IN-SITU CHAINING OF OLIGONUCLEOTIDE PROBES FOR TARGET DETECTION

DE602020071162T2Active Publication Date: 2026-04-29QBIOTIX LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
DE · DE
Patent Type
Patents
Current Assignee / Owner
QBIOTIX LTD
Filing Date
2020-06-15
Publication Date
2026-04-29

AI Technical Summary

Technical Problem

Current DNA/RNA detection methods, such as PCR and in-situ hybridization, are time-consuming and lack robustness and sensitivity, leading to ambiguous results and loss of histological context, especially in clinical and non-clinical environments, and fail to provide timely qualitative and quantitative molecular data.

Method used

Development of concatenated DNA-probe multimers formed from oligonucleotides that hybridize seamlessly to coding and complementary DNA/RNA sequences, using FRET technology to stabilize probe-target complexes and eliminate background noise, enabling rapid and reproducible detection within one hour.

Benefits of technology

The method provides robust and rapid detection of DNA/RNA with high specificity and sensitivity, allowing for quantitative analysis and maintaining histological context, enhancing clinical decision-making and reducing treatment costs.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

Field of the Invention

[0001] This invention relates to the in-situ concatenation of oligo-nucleotide probes for the detection of target sequencesBackground of the Invention

[0002] Personalised medicine, cancer diagnostics, rapid microbiological resistance testing, and microbial identification require a plurality of DNA / RNA-based information, which are derived from body fluids, tissue samples and swabs. The information, present in very low concentrations or single copies, is required in a timely manner directly from specimens. Equally, microbial infections require immediate identification of the culprit, including vital information for the targeted treatment of individuals, where current state of the art methodology fails to give clinicians immediate information in time to start therapeutic regimens. Even in non-clinical environments, food safety testing struggles to provide data for the release of production batches.

[0003] Two techniques are available to provide such information, each having its specific limitations. Amplification assays, such as PCR, are rapid well established and robust in trained hands. However, they require cell disruption, removing valuable histological, morphological and quantitative data at the cellular level. The alternative in-situ hybridisation is well known in the art but has not found its way into routine high volume testing. of genetic information. of genetic information.

[0004] Although ISH / FISH-based RNA and DNA detection techniques have been around for decades, they have been largely ineffective. They lack robustness and sensitivity to reliably detect the expression of genetic information. While Microarray and PCR provide useful molecular profiles of diseases, the clinically relevant histological information regarding cellular and tissue context, as well as spatial variation of the expression patterns in tissues or mixed cell populations are lost in the process. Currently available in-situ applications call lengthy hybridization and amplification procedures taking five hours for the total procedure., Effectively, they can only be accomplished in one day, if started at the beginning of a shift. Any sample arriving later needs to be either performed by two shifts, or call for an over-night procedure.

[0005] PCR procedures have been established to provide rapid results within 1-2 hours, including sample preparation. In these rapid applications the sample preparation encompasses total extraction of RNA / DNA disrupting any morphological correlations. Non-disruptive, In-situ PCR applications are also well known in the art. However, they call for very meticulous and lengthy procedures, sensitive to performance skills.

[0006] Other fluorescence in-situ hybridisation procedures (FISH) were devised to detect DNA and mRNA. These assays call for lengthy hybridisations and thus produce results in the best case at the end of a shift, usually however in two days upwards.

[0007] DNA-beacon technologies were developed to detect targets with ample numbers in-situ. This encompasses utilising the preference of DNA to form hair-pin loops wherever possible. This was used to develop oligo-nucleotides, which would form hair-pin loops with a targeting sequence in the loop and quencher-fluorophore pairs on the respective 3' and 5' prime ends. In the absence of a target the oligo-nucleotide will prefer the hair-pin loop conformation, bringing fluorophore and quencher into very close proximity. Upon excitation the quencher will capture the emitted photons and no signal is visible. In the presence of a target the loop will unfold and the two are separated. Upon excitation the oligo-nucleotide will emit a bright signal. This technology was developed further to identify ribosomal RNA within 30 minutes, allowing immediate identification of bacteria directly in clinical samples.

[0008] Other in-situ procedures were devised to shorten the assay time. Notably the branched DNA (bDNA) managed to bring the assay time down to one shift. Practically this means that only samples drawn at the very beginning of a shift may be analysed the same day. In a routine clinical environment this approach is effectively a two-day procedure.

[0009] All these assays produce qualitative data, where presence / absence is determined. The interpretation of the assays becomes ambiguous at the borderline of detection limits. This is especially the case with biological samples, which, frustratingly frequent, harbour autofluorescent particles. The issues concerning background fluorescence are enhanced when moving to higher magnifications. Skill and care in the preparation of samples becomes an issue, especially when dealing with glass slides of variable quality and age.

[0010] Only assays with total turn-around times of one to two hours are able to have an early impact on clinical decision finding and reduce treatment cost and potentially increase survival rates.

[0011] Moreover, the quantification of results is reduced to relative fluorescence with respect to background noise. Quantification in molar terms still remains a challenge.

[0012] It would therefore be desirable to have an assay that will provide both qualitative and quantitative molecular data within a histological context and the same time frame as other rapid histological techniques. US2014 / 255924 A1 describes a population of FRET labeled oligonucleotide probes able to form cancatemeres.Summary of the Invention

[0013] The present invention provides a multiplicity of nucleic acid probes or a composition comprising such probes as defined in the appended claims to allow a robust and rapid in-situ hybridisation assay for the detection of DNA and RNA molecules. Methods, assays and kits are also provided as defined in the appended claims.

[0014] In one aspect, there is provided an in-situ concatenated DNA-probe multimer, formed from at least two to a plurality of oligo-nucleotides, or nucleic acid probes, under stringently identical conditions, following 5' to 3' or 3' to 5' downstream target sequences essentially seamlessly, designed to work synergistically, all capable of hybridising simultaneously to the coding and complementary DNA-sequences of interest, where each oligo-nucleotide's 5' and 3' ends hold sequences designed to form helical stems in-situ with the neighbouring oligonucleotide in the presence of target sequences to polymerise in-situ, resulting in an elongated sequence with enhanced binding characteristics. Suitably, an essentially seamless array of individual, DNA oligonucleotide sequences hybridising to both the coding and complementary target sequences of genes is formed indicating the presence of a cell's malignant or otherwise pathogenic status. In other words, an assay to simultaneously detect DNA and cDNA in-situ. In one embodiment, an essentially seamless array of individual, DNA oligonucleotide sequences hybridising to both the coding and complementary target sequences of genes is formed indicating presence of antibiotic resistance or toxin gene expression in micro-organisms.

[0015] In another aspect or embodiment, there is provided an array of oligo-nucleotides, or nucleic acid probes, as defined herein, hybridising to any transcription product sequences of any length, from small non-coding RNA to messenger RNA. In one aspect or embodiment, there is provided an array of oligo-nucleotides or nucleic acid probes as described herein with non-target directed 3' and 5' ends designed to form short helixes interlinking only in-situ with the up- and downstream neighbouring oligo-nucleotides to effectively form one large stable hybridizing sequence of any length in either 5' to 3' or 3' to 5' directions. Suitably, the 5' end nucleotides are designed to mismatch the respective 3' up-stream target's sequence by having the alternative purine, where the up-stream target has the first purine, and, conversely, having an alternative pyrimidine-, where the target has the first pyrimidine-nucleotide. Suitably, the downstream, neighbouring oligo-nucleotides 3' mismatching sequence is designed to hybridise to the 5' nucleotides flanking the neighbouring upstream oligo-nucleotide following classical hybridisation rules. Suitably, the application of a set of rules defining the choice a flanking sequence prevents the hybridisation of flanking regions with target DNA or RNA. Suitably, all sequences towards targets are designed to hybridise with only one common ΔG (+ / - 2 kcal / mol) under hybridisation conditions.

[0016] In one embodiment, each stem formation provides an additional negative ΔG to the combined oligo-nucleotide array hybridisation process allowing the sum of target-hybrid and stem free energy to be fine-tuned to be within approximately 1 kcal / mol. Suitably, each stem formation provides an additional negative ΔG to the combined oligo-nucleotide array hybridisation process for the sum of target-hybrid and stem free energy to be restricted to be within approximately 1 kcal / mol under hybridisation conditions. Suitably, each stem formation provides an additional negative ΔG to the combined oligo-nucleotide array hybridisation process for the sum to be below the ΔG of the respective ΔG for the re-formation of the DNA double helix. Suitably, the ΔG of the stem formation are designed to be unfavourable in solution to disable self-elongation and the T m is designed to be below ambient temperatures to melt any forming self-hybridisation. Suitably, the oligo-nucleotides do not form self-quenching hairpin loops.

[0017] In one embodiment, there is provided an array of oligo-nucleotides or nucleic acid probes in accordance with the invention where the ΔG and T m of the target sequences to the coding DNA and cDNA overlap only to 50% the ΔG of the full target sequence.

[0018] In a further embodiment, the invention provides nucleic acid probe sequences where probes towards DNA and complementary DNA are prevented from self-hybridising in-situ giving false positive signals. Suitably, the oligo-nucleotide towards the complementary DNA covers the respective target's complementary sequence with essentially half of each of the complementary up- and downstream ΔG values of respective sequences. Suitably, the choice of targets on both coding and complementary DNA simultaneously shift the equilibrium from homologous DNA-helix re-formation towards heterologous hybrid formation. Suitably, the equilibrium of the hybridisation process is pulled away from self-hybridisation by the combined ΔG towards the full target plus stem sequences.

[0019] In another embodiment, there is provided an array of oligo-nucleotides or nucleic acid probes in accordance with the invention where the sequences hybridising to targets are DNA and the nucleotides forming the stem are DNA-analogues. In one embodiment, oligo-nucleotides or nucleic acid probes according to the invention are provided in which each alternating flanking sequence caries either an energizer (type-a probe) or a molecule capable of energy resonance transfer. Suitably the primary exciting energy is generated by light wave or low energy nuclide decay. In one embodiment, efficient energy (resonance) transfer is only possible in presence of the target providing ultimate proximity to each other and effectively emitting detectable photons. Suitably, the type-a probe carries at least one fluorescent moiety with a large Stokes shift. In one embodiment, the type-a probe carries at least one fluorescent moiety with a large Stokes shift with a fluorescence emission lasting up to milliseconds. Suitably the type-b probe carries at least one fluorophore with an excitation maximum coinciding with the emission maximum of type a probe. In one embodiment, the amount of photons emitted allows direct quantification via standards constructed under any of the previous claims, enabling automated reading and molar quantification. In one embodiment, the quantification provides means to determine a viral load both in a sample and at the cellular level.

[0020] In another embodiment, the invention provides an array of oligo-nucleotides or nucleic acid probes in accordance with the invention where the flanking regions are shortened by the use of non-nucleic acid spacer arms to form covalent crosslinks to achieve FRET enabling conditions. Other suitable systems used in nucleic acid hybridization assays are enzyme labelled systems including biotin-avidin system.

[0021] Suitably, the nucleic acid sequence in accordance with the invention may be constructed from ribonucleotides, ribonucleotide analogues, deoxyribonucleotides and / or deoxyribonucleotide analogues or combinations thereof.

[0022] In one embodiment, a nucleic acid probe, array of oligo-nucleotides or composition in accordance with the invention is directed towards transcription products of genes of diagnostic relevance.

[0023] In one embodiment, nucleic probe sequences may be chosen to provide at least one pair of probe types limited only by total target length or economic reasonableness.

[0024] Suitably, probe sequences may be applied in a non-disruptive assay, not compromising standard histological staining and reading procedures.

[0025] The invention further provides any diagnostic kit for the detection of DNA and RNA comprising probe sequences in accordance with the invention.

[0026] Suitable samples for using in the context of the present invention include biopsy samples, sections, and other biological material such as sputum, blood, urine, or other body fluids.

[0027] Suitably, the present invention may be used for the detection of any nucleic acids in cells from any kingdom.

[0028] In another embodiment, the present invention may be used to detect presence or absence of spoilants or contaminants in processed food and beverages In another embodiment, the present invention may be used to detect presence or absence of nucleic acids in environmental samples including but not limited to soil, dirt, dust and water.

[0029] Other embodiments provide methods for determining the biological status in bacteria, yeasts & moulds, parasites, human and animal tissue with respect to the production of toxins or antibiotic resistance.

[0030] Suitably, nucleic acid probe sequences in accordance with the invention may be labelled to allow automated quantification. In one embodiment, labelling is via a type-b oligo-nucleotide carrying a lanthanide complex. Suitably, bringing the said two types to close proximity generates a concentration dependent signal in presence of a target in an aqueous, i.e. quenching, environment.

[0031] Nucleic acid probe sequences as described herein may be designed at any starting point of any sequence giving an array of predictable sequences as exemplified in the sequences presented in Example 1.

[0032] In another embodiment, the invention provides probe sequences to determine a status quo of any cell of any kingdom.

[0033] Suitably probe sequences are capable of functioning both in native and fixed preparations.

[0034] In one embodiment, probe sequences for the detection of nucleic acids coding the HPV E6 protein are provided.

[0035] Further examples are given using the invention to further differentiate closely related organisms with identical ribosomal RNA sequences by detecting the presence / absence of marker mRNA sequences for microbial resistance or toxin production. Surprisingly it was found that, when applying the ZIP principles to the specific identification of bacteria, it was found that the specificity determined in a BLAST analysis increased by a factor of 10e14. Fig. 4a shows the specificity of a singular probe with an E-value of 0.049 and 4b, using the same specific sequence in combination with two flanking probes designed according to this invention, shows that the E-value increases to 2x10e-17 to 9x10e-20.Figures

[0036] Figure 1 shows an example of probes against HPV protein E6 within pos 1-600. Figure 2 shows an example of probes towards coding and complementary sequences. Figure 3 shows an example of an in-situ concatenated probe assay. Figure 4 shows an example of a ZIP-probe design to identify a microorganism via a specific target in the ribosomal RNA. Figure 4a shows NCBI BLAST for single target, and Figure 4b shows NCBI BLAST for in-situ concatenation probes with respective E-values. Figure 5 shows probes for the identification of rRNA together with mRNA coding for an expression product of diagnostic value. Figure 6 and Figure 7 shows three probes towards ribosomal RNA of E.coli working together under stringent ZIP requirement. Detailed Description of Invention

[0037] The objective of this invention is to enable a robust and rapid in-situ hybridisation assay for the detection DNA and RNA molecules with a target turnaround time of 1 hour. The robustness must enable high inter- and intra-lab reproducibility. Three aspects need to be addressed to shorten the turnaround time and enhance the reproducibility of an assay. The first critical point is the time required to complete the hybridisation. This must be reduced from several hours to several minutes without compromising specificity. The second point is the total number of steps required to produce a result, and thirdly the standardisation in the design of probes. Current assays require time, numerous steps and skilled hands in performing and reading the assays.

[0038] The issues may be addressed by finding ways to move towards a homogeneous assay. The most critical step lies in the differentiation between bound and unbound probes and the generation of a high signal to noise ratio. One obvious way would be to use molecular beacon technology. The major feature in beacon technology lies in the construction of the stem, where the stem opens only in the presence of a cognate target sequence. Un-hybridised sequences return to the thermodynamically favoured hairpin-loop formation in which a potential signal is quenched. Only bound, unfolded beacons will give a signal. The energy liberated in the hybridisation must be larger than the free energy of the hairpin-loop formation. Thus a large amount of free energy is consumed in opening the hairpin-loop structure. A target nucleic acid in-situ is seldom freely available for two dimensional hybridisation with straight forward two step kinetics. DNA and RNA are folded three dimensional molecules, they are not stand alone molecules, but well entwined 3-dimensional (3-D) protein nucleic acid complexes. In order to hybridise these complexes need to be unravelled and ionic conditions must be installed to favour the probe-target complex rather than the indigenous one. The process remains dynamic and competitive in the presence of all reaction partners, as is the case in homogeneous assays. ΔG 3 − Dtarget complex + ΔG Hairpin loop < = = = > − ΔG hairpin loop + ΔG probe / target − ΔG 3 − Dtarget complex

[0039] Therefore, in a successful hybridisation, the energy favouring the return to the start configurations must be overcome by choosing appropriate probe sequences and assay conditions.

[0040] Existing assays shift the equilibrium by changing the ionic environment or washing unbound probes. The current invention is related to designing probes and conditions that will enable, favour, and stabilise the probe / target hybrid. The underlying concept is to use sequences that will hybridise and in-situ to form polymerised probes that can only generate a signal, when successfully in place, i.e. in the hybrid complex. The binding kinetics, i.e. high K on and K off , in this configuration will shift from the fast binding of a plurality of small probes to the slow binding, i.e. slow K on , K off of a very large nucleic acid sequence. ∑ 1 n high k on ; k off for small probes = = > in − situ , one large probe with low k on ; k off kinetics

[0041] It requires time to shift the equilibrium towards the desired hybrid, where the hairpin loop is open and hybridised to the target, open to excitation / emission. Unbound hairpin loops are closed and no signal can be generated.

[0042] The subject matter of this invention is to utilise the free energy otherwise generated in the hairpin loop stem formation, and using this free energy to stabilise the binding of a plurality of probes to the target DNA or RNA. In this invention sequences are chosen, which cause a stem to be formed only in the presence of a target and only when hybridised. The total free energy generated in this configuration is the combined free energy of the hybrid and the stem forming in-situ. The differentiation between bound and unbound probes is achieved by applying FRET technology well described in the art.

[0043] This involves selecting a pair of fluorophores that have the emission wavelength of first fluorophore overlapping with the excitation wavelength of the second and a combined stokes shift as high as possible. A multitude of fluorophores are commercially available fulfilling this criterion. The preferred combinations are lanthanide chelates combined with fluorophores with a sharp emission maximum at 620nm. The most preferred combination is a Europium chelate with an emission maximum at 620nm, combined with a fluorophore being excited at 620nm (+ / -10nm), e.g. Atto 620. The combination requires close proximity, to enable energy resonance transfer. Conditions and sequences need to be chosen and maintained under which the stemsequences of unbound probes do not anneal to generate background noise and thus reduce the sensitivity of the assay.Formation of Zip-probes

[0044] In analogy to click chemistry, where reactions are in "one pot", and are characterised by a high thermodynamic driving force that drives it quickly and irreversibly to high yield of a single reaction product, according to this invention nucleic acid probes are sent inside a cell to hybridise towards respective target sequences. The targets are chosen to be as juxtaposition to each other as possible. The preferred position of neighbouring probes is without an intermediate sequence and most preferred without a spacer nucleotide. It is essential that the thermodynamic characteristics (ΔG) of all probes are designed to be as identical as possible. The standardisation is made according to the overall thermodynamic characteristics. Traditionally in the art the T m value is used to determine the length of a desired NA-sequence. However, here the free energy developed upon hybridisation has proven to be the most helpful parameter, as a sequence with a positive ΔG will not hybridise. The design is made by carefully choosing and adding bases to achieve the desired negative ΔG. For practical reasons one standard temperature must be chosen for all hybridisations. The ΔG of the sequence hybridising to the target should be chosen to be negative at the chosen hybridisation temperature. The preferred ΔG is between-15 and -35 ± 5kcal / mol. The most preferred ΔG was found to be at -26kcal / mol. Furthermore, increasing the stringency of the bandwidth of ΔG allowed, increased the robustness of the overall assay. The most stringent values were designed to be, when the ΔG value is held within ±1.5 kcal / mol.

[0045] The most important aspect of this invention is to add a 5'flanking sequence, strictly nothybridising to any target sequence in the vicinity, especially not to the directly neighbouring 5'-upstream sequences. This is achieved by rigorously swapping the coding sequences in the 5' flanking sequence. All changes will disturb hybridisation. The preferred swap is: A for G; G for T; C for A; T for C. The 3' flanking sequence of the neighbouring probe is made by complementing G with C; T with A; A with T, and C with G with respect to said 5'flanking sequence. This swap to force a mismatch of the 5'flank will also ensure that any sequence used to flank the neighbouring 3' end will also mismatch the target's coding sequence.

[0046] The length of the flanking sequence may be chosen from between one and a plurality of nucleotides. The preferred length is between 5 and 15 nucleotides. The most preferred number of nucleotides is defined by the amount needed to form one helical twist, when brought together with the 3' flanking sequence of the neighbouring 5'-upstream oligonucleotide.

[0047] Moreover, the sequences must be chosen in such a way that mixture of oligonucleotides present in one assay do not hybridise freely with each other under either hybridisation or reading temperatures and their required buffer and salt configurations. Very surprisingly it was found that it is possible to choose sequence that form a helix, having a negative ΔG and a T m -value close to 0°C. The most desirable length is when the ΔG is negative at -4.5 (+ / - 1.5 kcal / mol) and allows one full helical twist. This finding is of importance, because, while the flanking regions enable the forming of one long oligonucleotide multimer, it ensures that reading at room temperature will not allow these flanking sequences to anneal in solution, thus enabling a homogeneous assay. Choosing this design allows the application of FRET technology to generate the signal in a homogeneous assay.

[0048] In such a configuration the ΔG of this helix adds a positive stabilising effect, i.e. it increases the total amount of energy liberated, when one probe thus "zips" in one next to the other. The probe design starts at the 3' end towards the 5' end, i.e. following the coding sequence upstream. The individual probes are constructed 5' to 3'.This process may be elongated along the complete target sequence without limitation in length.

[0049] The teachings of WO 03 / 076655A2 describe the usage of at least two imminently neighbouring probes with stems carrying a fluorophore to the 5'flank of the first probe with a sequence complementary to the 3' stem of the second probe carrying a second fluorophore. In combination, the two fluorophores allow energy transfer. In the described preferred application, molecular beacons are applied; where non-bound hairpin loops emit a signal two to five times lower than the signal of a probe bound to a target due to the quenching fluorophore in the beacon. Using beacons results in the binding of a hairpin loop with a quencher at either the 3' or 5' end of the probe binding to the target. In reality this means that the preferred use of beacons only allows the usage of two beacons to bind to a target in such a way that FRET may be achieved. Furthermore, this is only possible if the quencher on probe #1 carries the quencher on the 5' end and probe #2 carries the quencher on the 3' prime end, as shown in Fig1 of WO 03 / 076655 A2. The overall signal generated therefore cannot be stronger than that of a single beacon. The combined pair of probes carry quencher both on the 3' and 5' end precluding an addition of a further probe as the signal of a third neighbouring beacon would be quenched. Therefore, the usage of beacons rules out the formation of unlimited multimers as described in the present invention. WO 03 / 076655A2 is therefore not suitable for the generation of multimers and therefore for any practical application in a homogeneous assay.

[0050] Disadvantages in the prior art are resolved in the present invention by using hairpin loops strictly using the same fluorophores on both 3' and 5' end of the hairpin loop enabling a homogeneous assay with no washing step required. FRET is achieved by alternating the fluorophores up and down-stream with hairpin loops carrying either fluorophores "A" or "B" on each respective hairpin loop to form FRET-pairs "AB" only when bound to a target (Fig. 1). FRET pairs, well known in the art may be chosen for this application. This represents an in-situ concatenation driven by the design of stem sequences.

[0051] Only in this formation, strictly omitting the usage of quenchers is it possible to form a plurality of hairpin loops bound to a target excerpting the fast kinetics of small hairpin loops and unfolding the full combined thermodynamic advantage of a large sequence binding to a target in-situ. Moreover, only in this formation is it possible to achieve the enhanced sensitivity of having multiple probes binding to one target.

[0052] Furthermore, WO 03 / 076655A2 does not teach how to design stems without cross reactivity. The careful design of stems as described above to avoid malalignments and background noise is an essential part of the present invention and the usage of beacons is precluded. The teachings of US 2005 / 0287548 A1 describes the usage of beacons with shared stems to form FRET-pairs and do not lead to the formation of multimers, because of said preclusion. US 6472156 B1 uses allelic configuration to bring fluorophores into physical vicinity to allow FRET to occur. It does not teach the formation of multimers.

[0053] Surprisingly, when a NCBI BLAST is made for in-situ concatenated probes, constructed according to the present invention, with a specific probe for the identification of a microorganism such as Staphylococcus aureus and neighbouring nonspecific probes in comparison to the respective single specific probe, the E-value drops from <0,05 to <10-15 (Fig. 4a and 4b). This indicates a significant enhancement of the specificity of an in-situ concatenated probe versus a single linear or beacon probe.

[0054] A further aspect of this invention is to add a fluorophore to the 5'flank of the first probe starting at the target's said 3' end and a corresponding fluorophore on the 3'-flank of the second. 5' upstream neighbour. A thermodynamically favoured helix is formed as an uninterrupted stem and will bring both fluorophores into very close proximity to enable FRET to occur. The very close proximity is advantageous, because resonance coupling carries an exponential decay with the distance. Combined with the virtues of time resolved fluorescence, this in-situ pairing enables a homogeneous assay, eliminating auto-and background fluorescence. The fluorophores are attached to the oligonucleotides via a spacer. It is especially advantageous, if a long spacer arm is included, distancing the fluorophores as well as being a dielectric preventing quenching from electron rich, stacking nucleotides.

[0055] In theory these spacer arms could also carry chemically active groups that would allow the application of technologies well known in the art of protein affinity labelling to form crosslinks in situ. This would give a covalent link between the oligonucleotides to form one long covalently liked molecule in-situ. The preferred choice of affinity label would encompass the design of an Azido group on one flank and lysine with a free epsilon amino-group positioned such that a covalent link may be formed by the same wavelength required for the excitation of lanthanide based fluorophore within the assay.

[0056] Any pair of fluorophores described in the art may be chosen. The preferred choice of fluorophore is where energy resonance may be achieved and energy be transferred from one fluorophore to the other. The objective in the choice is to generate the highest possible combined stokes shift and optimised energy transfer. This is only possible where close proximity is achieved to allow (fluorescence) resonance energy transfer (F)RET as described by Förster (Förster Theodor (1948): Intermolecular Energy Migration and Fluorescence. Ann Phys 437: 55-75). Other non-bound fluorophores will be in solution surrounded by water, which will quench the signal from unbound probes. This is a critical component for a timesaving homogeneous assay. The most preferred choice is to use a chelated lanthanide as energy / electron donor and a fluorophore with an excitation wavelength equivalent to the lanthanide's emission wave-length. This combination, with a combined stokes shift of 250 to 300nm, gives a very high signal to noise ratio which can be further enhanced by utilising time-resolved fluorescence technology well known in the art and readily commercially available.

[0057] In the choice of partners in FRET, three conditions need to be fulfilled. First, donor and acceptor should present energy compatibility, i.e., donor emission spectrum and acceptor excitation spectrum should overlap completely. Second, the donor and the acceptor should present compatible orientation. The transfer is maximal when the donor and acceptor transition dipole moments are parallel, and are minimum (equal to 0) when they are perpendicular. The most important factor is that energy transfer can take place only if the two partners are in very close proximity. The efficiency of the transfer is inversely proportional to the sixth power of the distance. E = R 6 / R 6 + r 6

[0058] Where R 0 is the distance corresponding to 50% energy transfer efficiency. For FRET to occur the two partners should be in the range of within 30-60 Å. The objective of constructing this configuration is to utilise the helix formation to provide the close proximity and maximise FRET efficiency with highest possible signal to noise ratio.

[0059] Many fluorophore combinations are described in the art, which may enable FRET. Because of the emission peak around 490 nm, Terbium-cryptate is an option and is compatible with fluorescein-like fluorophores as an acceptor. The especially preferred lanthanide is Europium, which is excited at 335nm. It exhibits a large Stoke shift with major a emission peak at 615 -620 nm. Europium also has a time of photon emission particularly suitable for time resolved fluorescence. This makes europium chelates compatible with deep red fluorophores the most preferred choice of fluorphores to perform FRET.

[0060] In using the said fluorophore partners in said assay formation the formed helix will bring the two partners within the required range for FRET. Other non-bound probes will be too far apart and be quenched by the aqueous environment of a homogeneous assay.

[0061] A further aspect in the design of such electron and energy rich fluorophores. The excited energy may be dissipated to other energy rich components such as nucleotides, especially Guanidine. They need to be separated by a dielectric. This is achieved by choosing a spacer arm for the chelate, sufficient to suppress the dissipation of energy, i.e. quench. The spacer design may also be made to incorporate a cross-link between the two partnering spacer arm using said affinity label techniques. Proximity might be achieved in many ways with the help of DNA probes. A long spacer arms may be added with said cross linking reagents, without help of the stem. However, the stem was chosen to enhance the kinetic performance under hybridisation conditions and simplify the probe construction.

[0062] The crosslinking in turn polymerises the short probes in-situ to rapidly form one large hybridising molecule with now changed kinetic properties. ∑ 1 n high k on ; k off small probes = = > in − situ , one large probe with low k on ; k off kinetics Effectively, one large NA-multimer is formed by concatenation in-situ, and only in the presence of a cognate sequence, which now binds to the target with increasing intensity. As the strand grows in length, the free energy generated by the multimer will be increasingly more negative ΔG and have higher T m than the individual small oligonucleotides. The hybrid will stabilize and not dissociate, providing the robustness required for a routine assay. In summary the kinetics may be described as ∑ 1 n high k on ; of small probes ==> in-situ, one large probe with low k off kinetics

[0063] Such an assay design combines the speed of small oligonucleotide hybridisation with sensitivity and specificity of large nucleotide probes or cosmids.

[0064] The same principles may be used to develop probes towards messenger RNA of sequences of interest. As the thermodynamic characteristics in the binding between RNA and DNA differ from DNA / DNA hybrids, the sequences for the mRNA detection will be shorter in order to work under identical assay conditions. This will allow the efficient development of commercial assays, all working under identical conditions. Moreover it will allow the simultaneous detection of a given DNA sequence with its expression product in the same cell.

[0065] A further aspect in reducing hybridisation time and simultaneously doubling the signal strength is to present probes towards the DNA sequence complementary to the target, i.e. to the cDNA. This would normally be a self-defeating approach as probes to the cDNA would hybridise with probes to the original target sequence, annihilating the initial objective. However, this may be avoided by introducing a "phase shift". The over-lap between two probes addressing complementary DNA and cDNA targets are only allowed to have 50% over-lap with respect to their ΔG values. When stringently applied, this will render the binding between said probes thermodynamically far inferior to any full sequential match, thus making this approach viable.

[0066] Therefore, when trying to detect DNA and cDNA together to enhance sensitivity the following needs to be considered. In order to prevent probes targeted to primary DNA target and those targeted towards the complementary sequence self-hybridising fortuitously the target and complementary targets must overlap to a maximum with the next downstream sequence. This requirement determines the sequences of the complementary sequence. Furthermore the overlap needs to be measured in ΔG as sheer numbers generates a shift and cause biases which could lead to self-hybridisation. Effectively this would take probes out of the equilibrium and reduce the hybridisation efficiency and thus slow down the whole assay.

[0067] Removing the cDNA out of the equilibrium will additionally favour the hybrid formation over the re-formation of the original helical DNA, speed and stabilise the system.

[0068] A further aspect of the design is to combine the virtues of DNA and DNA analogues. Lacking the charged phosphate backbone, DNA-analogues are poorly soluble in an aqueous environment. Effectively their length is limited to 12-15-mers. Using DNA for the target sequences, combined with DNA-analogues for the stem forming sequence will maintain the solubility, while easing the passage across membranes. This may not only speed the membrane passage and thus the assay but also reduce unspecific binding to membranes. Moreover, the DNA-analogues have a more negative ΔG and will increase the free energy liberated upon binding. "and / or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example "A and / or B" is to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually herein.

[0069] By concatenating, it is meant that DNA fragments are joined at the end of another DNA fragment. "Concatenating" as used in the present invention describes nucleic acid probes that can concatenate with at least another neighbouring probe to form a multimer. Advantageously, as the strand grows in length, the free energy generated by the multimer will be increasingly more negative (ΔG) and the strand will have higher T m than the individual small oligonucleotides.

[0070] Unless context dictates otherwise, the descriptions and definitions of the features set out above are not limited to any particular aspect or embodiment of the invention and apply equally to all aspects and embodiments which are described.

[0071] Certain aspects and embodiments of the invention will now be illustrated by way of example and with reference to the figures described above.Examples

[0072] a. Probe design: The thermodynamic values are calculate using the tool provided by The DINAMelt Web Server: http: / / unafold.rna.albany.edu / ?q=DINAMelt / Two-state-melting, entering standard hybridisation conditions and the temperature of choice. The hybridisation temperature chosen was 50°C and corrected for any urea entered to the assay. Salt and Mg concentrations were standardised to be 25mM NaCl and 10mM divalent metal salts.. b. The example chosen here is to demonstrate an assay to detect DNA from HPV E6 protein. The following probe sequences is an example, starting arbitrarily at position 61 of the published sequence. Designing a set of probes, starting at any other position follow the teachings presented here will result in a highly predictable sequences. Sequence samples and their respective thermodynamic values are in the attached file, Figure 1. Figure 1 shows an example of probes against HPV protein E6 within positions 1-600. Also, Figure 2 shows an example of probes towards coding and complementary sequences. c. A further example chosen is to demonstrate the usefulness of this invention is in the design of a ZIP-probe to identify a microorganism via a specific target in the ribosomal RNA with enhanced specificity, (Fig 4a,b). d. Assay procedure i. Sample preparation: The sample preparation follows all well established procedures known in art described for ISH procedures, and calls for no deviation from the procedure, be it smears, swabs, sputum, section, and paraffin embedded sections with one exception. As well known in the art, when probes towards Gram positive cells are applied, the cell wall needs to be digested with a lysis mixture comprising proteolytic enzymes such as but not limited to Lysozyme and / or Lysostaphin to enable said probes to enter the cytoplasm. ii. Full assay (a) 1. Dip in EtOH bath for 5min 2. Place on hot (50°C) plate until dry 3. Add hybridisation mix, sufficient to cover tissue 4. Close lid and hybridise for 10 min 5. Briefly dip in stop solution (hybridisation buffer without probes at RT for 1 min 6. Dip in EtOH 7. Dry on hot plate (50°C) 8. Read under fluorescent microscope, time resolved fluorescence devices iii. Full assay (b) 1. Apply 10µl sample to each field on a microscopic slide and dry on a hot (50°C) plate 2. For probes towards Gram negative organisms place 10µl lysis mix and dry on the hot plate 3. Dip in EtOH bath for 5min 4. Place on hot (50°C) plate until dry 5. Add 10µl hybridisation mix, or for sections sufficient to cover tissue 6. Close lid and hybridise for 10 min 7. Briefly dip in stop solution (hybridisation buffer without probes and formamide with 50% ethanol) at ambient temperature for 1 min. 8. Dip briefly in Ethanol (EtOH) 9. Dry on hot plate (50°C) 10. Read under fluorescent microscope e) Results

[0073] Three Zip probes (SEQ ID NO: 117, 118 and 119) identified to hybridise the DNA sequence: AGCGTGCCTTCTCCCGAGAT ATG TAG GTG AAG CGA CTTGCTCCTTCGACTGATTT CAGCTCCAC (SEQ ID NO: 120) specific for the E.coli ribosomal RNA were constructed according to the present invention. Samples were analysed according to the full assay (step diii(b)). Ribosomal rich regions within the cell show a bright green fluorescence under fluorescent microscope. Figure 6 and Figure 7 illustrate the ribosomal rich regions identified by the bright grey fluorescence, showing the three probes (SEQ ID NO: 117, 118 and 119) towards ribosomal RNA of E.coli working together under the stringent ZIP requirements. Table 1: Sequences illustrated in Figures 1-5 Sequence IDSequence nameSequenceSEQ ID NO 1Probe Sequence 3SEQ ID NO 2DNA Target Sequence 3SEQ ID NO 3Probe Sequence 4SEQ ID NO 4DNA Target Sequence 4SEQ ID NO 5Probe Sequence 5SEQ ID NO 6DNA Target Sequence 5SEQ ID NO 7Probe Sequence 6SEQ ID NO 8DNA Target Sequence 6SEQ ID NO 9Probe Sequence 7SEQ ID NO 10DNA Target Sequence 7SEQ ID NO 11Probe Sequence 8SEQ ID NO 12DNA Target Sequence 8SEQ ID NO 13Probe Sequence 9SEQ ID NO 14DNA Target Sequence 9SEQ ID NO 15Probe 3gSEQ ID NO 16Probe 4dSEQ ID NO 17Probe 5eSEQ ID NO 18Probe 6jSEQ ID NO 19Probe 7fSEQ ID NO 20Probe 8cSEQ ID NO 21Probe 9dSEQ ID NO 22Probe Sequence 10catttatcac atacagcatSEQ ID NO 23DNA Target Sequence 10atgctgtatg tgataaatgSEQ ID NO 24Probe Sequence c1bSEQ ID NO 25DNA Target Sequence c1bSEQ ID NO 26Probe Sequence c2bSEQ ID NO 27DNA Target Sequence c2bSEQ ID NO 28Probe Sequence c3bSEQ ID NO 29DNA Target Sequence c3bSEQ ID NO 30Probe Sequence c4bSEQ ID NO 31DNA Target Sequence c4bSEQ ID NO 32Probe Sequence c5bSEQ ID NO 33DNA Target Sequence c5bSEQ ID NO 34Probe Sequence c6bSEQ ID NO 35DNA Target Sequence c6bSEQ ID NO 36Probe Sequence c7bSEQ ID NO 37DNA Target Sequence c7bSEQ ID NO 38Half Target 3atagtataaaa gcag acaSEQ ID NO 39Half Probe 3a'tgtctgcttt ta tactaSEQ ID NO 40Half Target 3bttttatgcac caaaagaSEQ ID NO 41Half Probe 3b'tcttttggtg cataaaaSEQ ID NO 42Half Target 4agaactgcaat gtttcaSEQ ID NO 43Half Probe 4a'tgaaacattg cagttcSEQ ID NO 44Half Target 4bggacccacag gaSEQ ID NO 45Half Probe 4b'tcctgtgggt ccSEQ ID NO 46Half Target 5agcgacccaga aaSEQ ID NO 47Half Probe 5a'tttctgggtc gcSEQ ID NO 48Half Target 5bgttaccacag ttatgcSEQ ID NO 49Half Probe 5b'gcataactgt ggtaacSEQ ID NO 50Half Target 6aacagagctgc aaacSEQ ID NO 51Half Probe 6a'gtttgcagct ctgtSEQ ID NO 52Half Target 6baactatacat gatataatat tSEQ ID NO 53Half Probe 6b'aatattatat catgtatagttSEQ ID NO 54Half Target 7aagaatgtgtg tactgSEQ ID NO 55Half Probe 7a'cagtacacac attcSEQ ID NO 56Half Target 7bcaagcaacag ttactgSEQ ID NO 57Half Probe 7b'cagtaactgt tgcttgSEQ ID NO 58Half Target 8acgacgtgagg tataSEQ ID NO 59Half Probe 8a'tatacctcac gtcgSEQ ID NO 60Half Target 8btgactttgct tttcgSEQ ID NO 61Half Probe 8b'cgaaaagcaa agtcaSEQ ID NO 62Half Target 9aggatttatgc atagtataSEQ ID NO 63Half Probe 9a'tatactatgc ataaatccSEQ ID NO 64Half Target 9btagagatggg aatccatSEQ ID NO 65Half Probe 9b'atggattccc atctctaSEQ ID NO 66Half Target 10aatgctgtatg tgataaatSEQ ID NO 67Resulting cDNA Target (3b+4a)SEQ ID NO 68Resulting cDNA Probe 7'SEQ ID NO 69Resulting cDNA Target (4b+5a)ggacccacag gagcgaccca gaaaSEQ ID NO 70Resulting cDNA Probe 6'tttctgggtc gctcctgtgg gtccSEQ ID NO 71Resulting cDNA Target (5b+6a)SEQ ID NO 72Resulting cDNA Probe 5'SEQ ID NO 73Resulting cDNA Target (6b+7a)SEQ ID NO 74Resulting cDNA Probe 4'SEQ ID NO 75Resulting cDNA Target (7b+8a)SEQ ID NO 76Resulting cDNA Probe 3'SEQ ID NO 77Resulting cDNA Target (8b+9a)SEQ ID NO 78Resulting cDNA Probe 2'SEQ ID NO 79Resulting cDNA Target (9b+10a)SEQ ID NO 80Resulting cDNA Probe 1'SEQ ID NO 81Resulting cDNA Probes 7' with helping stemsSEQ ID NO 82Resulting cDNA Probes 6' with helping stemsSEQ ID NO 83Resulting cDNA Probes 5' with helping stemsSEQ ID NO 84Resulting cDNA Probes 4' with helping stemsSEQ ID NO 85Resulting cDNA Probes 3' with helping stemsSEQ ID NO 86Resulting cDNA Probes 2' with helping stemsSEQ ID NO 87Resulting cDNA Probes 1' with helping stemsSEQ ID NO 88Staaur Probe Sequencegcaagcttct cgtccgttcg cSEQ ID NO 89Staaur Target Sequencegcgaacggac gagaagcttg cSEQ ID NO 90β-lactamase gene TEM-1 #1 targetugcugcaacu uuauccgccu ccSEQ ID NO 91β-lactamase gene TEM-1 #1 probe with stemSEQ ID NO 92β-lactamase gene TEM-1 #2 targetauccagucua uuaauuguug ccgggSEQ ID NO 93β-lactamase gene TEM-1 #2 probe with stemSEQ ID NO 94β-lactamase gene TEM-1 #3 targetaagcuagagu aaguaguucg ccagSEQ ID NO 95β-lactamase gene TEM-1 #3 probe with stemSEQ ID NO 96β-lactamase gene TEM-1 #4 targetuuaauaguuu gcgcaacguu guugccSEQ ID NO 97β-lactamase gene TEM-1 #4 probe with stemSEQ ID NO 98β-lactamase gene TEM-1 #5 targetauugcugcag gcaucguggu gSEQ ID NO 99β-lactamase gene TEM-1 #5 probe with stemSEQ ID NO 100β-lactamase gene TEM-1 #6 targetucacgcucgu cguuugguau ggSEQ ID NO 101β-lactamase gene TEM-1 #6 probe with stemSEQ ID NO 102β-lactamase gene TEM-1 #7 targetcuucauucag cuccgguucc caSEQ ID NO 103β-lactamase gene TEM-1 #7 probe with stemSEQ ID NO 104β-lactamase gene TEM-1 #8 targetacgaucaagg cgaguuacau gaucSEQ ID NO 105β-lactamase gene TEM-1 #8 probe with stemSEQ ID NO 106β-lactamase gene TEM-1 #9 targetccccauguug ugcaaaaaag cggSEQ ID NO 107β-lactamase gene TEM-1 #9 probe with stemSEQ ID NO 108β-lactamase gene TEM-1 #10 targetuuagcuccuu cgguccuccgSEQ ID NO 109β-lactamase gene TEM-1 #10 probe with stemSEQ ID NO 110Probe c1SEQ ID NO 111Probe c2SEQ ID NO 112Probe c3SEQ ID NO 113Probe c4SEQ ID NO 114Probe c5SEQ ID NO 115Probe c6SEQ ID NO 116Probe c7SEQ ID NO 117E. coli probe 5'-1 with stem: Atto-465SEQ ID NO 118E. coli probe with stem: Atto-514SEQ ID NO 119E. coli probe 3'+1 with stem: Atto-465SEQ ID NO 120Sequence specific for E.coli ribosomal RNA

Claims

1. A multiplicity of non-beacon, hairpin loop forming nucleic acid probes capable of forming a concatenated hybrid in-situ with a target nucleic acid sequence, said nucleic acid probe comprising: a nucleic acid sequence complementary to the target nucleic acid sequence; a 5' flanking sequence comprising a first detection moiety, and a 3' flanking sequence comprising a second detection moiety; wherein the first detection moiety and the second detection moiety on a single nucleic acid probe are the same and are fluorophores; wherein said nucleic acid probes are capable of concatenating forming a multimer in-situ with at least another neighbouring nucleic acid probe such that, when the nucleic acid sequence is bound to the target sequence, the hairpin loop is open and the 5' flanking sequence of the nucleic probe interlinks with at least part of the 3' flanking sequence of a neighbouring probe to form a stem such that the first and second detection moieties of a stem interact to generate a FRET signal; wherein the 5' and 3' flanking stem sequences do not hybridise with the target nucleic acid sequence; wherein the nucleic acid sequences complementary to the target nucleic acid sequence hybridise to the target nucleic acid sequence with only one common ΔG + / - 2 kcal / mol under the defined hybridisation conditions; and wherein the mixture of oligonucleotides present in one assay do not hybridise freely with each other under either hybridisation or reading temperatures and their required buffer and salt configurations.

2. A multiplicity of nucleic acid probes according to claim 1, wherein the stem formed by the 5' and 3' flanking sequences may form heteroduplexes to other probes present and have a significantly less negative ΔG and a Tm-value below the hybridisation temperature with respect to the hybridisation target.

3. A multiplicity of nucleic acid probes according to any of the preceding claims, wherein the designed probes comprising nucleic acid sequences complementary to the target nucleic acid sequence comprise ribonucleotides, ribonucleotide analogues, deoxyribonucleotides and / or deoxyribonucleotide analogues or combinations thereof.

4. A multiplicity of nucleic acid probes according to any of the preceding claims, wherein the nucleic acid sequence complementary to the target nucleic acid sequence is DNA and the 5' and 3' flanking sequences comprise DNA-analogues.

5. A multiplicity of nucleic acid probes according to any of the preceding claims, wherein the target nucleic acid sequence is DNA or RNA.

6. A multiplicity of nucleic acid probes according to any of the preceding claims, wherein said first detection moiety of a stem is an energizer (type-a probe) and said second detection moiety of a stem is a molecule capable of energy resonance transfer (type-b probe); or wherein said first detection moiety of a stem is a molecule capable of energy resonance transfer (type-b probe) and said second detection moiety of a stem is an energizer (type-a probe).

7. A composition comprising a multiplicity of nucleic acid probes as claimed in any of the preceding claims.

8. A composition as claimed in claim 7, wherein ΔG is <0 kcal / mol at the chosen hybridisation temperature, in particular wherein ΔG is between-15 and -35 ± 5kcal / mol, more particularly ΔG is between -24 and -30.

9. A composition as claimed in either of claims 7 or 8, wherein efficient energy resonance transfer is only possible in presence of the target nucleic acid sequence where said first and second detection moieties are in proximity to each other and effectively emit detectable photons.

10. A composition as claimed in claim 9, wherein the amount of photons emitted allows direct quantification enabling automated reading and molar quantification, optionally wherein said quantification provides means to determine a viral load both in a sample and at the cellular level.

11. A composition as claimed in any of claims 7-10, comprising an essentially seamless array of probes carrying identical fluorophores on both 5' and 3' ends, where neighbouring probes alternate to carry fluorophore A on one, fluorophore B on the second, fluorophore A on the third, fluorophore B on the forth and multiples thereof, where a FRET dependant signal is only generated when A / B pairs form.

12. A composition as claimed in any of claims 7-11, wherein the multiplicity of probes comprises probes to DNA and mRNA.

13. A composition as claimed in any of claims 7-12, wherein the multiplicity of probes comprises probes to DNA and cDNA, in particular where the probes are capable of hybridising simultaneously to the coding and complementary DNA-sequences of interest.

14. A composition as claimed in claim 13, wherein nucleic acid probes towards DNA and complementary DNA are prevented from self-hybridising in-situ, in particular wherein the over-lap between two probes addressing complementary DNA and cDNA targets have no more than 50% over-lap with respect to their ΔG values.

15. An in-situ hybridisation method comprising: (a) contacting a multiplicity of nucleic acid probes as claimed in any of claims 1-6 or a composition of nucleic acid probes of any of claims 7-14 with a biological sample; (b) hybridising the nucleic acid probes of (a) with the sample; (c) inducing conditions which allow for stem formation between neighbouring probes and favour stabilisation of the probe / target hybrid complex, wherein the stem allows interaction of the detection moieties.

16. A method as claimed in claim 15, wherein the probe sequences are applied in a non-disruptive assay.

17. A method as claimed in claim 15 or 16, wherein the method is a homogeneous assay.

18. Use of a multiplicity of nucleic acid probes as claimed in any of claims 1-6 or a composition of any of claims 7-14, in the method as claimed in any of claims 15 to 17 to identify the presence or absence of one or a plurality of organisms within a biological sample.

19. Use as claimed in claim 18, wherein the use is diagnostic use.

20. Use as claimed in claim 18 or 19, wherein the organism is a virus, e.g. HPV, in particular where nucleic acids coding the HPV E6 protein or the HPV E4 protein are detected.

21. A kit for the detection of a target nucleic acid, said kit comprising a multiplicity of nucleic acid probes as claimed in any of claims 1-6 or a composition of nucleic acid probes as claimed in any of claims 7-14.