A system for the molecular detection and genotyping of Toxoplasma gondii

Abstract

A system for the molecular detection and genotyping of Toxoplasma gondii, consisting of: a DNA extraction unit configured to extract and purify DNA from stool and tissue samples; a PCR amplification unit configured to amplify T. gondii -specific DNA sequences using the nested PCR technique with primer sets comprising: external primers sag2Fext and sag2Rext, which target the non-coding region of the SAG2 gene to generate 1000 bp amplicon and nested inner primers sag2Fint and sag2Rint targeting the coding region of the SAG2 gene to generate a 500 bp amplicon; a gel electrophoresis system configured to visualize PCR amplification products on agarose gel; a restriction digestion unit configured to digest the nested PCR products with BsrDI and BspMI enzymes in a single reaction for genotyping; and a genotype analysis unit configured to classify the genotype of T. gondii into three clonal lineages and non-clonal genotypes based on restriction fragment profiles.

Description

FIELD OF THE INVENTION

[0001] The present disclosure relates to a system for molecular detection and genotyping of Toxoplasma gondii, in particular to a system configured to perform an accurate diagnosis of the disease and to identify the genotype of the T. gondii parasite into three clonal lineages and one non-clonal genotype. BACKGROUND OF THE INVENTION

[0002] Toxoplasma gondii is a pathogenic intracellular parasite that causes toxoplasmosis. The World Health Organization classifies toxoplasmosis as the most common foodborne parasitic disease. Since one-third of the world's population is infected, early detection and genotyping of T. gondii are essential for effective management and prevention strategies. Conventional detection is primarily based on serological methods such as ELISA, which are ineffective for mild infections and do not provide genotypic information essential for understanding virulence and disease severity.

[0003] Existing molecular detection systems target genes such as B1 and 529-bp repeat segments, but have limitations, including low specificity and the absence of these genes in some isolates. While PCR-RFLP genotyping systems exist, current methods are cumbersome, requiring multiple primer sets (up to 8 primers) and separate digestion reactions. When combined with detection systems, these approaches become laborious, requiring up to 6 separate PCR reactions before genotyping can be performed.

[0004] There is a need for an integrated system that can simultaneously detect T. gondii with high sensitivity and perform genotyping of the three clonal lineages (types I, II, III) and non-clonal genotypes using an optimized approach suitable for clinical samples and resource-limited settings. Summary of the invention

[0005] The present disclosure relates to a system for the molecular detection and genotyping of Toxoplasma gondii. The present invention provides an integrated system for the molecular detection and genotyping of Toxoplasma gondii that combines highly sensitive detection capabilities with comprehensive genotype classification in an optimized platform. The system utilizes specially designed primer sets that target the SAG2 gene using nested PCR amplification. Subsequently, a restriction enzyme digest is performed in a single reaction for simultaneous genotyping in three clonal lines and non-clonal variants.

[0006] The present disclosure further relates to providing a system for the molecular detection and genotyping of Toxoplasma gondii. The system comprises: a DNA extraction unit for extracting and purifying DNA from stool and tissue samples; a PCR amplification unit for amplifying T. gondii-specific DNA sequences using nested PCR technology with primer sets consisting of the external primers sag2Fext and sag2Rext, which target the non-coding region of the SAG2 gene to generate 1000 bp.Amplicon and nested inner primers sag2Fint and sag2Rint targeting the coding region of the SAG2 gene to generate a 500 bp amplicon; a gel electrophoresis system configured to visualize PCR amplification products on an agarose gel; a restriction digestion unit configured to digest the nested PCR products using the enzymes BsrDI and BspMI in a single reaction for genotyping; and a genotype analysis unit configured to determine the T. gondii genotype in three clonal lines and non-clonal genotypes based on restriction fragment profiles.

[0007] An object of the present disclosure is to provide a system for the molecular detection and genotyping of Toxoplasma gondii.

[0008] Another object of the present disclosure is to provide a unified system capable of detecting T. gondii infection with enhanced sensitivity while enabling genotypic classification into clonal lineages of types I, II, III, and atypical genotypes via a single integrated platform.

[0009] Another objective of the present disclosure is to reduce the complexity of current detection and genotyping approaches by eliminating the need for multiple separate PCR reactions and digestion procedures.

[0010] Another object of the present disclosure is to develop a method for analyzing different sample types, including stool and tissue samples from any stage of the T. gondii parasite life cycle, applicable for both clinical diagnostics and research applications in resource-limited settings.

[0011] To further clarify the advantages and features of the present disclosure, the invention will be explained in more detail with reference to specific embodiments illustrated in the accompanying drawings. These drawings illustrate only typical embodiments of the invention and are therefore not to be considered as limiting its scope. The invention will be described and explained in more detail with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE CHARACTERS

[0012] These and other features, aspects, and advantages of the present disclosure will become better understood when the following detailed description is read with reference to the accompanying drawings, in which like characters represent like parts throughout. Fig.1 shows a block diagram of a system for molecular detection and genotyping of Toxoplasma gondii according to an embodiment of the present disclosure; Fig. Figure 2 is a block diagram illustrating the operation of the system for molecular detection and genotyping of Toxoplasma gondii according to an embodiment of the present disclosure; and Fig. Figure 3 shows a schematic representation of the genomic sequence of Sag2 showing the priming site of our designed primers according to one embodiment of the present disclosure.

[0013] Those skilled in the art will also appreciate that the elements in the drawings are shown for convenience and are not necessarily to scale. For example, the flowcharts illustrate the method by key steps to enhance understanding of aspects of the present disclosure. Furthermore, with respect to device construction, one or more components of the device may be represented in the drawings by conventional symbols. The drawings may show only the specific details relevant to understanding embodiments of the present disclosure in order not to clutter the drawings with details that would be readily apparent to those skilled in the art from the present description. DETAILED DESCRIPTION:

[0014] To facilitate understanding of the principles of the invention, reference will now be made to the embodiment illustrated in the drawings and will be clearly described. However, the scope of the invention is not limited thereby. Changes and further modifications to the illustrated system, as well as further applications of the principles of the invention, are possible, as would normally occur to one skilled in the art to which the invention pertains.

[0015] It will be understood by those skilled in the art that the foregoing general description and the following detailed description are exemplary and explanatory of the invention and are not intended to be limiting thereof.

[0016] References in this specification to "one aspect," "another aspect," or similar language mean that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present disclosure. Therefore, the phrases "in one embodiment," "in another embodiment," and similar language in this specification may or may not refer to the same embodiment.

[0017] The terms "comprises," "comprising," or other variations thereof are intended to cover non-exclusive inclusion, such that a process or method comprising a list of steps may include not only those steps, but also additional steps not expressly listed or inherent in that process or method. Likewise, the statement "comprises" for one or more devices, subsystems, elements, structures, or components does not exclude, without further limitation, the existence of other devices, subsystems, elements, structures, components, or additional devices, subsystems, elements, structures, or components.

[0018] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. The systems, methods, and examples provided herein are for illustrative purposes only and should not be considered limiting.

[0019] Embodiments of the present disclosure will be described in detail below with reference to the accompanying drawings.

[0020] Fig. 1 shows a block diagram of a system for molecular detection and genotyping of Toxoplasma gondii according to an embodiment of the present disclosure.

[0021] Referring to Fig.1, the system (100) comprises: a DNA extraction unit (102) configured to extract and purify DNA from stool and tissue samples; a PCR amplification unit (104) configured togondii - to amplify specific DNA sequences using the nested PCR technique with primer sets comprising the external primers sag2Fext and sag2Rext targeting the non-coding region of the SAG2 gene to generate a 1000 bp amplicon and nested internal primers sag2Fint and sag2Rint targeting the coding region of the SAG2 gene to generate a 500 bp amplicon; a gel electrophoresis system (106) configured to visualize PCR amplification products on an agarose gel; a restriction digestion unit (108) configured to digest the nested PCR products using the enzymes BsrDI and BspMI in a single reaction for the purpose of genotyping; and a genotype analysis unit (110) configured to determine the T. gondii genotype in three clonal lines and non-clonal genotypes based on restriction fragment profiles.

[0022] In one embodiment, the DNA extraction unit (102) is configured to use the phenol / chloroform extraction technique or commercial DNA extraction kits.

[0023] In one embodiment, the PCR amplification unit (104) is configured to operate under optimized thermocycling conditions suitable for both external and nested primer sets with identical PCR parameters.

[0024] In one embodiment, the nested inner primers sag2Fint and sag2Rint are configured to independently detect T. gondii infection by conventional PCR without the need for external primers.

[0025] In one embodiment, the primer sets are configured with specificity for the T. gondii SAG2 gene with minimal cross-annealing potential for other organisms.

[0026] In one embodiment, the restriction digestion unit (108) is configured to operate under optimized conditions that allow simultaneous digestion with BsrDI and BspMI enzymes for discriminatory genotyping.

[0027] In one embodiment, the genotype analysis unit (110) is configured to distinguish between type I, type II, and type III clonal lines and atypical non-clonal genotypes based on specific restriction fragment patterns.

[0028] In one embodiment, the system (100) further comprises a gel purification unit (112) configured to purify nested PCR products prior to restriction digestion if required for optimal genotyping results.

[0029] In one embodiment, the system is configured to analyze samples from any stage of the T. gondii parasite life cycle, including oocysts and tissue cysts.

[0030] In one embodiment, the system (100) further comprises a gel documentation system (114) configured to capture and analyze restriction fragment profiles for genotype determination and result documentation.

[0031] The present invention relates to a system for the molecular detection and genotyping of Toxoplasma gondii. The proposed system can simultaneously detect T. gondii with high sensitivity and perform genotyping of the three clonal lineages (types I, II, III) as well as non-clonal genotypes using an optimized approach suitable for clinical samples and resource-limited environments.

[0032] The system operates with a coordinated sequence of integrated units that collectively enable the detection and genotyping of Toxoplasma gondii in biological samples. The DNA extraction unit initiates the analysis by processing stool and tissue samples from suspected infected individuals or animals. It uses either phenol / chloroform extraction techniques or commercial DNA extraction kits to obtain purified genomic DNA for subsequent amplification. This unit is designed to process various sample types and ensures the DNA integrity critical for subsequent PCR analysis.

[0033] The PCR amplification unit represents the central detection component of the system. It uses a nested PCR strategy with specially designed primer sets targeting the SAG2 gene of T. gondii. The external primers sag2Fext and sag2Rext target the non-coding region of the SAG2 gene and generate a 1000 base pair amplicon in the first round of amplification. These external primers increase the overall sensitivity of the detection system by enabling an initial amplification of the target sequence. The nested internal primers sag2Fint and sag2Rint target the coding region of the SAG2 gene and generate a 500 base pair amplicon, which both confirms the presence of T. gondii and provides the substrate for subsequent genotyping analysis.

[0034] The nested PCR approach significantly increases detection sensitivity compared to conventional single-round PCR systems. The system is configured so that the inner primers alone can independently detect T. gondii infection by conventional PCR when highly sensitive nested amplification is not required. Both primer sets operate under identical, optimized thermocycling conditions, simplifying operational requirements and reducing the potential for error. Primer design includes comprehensive specificity analysis to ensure minimal cross-reactivity with other organisms while maintaining high affinity for T. gondii SAG2 sequences.

[0035] After amplification, the gel electrophoresis system provides visual confirmation of successful PCR amplification through agarose gel separation of the amplified products. This system enables real-time monitoring of the detection process and quality assessment of the amplified DNA prior to genotyping analysis. The electrophoresis system is integrated into the overall workflow to ensure a seamless transition between the detection and genotyping phases.

[0036] The restriction digestion unit performs the crucial genotyping function using a novel single-reaction approach with the restriction enzymes BsrDI and BspMI. This unit is specifically configured to digest the 500 base pair PCR product and generates characteristic restriction fragment patterns that allow discrimination between different T. gondii genotypes. The simultaneous use of both restriction enzymes in a single reaction significantly simplifies the genotyping process compared to existing multi-enzyme and multi-reaction approaches. The restriction digestion conditions are optimized to ensure complete digestion while maintaining enzyme stability and activity.

[0037] The Genotype Analysis Unit interprets the restriction fragment patterns to classify T. gondii isolates into the three major clonal lineages (Type I, Type II, and Type III) as well as atypical, non-clonal genotypes. This unit correlates the observed fragment patterns with predefined reference profiles for each genotype, thus enabling accurate and reliable genotype determination. The analysis function also includes the identification of mixed infections and atypical genotypes that may not conform to the classic three-lineage classification system.

[0038] Other system components include an optional gel purification unit, which can purify nested PCR products as needed to achieve optimal genotyping results, especially for samples with multiple bands or background amplification. The gel documentation system offers comprehensive recording and analysis functions for restriction fragment profiles. This enables permanent result documentation and facilitates the comparative analysis of multiple samples.

[0039] The integrated system architecture ensures compatibility of all components while providing flexibility for different sample types and analysis requirements.

[0040] The system is designed for effective operation with minimal DNA concentrations, making it suitable for clinical samples where DNA yield may be limited. The entire system can be deployed even in resource-limited environments while ensuring high analytical performance standards.

[0041] Fig. Figure 2 shows a block diagram illustrating the operation of the system for molecular detection and genotyping of Toxoplasma gondii according to an embodiment of the present disclosure.

[0042] Fig. Figure 3 shows a schematic representation of the genomic sequence of Sag2 showing the priming site of our designed primers according to one embodiment of the present disclosure.

[0043] The present invention relates to a system for the molecular detection and genotyping of Toxoplasma gondii as described in Fig.2, the system comprising a sequence of integrated functional modules that enable detection down to the genotypic level.

[0044] According to Fig.2, the system starts with a sample collection unit configured to collect biological samples from suspected infected individuals or animals, including animal samples based on investigations. The collected sample is forwarded to a DNA extraction unit configured to extract and purify genomic DNA using either the phenol / chloroform method or commercially available DNA extraction kits. The current implementation used the phenol / chloroform method. The extracted DNA is transferred to a PCR amplification unit equipped to detect T. gondii-specific sequences using a nested PCR approach with primers. The amplification unit includes two sets of primers: external primers called sag2Fext and sag2Rext, and nested (internal) primers called sag2Fint and sag2Rint.The inner primer set sag2Fint and sag2Rint can be operated independently within the system to detect T. gondii DNA without external primers.

[0045] The detection module is configured with primer sets developed based on a query and multiple sequence alignment of the SAG2 gene. The priming site is selected to ensure compatibility with the discriminatory restriction digest required for genotyping. Fig.Figure 3 shows the target priming regions of the SAG2 gene. The primers sag2Fext and sag2Rext bind to the non-coding region of the SAG2 gene and generate a 1000 bp amplicon (Table 1). Primer suitability analysis revealed that these primers meet all evaluation criteria except for the nearest neighbor Tm gene (Table 2). Specificity analysis using NCBI Primer-BLAST revealed that these primers are specific for the SAG2 gene of T. gondii and have a low potential for cross-annealing. Table 1: Description of the primer used, the sequence, the Tm value, as well as the GC content and the amplicon size that can be obtained from the primer sets. Primer name Sequence 5'- 3' Tm (°C) GC% Expected product size External sag2Fext CTTGCGATTCTGTGTGTTGTT 50 43 ~1000 bp sag2Rext TTCCCGTTACCACCAACTTC 52 50 Nested (internal) sag2Fint TTCAAGTTCGCTCTTGCGTC 52 50 500 basis points sag2Rint CACAAA CGTGATCAACAAACC 50 43 Table 2: Primer suitability testing First ( sequence 5'- 3') PercentGC Self-annealing Hairpin formulation Tm(nearestneighbor) External CTTGCGATTCTGTGTGTTGTT Happen Happen Happen warning TTCCCGTTACCACCAACTTC Happen Happen Happen warning Nested (internal) TTCAAGTTCGCTCTTGCGTC Happen Happen Happen warning

[0046] The primers sag2Fint and sag2Rint target the coding region of the SAG2 gene and generate a 500 bp amplicon (Table 1). The sag2Rint primer meets all design criteria, while the sag2Fint primer meets all but the nearest neighbor Tm primer (Table 2). Specificity assessments confirm that the inner primers are specific for T. gondii and there is minimal potential for cross-reactivity with non-target organisms.

[0047] The PCR amplification unit is operational under consistent thermocycling conditions for both primer sets (see Table 3). The first amplification round uses the primers sag2Fext and sag2Rext, followed by a second amplification with the primers sag2Fint and sag2Rint. This nested amplification confirms the presence of T. gondii DNA. System validation with T. gondii oocysts from cats and tissue cysts from chickens demonstrates performance consistent with in silico predictions. Furthermore, operation of the amplification unit with only the inner primers sag2Fint and sag2Rint on oocyst and tissue cyst samples confirms detection capability. Table 3: Temperature cycle parameters used in PCR tests temperature Time For both external and nested Or Initial denaturation 94 5 7 Denaturation 94 0.3 1 Glow 45.5 0.3 1 extension 72 1 1 Last extension 72 7 10

[0048] The amplified products are analyzed using gel electrophoresis for visualization. After detection, the PCR product generated with the sag2Fint and sag2Rint primers is passed either directly or through a gel purification unit if the signal quality requires purification for genotyping. The genotyping module includes a restriction digestion unit configured for simultaneous enzymatic digestion with the enzymes BsrDI and BspMI. Direct digestion is activated for single, high-quality bands; otherwise, the optional purification module is used.

[0049] The enzymatic digestion module utilizes BsrDI and BspMI, identified by in silico restriction analysis of PCR products generated from internal primers. This module is operational under the optimized reaction conditions described in Table 4. The reference sequences used in the in silico analysis include isolates such as LGE96-1 (AF357578.1), COUGAR (AF249696.1), CASTELLS (AF357582.1), MAS (AF357580.1), RUB (AF357581.1), S48 (AF357577.1), NED (AF357579.1), DEG (JX045473.1), RH (GU174755.1), ME49 (JX045474.1), and VEG (JX045477.1), which exhibit restriction fragment profiles characteristic of the three clonal genotypes and atypical non-clonal genotypes of T. gondii. Table 4: RFLP working conditions and restriction fragment size (profile) marker Chromosome number Restriction enzymes Digestion and electrophoresis conditions Fragment band size (bp) Type I Type II Type III Sag 2 VIII BsrDI, BspMI NEB 3.1, 37 0 C 1 h, 65 0 C 260 310 310 1 hour, 3% gel 150 190 150

[0050] The restriction digestion unit generates restriction fragment profiles that define enzyme-specific cleavage sites and genotype-specific cleavage patterns. Operational validation of the digestion unit on T. gondii oocysts from cats and tissue cysts from chickens shows consistent fragment profiles with predicted results.

[0051] In an exemplary embodiment, the sample is identified as genotype type II. Lane 1 corresponds to type II, lane 2 to an atypical genotype, and lane 3 to genotype type III. All digestion results are visualized using gel electrophoresis.

[0052] A gel documentation system is included to capture, archive, and support the analysis of electrophoretic profiles generated during the detection and genotyping processes.

[0053] The complete system is compatible with any biological sample and can detect T. gondii at all life cycle stages, including oocysts and tissue cysts. The system requires standard molecular biology instruments, including a thermal cycler, a gel electrophoresis setup, and a gel documentation platform.

[0054] The system includes a molecular detection module for Toxoplasma gondii with specially developed primer sets. The primers sag2Fext and sag2Rext, in combination with the primers sag2Fint and sag2Rint, enable highly sensitive detection of T. gondii using nested PCR. Used independently in a conventional PCR configuration, the primers sag2Fint and sag2Rint are sufficient to detect T. gondii infection or parasitic DNA in a biological sample.

[0055] The system also includes an amplification condition module that defines and optimizes the working parameters for the sag2Fext and sag2Rext, as well as sag2Fint and sag2Rint primer sets, ensuring reliable amplification performance and consistent results during detection processes.

[0056] For genotyping, the system features a restriction digestion unit that combines the enzymes BsrDI and BspMI in a single enzymatic reaction. This enzyme pair is applicable to the PCR amplicon generated with the primers sag2Fint and sag2Rint and can differentiate T. gondii into the three established clonal lineages as well as non-clonal variants based on restriction fragment profiles.

[0057] The system also integrates a digestion condition module that specifies the optimal reaction conditions for the enzymes BsrDI and BspMI as well as the characteristic restriction fragment profiles associated with each genotype of T. gondii, thus enabling accurate lineage identification through downstream electrophoretic visualization.

[0058] The system described here has been shown to effectively detect and genotype Toxoplasma gondii in resource-limited laboratory settings. Cases of failed molecular confirmation of T. gondii infection have been reported in various laboratories, particularly in resource-limited regions. The system described here overcomes these limitations by requiring only a small amount of DNA, using a reduced number of primers, and performing a single restriction digestion reaction. Thanks to its high sensitivity and specificity, the system offers a practical and reliable solution for precise molecular diagnosis and genotyping of T. gondii in resource-limited settings.

[0059] The drawings and the foregoing description illustrate examples of embodiments. Those skilled in the art will recognize that one or more of the described elements may well be combined into a single functional element. Alternatively, certain elements may be separated into multiple functional elements. Elements of one embodiment may be added to another embodiment. For example, the order of the processes described herein may be changed and is not limited to the manner described herein. Furthermore, the actions of a flowchart need not be performed in the order shown; nor do all actions need to be performed. Also, actions that are not dependent on other actions may be performed in parallel with the other actions. The scope of the embodiments is in no way limited by these specific examples.Numerous variations, whether explicitly stated in the specification or not, such as differences in structure, dimensions, and use of materials, are possible. The scope of the embodiments is at least as broad as indicated in the following claims.

[0060] Advantages, further benefits, and solutions to problems have been described above with reference to specific embodiments. However, the advantages, advantages, solutions to problems, and any components that may result in or enhance an advantage, advantage, or solution are not to be construed as critical, required, or essential features or components of any or all of the claims. REFERENCES 100 The system comprises: a DNA extraction unit. 102 DNA extraction unit 104 PCR amplification unit 106 Gel electrophoresis system 108 restriction digestion unit 110 Genotype Analysis Unit 112 Gel cleaning unit 114 Gel documentation system 202 DNA extraction 204 Nested PCR 206 Gel electrophoresis 208 Pcr-Rflp 210 Gel electrophoresis 212 With Sag2fext; Sag2rext Primers And Sag2fint; Sag2rint primers 214 Gel Cleansing 216 With Bsrdi and Bspmi enzymes 218 3 hours for T. Gondii genotyping 220 4 Hours For Detection For T. Gondii 302 Sag2 Genomic Sequence 304 Outer Pf 306 coding region 308 Inner-Pr 310 external pr 312,500 basis points 314 Inner-Pf

Claims

[1] A system for the molecular detection and genotyping of Toxoplasma gondii, consisting of: a DNA extraction unit configured to extract and purify DNA from stool and tissue samples; a PCR amplification unit configured to amplify T. gondii -specific DNA sequences using the nested PCR technique with primer sets comprising: external primers sag2Fext and sag2Rext, which target the non-coding region of the SAG2 gene to generate 1000 bp amplicon and nested inner primers sag2Fint and sag2Rint targeting the coding region of the SAG2 gene to generate a 500 bp amplicon; a gel electrophoresis system configured to visualize PCR amplification products on agarose gel; a restriction digestion unit configured to digest the nested PCR products with BsrDI and BspMI enzymes in a single reaction for genotyping; and a genotype analysis unit configured to classify the genotype of T. gondii into three clonal lineages and non-clonal genotypes based on restriction fragment profiles. [2] The system of claim 1, wherein the DNA extraction unit is configured to use the phenol / chloroform extraction technique or commercial DNA extraction kits. [3] The system of claim 1, wherein the PCR amplification unit is configured to operate under optimized thermocycling conditions suitable for both external and nested primer sets with identical PCR parameters. [4] The system of claim 1, wherein the nested internal primers sag2Fint and sag2Rint are configured to independently detect T. gondii infection by conventional PCR without the need for external primers. [5] The system of claim 1, wherein the primer sets are configured with specificity for the T. gondii SAG2 gene with minimal cross-annealing potential for other organisms. [6] The system of claim 1, wherein the restriction digestion unit is configured to operate under optimized conditions allowing simultaneous digestion with BsrDI and BspMI enzymes for discriminatory genotyping. [7] The system of claim 1, wherein the genotype analysis unit is configured to distinguish between clonal type I, type II and type III lineages and atypical non-clonal genotypes based on specific restriction fragment patterns. [8] The system of claim 1, further comprising a gel purification unit configured to purify nested PCR products prior to restriction digestion when required for optimal genotyping results. [9] The system of claim 1, wherein the system is configured to analyze samples from any stage of the life cycle of the T. gondii parasite, including oocysts and tissue cysts. [10] The system of claim 1, further comprising a gel documentation system configured to acquire and analyze restriction fragment profiles for genotyping and result documentation.

Images