0037] In the diagram: 1-Top cover; 2-Salt bridge positioning buckle; 201-Spherical positioning part; 202-Channel; 3-Base; 301-Positioning groove; 4-Electrode column; 5-PCB circuit board; 6-Power terminal; 7-Avoidance opening; 8-Optical observation window; 9-Commercial cell culture dish. Detailed Implementation

[0038] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the implementation of the present invention is not limited thereto.

[0039] See Figures 1-6 The novel agar salt bridge-type electrostimulation cell culture device of this utility model includes a top cover 1, a salt bridge positioning module for installing the salt bridge, and an electrostimulation module for providing electrostimulation pulses, which are disposed in the top cover 1.

[0040] See Figures 1-6 The top cover 1 is connected to the standard commercial cell culture dish 9 (e.g., a 6-well plate) via an interlocking structure along the upper and lower edges, thereby forming an airtight cavity between the top cover 1 and the standard commercial cell culture dish 9. Simultaneously, through the above-mentioned configuration, the top cover 1 of the novel agarose bridge electrostimulation cell culture device of this invention can be adapted to all standard commercial cell culture dishes 9, achieving physical compatibility with the standard commercial cell culture dish 9. This eliminates the dependence of traditional agarose bridge electrostimulation cell culture devices on customized cavities, thus significantly improving experimental versatility and reducing research costs.

[0041] In this embodiment, the top cover 1 has a size of 126.4mm × 84.5mm and a thickness of 3.5mm. The lower edge of the top cover 1 adopts a snap-fit ​​structure, which can be adapted to the standard commercial cell culture dish 9 (i.e., 6-well plate), thereby achieving a stable combination with the standard commercial cell culture dish 9 (i.e., 6-well plate) to form an integrated experimental system.

[0042] See Figures 1-6 The top cover 1 is provided with two sets of optical observation windows 8, both of which are circular structures; each set of optical observation windows 8 is provided with a stepped groove, the outer diameter of which is 12.75 ±0.2mm, the inner diameter is 11 ±0.2mm, and the groove depth is 2.1mm ±0.2mm. A glass plate with an outer diameter of 2mm is embedded in the stepped groove (which can be changed according to actual needs) so that researchers can observe the effect of electrical stimulation on cells in real time.

[0043] In this embodiment, the optical glass layer at the bottom of the commercial cell culture dish 9 (6-well plate) is coaxially configured with the optical observation window 8 to meet the requirements of real-time dynamic imaging.

[0044] See Figures 1-6 The salt bridge positioning module consists of multiple sets, each set including a base 3 mounted on the top cover 1 and a salt bridge positioning buckle 2 mounted on the base 3.

[0045] The base 3 is composed of two sets of parallel support plates; when the salt bridge positioning buckle 2 is installed on the base 3, the salt bridge positioning buckle 2 is clamped by the two sets of parallel support plates.

[0046] The salt bridge positioning buckle 2 has a U-shaped structure and a channel 202 for installing the agar salt bridge is provided inside the salt bridge positioning buckle 2. The cross-section of the channel 202 is rectangular. In this embodiment, the outer hole of the salt bridge positioning buckle 2 is a rectangle of 10mm×9mm and the inner hole (i.e., the channel 202) is a rectangle of 6mm×5mm. The overall dimensions of the salt bridge positioning buckle 2 are: length of 28mm, width of 10mm and height of 27.5mm.

[0047] See Figures 1-6 An adjustment mechanism is provided between the salt bridge positioning buckle 2 and the base 3. The adjustment mechanism is used to adjust the height of the salt bridge positioning buckle 2. The adjustment mechanism includes spherical positioning parts 201 provided on the front and rear sides of the salt bridge positioning buckle 2 and positioning grooves 301 provided on the two sets of support plates that cooperate with the spherical positioning parts 201. The positioning grooves 301 extend vertically.

[0048] In this embodiment, the salt bridge positioning buckle 2 has a cylindrical groove with a bottom radius of 1.56 mm and a length (or depth) of 4 mm, for placing a cylindrical positioning bead (i.e., a spherical positioning part 201) with a length of 4 mm, a bottom radius of 1.19 mm, and a ring with a length of 0.8 mm and a bottom radius of 1.75 mm. The cylindrical positioning bead has a radius of 1.19 mm. The upper and lower sides of the positioning groove 301 are both quarter-spheres with a radius of 1.55 mm, and the middle is a cylinder with a bottom radius of 1.55 mm and a height (or length) of 5 mm.

[0049] See Figures 1-6 The electrical stimulation module includes a PCB circuit board 5 and multiple sets of electrode posts 4 disposed on the PCB circuit board 5, wherein...

[0050] The top cover 1 has a nut post with an inner diameter of 3mm at each of its four corners. Correspondingly, the PCB circuit board 5 has a mounting hole with an inner diameter of 3mm at the position corresponding to the nut post. A screw with an outer diameter of 3mm passes through the mounting hole and engages with the nut post to fix the PCB circuit board 5 on the top cover 1.

[0051] The electrode post 4 is mounted on the PCB circuit board 5 via a threaded connection structure and is electrically connected to the PCB circuit board 5 (e.g., by wire connection). The electrode post 4 (taking a Pt electrode post 4 as an example, but electrode posts 4 made of different materials can be replaced as needed) is surface-treated with a platinum coating. The threaded connection structure includes four sets of M2 patch studs disposed on the PCB circuit board 5, each set of patch studs having an internal thread, and the electrode post 4 having an external thread that mates with the internal thread. The threaded connection structure allows for millimeter-level precise adjustment of the axial displacement of the electrode post 4. Combined with the adjustment mechanism for adjusting the height of the salt bridge positioning buckle 2, continuous adjustment of the electrode spacing can be achieved, thereby realizing stepless continuous control of the electric field intensity gradient. This approach combines electrochemical interface stability with experimental reproducibility and is suitable for high-throughput electrophysiological experimental research.

[0052] During the experiment, the Pt electrode column (2mm in diameter and about 3cm in length, with the external thread being 1cm long) can be moved axially through the threaded connection structure. This structural design allows the top cover 1 to be combined with the standard commercial cell culture dish 9 to form an integrated electrostimulation experimental platform, providing a stable and controllable experimental environment for cell electrostimulation research.

[0053] See Figures 1-6 The top cover 1 has a clearance opening 7 on its side for avoiding the power terminal 6 of the PCB circuit board 5. In this embodiment, there are two sets of clearance openings 7.

[0054] See Figures 1-6 The novel agarose bridge-type electrostimulation cell culture device of this invention has the following advantages:

[0055] (1) Compatible with commercial cell culture dishes 9, with better adaptability:

[0056] Existing agar-agar bridge-type electrostimulation cell culture devices require customized culture chambers of specific specifications, resulting in high experimental costs and limited applicability. The novel agar-agar bridge-type electrostimulation cell culture device of this invention adopts a fitted top cover 1 structure, which is compatible with standard commercial cell culture dishes 9 (e.g., 6-well plates) without additional customization, thereby improving experimental versatility and reducing costs.

[0057] (2) The electric field is adjustable, making the experiment more flexible:

[0058] Existing agarose bridge-type electrostimulation cell culture devices have fixed electrodes and salt bridges, and the electric field distribution is not adjustable, making it difficult to adapt to different experimental needs. This novel agarose bridge-type electrostimulation cell culture device utilizes detachable, axially movable electrode posts 4 and sliding salt bridge positioning clips 2 to achieve dynamic control of the electric field strength and distribution, thereby adapting to heterogeneous cell microenvironments and improving experimental repeatability and accuracy.

[0059] (3) Integrated observation window to realize in-situ dynamic monitoring:

[0060] Existing agarose bridge-type electrostimulation cell culture devices have structures that obstruct the microscopic imaging path, making real-time observation impossible. This novel agarose bridge-type electrostimulation cell culture device features an optical observation window with an integrated glass slide on the top cover 1, ensuring unobstructed microscopic imaging channel 202 and enabling in-situ dynamic monitoring of cell state during electrostimulation, thus improving the real-time nature and accuracy of the data.

[0061] (4) Enclosed design reduces pollution and electric field drift:

[0062] Existing agarose-bridged electrostimulation cell culture devices with open electrode structures are susceptible to external contamination, and electrochemical side reactions can easily occur when the electrodes contact the culture medium, thus affecting experimental stability. This novel agarose-bridged electrostimulation cell culture device employs a closed structure, effectively isolating the external environment, optimizing the salt bridge-culture medium interface, reducing ion leakage and conductivity gradient drift, thereby ensuring electric field stability and improving experimental reliability.

[0063] (5) 3D printing integrated manufacturing improves production efficiency and repeatability:

[0064] Existing agarose bridge-type electrostimulation cell culture devices are mostly assembled manually or machined by CNC, resulting in high manufacturing costs and limited structural consistency. This invention presents a novel agarose bridge-type electrostimulation cell culture device based on 3D modeling and printing technology, achieving high-precision manufacturing, ensuring structural consistency, improving reproducibility, and reducing production costs. It is suitable for standardized, high-throughput research.

[0065] In summary, the novel agar-agar bridge-type electrostimulation cell culture device of this invention overcomes the limitations of existing technologies in terms of adaptability, electric field control, real-time monitoring, pollution control, and manufacturing process. It has the advantages of strong versatility, adjustability, real-time observation, closed and pollution-proof design, and large-scale production capability, providing a better experimental tool for electrophysiological research and cell engineering.

[0066] See Figures 1-8 The following are specific application examples of the novel agarose bridge-type electrostimulation cell culture device of this utility model:

[0067] A novel agarose-bridged electrostimulation cell culture system was constructed using commercially available 6-well cell culture plates for cell electrostimulation experiments. The specific steps were as follows:

[0068] I. Preparation and assembly of agar filling in salt bridge positioning clips:

[0069] Weigh 0.12g of agar powder; measure 6ml of distilled water and 6ml of saturated KCl solution; mix the agar powder, distilled water and saturated KCl solution evenly; heat the mixture to completely dissolve the agar powder; use a dropper to drip the above solution into the channel of the salt bridge positioning clip; cool for several minutes until the agar solidifies; install the prepared salt bridge positioning clip on the base.

[0070] 2. Mount the electrode posts onto the PCB electrode board;

[0071] Screw on the electrode posts so that the overall length of the electrode posts is 20mm. At this point, the top cover assembly is complete.

[0072] III. Preparation of Ringer's solution:

[0073] Weigh out 8.6g of sodium chloride, 0.3g of potassium chloride, and 0.28g of calcium chloride; add distilled water to 1000ml, mix and stir until the solutes are completely dissolved; using a pipette, add 4ml of Ringer's solution to each of the four corner wells of a commercial 6-well cell culture plate.

[0074] IV. RAW264.7 cell culture:

[0075] RAW264.7 cells were resuspended in high-glucose DMEM medium containing 10% South American serum and 1% penicillin-streptomycin, and cultured in a 5% CO2, 37°C incubator until cell confluence reached 80%-90%. Cells were then collected and cultured at 4 × 10⁶ cells per well. 5 Cells were seeded at a density of 1 / mL in the two middle wells of a commercially available 6-well cell culture plate, using the same culture medium without the addition of any inducing agents. After the cells reached 80%-90% confluence, subsequent molecular assays and related experimental analyses were performed at different time points as required by the experiment.

[0076] V. Electrical stimulation of cells experiment

[0077] The aforementioned commercial 6-well cell culture plates were divided into two groups for electrical stimulation experiments: "10Hz, 2V" and "blank control group Con". The electrical stimulation time was set to 1 hour, followed by electrical stimulation. During the electrical stimulation process, the output signal in the culture chamber was continuously monitored by a detection device to ensure that the actual output met the preset requirements.

[0078] 6. Total RNA extraction:

[0079] Total RNA was extracted from electrically stimulated cells using the TRNzol Universal Total RNA Extraction Reagent (DP424) from Tiangen Biotech (Beijing) Co., Ltd. 1 mL of Trizol was added to the two middle wells of a commercial 6-well plate to lyse cells, and the cells were repeatedly pipetted in. The solution was incubated at room temperature for 5 minutes. The lysate was transferred to a 1.5 mL centrifuge tube, 200 μL of chloroform was added, the tube was capped tightly, vortexed, and incubated at room temperature for 3 minutes. The tube was then centrifuged at 12000 g / min for 15 minutes at 4°C. The supernatant was transferred to a new 1.5 mL centrifuge tube, 500 μL of isopropanol was added, vortexed, and incubated at room temperature for 10 minutes. The tube was then centrifuged at 12000 g / min for 10 minutes at 4°C. The supernatant was aspirated and discarded, retaining the white precipitate at the bottom. 1 mL of 75% ethanol (prepared with DEPC water) was added, and the white precipitate was gently tapped off by hand. The tube was then centrifuged at 7500 g / min for 5 minutes at 4°C. Discard the supernatant, then dry at room temperature for 15 minutes, and then add 30-40 μL of DEPC water to redissolve the RNA. Store the RNA in a -80°C freezer or use it directly.

[0080] VII. Reverse transcription experiment of total RNA:

[0081] Using a reverse transcription kit (TaKaRa, catalog number RR047A), 1000 ng of extracted total RNA was reverse transcribed into cDNA according to the kit's operating procedures. The specific process is as follows:

[0082] After determining the RNA concentration, calculate the required volume of RNA and DEPC water to be added based on the amount of 500 ng of total RNA added to a 10 μL reverse transcription system.

[0083] Add DEPC water, total RNA and 5×PrimeScript™ RT Master Mix (TaKaRa, catalog number RR047A) to the PCR tube in sequence, and mix well;

[0084] Reverse transcription amplification was performed on a PCR instrument according to the procedure of reacting at 37℃ for 15 min, reacting at 85℃ for 5 s, and storing at 4℃.

[0085] The amplified cDNA can be diluted 30-50 times with sterile triple-distilled water for quantitative real-time PCR amplification, or stored at -20℃ for a long time.

[0086] 8. Quantitative Real-Time PCR Amplification (Q-PCR):

[0087] Following the instructions of the kit (TaKaRa, catalog number RR820A), Q-PCR was performed using real-time quantitative PCR with Gapdh as an internal control gene to detect gene expression levels. The specific procedure is as follows:

[0088] Before the experiment, prepare the detection primers, sterile triple-distilled water, 96-well PCR plate, and real-time fluorescence reagent.

[0089] The specific location of the reaction product in the 96-well PCR plate is assigned according to the number of genes to be detected.

[0090] Prepare the reaction solution according to the ratio of 2 replicates per sample for each gene to be tested: 20 μL reaction system contains 2 μL cDNA template, 10 μL 2×SYBR® Premix Ex Taq™ II (TAKARA) reagent, 1 μL upstream primer (10 μM), 1 μL downstream primer (10 μM), and 6 μL triple-distilled water.

[0091] After adding all the reaction solution to the corresponding wells, seal the 96-well PCR plate with a special sealing film and centrifuge at 2500 rpm for 3 min.

[0092] After centrifugation, the samples were analyzed using a BIO-RAD CFX96 Touch™ Real-Time PCR System. The reaction program was as follows:

[0093] A. Pre-denaturation at 95℃ for 30 seconds;

[0094] B. PCR reaction: 95℃ for 5 seconds, 60℃ for 30 seconds, read the plate, repeat 40 times;

[0095] C. Fit the curve and read the board;

[0096] After the reaction was completed, the data was analyzed using the system's built-in analysis software. Values ​​with a CT value difference greater than 0.5 between the two replicates were excluded. The relative expression levels of each detected gene were calculated based on the internal reference gene. The Q-PCR primer list is as follows:

[0097] <![CDATA[ Mouse iNOS ]]> <![CDATA[ F:TCCCAGCAATGGGCAGACTCR:GGTGGGACAGCTTCTGGTCG ]]> <![CDATA[ Mouse Ptgs2 ]]> <![CDATA[ F:CCTGGGTTCACCCGAGGACTR:TGCAGGTTCTCAGGGATGTGAG ]]> <![CDATA[ Mouse Gapdh ]]> <![CDATA[ F:TGTGTCCGTCGTGGATCTGAR:CCTGCTTCACCACCTTCTTGA ]]>

[0098] from Figure 7 and Figure 8 The experimental results showed that the expression of Ptgs2 and iNOS genes in RAW264.7 cells gradually increased with increasing voltage, indicating a voltage dependence; this suggests that voltage changes have a significant regulatory effect on the expression of these two genes.

[0099] The above are preferred embodiments of the present utility model, but the embodiments of the present utility model are not limited to the above content. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present utility model shall be considered equivalent substitutions and shall be included within the protection scope of the present utility model.

Claims

1. A novel agarose-bridged electrostimulation cell culture device, characterized in that, It includes a top cover, a salt bridge positioning module disposed within the top cover for mounting the salt bridge, and an electrical stimulation module for providing electrical stimulation pulses, wherein, The top cover is mounted on a commercial cell culture dish and is provided with multiple sets of optical observation windows. The salt bridge positioning module is in multiple sets. Each set of salt bridge positioning modules includes a base set on the top cover and a salt bridge positioning buckle set on the base. The salt bridge positioning buckle is installed on the base, and an adjustment mechanism is provided between the salt bridge positioning buckle and the base. The adjustment mechanism is used to adjust the height of the salt bridge positioning buckle and / or the front-to-back distance and / or the left-to-right distance between two adjacent sets of salt bridge positioning buckles. The electrical stimulation module includes a PCB circuit board and multiple sets of electrode posts disposed on the PCB circuit board, wherein the PCB circuit board is mounted on the top cover; the electrode posts are mounted on the PCB circuit board via a threaded connection structure.

2. The novel agar-salt bridge-type electrostimulation cell culture device according to claim 1, characterized in that, The top cover is connected to the commercial cell culture dish via an interlocking structure along the upper and lower edges, thereby creating an airtight cavity between the top cover and the commercial cell culture dish.

3. The novel agar-salt bridge-type electrostimulation cell culture device according to claim 1, characterized in that, The optical observation window consists of two sets, both of which are circular in structure.

4. The novel agar-salt bridge-type electrostimulation cell culture device according to claim 3, characterized in that, The optical observation window is provided with a stepped groove, the outer diameter of which is 12.75 mm, the inner diameter is 11 mm, and the groove depth is 2.1 mm. A glass plate with an outer diameter of 2 mm is embedded in the stepped groove.

5. The novel agar-salt bridge-type electrostimulation cell culture device according to claim 1, characterized in that, The base consists of two sets of parallel support plates; when the salt bridge positioning buckle is installed on the base, the salt bridge positioning buckle is held by the two sets of parallel support plates.

6. The novel agar-salt bridge-type electrostimulation cell culture device according to claim 5, characterized in that, The salt bridge positioning buckle has a U-shaped structure and a channel for installing the agar salt bridge is provided inside the salt bridge positioning buckle. The cross-section of the channel is a rectangle with a length of 6mm and a width of 5mm.

7. The novel agar-salt bridge-type electrostimulation cell culture device according to claim 6, characterized in that, The salt bridge positioning buckle is provided with spherical positioning parts on both the front and rear sides. Correspondingly, the two sets of support plates are provided with positioning grooves that cooperate with the spherical positioning parts, wherein the positioning grooves extend vertically.

8. The novel agar-salt bridge-type electrostimulation cell culture device according to claim 1, characterized in that, Nut posts are provided at the four corners of the top cover, and mounting holes are provided at the positions corresponding to the nut posts on the PCB circuit board. The PCB circuit board is fixed to the top cover by screws passing through the mounting holes and engaging with the nut posts.

9. The novel agar-salt bridge-type electrostimulation cell culture device according to claim 8, characterized in that, The threaded connection structure includes multiple sets of surface mount studs disposed on the PCB circuit board, each set of surface mount studs being provided with internal threads, and the electrode post being provided with external threads that mate with the internal threads.

10. The novel agar-salt bridge-type electrostimulation cell culture device according to claim 1, characterized in that, The top cover has two sets of clearance openings on its side to avoid the power terminals of the PCB circuit board.