Enzyme substrate for the detection of shiga toxin
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-05-03
- Publication Date
- 2026-03-11
AI Technical Summary
Current methods for detecting Shiga toxin-producing Escherichia coli (STEC) are complex, costly, and require specialized equipment, limiting timely and sensitive detection, especially in primary diagnostic laboratories.
Development of a single-stranded oligonucleotide with a sarcin-ricin loop nucleotide sequence and a cleavage-dependent label that forms loop or stem-loop structures, allowing for the detection of Shiga toxin activity through enzymatic reaction, enabling simple and cost-effective detection in both human and veterinary sectors.
The method allows for rapid and specific detection of Shiga toxin-producing STEC strains within 30 to 60 minutes, reducing the complexity and cost of current detection methods, and can be used in agar-based assays for improved monitoring and research.
Smart Images

Figure IMGF000045_0001 
Figure IMGF000045_0002 
Figure IMGF000018_0001
Abstract
Description
[0001] ENZYME SUBSTRATE FOR THE DETECTION OF SHIGATOXIN
[0002] DESCRIPTION
[0003] The invention lies in the field of biochemistry, molecular diagnostics and the determination of bacterial toxins.
[0004] The invention relates to an oligonucleotide comprising a) a nucleotide sequence of a sarcin-ricin loop (SRL) of a eukaryotic / mammalian 60S ribosomal subunit, wherein the SRL nucleotide sequence comprises at least one adenine, and b) at least one cleavage-dependent label, wherein the oligonucleotide is single-stranded. Preferably, the oligonucleotide forms at least one loop or stem-loop structure.
[0005] In a further aspect, the invention relates to a method for detecting an active Shiga toxin in a sample, comprising the steps of: a) providing at least one oligonucleotide according to the invention, b) providing a sample to be tested for Shiga toxin, c) incubating the sample with the at least one single-stranded oligonucleotide, d) detecting a signal of a label, wherein a signal is indicative of the presence of a Shiga toxin in the sample.
[0006] The invention also comprises a kit containing at least one oligonucleotide according to the invention with the necessary reagents for toxin detection described here.
[0007] BACKGROUND AND STATE OF THE ART
[0008] The species Escherichia coli has been described both as a component of the intestinal flora and as a pathogen. The latter includes the pathovar of Shigatoxigenic E. coli (STEC) and enterohemorrhagic E. coli (EHEC). The term STEC will be used below, which also includes EHEC. These bacteria possess a number of virulence factors, particularly the Shiga-like toxin Stx, and can thus cause diarrhea, bloody diarrhea, or other very serious illnesses such as hemolytic uremic syndrome (HUS). In Germany, the number of cases has increased in recent years, and in 2017, there were approximately 2,000 reported cases of STEC and approximately 100 cases of life-threatening hemolytic uremic syndrome (HUS). Children up to the age of five are particularly affected by the infections (RKI 2016, 2017; Kaper et al., 2004; Croxen et al., 2013).
[0009] STEC are important zoonotic pathogens that are found primarily in association with animals (especially ruminants) and corresponding foods such as meat and milk, but also in plant products (Croxen et al., 2013; Persad and Lejeune, 2014; Garcia et al., 2010). By causing large outbreaks, such as in 2011, and by contamination of food and the subsequent recall from the market, STEC results in very high socio-economic and economic costs (Frank et al., 2011; Karch et al. 2010; COMMISSION Staff Working Document, 2011). The timely and qualified detection of such pathogens in humans, food, and animals is therefore of great importance. However, this is increasingly carried out using molecular techniques (e.g. PCR) and without subsequent pathogen isolation. In order to differentiate STEC from other E. coli strains (e.g.those of the intestinal flora) and, on the other hand, to ensure a clear assignment of virulence markers, such as Stx, to the corresponding E. coli clone, and further phylogenetic analyses for disease cluster and source identification, the isolation from stool or food matrices plays a prominent role (Flieger et al., 2013).
[0010] However, isolate extraction is becoming increasingly problematic, as it is often not required in primary diagnostic laboratories for diagnosis in medical practice, and molecular biological methods are increasingly being used directly on primary material (stool, food) without subsequent isolation of the pathogen (Flieger et al., 2013; Fruth et al., 2016; FDA, 1995). Another problem is that the methods currently used for pathogen isolation (including in human, food, and veterinary reference laboratories) are very complex. After enrichment culture and single colony plating, dozens of colonies must usually be tested for the stx gene using PCR or dot blot. Alternatively, the equally complex immunodetection of Stx (colony immunoblot, whose commercial distribution was discontinued in 2015) or Vero cell culture assays (Hull et al., 1993, Wang et al., 2016) and the detection of E.coli of serogroup 0157 due to metabolic peculiarities (lack of sorbitol fermentation and beta-glucuronidase activity). However, only approximately 10% of STEC infections are caused by this serogroup (Fruth et al., 2015; RKI 2016, 2017). Even newer agar media (CHROM(c)STEC and similar) cannot comprehensively detect STEC, as they rely, for example, on the pathogens' resistance to telluride, which only approximately 40% of pathogens possess (Käse et al., 2015). Although further test methods have been published, they do not currently represent a technical breakthrough, as they are based on the use of very complex analysis techniques (e.g., proteome analysis by matrix-assisted laser desorption ionization (MALDI) - time of flight tandem mass spectrometry) involving expensive analysis equipment that is only available in a few specialized laboratories (e.g., Fagerquist et al., 2014).
[0011] Consequently, STEC are important zoonotic pathogens that occur in association with animals and food. Furthermore, these pathogens cause large outbreaks and high economic costs through food contamination and subsequent product recalls. Therefore, the timely and qualified detection of such pathogens in humans, food, and animals is of utmost importance.
[0012] Isolate extraction is essential for further analysis of the pathogens, particularly for elucidating infection chains and sources. However, it is increasingly becoming a major problem, as currently used methods are very complex and costly, requiring the use of sophisticated equipment such as mass spectrometry (Basu et al., 2015; Brigotti et al., 2007; Li et al., 2017). Furthermore, due to the diversity of STEC (serogroups, metabolic properties, resistance), the combination of different diagnostic methods is necessary, and the use of individual tests based on markers not consistently present in STEC is often inconclusive. However, Stx is present in all STEC and is detected either by PCR via the stx gene or directly by ELISA.Current diagnostics are limited by the lack of information from these assays regarding the actual enzymatic activity, which is largely responsible for the harmful properties of Stx. Brigotti et al. (2001) found, by measuring released adenine, that Shiga toxin 1 (Stx1) can damage single-stranded DNA through depurination. Roday et al. (2007) investigated the activity of ricin and reported the catalytic ability of the ricin toxin A chain (RTA) to generate an abasic site in a 14-mer stem-tetraloop RNA. EP1241267A3 describes a multi-step assay for the detection of the ribosome-inactivating protein (RIP) mistletoe lectin using hybrid DNA-RNA constructs. Wang et al., 2016, described an antibody-based LFIA immunoassay for the detection of E. coli strain O157:H7. None of these documents describe the method, oligonucleotides, or their sequences of the present invention.
[0013] The availability of a simple and cost-effective method that can sensitively and reliably detect Shiga toxins and / or STEC would therefore be a significant advance in the human, food and veterinary sectors.
[0014] SUMMARY OF THE INVENTION
[0015] The object of the invention is achieved by the features of the independent claims. Advantageous embodiments of the invention are described in the dependent claims.
[0016] In a preferred embodiment, the invention relates to an oligonucleotide comprising a) a nucleotide sequence of a sarcin-ricin loop (SRL) of a eukaryotic / mammalian 60S ribosomal subunit, wherein the SRL nucleotide sequence comprises at least one adenine, and b) at least one cleavage-dependent label, wherein the oligonucleotide is single-stranded.
[0017] Preferably, the oligonucleotide forms at least one loop or stem-loop structure.
[0018] In a further preferred embodiment, the invention relates to a method for detecting an active Shiga toxin in a sample comprising the steps of: a) providing at least one single-stranded oligonucleotide according to the present invention, b) providing a sample to be tested for Shiga toxin, c) incubating the sample with the at least one single-stranded oligonucleotide, d) detecting a signal from a label, wherein a signal is indicative of the presence of a Shiga toxin (and optionally a Shiga toxin-producing pathogen) in the sample.
[0019] In embodiments, step d) comprises detecting a signal from a label (e.g., fluorescence signal), wherein a signal (e.g., fluorescence signal) is indicative of the presence of a Shiga toxin (and optionally a Shiga toxin-producing pathogen) in the sample.
[0020] All embodiments, advantages, and features described below relate, unless explicitly excluded or explicitly stated otherwise, to the oligonucleotide according to the invention, its use, the kit according to the invention, and the method according to the invention. The generic term STEC is used below, which also includes EHEC. STEC are important pathogens that cause diseases in humans ranging from diarrhea to severe hemolytic uremic syndrome (HUS). STEC occur in animals and food and can cause large outbreaks in humans, which are associated with high economic costs. The timely and qualified detection of STEC, including the isolation of isolates from patients, animals, and food, remains of great importance, but is also difficult and labor-intensive.One of the inventors' goals was to solve this problem and develop a detection method for STEC. This method should preferably be based on the detection of the enzymatic activity of Shiga toxins (Stx) in vitro. In addition to being easy to use and inexpensive, the detection method should also detect STEC sensitively and reliably. To this end, the inventors adapted the standard cultivation of STEC samples used in diagnostics and research. Starting with these samples, the detection method was gradually developed further by using the measured Stx activity of the culture supernatants to optimize the SRL substrates and reaction conditions for a more specific reaction with stronger fluorescence signals.
[0021] The availability of a reliable detection method for the identification of STEC, such as the method according to the invention, is therefore an enormous step forward.
[0022] STEC are a heterogeneous group with a high variation in marker genes, but Shiga toxin (STX; Stx) is present in all STEC. Stx possesses RNA-A / -glycosidase enzyme activity that attacks ribosomes (Bergan et al., 2012). Ribosomes are composed of two subunits (60S and 40S), which consist largely of ribosomal RNA (rRNA). Within the 60S unit is a specialized structure, the sarcin ricin loop (SRL). The SRL is recognized by Stx via a recognition sequence, and a specific base (adenine) is depurinated, i.e., cleaved off, by the enzymatic activity of the Shiga toxin (Menge, 2020).
[0023] For this reason, the inventors have developed a detection method based on the catalytic activity of Shiga toxin (Stx).
[0024] For the reasons mentioned above, the availability of a simple method and the potential use of an agar-based method for the identification of sfx-positive E. coli colonies represents a significant advance that can significantly improve the analysis of STEC in both human and food and veterinary medicine.
[0025] Consequently, the invention provides a new enzyme activity-based assay, which can also be performed on an agar basis, that significantly simplifies the currently complex initial detection of Stx-positive E. coli in human, food, and veterinary applications. The new test facilitates the implementation of screening programs, thus significantly simplifying and expanding the scope of monitoring and research tasks (e.g., for a deeper understanding of infection / colonization of animals and humans, including transmission and contamination of various foods) in the zoonosis and One Health fields, which are generally based on the isolation and subsequent characterization of the pathogen. Furthermore, the method according to the invention offers a major advantage in embodiments for simple isolation / detection of the pathogen as a basis for the work.The invention described herein can fundamentally improve STEC detection in all areas of zoonosis and One Health research.
[0026] For this purpose, various clinical STEC strains were analyzed, and the functionality of the method according to the invention was validated for their detection. Several fluorescently labeled Stx oligonucleotide substrates were developed, the reaction conditions of the method according to the invention were optimized, and its specificity was validated.
[0027] Figures 4 and 5 illustrate the principle of an exemplary embodiment of the detection method according to the invention for determining the Stx activity of STEC samples.
[0028] During development, the STEC strains were first cultivated in liquid medium, and then the culture supernatant containing the Stx produced by STEC was collected. Detection of Stx activity was based on the enzymatic activity of Shiga toxin. The natural substrate (SRL) of Stx is located within the ribosomes. Stx depurinates SRL within the ribosomes, thus blocking translation. However, the use of ribosomes to detect Stx activity in vitro makes the detection assay complex / complicated, so a synthetic, DNA-based SRL substrate was designed. To measure Stx activity, the SRL substrate was coupled with a fluorophore / quencher pair as a label in a first embodiment.Diluted in the reaction mix and mixed with the culture supernatant for detection, two possible results can occur in this embodiment: One or no fluorescence signal is detected in the detection device. If no Stx is present in the culture supernatant, SRL remains intact, so that the fluorophore and quencher are in close proximity. The fluorescent signal of the fluorophore is absorbed by the quencher, whereby no signal can be detected. If active Stx is present, the SRL is depurinated at the specific adenine. In addition, a strand break initiated by Stx preferably occurs, and two halves of the SRL are formed. As a result, the fluorophore and quencher move away from each other in liquid, and the fluorescence of the fluorophore can be detected. In embodiments, in addition to culturing the STEC strains for the determination of Stx activity in the detection method according to the invention, for example,the SRL substrate, the reaction mix and the reaction temperature and / or the Shiga toxin may be relevant.
[0029] Stx are enzymatically active AB5 toxins that depurinate the SRL within the 60S ribosomal subunit at a specific adenine and block translation (Beddoe et al., 2010). For the development of the inventive method for STEC detection, which is based on the detection of Stx enzyme activity, the effect of Stx on the SRL is preferably used. The sarcin ricin loop forms a loop structure within the 28S rRNA of the 60S ribosomal subunit.
[0030] In the examples disclosed here, the inventors tested 94 bacterial strains, including 65 STEC strains, 11 Shigella strains, and 18 strains of enteric pathogens that do not produce Shiga toxin (Salmonella, EAEC, EPEC, EIEC, Yersinia). Stx production was detected for 59 of the 65 STEC strains and 6 of the 11 Shigella strains using the established, yet complex and time-consuming, detection methods of Stx Western blot and the Vero cell cytotoxicity assay. This means that 6 of the 65 STEC strains, 5 of the 11 Shigella strains, and all 18 enteric pathogen strains were Stx-negative in the reference method used and in the assay newly described here. All pure cultures examined could then be correctly detected as positive or negative by the method according to the invention in a simple and efficient manner.The examples demonstrate that, after analyzing various fluorescently labeled oligonucleotide enzyme substrates, robust and specific Stx detection is possible within 30 to 60 minutes for the reference strains, depending on the Stx amount and Stx subtype. In summary, the inventors have developed a rapid detection test for STEC based on the enzymatic activity of Stx as the main virulence factor.
[0031] In specific embodiments, the method can be used for the simple agar-based detection of STEC based on the enzymatic activity of Shiga toxin. Without being bound by current theory, the underlying mechanism of the assay depends on embodiments of the invention; specifically, active Shiga toxin possesses RNA-A / -glycosidase activity that depurinates a specific adenine in the sarcin-ricin loop (SRL) of the 28S ribosomal RNA, thereby inhibiting protein synthesis in eukaryotic cells (Chan et al., 2016). The enzymatic activity preferably produces a staining or fluorescent readout in a specially modified substrate, which can be read visually or with simple instrumentation. Exemplary embodiments are shown, for example, in Figures 1 and 4.
[0032] The SRL is essential for GTP-catalyzed steps during translation. Within the SRL, Stx depurinates a specific adenine residue in the GAGA recognition sequence, thereby completely blocking translation (Endo et al., 1988; Tesh et al., 1993).
[0033] In preferred embodiments of the method according to the invention, the oligonucleotide according to the invention is depurinated or cleaved by the enzymatic activity of the Shiga toxin, and preferably not by a lyase, such as an apurinic / apyrimidinic (AP) lyase, or another cleavage reaction (e.g. by a chemical substance).
[0034] In other words, in preferred embodiments of the method according to the invention, the oligonucleotide according to the invention is not cleaved by a lyase, such as an apurinic / apyrimidinic (AP) lyase, and / or another cleavage reaction, eg by a chemical substance.
[0035] In preferred embodiments, the present method (also) does not require additional substances such as trypsin, DTT, urea, and / or TCEP for Stx activation and detection of Stx activity. The present method preferably (also) does not require rebuffering and / or enzyme-linked adenine detection with (expensive) additional substances.
[0036] In the method according to the invention, the presence of active Stx is indicated by the active Stx depurinating its target sequence in the oligonucleotide according to the invention, which in embodiments is an SRL, at the specific adenine. In addition, a Stx-initiated strand break preferably occurs, thereby splitting the oligonucleotide into two halves.
[0037] In embodiments herein, the method according to the invention is also referred to as an enzyme activity assay, enzyme assay or an agar-based detection method.
[0038] Thus, the method of the invention and / or a reaction buffer and / or a sample therein preferably does not comprise / use lyase or other nucleic acid-cleaving enzymes, except for one or more Shiga toxins. Consequently, a reaction buffer therein preferably does not comprise lyase or other nucleic acid-cleaving enzymes. In some embodiments, a reaction buffer therein does not comprise ricin. In some embodiments, a reaction buffer and / or an enzyme assay comprises ricin.
[0039] The presence of one or more Shiga toxins in a sample is preferably indicative of (the presence of) a Shiga toxin-producing pathogen(s) in a sample. In embodiments, the method according to the invention therefore comprises the diagnosis of an infection with a Shiga toxin-producing pathogen (e.g., E. coli bacterium (STEC), Acinetobacter bacterium, or Shigella bacterium) if a patient sample is being analyzed, or a contamination, e.g., if food is being examined.
[0040] In embodiments, the oligonucleotide is present in a detection or reaction solution or buffer (e.g., detection buffer, e.g., an acetate buffer).
[0041] In embodiments, a detection or reaction solution (detection buffer; depurination buffer) is added (to the sample) before or during steps c) and / or d) of the method according to the invention.
[0042] In embodiments, a detection or reaction solution (reaction and / or detection buffer; depurination buffer) comprises ammonium acetate with a concentration between 10 and 150 mM, or 10-100 mM, 20-150 mM, 30-100 mM, 40-100 mM, 50-100 mM, 60-100 mM, 70-100 mM, 80-100 mM, 90-100 mM, 100-110 mM, 100-120 mM, 100-130 mM, 100-140 mM, 100-150 mM, 50-150 mM, or 10, 20, 30, 40, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 150, 120, 125, 130, 135 mM or preferably between 10-150 mM, 10-100 mM, 50-100 mM, or 80-110 mM or 100 nM. In embodiments, a detection or reaction solution (reaction and / or detection buffer; depurination buffer) may comprise sodium acetate, potassium acetate, and / or potassium citrate instead of, or in addition to, ammonium acetate.The final concentrations of sodium acetate, potassium acetate, potassium citrate and / or ammonium acetate in a detection or reaction solution may be those previously stated or adjusted according to the alternative or additional reagent(s).
[0043] In embodiments, the lower detection limit of a Stx activity present in a sample (e.g. a culture supernatant, pathogen colony or patient sample) by means of the method according to the invention is between 11 and 29 ng / mL, or between 10 and 30 ng / mL, between 1 and 50 ng / mL, between 5 and 30 ng / mL or at > 1 ng / mL, 2.5 ng / mL, 5 ng / mL, 7.5 ng / mL, 10 ng / mL, 11 ng / mL, 12 ng / mL, 13 ng / mL, 14 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 29 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 50 ng / mL, preferably at least > 10 ng / mL, more preferably > 5 ng / mL.
[0044] In embodiments, a detection or reaction solution (detection buffer; depurination buffer) comprises a pH between 3-4, or between pH 2.5-4.5, or pH 3.5-4.5, pH 2-5, pH 3, pH 3.5, pH 4, pH 4.5, pH 5, pH 5.5, pH 6, pH 6.5 or pH 7 or of > pH 2.5, > pH 3, and < pH 5, < pH 4 or preferably between pH 3-4.
[0045] In embodiments, steps c) and / or d) of the method according to the invention comprise a detection or reaction temperature or temperature gradient between 30°C and 55°C, between 40 and 60, between 44 and 57°C, between 37 and 57°C, between 40 and 50°C, or of 30°C, 35°C, 40°C, 44°C, 45°C, 50°C, 60°C or of > 30°C, > 35°C, > 40°C, > 44°C, > 45°C, > 50°C or preferably of > 40°C, > 44°C, between 30°C and 55°C. In some specific embodiments, a detection or reaction solution (reaction and / or detection buffer; depurination buffer) comprises ammonium acetate with a concentration between 10 and 100 mM, preferably 100 mM and / or has a pH between pH 3-4.
[0046] In some specific embodiments, steps c) and / or d) of the method according to the invention comprise a detection or reaction temperature or temperature gradient between 30 °C and 60 °C, preferably between 40-60 °C.
[0047] In embodiments, the oligonucleotide is present in a solid, semi-solid, or liquid (bacterial) growth medium (or nutrient medium), preferably in a growth agar plate (as growth medium) or a semi-solid or liquid growth medium. In embodiments, the solid, semi-solid, or liquid growth medium is a (bacterial) growth medium (or nutrient medium). In embodiments, the solid, semi-solid, or liquid growth medium is an agar medium (a medium comprising agar-agar, agarose).
[0048] In embodiments, the oligonucleotide is present in a solid or liquid growth medium, preferably in a growth agar plate (as growth medium) or a liquid growth medium comprising a detection or reaction solution / buffer (e.g., detection buffer, e.g., an acetate buffer). In embodiments, the oligonucleotide is present in a growth and / or detection agar plate. In embodiments, the oligonucleotide is present in a liquid or solid growth and / or detection medium.
[0049] In embodiments, the oligonucleotide is present in a detection or reaction solution or buffer (e.g., detection buffer, e.g., an acetate buffer) and / or a bacterial growth medium, preferably a growth agar plate (as growth medium), or in a mixture of the foregoing.
[0050] In embodiments, the oligonucleotide is present in a reaction or detection solution or a (bacterial) growth medium or in a mixture of the foregoing.
[0051] In embodiments, the oligonucleotide is present in a reaction or detection solution or a bacterial growth medium, or in a mixture of the above, wherein the reaction or detection solution or the (bacterial) growth medium comprises a dye or chromogenic dye for chromogenic detection. Such a (bacterial) growth medium is preferably a chromogenic growth and / or nutrient medium.
[0052] In embodiments, the oligonucleotide is immobilized on a solid phase. In embodiments, a solid phase can be a substrate, column material, beads (e.g., magnetic or agarose beads), a surface, glass, plastic, resin, a reaction vessel, a well plate, an array, a chip, or any other surface known to those skilled in the art that is suitable for immobilizing an oligonucleotide.
[0053] In some embodiments, the oligonucleotide is immobilized on a solid phase, wherein the solid phase is part of a reaction and / or culture vessel. In some embodiments, the reaction and / or culture vessel is filled or covered with reaction, nutrient, and / or (bacterial) growth medium. In some embodiments, the reaction and / or culture vessel is a well of a (multi-)well plate or a reaction vessel with multiple wells. In the method according to the invention, the presence of active Stx can be detected by depurinating active Stx at the specific adenine of its target sequence in the oligonucleotide according to the invention, which preferably also initiates a strand break, so that the oligonucleotide is cleaved into two halves.
[0054] Consequently, the at least one label of the oligonucleotide according to the invention is at least a cleavage-dependent label that can indicate the cleavage of the oligonucleotide by Stx and enables detection of active Stx (e.g., in a sample). A cleavage-dependent label preferably enables signal generation and / or signal change upon cleavage of the oligonucleotide according to the invention by Stx.
[0055] In embodiments, the at least one cleavage-dependent label comprises at least one fluorophore and at least one quencher.
[0056] In embodiments, the at least one fluorophore and at least one quencher are arranged such that the at least one quencher quenches the fluorescence of the at least one fluorophore as long as the oligonucleotide is uncleaved.
[0057] In embodiments, the at least one cleavage-dependent label comprises at least one luminescent dye.
[0058] In embodiments, the at least one cleavage-dependent label comprises at least one chromogenic dye or a dye for chromogenic detection.
[0059] In embodiments, a chromogenic dye may be contained in a chromogenic growth medium or nutrient medium or a chromogenic substrate, and / or chromogenic detection may include these. In embodiments, chromogenic detection may be based on or include the detection of an increase in color intensity, a color change, and / or a color change.
[0060] In embodiments, the at least one cleavage-dependent label comprises at least one label at the 3' end and / or at least one label at the 5' end of the oligonucleotide. In embodiments, the at least one cleavage-dependent label comprises at least one label within the oligonucleotide sequence, at the 3' end, and / or at least one label at the 5' end of the oligonucleotide.
[0061] In embodiments, the at least one cleavage-dependent label comprises at least one fluorophore and at least one quencher within the oligonucleotide sequence, at the 3' end and / or at the 5' end of the oligonucleotide. In embodiments, the at least one cleavage-dependent label comprises at least one fluorophore at the 5' end and at least one quencher at the 3' end of the oligonucleotide. In embodiments, the at least one cleavage-dependent label comprises at least one fluorophore and / or quencher within the oligonucleotide sequence. In embodiments, the at least one cleavage-dependent label comprises at least one fluorophore and / or quencher at the 3' end and / or at the 5' end of the oligonucleotide. In embodiments, the positions of the at least one fluorophore and at least one quencher described herein may be interchanged or different.
[0062] In embodiments, the oligonucleotide comprises at least one Stx target sequence and / or recognition sequence, wherein the Stx target / recognition sequence preferably comprises at least one adenine. In embodiments, the at least one Stx target / recognition sequence is one or part of a nucleotide sequence of a sarcin-ricin loop (SRL) of a eukaryotic / mammalian ß0S ribosomal subunit, wherein the SRL nucleotide sequence comprises at least one adenine.
[0063] In embodiments, the oligonucleotide is preferably single-stranded and optionally forms at least one loop or stem-loop structure.
[0064] In some embodiments, the presence of a stem-loop structure can enable improved Stx detection. This is a surprising difference from other RIPs, such as ricin, whose activity is independent of stem loops (Amukele et al., 2005, Biochemistry). Optimal detection of ricin activity is shown, for example, with RNA substrates with a length of 14 nucleotides (Chen et al., 1998, Biochemistry). Therefore, a stem-loop structure is not required for ricin's catalytic activity on DNA. A similar result has been shown for the RIP saporin, a type 1 RIP, which cleaves neither a GAGA sequence motif nor a stem-loop, but preferentially a tetraloop structure with an ACG sequence motif at the beginning of the loop (Hauf et al., 2022, ACS chemical biology). Consequently, different RIPs have very different target sequences and structures, which must be used for a particular detection assay.
[0065] Since the requirements of other RIPs cannot necessarily be used to determine an ideal substrate for a specific RIP, such as Stx, it was particularly surprising that the nucleic acid constructs according to the invention enable sensitive and reliable detection of Stx activity.
[0066] In embodiments, the oligonucleotide is single-stranded RNA (ssRNA) or DNA (ssDNA). In embodiments, the oligonucleotide is RNA or DNA. In embodiments, the oligonucleotide comprises RNA and / or DNA.
[0067] In embodiments, the oligonucleotide comprises DNA. In embodiments, the oligonucleotide is a DNA molecule. In embodiments, the oligonucleotide is a (partially) single-stranded DNA (ssDNA). In embodiments, the oligonucleotide comprises a partially single-stranded DNA molecule. In embodiments, the oligonucleotide is a partially single-stranded DNA molecule.
[0068] In embodiments, the oligonucleotide comprises single-stranded and double-stranded regions. In some embodiments, a single-stranded region forms or comprises a loop structure. In some embodiments, a double-stranded region forms or comprises a star structure.
[0069] In embodiments, the oligonucleotide comprises at least one loop or stem-loop structure and preferably at least one single-stranded and at least one double-stranded region, wherein the single-stranded region preferably comprises at least one loop structure and the double-stranded region preferably comprises at least one star structure.
[0070] In some of these embodiments, the oligonucleotide comprises a stem-loop structure, wherein the loop structure is formed by a single-stranded region and the star structure is formed by a double-stranded region. In some embodiments, the oligonucleotide comprises exactly one stem-loop structure, with a stem and a loop structure. In some preferred embodiments, the at least one star-loop structure of the oligonucleotide is, comprises, or resembles a sarcin-ricin loop (SRL) structure.
[0071] In embodiments, the oligonucleotide comprises a single loop or stem-loop structure, and preferably less than 26 nucleotides.
[0072] In embodiments, the oligonucleotide further comprises at least one linker sequence between the Stx target recognition sequence and the at least one label. In embodiments, the oligonucleotide further comprises at least one linker sequence between the SRL nucleotide sequence and the at least one label.
[0073] In some embodiments, a 5' linker sequence comprises the nucleotide sequence ACTT, and / or a 3' linker sequence comprises the nucleotide sequence AGT.
[0074] In embodiments, the SRL nucleotide sequence of the oligonucleotide comprises at least one (nucleotide) sequence GAGAG.
[0075] In preferred embodiments, the oligonucleotide comprises the sequence GAGAG. In preferred embodiments, the oligonucleotide comprises the sequence GAGAG or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. The (nucleotide) sequence GAGA is presumably essential as a recognition sequence (cleavage target sequence) for Stx. For the plant toxin ricin (which also possesses RNA A / glycosidase activity), the recognition sequence GAGA has been shown to be sufficient (Endo et al., 1988; Glück et al., 1992).
[0076] In embodiments, the use of at least one linker in the oligonucleotide according to the invention is preferred, particularly in some embodiments in which a weak detection signal is generated with a substrate (oligonucleotide) without a linker. The additional use of linkers can lead to an improvement in the detection signal in such embodiments (Noble et al., 2005; Mao et al., 2018). In addition, the natural SRL structure was preferably considered where possible, and base pairing was enabled for spatial proximity for F / Q.
[0077] See, for example, in the examples for substrate 2 (without linker) compared to substrate 4 (with linker). The length and sequence of the linkers can, however, vary and, in embodiments, be adapted for a specific Stx variant or target bacterial strain of interest. The linker sequence can be shortened or comprise one or more additional nucleotides. In embodiments, the sequence outside the target motif (recognition sequence) for Stx can vary, both in its nucleotide sequence and its length. For example, it was shown for ricin using a mass spectrometric assay that successful detection is already possible with a short substrate (e.g., 14-mer) comprising the recognition sequence GAGA of ricin, whereby the structure and / or nucleotide sequence of the substrate outside this recognition sequence did not appear to be essential.
[0078] In embodiments, the oligonucleotide comprises the sequence GAGAGGAGAG (SEQ ID NO: 1). In embodiments, the oligonucleotide comprises the sequence GAGAGGAGAG or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0079] In embodiments, the oligonucleotide comprises the sequence CGAGAGGAGAGG (SEQ ID NO: 2). In embodiments, the oligonucleotide comprises the sequence CGAGAGGAGAGG or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. In some preferred embodiments, the oligonucleotide comprises the sequence AGTACGAGAGGAAC (SEQ ID NO: 3). In embodiments, the oligonucleotide comprises the sequence AGTACGAGAGGAAC or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. In embodiments, the SRL nucleotide sequence of the oligonucleotide comprises at least one (nucleotide) sequence AGTACGAGAGGAAC.
[0080] In some preferred embodiments, the oligonucleotide comprises the sequence ACTTAGTACGAGAGGAACAGT (SEQ ID NO: 7). In some embodiments, the oligonucleotide comprises the sequence ACTTAGTACGAGAGGAACAGT or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. In some embodiments, the SRL nucleotide sequence of the oligonucleotide comprises at least one (nucleotide) sequence ACTTAGTACGAGAGGAACAGT.
[0081] In embodiments, the oligonucleotide comprises the sequence CTGAACTCAGTACGAGAGGAACCGTTCAG (SEQ ID NO: 4) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0082] In embodiments, the oligonucleotide comprises CTGAACTCAGTACGA(F)GAGGAACCGTTCAG(Q) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of the at least one fluorophore and at least one quencher may be interchanged.
[0083] In embodiments, the oligonucleotide comprises CTGAACTCAGTACGA(M)GAGGAACCGTTCAG (M) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, wherein M is at least one cleavage-dependent label.
[0084] In embodiments, the oligonucleotide comprises the sequence TCAGTACGAGAGGAACC (SEQ ID NO: 5) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0085] In embodiments, the oligonucleotide comprises (F)-TCAGTACGAGAGGAACC-(Q) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of the at least one fluorophore and at least one quencher may be interchanged.
[0086] In embodiments, the oligonucleotide comprises (M)-TCAGTACGAGAGGAACC-(M) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, wherein M is at least one cleavage-dependent label.
[0087] In embodiments, the oligonucleotide comprises the sequence TCAGTACGAGAGGAGAGGAACC (SEQ ID NO: 6) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0088] In embodiments, the oligonucleotide comprises (F)-TCAGTACGAGAGGAGAGGAACC-(Q) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of the at least one fluorophore and at least one quencher can be reversed. In embodiments, the oligonucleotide comprises (M)-TCAGTACGAGAGGAGAGGAACC-(M) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where M is at least one cleavage-dependent label.
[0089] In embodiments, the oligonucleotide comprises the sequence AC7TAGTACGAGAGGAACAGT (SEQ ID NO: 7) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0090] In some of these embodiments, the sequence ACTT at the 5' end and / or the sequence AGT at the 3' end is a linker sequence.
[0091] In embodiments, the oligonucleotide comprises (F)-ACTT AGT ACG AG AGG AAC AG T-(Q) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of the at least one fluorophore and at least one quencher may be interchanged.
[0092] In preferred embodiments, this oligonucleotide is No. 4 in Table 1.
[0093] In embodiments, the oligonucleotide comprises (M)-ACTTAGTACGAGAGGAACAGT-(M) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, wherein M is at least one cleavage-dependent label.
[0094] In embodiments, the oligonucleotide comprises (M)-ACTGCTTAGTACGAGAGGAACCATAGT-(M) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, wherein M is at least one cleavage-dependent label.
[0095] In embodiments, the oligonucleotide comprises (F)-ACTGCTTAGTACGAGAGGAACCATAGT- (Q) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of the at least one fluorophore and at least one quencher may be interchanged.
[0096] In embodiments, the oligonucleotide comprises the sequence ACT7AGTAC(Q)GAGAGGAACAGT or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0097] In some embodiments, the sequence ACTT at the 5' end and / or the sequence AGT at the 3' end is a linker sequence.
[0098] In embodiments, the sequence ACT at the 5' end and / or the sequence AGT at the 3' end is a linker sequence.
[0099] In embodiments, the oligonucleotide comprises at least one 5' and / or 3' linker sequence.
[0100] In embodiments, a 5' and / or 3' linker sequence comprises the sequence ACT and / or AGT. In embodiments, a 5' linker sequence comprises the sequence ACT. In embodiments, a 3' linker sequence comprises the sequence AGT. In embodiments, a 5' linker sequence comprises the sequence AGT. In embodiments, a 3' linker sequence comprises the sequence ACT. In some embodiments, a 5' linker sequence comprises the sequence ACTN, where N is preferably A, G, T, or C, more preferably ? or G. In some embodiments, a 3' linker sequence comprises the sequence NAGT, where N is preferably A, G, T, or C, more preferably A or C. In some embodiments, a 5' linker sequence comprises the sequence AN, where N is preferably A, G, T, or C, more preferably C, A, or T. In some embodiments, a 3'linker sequence comprises the sequence NT, where N is preferably A, G, T or C, more preferably G, T or A.
[0101] In embodiments, the oligonucleotide comprises at least one 5' and / or 3' linker sequence, preferably wherein a linker sequence has a length of between 1 and 10 nucleotides (nt). In some embodiments, the oligonucleotide comprises at least one 5' and 3' linker sequence. In embodiments, a linker sequence has a length of between 1 and 10 nucleotides (nt), or of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nt. In embodiments, a linker sequence has a length of between 1 and 5 nt, preferably of 2-4, 3-4, or 3 nt.
[0102] In embodiments, the oligonucleotide comprises at least one 5' and one 3' linker sequence, wherein the linker sequences preferably comprise a (mutually) complementary nucleotide sequence and / or preferably can hybridize with each other (at least partially). In embodiments, the oligonucleotide comprises at its 5' and 3' ends a (mutually) complementary nucleotide sequence, preferably each with a length of between 1 and 10 nt. In embodiments, the complementary nucleotide sequences, e.g., linker sequences, hybridize at the 5' and 3' ends of the oligonucleotide and form a double-stranded star structure (wherein a part of the oligonucleotide preferably forms a single-stranded loop structure, and thus a stem-loop structure).
[0103] In embodiments, the oligonucleotide comprises (f)-ACTTAGTAC(Q)GAGAGGAACAGT-Q) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of the at least one fluorophore and at least one quencher may be interchanged.
[0104] In embodiments, the oligonucleotide comprises (M)-ACTTAGTAC(M)GAGAGGAACAGT-(M) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, wherein M is at least one cleavage-dependent label.
[0105] In embodiments, the oligonucleotide has a length of 4-21, 4-25, 4-27, 4-28, 4-29, 4-30, 5-50, 5-30 or 5-20 nucleotides (nt). In embodiments, the oligonucleotide has a length of, for example, 5-25, 5-20, 5-15, 5-10, 8-30, 8-25, 8-27, 8-20, 8-15, 8-10, 9-30, 9-29, 9-28, 9-27, 9-26, 9-25, 9-24, 9-23, 9-22, 9-21, 9-20, 9-19, 9-18, 9-17, 9-16, 9-15, 9-14, 9-13, 9-12, 9-11, or 9-10 nucleotides. The length of the oligonucleotide can be defined by a range formed by one of the above values, e.g. B. by any value in combination with any other value as endpoints of the range.
[0106] In some embodiments of the oligonucleotides listed above, an underlined nucleotide is preferably a depurinated nucleotide within the Stx recognition sequence, especially adenine (A); a bold nucleotide indicates a (possibly duplicated) recognition sequence; and an italicized nucleotide indicates a linker sequence. In some embodiments, the typeface of the oligonucleotides listed above is irrelevant, and only the nucleotide sequence itself is meant.
[0107] In preferred embodiments, the oligonucleotide comprises the sequence GAGA. In some embodiments, the oligonucleotide comprises the sequence GAG or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. In such embodiments, an oligonucleotide comprises at least one GAG sequence, since this sequence represents the shortest target sequence (substrate) or the minimal target sequence for STX. In some embodiments, the oligonucleotide (substrate) is or comprises a very long nucleic acid molecule that comprises at least one or a plurality of target and / or non-target sequences.
[0108] In embodiments, the oligonucleotide comprises the sequence XXXGAGAGXXX or a sequence that is 70%, 80%, 90%, 95% or 99% identical thereto, where XXX represents a nucleotide sequence of any length, preferably a sequence comprising 4-21 nt.
[0109] In embodiments, the oligonucleotide comprises the sequence NNNGAGAGNNN or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. Where NNN represents any length of nucleotide sequence comprising nucleotides A, T, C, and / or G, preferably a sequence comprising 4-21 nt.
[0110] In embodiments, the oligonucleotide comprises the sequence XXXGXGXGXXX or a sequence that is 70%, 80%, 90%, 95% or 99% identical thereto, where XXX represents a nucleotide sequence of any length, preferably a sequence comprising 4-21 nt.
[0111] In embodiments, the oligonucleotide comprises the sequence NNNGRGRGNNN (SEQ ID NO: 14) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. Where NNN represents any length of nucleotide sequence, preferably a sequence comprising 4-21 nt, comprising nucleotides A, T, C, and / or G, and R represents nucleotides A or G.
[0112] In embodiments, the oligonucleotide comprises the sequence NNNAGTACGAGAGGAACNNN (SEQ ID NO: 12) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. Wherein NNN represents a nucleotide sequence of any length, preferably a sequence comprising 4-21 nt, comprising the nucleotides A, T, C, and / or G.
[0113] In embodiments, the oligonucleotide comprises the sequence NNNAGTACGRGRGGAACNNN (SEQ ID NO: 15) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. Where NNN represents any length of nucleotide sequence, preferably a sequence comprising 4-21 nt, comprising nucleotides A, T, C, and / or G, and R represents nucleotides A or G.
[0114] In embodiments, the oligonucleotide comprises the sequence NNNGTACGRGRGNARNNN (SEQ ID NO: 25) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. Where NNN represents any length of nucleotide sequence, preferably a sequence comprising 4-21 nt, comprising nucleotides A, T, C, and / or G, and R represents nucleotides A or G.
[0115] In embodiments, the oligonucleotide comprises the sequence ACTTXXXAGTACGAGAGGAACXXXAGT or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. Where XXX represents any length of nucleotide sequence, preferably a sequence comprising 4-21 nt.
[0116] In embodiments, the oligonucleotide comprises the sequence
[0117] ACTXXXTAGTACGAGAGGAACXXXAGT or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. Where XXX stands for any length of nucleotide sequence, preferably a sequence comprising 4-21 nt.
[0118] In embodiments, the oligonucleotide comprises the sequence ACTTNNNAGTACGAGAGGAACNNNAGT (SEQ ID NO: 8) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. Where NNN represents any length of nucleotide sequence comprising nucleotides A, T, C, and / or G, preferably a sequence comprising 4-21 nt.
[0119] In embodiments, the oligonucleotide comprises the sequence ACTNNAGTACGAGAGGAACNNNAGT (SEQ ID NO: 11) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. Where NNN represents any length of nucleotide sequence comprising nucleotides A, T, C, and / or G, preferably a sequence comprising 4-21 nt.
[0120] In embodiments, the oligonucleotide comprises at least the specific sequence GAGAG in a region of the oligonucleotide, wherein the entire oligonucleotide, including GAGAG flanking sequences, comprises a sequence with 70%, 80%, 90%, 95%, or 99% identity to the sequence ACTTAGTACGAGAGGAACAGT (SEQ ID NO: 7). Thus, in embodiments, it is possible to position the central target sequence GAGAG as a specific and preferably necessary sequence, wherein the flanking sequences (outside the GAGAG sequence) may exhibit a certain sequence variance.
[0121] In embodiments, the oligonucleotide comprises at least the specific sequence GAGAG in a region of the oligonucleotide, wherein the entire oligonucleotide, including GAGAG flanking sequences, comprises a sequence with 70%, 80%, 90%, 95%, or 99% identity to the sequence ACTGCTTAGTACGAGAGGAACCATAGT (SEQ ID NO: 13). Thus, in embodiments, it is possible to position the central target sequence GAGAG as a specific and preferably necessary sequence, wherein the flanking sequences (outside the GAGAG sequence) may exhibit a certain sequence variance.
[0122] In embodiments, the oligonucleotide comprises the sequence ACTAGTACGAGAGGAACGT (SEQ ID NO: 16) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0123] In embodiments, the oligonucleotide comprises the sequence AATAGTACGAGAGGAACTT (SEQ ID NO: 17) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0124] In embodiments, the oligonucleotide comprises the sequence ACTTAGTACGAGAGGAAAAGT (SEQ ID NO: 18) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0125] In embodiments, the oligonucleotide comprises the sequence ACTGAGTACGAGAGGAACAGT (SEQ ID NO: 19) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0126] In embodiments, the oligonucleotide comprises the sequence ATTAGTACGAGAGGAACAT (SEQ ID NO: 20) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0127] In embodiments, the oligonucleotide comprises the sequence ACTTAGTACGGGAGGAACAGT (SEQ ID NO: 21) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0128] In embodiments, the oligonucleotide comprises the sequence ACTTAGTACGAGGGGAACAGT (SEQ ID NO: 22) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. In embodiments, the oligonucleotide comprises the sequence ACTTAGTACGGGGGGAACAGT (SEQ ID NO: 23) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0129] In embodiments, the oligonucleotide comprises the sequence AGTTTGTACGAGAGCAGGACT (SEQ ID NO: 24) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0130] Table 7: Embodiments of the oligonucleotides according to the invention, which can serve as synthetic ssDNA substrates based on the sequence of the sarcin ricin loop (SRL), for the detection of Stx enzyme activity. SRL substrates investigated in the order of development with their respective sequences, features, fluorophores (F): Cy5 = Cy5 fluorophore; FAM = 6-FAM fluorophore (fluorescein), and quencher (Q). Sequence color code: underlined = depurinated adenine (A) within the Stx recognition sequence; bold = (duplicated) recognition sequence; italics = linker sequence. Oligonucleotide no. 4 was used for the Stx activity studies in some of the examples (e.g., at a concentration of 100 pM).
[0131] Table 2: Embodiments of the oligonucleotides according to the invention, which can serve as synthetic ssDNA substrates based on the sequence of the sarcin ricin loop (SRL), for the detection of Stx enzyme activity (see also Figure 3). Investigated SRL substrates with their respective sequences, features, fluorophores (F), and quenchers (Q). Sequence color code: underlined = depurinated adenine (A) within the Stx recognition sequence; bold = (duplicated) recognition sequence; italics = linker sequence.
[0132] In embodiments, the method for detecting an active Shiga toxin in a sample comprises the steps of: a) providing at least one single-stranded oligonucleotide according to the present invention, b) providing a sample to be tested for Shiga toxin, c) incubating the sample with the at least one single-stranded oligonucleotide, wherein a, e.g., a fluorescence signal is generated as soon as a Shiga toxin depurinates the oligonucleotide at the at least one adenine, wherein the oligonucleotide is cleaved, d) detecting a signal of a label, wherein a signal is indicative of the presence of a Shiga toxin, and optionally of a Shiga toxin-producing pathogen, in the sample, and
[0133] Table 3: Exemplary embodiments of the oligonucleotides according to the invention. The sequences disclosed in this table can include both DNA and RNA sequences (consequently, T (thymine) herein also alternatively stands for U (uracil). 'NNN' stands for any length of nucleotide sequence comprising nucleotides A, T, C, and / or G, and 'R' stands for nucleotides A or G.
[0134] In embodiments of the method according to the invention, a signal (of the at least one label), e.g. a fluorescence signal, is thus generated in step c) as soon as a Shiga toxin depurinates the oligonucleotide at the at least one adenine, whereby the oligonucleotide is cleaved.
[0135] In embodiments of the method according to the invention, the Shiga toxin contained in the sample is selected from the group comprising Stx1 and Stx2 or related Stx types.
[0136] In embodiments of the method according to the invention, the Shiga toxin contained in the sample is selected from the group comprising Stx1 and Stx2, Stx1a-d, and Stx2a-g. In embodiments of the method according to the invention, the Shiga toxin contained in the sample is selected from the group comprising Stx1 and Stx2, Stx1a-d, and Stx2a-o.
[0137] In embodiments of the method according to the invention, the Shiga toxin-producing pathogen is a Shiga toxin-producing E. coli bacterium (STEC), Acinetobacter, and / or Shigella bacterium, such as Shigella dysenteriae. In embodiments of the method according to the invention, the Shiga toxin-producing pathogen is a Shiga toxin-producing E. coli bacterium (STEC).
[0138] In embodiments of the method according to the invention, the Shiga toxin-producing pathogen is a Shiga toxin-producing Shigella bacterium, such as Shigella dysenteriae. In embodiments of the method according to the invention, the Shiga toxin-producing pathogen is a Shiga toxin-producing Acinetobacter bacterium.
[0139] In embodiments of the method according to the invention, the oligonucleotide is present in an agar medium in step a) and the sample is applied to an agar medium in step b).
[0140] In embodiments of the method according to the invention, the detection in step d) detects a signal detection in the agar medium.
[0141] In some embodiments, the agar medium is solid, semi-solid (viscous), or liquid. In some embodiments, the agar medium is solid or semi-solid (viscous) and is present in a culture plate / culture dish (as an "agar plate").
[0142] In embodiments of the method according to the invention, the oligonucleotide in step a) is present in an agar medium and the sample is applied to the agar medium in step b), and / or wherein the detection in step d) detects a signal recognition in the agar medium.
[0143] In embodiments of the method according to the invention, the oligonucleotide in step a) is immobilized on a solid phase.
[0144] In embodiments, a solid phase can be a substrate, column material, beads (e.g., magnetic or agarose beads), a surface, glass, plastic, resin, a reaction vessel, a well plate recess or a surface therein, an array, a chip, or any other surface or solid phase known to those skilled in the art that is suitable for immobilizing an oligonucleotide. In some embodiments, the oligonucleotide in step a) is immobilized on a solid phase, wherein the solid phase is part of a reaction and / or culture vessel. In some embodiments, the reaction and / or culture vessel is filled or covered with reaction, nutrient, and / or (bacterial) growth medium.
[0145] In embodiments of the method according to the invention, the oligonucleotide is present in a liquid reaction solution or detection solution in step a) and the sample is introduced into the liquid reaction medium in step b).
[0146] In embodiments, the oligonucleotide in step a) is present in a reaction or detection solution or a (bacterial) growth medium or in a mixture of the above, wherein the reaction or detection solution or the (bacterial) growth medium is present in a reaction vessel or a well of a well plate.
[0147] In embodiments, the oligonucleotide in step a) is present in a reaction or detection solution or a (bacterial) growth medium, or in a mixture of the above, wherein the reaction or detection solution or the (bacterial) growth medium comprises a dye or chromogenic dye for chromogenic detection. Such a (bacterial) growth medium is preferably a chromogenic growth and / or nutrient medium. In embodiments, chromogenic detection also includes fluorogenic detection.
[0148] In embodiments, the oligonucleotide is present in a detection or reaction solution or buffer (e.g., detection buffer, e.g., an acetate buffer). In embodiments of the method according to the invention, the oligonucleotide in step a) is present in a (liquid, semi-solid, or solid) reaction medium or reaction solution, and the sample in step b) is introduced into the liquid or onto the (semi-)solid reaction medium.
[0149] In embodiments, the oligonucleotide is present in a solid or liquid (bacterial) growth medium, preferably a growth agar plate (as growth medium).
[0150] In embodiments, the oligonucleotide is present in a solid or liquid growth medium, preferably a growth agar plate (as growth medium) comprising a detection or reaction solution buffer (e.g., detection buffer, e.g., an acetate buffer). In embodiments, the oligonucleotide is present in a growth and / or detection agar plate. In embodiments, the oligonucleotide is present in a liquid or solid growth and / or detection medium.
[0151] In embodiments, the oligonucleotide is present in a detection or reaction solution or buffer (e.g., detection buffer, e.g., an acetate buffer) and / or a bacterial growth medium, preferably a growth agar plate (as growth medium), or in a mixture of the foregoing.
[0152] In embodiments, the invention relates to a kit comprising at least a) an oligonucleotide according to the present invention, and b) optionally at least one reaction buffer, wherein the reaction buffer is preferably a depurination buffer comprising ammonium acetate.
[0153] In embodiments, the invention relates to a kit comprising at least a) an oligonucleotide according to the present invention, and b) optionally at least one reaction and / or detection solution, wherein the reaction and / or detection solution is preferably a depurination buffer comprising ammonium acetate.
[0154] In embodiments, a depurination buffer may comprise sodium acetate, potassium acetate, potassium citrate instead of or in addition to ammonium acetate.
[0155] In embodiments, the invention relates to a kit for carrying out the method according to the invention, wherein the kit preferably comprises at least one oligonucleotide according to the present invention.
[0156] The immediate disclosure also includes kits, packages, and multi-container units comprising one or more of the kit components or assay components described herein.
[0157] Embodiments and features of the invention described with respect to the method, oligonucleotides, and kits are deemed to be disclosed with respect to any other aspect of the disclosure, so that features characterizing the methods can be used to characterize the oligonucleotides or kit, and vice versa. The various aspects of the invention are unified by, benefit from, are based on, and / or are linked by the common and surprising finding that an active Stx can be detected by providing an oligonucleotide according to the invention.
[0158] DETAILED DESCRIPTION OF THE INVENTION
[0159] All cited patent and non-patent literature documents are hereby incorporated by reference in their entirety.
[0160] "Nucleotides" are organic molecules consisting of three subunits: a nucleobase, a five-carbon sugar (ribose or deoxyribose), and a phosphate group consisting of one to three phosphates. "Nucleobases" are nitrogen-containing biological compounds and may also be referred to as "nucleic acid bases" or "bases." Accordingly, these terms may be used interchangeably here. Nucleobases include, in the case of the primary or canonical nucleobases of DNA: guanine (G), adenine (A), cytosine (C), and thymine (T), as well as uracil (U)—instead of thymine—in RNA. In addition to the primary or canonical nucleobases of DNA and RNA, other synthetic and / or naturally occurring nucleobases and / or (chemically) modified nucleobases, such as amino acids, may also be present. B. hm5C, (5-hydroxymethylcytidine), m5C (5-methylcytidine), N4-methylcytosine, m6A, (N6-methyladenosine), 5-methylaminomethyl-2-thiouridine (mam5s2u), 1-methyladenosine,1-methylpseudouridin, 1-methylguanosin, 1-methylinosin, 2,2-dimethylguanosin, 2-methyladenosin, 2-methylguanosin, 3-methylcytidin, N4-methylcytosin, 5-methylcytidin, N6- methyladenosin, 7-methylguanosin, 5-methylaminomethyluridine, beta-D-mannosylqueuosin, 5- methoxycarbonylmethyl-2-thiouridin, 5-methoxycarbonylmethyluridin, 5-methoxyuridin, 2- methylthio-N6-isopentenyladenosin, N-((9-beta-D-ribofuranosyl-2-methylthiopurin-6- yl)carbamoyl)threonin, N-((9-beta-D-ribofuranosylpurine-6-yl), N-methyl- carbamoyl)threonineuridin-5-oxoaceticuridin-5-oxyacetic, wybutoxosin, pseudouridin, queuosin, 2-thiocytidine, 5-methyl-2-thiouridin, 2-thiouridin, 4-thiouridine, 5-methyluridine, N-((9-beta-D- ribofuranosylpurine-6-yl)carbamoyl)threonin, 2'-O-methyl-5-methyluridin, 2'-O- methyluridinewybutosin, 3-(3-amino-3-carboxypropyl)uridin,4-acetylcytidin, 5- (carboxyhydroxylmethyl)uridin, 2'-O-methylcytidin, 5-carboxymethylaminomethyl-2-thiouridin, 5- carboxymethylaminomethyluridine, dihydrouridine,2'-0-methylpseudouridine, 2'-O-methylguanosineosine, N6-isopentenyladenosine, 1-methyladenosine, 1-methylpseudouridine, 1-methylguanosine, 1-methylinosine, 2,2-dimethylguanosine, 2-methylguanosine, 3-methylcytidine, p (pseudouridine), q (queusine), s2c (2-thiocytidine), 5fC (5-formylcytosine), 5caC (5-,
[0161] Carboxylcytosine), 2-fluoro, 2-O-methyl, 2-fluoroarabinose nucleic acid, hexitol nucleic acid, 2-O-methoxyethyl, ribuloNA, (1'-3')-ß-L-ribulo nucleic acid, αL-threose nucleic acid, 3'-2'-phosphonomethyl-threosyl nucleic acid, 2'-deoxyxylonucleic acid, can be used in the context of the present invention. All possible chemical modifications and synthetic and / or naturally occurring nucleobases are known to those skilled in the art (e.g., McCown et al., 2020, WIREs RNA; Sood et al., 2019, J Cheminform; https: / / dnamod.hoffmanlab.org / ).
[0162] In embodiments, any DNA nucleobase: guanine (G), adenine (A), cytosine (c), thymine (T), and uracil (U) may be chemically modified and / or replaced by one of the aforementioned bases. In embodiments, "X" in a nucleotide sequence also includes any chemically modified base and / or one of the aforementioned bases. "Sequence variants" or "variants" of oligonucleotides or nucleic acid sequences, as defined in the present invention, may comprise a nucleic acid sequence that differs from an original sequence by one or more mutations, such as one or more substituted, inserted, and / or deleted nucleotides. In embodiments, the sequence variation described herein may apply to one or more embodiments described throughout the application with respect to conservative substitutions and / or percent identity.Nucleic acid substitutions, as defined herein, are changes to the nucleic acid sequence of the nucleic acid molecule, whereby one or more nucleic acids are replaced by the same number of (different) nucleic acids, thus altering the nucleic acid sequence. Like the additions, the substitutions can be natural or artificial. "Variant" oligonucleotides, as defined within the scope of the present invention, can have one or more conservative nucleic acid substitutions compared to their native, i.e., non-mutated, physiological sequence. These nucleic acid sequences fall specifically under the term "variants" as defined herein.
[0163] In embodiments of the invention, oligonucleotide or target sequences may exhibit some variation in sequence and / or length compared to the specific sequences described herein. In embodiments, a nucleic acid molecule, such as an oligonucleotide, may exhibit an addition or deletion of 0 to 10 nucleotides at the 5' or 3' end / terminus of a sequence, with reference to the specific sequences described herein.As used herein, the term "an addition or deletion of 0 to 10 nucleotides at the 5'- or 3'-terminus of a sequence" means that the nucleic acid a) has 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 additional nucleotides deleted from its 5'-terminus and 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides deleted from its 3'-terminus or b) has 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 additional nucleotides deleted from its 3'-terminus and 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides deleted from its 5'-terminus, c) 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 additional nucleotides at its 5'-terminus and 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 additional nucleotides at its 3'-terminus or d) 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides at its 5'-terminus and 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides at its 3'-terminus.
[0164] In embodiments, the method, kit or oligonucleotides of the present invention are characterized in that the oligonucleotides and / or the one or more Stx target sequence(s) comprise a nucleotide sequence having 80% or more, 85% or more or preferably 90%, 95% or more sequence identity to the sequences provided herein, for example 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% sequence identity. A sequence variant with 80% to 99% sequence identity is preferably functionally analogous, ie sequences which have differences in the nucleotide sequence, but nevertheless have a similar specificity for the Stx to be detected, so that the function of the oligonucleotide and / or the one or more Stx target sequence(s) is retained within the scope of the present invention.Functionally analogous sequences can be tested by the skilled person without inventive effort based on the information provided in the application, e.g., by testing the Stx cleavage and / or depurination properties and preferences within the framework of the method described herein.
[0165] As used herein, "percent (%) sequence identity", "sequences with % identity", "percent (%) sequence homology" or "sequences with % homology" to a particular "reference sequence", e.g., one of the nucleic acid sequences disclosed herein, means the percentage of nucleotides in a particular sequence that are identical to the nucleotides of the reference sequence and is determined by comparing the two optimally aligned sequences across a comparison window, where the portion of the polynucleotide sequences in the comparison window may contain additions or deletions (i.e., gaps) compared to the reference sequence (which does not contain additions or deletions) for the optimal alignment of the two or more sequences.The percentage is calculated by determining the number of positions where the identical nucleic acid base or amino acid residue occurs in the two or more sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity.
[0166] As used herein, "sequence identity", "identity", "sequence homology", or "homology" in the context of two nucleic acid sequences refers to a particular percentage of residues in the two sequences that are the same when aligned for maximum similarity over a particular comparison window, as measured by sequence comparison algorithms or by visual inspection.
[0167] Insertions and substitutions are particularly possible at sequence positions where no change in the three-dimensional structure affects the target sequence or only affects it to a desired extent.
[0168] For the purposes of the invention, a "cleavage-dependent label" is a detectable label that generates a signal, whereby cleavage of the oligonucleotide causes a change in the signal. Thus, any detectable label that exhibits a signal change upon cleavage of the oligonucleotide of the invention can be used. Examples of cleavage-dependent labels are described herein, and it does not require undue effort on the part of the person skilled in the art to identify or use such labels.
[0169] In the context of the present invention, a "label" may, in embodiments, describe one or more fluorophores or one or more quenchers. Accordingly, in the context of the invention, an oligonucleotide may, in embodiments, carry or comprise one or more fluorophores and / or quenchers. The proximity of a fluorophore to the quencher prevents the detection of its fluorescence, whereas cleavage of the oligonucleotide by Stx disrupts the dye (fluorophore)-quencher proximity, thus allowing unquenched emission of fluorescence, which may be detected, for example, upon excitation with a laser.In embodiments, an oligonucleotide comprises at least one fluorophore and at least one quencher (these are preferably present "in pairs"), wherein the quencher preferably suppresses the fluorophore signal as long as the oligonucleotide is uncleaved, wherein the at least one fluorophore and the at least one quencher are present relative to each other within the oligonucleotide either at the respective ends (3' and 5') and / or within the oligonucleotide sequence.
[0170] In embodiments in which multiple quencher-fluorophore pairs are present within an oligonucleotide, the pairs may also be arranged in different locations relative to each other, e.g., at at least one end of the oligonucleotide and / or within the sequence. In embodiments, an oligonucleotide may comprise no, one, or more labels. For example, there may be no or at least 1, 2, 3, 4, 5 labels, or even up to 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 labels. In some embodiments, an oligonucleotide comprises no, 1, 2, or up to 3 labels. In other embodiments, an oligonucleotide comprises no, 1, 2, 3, 4, 5, or even more than 5 labels.
[0171] The term "nucleic acid" refers to nucleic acid molecules, including, without limitation, DNA, ssDNA, dsDNA, RNA, mRNA, tRNA, lncRNA, ncRNA, microRNA, siRNA, rRNA, sgRNA, piRNA, rmRNA, snRNA, snoRNA, scaRNA, gRNA, or viral RNA. Nucleic acid sequences herein refer to a consecutive arrangement of nucleotides, where nucleotides are represented by their nucleobases in guanine (G), adenine (A), cytosine (C), and thymine (T) in DNA and uracil (U) in RNA. A nucleic acid sequence may also refer herein to the sequence of consecutive letters or nucleobases (consisting of G, A, C, and T or U) that represent the actual sequence of consecutive nucleic acids in a DNA or RNA strand. This nucleic acid sequence can be identified and characterized biochemically and bioinformatically using DNA or RNA sequencing or by complementary nucleic acid probes (e.g.In embodiments herein, mediator probes) are specifically detected, e.g., in the context of a PCR, real-time PCR, or digital PCR detection reaction. The sequence analysis can also comprise the comparison of the resulting nucleic acid sequence or a detection signal specific thereto with one or more reference nucleic acid sequences and / or with the detection signals of housekeeping genes. The term nucleotide can be abbreviated to "nt." The term base pair (two nucleobases bound to each other via hydrogen bonds) can be abbreviated to "bp."
[0172] The term "oligonucleotide" may refer to or encompass a nucleic acid molecule with a specific length of consecutive nucleotides. In the context of the present invention, the terms "oligonucleotide" and "nucleic acid molecule," or in some contexts, "oligonucleotide" and "SRL," may be used interchangeably. Oligonucleotides are short DNA or RNA molecules (oligomers). Oligonucleotides are generally characterized by the sequence of nucleotide residues that comprise the molecule. Oligonucleotides can typically form sequence-specific structures and can sometimes form duplexes or double-stranded structures, as well as single-stranded and / or loop structures that extend across all or part of the sequence.
[0173] In the context of the invention, a "target sequence" (or recognition sequence) describes any nucleic acid sequence of interest that can serve as a target sequence for depurination and / or cleavage by Stx in the method according to the invention or the oligonucleotide. A target sequence can preferably be a DNA or RNA sequence. A target sequence can represent part or the entire nucleic acid sequence of a target DNA or an oligonucleotide.
[0174] In the context of the invention, a "signal change" describes a change in or the emergence of a detectable signal. In embodiments, this is, for example, a fluorescence signal change, a color change, a staining, a luminescence signal or a light signal or any other detectable signal. This signal change is preferably a significant, differentiable and / or characteristic change in the one signal, which is clearly demarcated or distinguished from potential baseline or background signals or background or background noise (e.g. negative control or buffer / medium control). The person skilled in the art is aware that under some experimental conditions, non-specific signals, baseline signals or background or background noise can occur during signal detection due to fluorophores, dyes or other labels.Therefore, in the context of the invention, a signal change preferably describes a significant, differentiable, and / or characteristic change in the (detectable) signal, and not a baseline or background signal or background or background noise. In embodiments, this signal change can mean an increase in fluorescence intensity, in other words, an increase in the fluorescence signal. In embodiments, this signal change can mean an increase in luminescence intensity, in other words, an increase in the luminescence signal. In embodiments, this signal change can mean an increase in color intensity or a color change. In some embodiments, a signal change is a decrease in the signal. The increase in a signal is preferably due to the oligonucleotide according to the invention being cleaved and / or depurinated by Stx in the presence of Stx.
[0175] In embodiments, the number of resulting cleavages, digestions, and / or separations of the respective labels increases, whereby, for example, in embodiments, at least one fluorophore is released and / or separated from its quencher (i.e., the distance between quencher and fluorophore increases such that the fluorescence signal is no longer quenched by the quencher). An increase (increase in the number) of released and / or non-quenched fluorophores thus leads to an increase in the fluorescence signal, which is specific and indicative of the presence of an (enzymatically) active Stx.
[0176] “Fluorophore” (or fluorochrome, similar to a chromophore) is a fluorescent chemical compound that can re-emit light when excited by light. Fluorophores for use as labels in the construction of labeled probes of the invention include, but are not limited to, rhodamine and derivatives such as Texas Red, fluorescein and derivatives such as 5-bromomethylfluorescein, Lucifer Yellow, IAEDANS, 7-Me2N-coumarin-4-acetate, 7-OH-4-CH3-coumarin-3-acetate, monobromobimane, pyrene trisulfonates such as Cascade Blue and monobromotrimethyl-ammoniobimane, 7-NH2-4CH3-coumarin-3-acetate (AMCA), FAM, TET, CAL Fluor Gold 540, JOE, VIC, Quasar 570, CAL Fluor Orange 560, Cy3, NED, Oyster 556, TMR, CAL Fluor Red 590, HEX, ROX, LC Red 610, CAL Fluor Red 610, Texas Red, LC Red 610, CAL Fluor Red 610, LC Red 640, CAL Fluor Red 635, Cy5, LC Red 670, Quasar 670, Oyster 645, LC Red 705, Cy5.5, BODIPY FL, Rhodamine Green, Oregon Green 30 488, Oregon Green 514, Cal Gold, BODIPY R6Gj, Yakima Yellow, Cal Orange, BODIPY TMR-X, JOE, HEX, Quasar-570 / Cy3, TAMRA, Rhodamine Red-X, Redmond Red, BODIPY 581 / 591 , Cy3.5, Cal Red / Texas Red, BODIPY TR-X , BODIPY 630 / 665-X, Quasar-670 / Cy5, Pulsar-650, Dy490, Atto-488, Atto532, Atto-Rho-6G, Dy590, Atto-Rho101 , Cy5, Dy-636, Atto-647N, Cy5.5, Dy682, Atto-680, BMN-488, BMN-505, BMN-536, BMN-562, Rhodamin und Derivaten, wie Texas Red, Fluorescein und Derivaten, wie 5-Brommethylfluorescein, Lucifer Yellow, IAEDANS, 7-Me2N-Cumarin-4-acetat, 7- OH-4-CH3-Cumarin-3-acetat, 7-NH2-4CH3- 25-Cumarin-3-acetat (AMCA), Monobrombiman, Pyrentrisulfonate, wie Cascade Blue, und Monobromtrimethylammoniobiman, FAM, TET, CAL Fluor Gold 540, HEX, JOE, VIC, CAL Fluor Orange 560, Cy3, NED, Quasar 570, Oyster 556, TMR, CAL Fluor Red 590, ROX, LC red 610, CAL Fluor Red 610, Texas red, LC red 610, CAL Fluor Red 610, LC red 640, CAL Fluor Red 635, Cy5, LC red 670, Quasar 670, Oyster 645, LC red 705, Cy5. 5, BODIPY FL, Oregon Green 30 488, Rhodamine Green, Oregon Green 514, Cal Gold, BODIPY R6Gj, Yakima Yellow, JOE, HEX, Cal Orange, BODIPY TMR-X, Quasar-570 / Cy3, TAMRA, Rhodamine Red-X, Redmond Red, BODIPY 581 / 591 , Cy3. 5, Cal Rot / Texas Rot, BODIPY TR-X, BODIPY 630 / 665-X, Pulsar-650, Quasar-670 / Cy5.
[0177] "Quenching" refers to any process that reduces the fluorescence intensity of a given substance. Quenching is the basis for Förster resonance energy transfer (FRET) assays, static or contact quenching assays, or a combination of both. FRET is a dynamic quenching mechanism because the energy transfer occurs while the donor is in an excited state. Contact quenching requires close spatial proximity in the form of physical contact between the donor and quencher. A "quencher" is a molecule that quenches the fluorescence emitted by the fluorophore when it is excited by the light source of a PCR cycler or detection device.Quenchers for use as labels in the construction of labeled signal oligos and / or base strands of the invention include, without claiming to be exhaustive, DDQ-I, Iowa Black, Iowa Black FQ, QSY-9, BHQ-1, QSY-7, BHQ-2, DDQ-II, 22 Eclipse, Iowa Black RQ, QSY-21, BHQ-3 Dabcyl, QSY-35, BHQ-0, ElleQuencher, BMN-Q1, BMN-Q2, BMN-Q60, BMN-Q-535, BMN-Q590, BMN-Q620, BMN-Q650. Those skilled in the art will be familiar with suitable reporter-quencher pairs and will know which to select for a particular application.
[0178] In the context of the invention, a "sample" preferably refers to a biological sample, preferably obtained or isolated from a patient, a subject, a tissue, cell, yeast, or bacterial culture, from the environment, or from a food, animal, plant, or other biological source. The term "sample" as used herein may refer, for example, to a sample of a body fluid or tissue obtained for the purpose of diagnosing, prognosticating, or evaluating a subject of interest, e.g., a patient. Preferably, the sample is a sample of a body fluid, such as stool, blood, serum, plasma, cerebrospinal fluid, urine, saliva, sputum, pleural effusions, cells, a cell extract, a tissue sample, a tissue biopsy, a stool sample, and the like. In particular, the sample is blood, blood plasma, blood serum, or urine.Alternatively, the sample may be obtained from a tissue, cell, yeast or bacterial culture, from the environment, or from a food or other biological source.
[0179] A sample may be selected from the group consisting of a liquid sample, a solid sample, a biopsy, a liquid biopsy, a tissue sample, a cell culture sample, a food sample, an environmental sample, or a sample derived from an exchange. The sample may further include or be a body fluid, whole blood or blood components, plasma, serum, cells, tissue, saliva, sputum, mucus, phlegm, semen, vaginal fluid, cerebrospinal fluid or cerebrospinal fluid, urine, or pleural effusions.
[0180] A nutrient medium, also known as a culture medium or growth medium (the terms can be used interchangeably herein), is used to cultivate microorganisms, cells and tissues. A distinction can be made between liquid (e.g. broth, nutrient broth or nutrient solution), semi-liquid (viscous) and gelled (“solid”) nutrient media (nutrient medium). Solid nutrient media are nutrient media that are in the form of a gel due to the addition of a gelling agent (e.g. agar-agar). Solid nutrient media are primarily used for analytical purposes because they also enable the quantification of microorganisms. Semi-solid nutrient media are mainly used in high layers in test tubes, known as “high layer tubes”. This so-called “soft agar” contains agar-agar in a lower concentration than is usual in a more solid nutrient medium.In embodiments, nutrient media may contain nutrients for the growth of bacteria or cells, or may also comprise additional substrates, such as oligonucleotides described herein and / or buffer reagents and / or detection reagents.
[0181] The terms "patient" or "host" can be used interchangeably here. A patient or host can be an organism, a cell culture of patient cells or cell lines, an animal, or a cell culture of animal cells or cell lines. A patient preferably refers to a species from which a sample is taken and / or whose biological material constitutes the majority of the biological material in a sample. A patient can be selected from the group of vertebrates, animals, farm animals, mammals, humans, preferably mammals or humans.
[0182] Herein, the method according to the invention can also be referred to as an enzyme assay or assay for short.
[0183] FIGURES
[0184] The invention is further described by the following figures. These are not intended to limit the scope of the invention, but rather represent preferred embodiments of aspects of the invention provided to illustrate the invention described herein.
[0185] Figure 1: Assay principle of an embodiment of the method according to the invention comprising agar-based detection of Stx activity. A) Enzymatic reaction of Stx; B) Visualization using a modified chromogenic probe as an example (other readouts possible);
[0186] C) Principle of application of the probe in laboratory diagnostics.
[0187] Figure 2: Comparison of the 28S rRNA sequences of the SRL of Homo sapiens and Rattus norvegicus. The 28S rRNA sequences of the sarcin ricin loop of Homo sapiens (left; PDB 7UCR; SEQ ID NO: 9) and Rattus norvegicus (right; PDB 1 SCL; SEQ ID NO: 10) are shown. The highly conserved region is highlighted in bold. The recognition sequence GAGAG of the SRL is written in gray. Light gray underlines = depurinated adenine (A) within the Stx recognition sequence. Watson-Crick base pairing is represented by the dotted line. This figure was created with BioRender.com.
[0188] Figure 3: Embodiments of the oligonucleotide according to the invention, which in these embodiments represent synthetic, single-stranded substrates (ssDNA, with fluorophore and quencher) based on the sequence of the SRL and with which Stx activity can be investigated. Shown are substrates 1-4 (StxSense1-4), substrate 4 as an RNA sequence ("4 RNA"), and substrates 5, 9, 12, 15, and 16 (StxSense6, 9, 12, 15, and 16). Exemplary embodiments of the oligonucleotide according to the invention are shown, whereby embodiments 4 and 12 may be particularly preferred in some embodiments. Q = quencher; Fluorophores (F): Cy5 = Cy5 fluorophore; FAM = 6-FAM fluorophore (fluorescein). Sequence color code: light gray underlined = depurinated adenine (A) within the Stx recognition sequence; dark gray in 3 (GAGAG) = duplicated recognition sequence; underlined nucleotides = linker sequence. Substrate images were created with BioRender.com.
[0189] Figure 4: Location of the sarcin-ricin loop (SRL) targeted by Stx activity within the 60S ribosome subunit. A synthetic SRL mimic containing a fluorophore (6-FAM) and quencher (Q) is used in vitro to detect Stx's enzymatic activity. In the presence of Stx, the SRL is depurinated and the sugar-phosphate backbone is cleaved. As a result, the fluorophore and quencher are no longer in physical proximity, resulting in a fluorescent signal.
[0190] Figure 5: Schematic representation of the experimental procedure of an embodiment of the method according to the invention for detecting Stx activity from the sample. Stx activity is detected here using a synthetic substrate that mimics SRL. The substrate is coupled to a fluorophore and a quencher. Stx cleaves the SRL substrate, resulting in the formation of a fluorescence signal. Using this experimental procedure, the intensity of the fluorescence signal caused by Stx-positive samples can also be increased by modifying sequences of the SRL substrate.
[0191] Figure 6: Comparative analysis of some embodiments of the developed SRL substrates (oligonucleotides) with regard to the specific detection of Stx activity. Comparative analysis from Example 1, wherein embodiments of the oligonucleotides according to the invention were used as SRL substrates for the specific detection of Stx activity. Analysis of various SRL substrates (see also Figure 3) using (A) the reference strain EDL933 O157:H7 (stx1a / 2a) and (B) 16-02409 O157:H7 (stx2a) over a period of 12 hours. Using the substrate "5'FAM-Stem-[SRL]" (substrate no. 4; StxSense4; SEQ ID NO: 7), the enzymatic activity of Stx could be detected in both strains, but not in EDL933 Astx1 / 2. Statistical analysis of both strains using substrate 4 (StxSense4) shows a significant difference in the fluorescence signals compared to EDL933 Astx1 / 2 and the other tested substrates. The curves (median) are shown.Statistical analysis was performed using the Mann-Whitney test for non-normally distributed data and the Student's t-test with soft correction for normally distributed data (*, p < 0.05; **, p < 0.01; ***, p < 0.001), based on EDL933 Astx1 / 2. RFU, Relative Fluorescence Units; t [h], time [hours].
[0192] Figure 7: In this experiment, 100 mM ammonium acetate (depurination buffer) is preferred and can enhance the fluorescence signal of Stx-positive samples. The STEC strains were incubated in LB (pH 7) with ciprofloxacin (Cip) for 24 h at 37 °C and 250 rpm. The Stx activity of the culture supernatants was then compared in 10 mM and 100 mM ammonium acetate, respectively. The results of three independent experiments are shown. The enzyme activity of the Stx produced in the culture supernatants was measured for all cultures in duplicate over 12 h using fluorescence evolution (RFU). The data are presented as medians. Statistical analysis was performed using Student's t-test with soft correction for normally distributed data (*, p < 0.05; **, p < 0.01; ***, p < 0.001), based on EDL933 Astx1 / 2. RFU, Relative Fluorescence Units; t [h], time [hours].Figure 8: The enzymatic activity of Stx with DNA-based SRL substrate is preferably carried out at acidic pH. The bacterial strains were incubated in LB (pH 7) with Cip for 24 h at 37 °C and 250 rpm. The Stx activity of the culture supernatants was then determined in 100 mM ammonium acetate at pH values between pH 3 and pH 7. The results of three independent experiments are shown. The enzyme activity of the produced Stx in the culture supernatants was measured for all cultivations in duplicate over 12 h using fluorescence evolution (RFU). The data are presented as medians. Statistical analysis was performed using Student's t-test with soft correction for normally distributed data (*, p < 0.05; **, p < 0.01 ; ***, p < 0.001), based on EDL933 A stx 1 / 2. D. RFU, Relative Fluorescence Units; t [h], time [hours].
[0193] Figure 9: The preferred minimum SRL concentration for significant Stx detection in this experiment is 2 pM, and saturates the curve with maximum RFU starting at 4 pM SRL (EDL933) or 5 pM SRL (16-02409). The bacterial strains were incubated in LB (pH 7) with Cip for 24 h at 37 °C and 250 rpm. The culture supernatants were then tested for enzyme activity in 100 mM ammonium acetate (pH 4) with different concentrations (1 pM to 8 pM) of the SRL substrate. The results (median) over time for strains (A) EDL933 and (B) 16-02409 from three independent experiments are shown. The enzyme activity of the produced Stx in the culture supernatants was measured for all cultures in duplicate over 12 h using fluorescence evolution (RFU). Statistical analysis was performed using the Student's t-test with soft correction for normally distributed data for the endpoint analysis (*, p < 0.05; **, p < 0.05).01 ; ***, p < 0.001), relative to EDL933 Astx1 / 2. RFU, Relative Fluorescence Units; t [h], time [hours].
[0194] Figure 10: The reaction temperature and sample dilution can be adjusted to optimize the detection of Stx activity in different samples. The bacterial strains were incubated in LB (pH 7) with Cip for 24 h at 37 °C and 250 rpm. The culture supernatants were then tested for enzyme activity at reaction temperatures (100 mM ammonium acetate, pH 4) between 37 °C and 57 °C for (A) EDL933 and (B) 16-02409. For a temperature range between 37 °C and 45 °C, the Stx activity of 1:2 and 1:5 diluted culture supernatants (C, D) was additionally tested. The results (median) over time of three independent experiments are shown. The enzyme activity of the produced Stx in the culture supernatants was measured for all cultures in duplicate over 12 h using fluorescence evolution (RFU). Data are presented as medians.Statistical analysis was performed using the Student's t-test with soft correction for normally distributed data (*, p < 0.05; **, p < 0.01 ; ***, p < 0.001), based on EDL933 A stx 1 / 2. RFU, Relative Fluorescence Units; t [h], time [hours].
[0195] Figure 11: Using the enzyme assay, Stx2a-g and Stx1a-c can be detected in culture supernatants in this experiment preferentially after 30 min to 8 h, and this also depends on the Stx concentration. To verify whether the enzyme assay detects all subtypes of Shiga toxin, STEC strains covering the subtypes Stx1 ad and Stx2a-g were incubated in LB (pH 7) with 12 ng / mL Cip for 24 h at 37 °C, 250 rpm. Stx production was analyzed using a cytotoxicity assay with Vero cells and by Western blot (C) to detect Stx2 in the culture supernatants using a-Stx2 (mouse, 135 / 6-B9, Sifin) and fluorescent a-mouse IgG (StarBright Blue B520, BioRad Laboratories, Inc.). Subsequently, the culture supernatants were analyzed for enzyme activity in the enzyme assay (100 mM ammonium acetate, pH 4) (A, B).The enzyme activity of the Stx produced in the culture supernatants of three independent cultures was measured for all cultures in duplicate over 12 h using fluorescence development (RFU). Gray areas mark the range in which samples are classified as negative (relative to EDL933 Astx1 / 2). Data are presented as medians. Statistical analysis was performed using the Student's t-test with soft correction for normally distributed data for the endpoint analysis (*, p < 0.05; **, p < 0.01; ***, p < 0.001), relative to EDL933 Ast x 1 / 2. RFU, Relative Fluorescence Units; t [h], Time [hours]; MW [kDa], Molecular Weight.
[0196] Figure 12: The detection of STEC with the enzyme assay is based on the detection of Stx and is independent of the STEC serogroup. To test whether the enzyme assay detects other important serogroups besides 0157 based on the Stx produced, three STEC strains each from serogroups 026, 091, 0111, 0113, 0121, and 0145 were selected from the strain collection of the NRZ (RKI). These strains were incubated in LB (pH 7) with Cip for 24 h at 37 °C and 250 rpm. The culture supernatants were then analyzed for Stx activity in the enzyme assay (100 mM ammonium acetate, pH 4) (A, B). A representative STEC strain from each serogroup is shown. Stx production was investigated by cytotoxicity assay with Vero cells (D) and Western blot (C) to detect Stx2 in culture supernatants using a-Stx2 (mouse, 135 / 6-B9, Sifin) and fluorescent a-mouse IgG (StarBright Blue B520, BioRad Laboratories, Inc.).Stx activity from three independent cultures was measured in duplicate over 12 hours using fluorescence development (RFU). Gray areas mark the range in which samples are classified as negative (relative to EDL933 Astx1 / 2). Data are presented as medians. Statistical analysis was performed using the Student's t-test with soft correction for normally distributed data for the endpoint analysis (*, p < 0.05; **, p < 0.01; ***, p < 0.001), relative to EDL933 Astx1 / 2. RFU, Relative Fluorescence Units; t [h], Time [hours]; MW [kDa], Molecular Weight.
[0197] Figure 13: Detection of Stx-producing Shigella strains. The Stx produced by Shigella dysenteriae (Stx1) and Shigella flexneri (Stx2) is 95% (Stx1) and 55% (Stx2) identical to that produced by STEC. To verify whether the enzyme assay also detects the Stx produced by Shigella, five strains of S. dysenteriae and six strains of S. flexneri were selected from the strain collection of the NRZ (RKI). A representative Shigella strain is shown in each case. The strains were incubated in LB (pH 7) with Cip for 24 h at 37 °C and 250 rpm. Stx production was assayed by cytotoxicity assay with Vero cells and (A) Western blot (B) for detection of Stx2 in culture supernatants using α-Stx2 (mouse, 135 / 6-B9, Sifin) and fluorescent α-mouse IgG (StarBright Blue B520, BioRad Laboratories, Inc.). (C) Stx activity of three independent cultures was measured for all cultures in duplicate over 12 h using fluorescence evolution (RFU).Gray areas mark the range in which samples are classified as negative (relative to EDL933 Astx1 / 2). Data are presented as medians. Statistical analysis was performed using the Student's t-test with soft correction for normally distributed data for the endpoint analysis (*, p < 0.05; **, p < 0.01; ***, p < 0.001), relative to EDL933 Astx1 / 2. RFU, Relative Fluorescence Units; t [h], time [hours]; MG [kDa], molecular weight.
[0198] Figure 14: No cross-reactivity regarding enzyme activity using the SRL substrate and other enteric E. coli (EAEC, EPEC, EIEC) that do not produce Stx. Since patient samples from diarrheal diseases may also contain other enteric E. coli, the cross-reactivity of these strains to the specific SRL substrate was investigated. Two strains each were selected from the strain collection of the NRZ (RKI). The strains were incubated in LB (pH 7) with Cip for 24 h at 37 °C, 250 rpm. Stx production was examined using (A) a cytotoxicity assay with Vero cells and (B) Western blot to detect Stx2 in the culture supernatants with α-Stx2 (mouse, 135 / 6-B9, Sifin) and fluorescent α-mouse IgG (StarBright Blue B520, BioRad Laboratories, Inc.). (C) Stx activity of three independent cultures was measured for all cultures in duplicate over 12 h using fluorescence evolution (RFU).Gray areas mark the range in which samples are classified as negative (relative to EDL933 Astx1 / 2). Data are presented as medians. Statistical analysis was performed using the Student's t-test with soft correction for normally distributed data (*, p < 0.05; **, p < 0.01; ***, p < 0.001), relative to EDL933 Astx1 / 2. RFU, Relative Fluorescence Units; t [h], time [hours]; MG [kDa], molecular weight.
[0199] Figure 15: For other enteric pathogens without Stx (Salmonella, Yersinia), no nonspecific reaction regarding enzyme activity could be detected using the SRL substrate. In addition to the previously investigated enteric pathogens E. coli, other enteric pathogens can also cause diarrhea. To rule out a nonspecific reaction of these pathogens to the enzyme assay, four Yersinia sp. and six Salmonella spp. strains were tested. The strains were incubated in LB (pH 7) with Cip for 24 h at 37 °C and 250 rpm. Stx production was assayed by (A) Vero cell cytotoxicity assay and (B) Western blot for Stx2 detection of culture supernatants using α-Stx2 (mouse, 135 / 6-B9, Sifin) and fluorescent α-mouse IgG (StarBright Blue B520, BioRad Laboratories, Inc.). (C) Stx activity of three independent cultures was measured for all cultures in duplicate over 12 h using fluorescence evolution (RFU).Gray areas mark the range in which samples are classified as negative (relative to EDL933 Asfx1 / 2). Data are presented as medians. Statistical analysis was performed using Student's t-test with soft correction for normally distributed data (*, p < 0.05; **, p < 0.01; ***, p < 0.001), relative to EDL933 Ast x 1 / 2. RFU, Relative Fluorescence Units; t [h], time [hours]; MG [kDa], molecular weight.
[0200] Figure 16: Implementation of an embodiment of the method according to the invention for detecting the enzymatic activity of Shiga toxin in vitro. The samples are cultured for 24 hours at 37°C and 250 rpm in LB medium containing 12 ng / mL Cip or on LB agar containing 12 ng / mL Cip. From the obtained culture supernatants, 5 pL or 1 to 3 individual colonies are added to a white 96-well plate with a prepared reaction mix. The enzymatic reaction takes place at 44°C for 1 to 12 hours. The fluorescent signal (RFU, Relative Fluorescent Unit) is recorded using a fluorescence detection device, such as a real-time cycler. The culture supernatant / colonies of the reference strain EDL933 are used as a positive control; LB and EDL933 A st x 1 / 2 act as a negative control and define the cutoff value. The image was created with BioRender.com.
[0201] Figure 17: A) Detection of Stx activity using the substrates StxSensel to StxSense4 and the STEC strain EDL933 O157:H7, which produces Stx1a and Stx2a. B) Detection of Stx activity using the substrates StxSensel to StxSense4 and the STEC strain 16-02409 O157:H7, which produces Stx2a.
[0202] Figure 18: A) Detection of Stx activity with the substrates StxSense4, 5, 9, 12, 15, and 16 and the STEC strain EDL933 O157:H7, which produces Stx1a and Stx2a. B) Detection of Stx activity with the substrates StxSense4, 5, 9, 12, 15, and 16 and the STEC strain 16-02409 O157:H7, which produces Stx2a.
[0203] Figure 19: A) Detection of Stx activity with the substrates StxSensel to StxSense4 and the knockout mutant EDL933 O157:H7, which produces neither Stx1 nor Stx2. B) Detection of Stx activity with the substrates StxSense4, 5, 9, 12, 15, and 16 and the knockout mutant EDL933 O157:H7, which produces neither Stx1 nor Stx2.
[0204] Figure 20: Comparison of DNA / RNA substrate StxSense4. Analysis of the enzymatic activity of Stx with DNA- and RNA-based StxSense4 for the STEC strain EDL933 O157:H7, stx1a / 2a, and the knockout mutant EDL933 O157 Astx1 / 2.
[0205] EXAMPLES
[0206] The invention is further described by the following examples. These are not intended to limit the scope of the invention, but rather represent preferred embodiments of various aspects of the invention, which are provided to illustrate the invention described herein.
[0207] Materials and methods
[0208] In this example, synthetic, single-stranded DNA substrates were used to detect the enzymatic activity of Stx. Figure 4 shows the location of the sarcin-ricin loop (SRL), which is targeted by Stx activity within the 60S ribosome subunit. A synthetic SRL mimic containing a fluorophore (6-FAM) and quencher (Q) was used in vitro to detect the enzymatic activity of Stx. In the presence of Stx, the SRL is depurinated and the sugar-phosphate backbone is cleaved. As a result, the fluorophore and quencher are no longer in physical proximity, resulting in a fluorescent signal.
[0209] bacterial strains
[0210] As a basis for the present invention, the inventors examined a total of 94 strains collected between 1998 and 2021 from the strain collection of the National Reference Center (NRZ) for Salmonella and other bacterial enteric pathogens of the Robert Koch Institute (RKI), as well as the two established reference strains EDL933 and EDL933 Astx1 / 2. STX was confirmed in all strains by PCR. The strains covered different serotypes as well as types and subtypes of Shiga toxin. The STEC strains examined possessed STX1, STX2, or STX1 / 2 in combination.
[0211] As an exemplary strain selection with which the development of the method according to the invention, e.g. as an enzyme assay, was carried out, consisted of the reference strain EDL933 O157:H7 and the STEC strain 16-02409 O157:H7 as positive controls, as well as the E. coli C600 and the KO mutant EDL933 Asfx1 / 2 O157:H7 as negative controls.
[0212] Additionally, other enteric E. coli without Stx were used as control strains: three enteropathogenic E. coli (EPEC), three enteroaggregative E. coli (EAEC), and two enteroinvasive E. coli (EL EC). A further six Salmonella spp., four Yersinia enterocolitica, and eleven Shigella flexneri and Shigella dysenteriae strains were examined.
[0213] Table 4. Strain selection from positive and negative controls used in this example for
[0214] Development of the enzyme assay.
[0215] Cultivation and induction of Stx production of STEC strains in liquid culture and on agar plates
[0216] Preparation of culture supernatants (stx induction)
[0217] For each bacterial strain, 3 mL of LB medium warmed to room temperature was placed in a sterile glass tube. For overnight culture, the STEC strain was transferred from the glycerol stock into the prepared LB tube using a sterile glass rod and inoculated. Cultivation was carried out above night for 16 hours at 37 °C and 250 rpm in a shaking incubator (New Brunswick Scientific, Innova 42). The next day, the GD600 of each culture was determined using a spectrophotometer (Beckman Coulter, DU720). All cultures were then adjusted to a GD600 of 0.05 in 4 mL of fresh LB medium in a new, sterile glass tube. To induce Stx production, 5 pL of 10 pg / mL Cip was added to the culture tube (final Cip concentration: 12 ng / mL). The samples were then cultivated in a shaking incubator for 24 h at 37 °C, 250 rpm.During testing of the optimal inducer for Shiga toxin induction, mitomycin C (MMC, 1 mg / mL), gentamicin (1.2 pg / mL) and ethylenediaminetetraacetic acid (EDTA, 20 mM) were also investigated.
[0218] To obtain the culture supernatants, 3 mL of the bacterial culture was transferred to 1.5 mL reaction tubes (Eppendorf) and centrifuged at 9,000 xg for 5 min. The supernatant and pellet were separated. The culture supernatant was then sterile-filtered using a 0.2 pm filter (Sartorius) and stored at 4 °C for a maximum of one week until use in the experiments. The pellet was stored at -20 °C.
[0219] Concentration of Stx culture supernatants (preferred but not necessary)
[0220] If necessary, 2 mL of the Stx-induced and sterile-filtered supernatants were concentrated to 100 pL (10- or 20-fold concentrate) using a centrifugal filter (Amicon Ultra 0.5 mL Centrifugal Filter, cutoff size 10 kDa, Merck Millipore). For this purpose, 500 pL of the Stx culture supernatant were centrifuged in four rounds at 14,000 xg for 6 min. The concentrated volume of 100 pL was then transferred to a new 1.5 mL reaction tube by inverting the filter column and centrifuging at 1,000 rpm for 2 min. The concentrate was stored at 4 °C for a maximum of one week and subsequently at -20 °C.
[0221] Cultivation of STEC strains on LB agar
[0222] The selected strains were then cultured on LB agar plates supplemented with 12 ng / mL Cip. For this purpose, 100 μL of 12 ng / mL Cip were plated on a sterile LB agar plate, and then a small amount of the STEC strain was streaked onto the agar plate using a sterile glass rod from the corresponding cryogenic tube. The agar plates were cultured for 18 h at 37 °C in an incubator.
[0223] Optimizations of the liquid-based detection of enzymatically active Stx
[0224] To enhance the fluorescent signal (relative fluorescence units, RFU) of Stx-positive samples, various parameters of the liquid-based assay were adjusted and compared with the previously optimal setting. The following parameters were investigated: plate type (white / clear, various manufacturers), depurination buffer with 10 and 100 mM ammonium acetate (pH 4), depurination buffer in pH 4 / pH 5 / pH 6 / pH 7, temperature gradient between 30 °C and 55 °C, and different concentrations of the fluorescent SRL substrate (1 to 8 pM final concentration).
[0225] Enzyme activity assay with STEC single colonies
[0226] The routine cultivation of STEC strains on agar plates also leads to the secretion of Stx into the LB agar (Kimmitt et al., 2000). For this purpose, 20 μL of the reaction mix (19.5 μL of 10 mM ammonium acetate, pH 4 with 0.5 μL of SRL stock solution per sample) was pipetted into the well of the white 96-well plate. Subsequently, one to three randomly selected colonies from the induced STEC strains grown on LB agar were transferred into the prepared reaction buffer using an inoculating loop. Triplicate determinations were performed per sample, since not all individual colonies produce Stx (Scotland et al., 1988). The determination of enzymatic Stx activity was performed analogously to induced Stx culture supernatants.
[0227] Determination of specificity for Stx
[0228] To determine the specificity of the enzyme assay, STEC strains expressing Stx1 and Stx2 of various Stx subtypes were used. In addition to the "classic" STEC serotype O157:H7, other serotypes were also tested. To rule out nonspecific cross-reactivity with other diarrheal pathogens, various enteric E. coli (EAEC, EPEC, EIEC) as well as other enteric pathogens such as Shigella spp., Yersinia spp., and Salmonella enterica were tested.
[0229] Substrates
[0230] To optimally determine detectable Stx enzyme activity in vitro, five different substrates were designed based on the sarcin ricin loop (SRL) and produced by idt Integrated DNA-Technologies (see Table 1). Each SRL substrate was coupled with a fluorophore / quencher pair, with the quencher located at the 3' end of all substrates. For substrate 1, the Cy5 fluorophore was directly bound to the adenine (manufacturer: biomers.net), which is depurinated by Stx. All other substrates (substrates 2 to 4, manufacturer: idt) were labeled with a 6-FAM fluorophore at the 5' end. In the initial state without the addition of Stx, the fluorophore and quencher are in close proximity for all substrates, so that the fluorescence of the fluorophore is absorbed by the quencher, and no fluorescence signal is detected.Once enzymatically active Stx depurinates the specific adenine and fluorophore and quencher fragments are formed by the additional strand break of the ssDNA, the fluorescence can no longer be absorbed by the quencher. The various synthetic SRL substrates (numbers 1 to 4; as an embodiment of the oligonucleotide according to the invention) are shown in Figure 3. Cy5 and FAM (here 6-FAM) denote fluorescent labels, and Q denotes a quencher (BMN-Q620 in substrate 1 and BHQ-1 in substrates 2-5). The Stx recognition sequence is highlighted in gray, embedded in the SRL sequence of Rattus norvegicus, and the target adenine for depurination is underlined. Substrate 3 contains two recognition sequences, and substrate 5' FAM-Zen-SRL contains an additional internal quencher (Zen). Substrates 4 and 5' FAM-Zen-SRL contain modified sequence ends (5' ACTT and 3' TGA) to enhance the fluorescence signal. This image was created with BioRender.com.The oligonucleotides (“ssDNA substrates”) used in the example and shown in Figure 4 and their nucleotide sequences are also listed in Table 1.
[0231] With these embodiments of the oligonucleotide according to the invention, an analysis was carried out according to the method according to the invention.
[0232] The key steps of the enzyme assay for detecting Stx activity using a synthetic substrate (an embodiment of the oligonucleotide of the invention) that mimics SRL are shown in Figure 5. The substrate is coupled to a fluorophore and a quencher. Stx cleaves the SRL substrate, resulting in the generation of a fluorescent signal. Fluorescently labeled single-stranded DNA substrates based on the sarcin-ricin loop (SRL) can be used to detect Shiga toxin enzyme activity.
[0233] Enzyme activity assay with Stx culture supernatants
[0234] The enzymatic detection of active Shiga toxin was performed in a 96-well format as an enzyme activity assay using STEC culture supernatants. The enzymatic activity of a sample, e.g., prepared STEC culture supernatants, could be verified by substrate conversion. Fluorescence detection was performed using a real-time cycler with FAM or Cy5 filters, depending on the fluorescent label. The reaction was carried out in a white 96-well plate (Eppendorf SE (twin-tec®)). The reaction was carried out in a reaction mix consisting of 100 mM ammonium acetate, pH 4, and the SRL substrate. Ammonium acetate was stored at room temperature, and the SRL substrate was stored at -20°C until use. For each sample, 14.6 pL of 100 mM ammonium acetate, pH 4, was mixed with 0.4 pL of SRL substrate (100 mM stock solution; final concentration 2 pM) for the reaction mix and added to a well.To analyze the sample, 5 pL of Stx culture supernatant was then added to the reaction mix, and the reaction was performed in a real-time cylinder (CFX Opus 96, BioRad Laboratories). Stx activity was analyzed using the measured RFU values in Excel and graphically displayed in GraphPad Prism 9 (GraphStats Technologies).
[0235] Table 5: Real-time cycler settings for performing the enzyme activity assay
[0236] Detection of enzyme activity in the reaction vessel The possibility of detecting the enzyme activity of Stx in a reaction vessel was investigated using the ChemiDoc MP. For this purpose, 37.5 pL of 2 pM 5'FAM-Stem-SRL in 100 mM depurination buffer were added to 12.5 pL of Stx culture supernatant in a 1.5 mL reaction vessel and incubated at 44 °C (Thermomixer, Eppendorf SE). The reaction was carried out analogously to the 96-well format with the same ratios of reaction mix to culture supernatant. The enzymatic reaction was then monitored in the ChemiDoc (Bio-Rad Laboratories, Inc.) using the fluorescein filter. The fluorophore attached to the SRL substrate, 6-carboxyfluorescein (6-FAM), requires an excitation wavelength of A = 495 nm and emits light at a wavelength of A = 517 nm.
[0237] Example 1
[0238] The present example demonstrates the principle of an enzymatic assay based on RNA-A / -glycosidase activity, as enabled by embodiments of the invention. For the development, the inventors used, among others, SRL from bacteria, yeast, or the rat (Rattus norvegicus). The SRL sequences between humans and rats differ in isolated nucleotides (see Figure 2 and Table 1). The nucleotide sequence of the 28S rRNA, and thus of the SRL, is highly conserved, particularly at positions 4320 to 4329 in eukaryotic cells. The Stx recognition sequence GAGA is also located in this region (Lordanov et al., 1997), which means that the effect on the SRL should be independent of the organism.
[0239] Based on the natural SRL sequence, five synthetic SRL substrates were designed to detect the enzymatic activity of Stx. Detecting Stx activity requires a sufficiently strong fluorescence signal that should allow reliable discrimination between Stx-positive and -negative samples after a short test time. Culture supernatants of the reference strain EDL933 O157:H7, the STEC strain O157:H7 16-02409, and, as negative controls, the culture medium LB and the KO mutant EDL933 st x 1 / 2 O157:H7 were used to evaluate the developed substrates (Gobert et al., 2007). Since neither Stx1 nor Stx2 can be produced in this strain, a positive signal from the culture supernatant of this strain would indicate a nonspecific reaction with the substrate. Further information on strain selection can be found in Section 3.2.1. listed.The enzyme reaction was carried out at 44 °C in a white 96-well plate from Eppendorf (TwinTec) in 100 mM ammonium acetate, pH 4, and 2 pM substrate.
[0240] Results
[0241] The results are shown in Figure 6. The curves of the two Stx-producing strains EDL933 and 16-02409 over 12 hours (h) are shown.
[0242] The analysis of all five substrates with the three different strains was carried out during the same reaction run in a white 96-well plate in the real-time device. The detection of Stx activity with the five different SRL substrates was carried out using the same culture supernatant in order to directly compare the effectiveness of the substrates. Stx production in the culture supernatant was checked using Vero cell cytotoxicity assay, Western blot, and Stx ELISA. The curve for EDL933 Ast x 1 / 2 was within the medium control range for all SRL substrates over the entire period, although the fluorescence intensity varied between the SRL substrates. Stx could be detected in the culture supernatants of both Stx-producing strains using established methods. For EDL933, an increase in the curves for substrates 2 (5'FAM-SRL or "StxSense2"); See Table 1) and 4 (5'FAM-Stem-SRL or “StxSense4”); See Table 1).Stx could be detected for both strains with substrate no. 4 after a one-hour reaction time, as these values were significantly higher than the negative controls. In comparison, with substrate no. 2 (5'FAM-SRL or "StxSense2"), Stx activity could be evaluated as positive after a six-hour reaction time. Substrate no. 4 ("5'FAM-Stem-SRL" or "StxSense4") enabled a six-fold faster detection of EDL933 than with substrate no. 2. The three other substrates tested did not show any slope, thus substrates no. 1 and 3 and 5'FAM-Zen-SRL (see Table 1) were less suitable for detecting Stx activity in strain EDL933 compared to the other two substrates, at least under the specific conditions chosen (assay conditions, strain EDL933, etc.). For strain 16-02409, two positive curves were also detected (substrate no. 4 and substrate 5' FAM-Zen-SRL).Similar to EDL933, active Stx could be detected in the culture supernatant with substrate 4 after just one hour of reaction time, while detection with substrate 5' FAM-Zen-SRL took approximately seven times longer. For the three other substrates (Figure 6; see Table 1), no positive signal was detected for the Stx culture supernatant. Under the given conditions, Stx activity could only be detected with two of the developed substrates for each of the two strains. Substrate 4 detected Stx earlier than the other substrates, so substrate 4 ("5'FAM-Stem-SRL" or "StxSense4") was selected as the optimal substrate for all further investigations due to its rapid detection with both STEC strains and the lack of reaction with the negative controls.
[0243] The detected fluorescence served as a marker for substrate hydrolysis by Stx from the positive control EDL933, the test strain STEC 16-02409, and the negative control EDL933 Astx1 / 2. For both Stx-producing strains (EDL933 and 16-02409), the substrate 5'FAM-Stem-SRL ("StxSense4"; No. 4) was the optimal substrate for detecting Stx activity. The results represent the medians of triplicate samples (n = 3) and are representative of three independent experiments. Statistical analysis was performed using Student's t-test corrected by Weich's method (*, p < 0.05; **, p < 0.01; ***, p < 0.001), with the results compared to those of EDL933 Astx1 / 2. RFU, relative fluorescence units; t [h], time [hours],
[0244] Optimizations of the inventive method (enzyme assays)
[0245] Enzyme reactions are delicate equilibria. Stx activity has been largely studied to date. Work by Basu and colleagues examined Stx activity in vitro with RNA and DNA substrates. They found that these reactions require an acidic pH and can be carried out at both 20 °C and 37 °C (Basu et al., 2016). Stx activity is independent of cofactors such as NADP (Jackson, 1990).
[0246] After determining embodiments of the invention in the form of different substrates, the aim was to improve the fluorescence signal of Stx-positive samples as well as the stability of the enzyme reaction and the assay. The various components of the enzyme assay were therefore systematically investigated and adapted. For this purpose, a reaction solution comprising ammonium acetate and an SRL substrate, the reaction temperature, and the sample dilution were investigated.
[0247] Example 2 - The use of a buffer containing 10-100 mM ammonium acetate enhances the fluorescence signal in the detection of Stx-positive samples
[0248] Stx activity was detected in depurination buffer consisting of ammonium acetate and SRL substrate. Buffer concentrations of 10 mM have been described in the literature for investigating the enzymatic activity of ribosome-inactivating proteins and for mass spectrometric analyses (Roday et al., 2008; Li and Turner, 2017). Previous studies of Stx activity used concentrations of the RNA-based SRL substrate between 1 mM and 2 pM (Basu et al., 2016; Li and Turner, 2017), which for substrate no. 4 (5'FAM-Stem-SRL; "StxSense4") corresponds to substrate costs of approximately €0.20 per sample. The influence of the ammonium acetate concentration was analyzed using 2 pM SRL substrate at 44 °C for 12 h. The pH of both solutions was adjusted to pH 4. Stx activity was assayed with 10 mM and 100 mM ammonium acetate, respectively (Figure 7).The Stx activity of the selected strains (EDL933, 16-02409 and EDL933 st x 1 / 2 ) and negative controls was tested under the above conditions.
[0249] For the negative controls, no non-specific reaction was detected at any time point for either of the two tested conditions. The background noise, based on the RFU values of the negative controls, was RFU = 1167 in 10 mM and RFU = 905 in 100 mM ammonium acetate. For the two Stx-producing strains, a direct comparison of the depurination buffers revealed a higher Stx activity in 100 mM ammonium acetate. 100 mM ammonium acetate increased the fluorescence signal in both 16-02409, stx2a, and EDL933, stx1a / 2a, immediately after the start of the reaction, showing a 1.7-fold increase in RFU after just 2 hours. Eight hours after the start of the reaction, the curve for 16-02409 reached a plateau, which remained constant until the end of the enzyme assay (12 hours). The curve in 100 mM ammonium acetate could be considered as clearly positive for 16-02409 two hours after the start of the reaction compared to the negative controls.The curve in 10 mM ammonium acetate two hours after the start of the reaction is also considered positive. However, the increase in RFU is lower, reaching the maximum RFU value of 100 mM ammonium acetate only after 12 hours of reaction time.
[0250] For the two STEC strains and their culture supernatants tested, the use of 100 mM ammonium acetate resulted in an enhanced fluorescence signal, which was essential for the detection of the Stx activity of EDL933.
[0251] Example 3 - pH values below pH 5 are during enzymatic Stx detection
[0252] If synthetic RNA substrates are used to study the enzymatic activity of toxins, for example, an acidic pH is essential (Roday et al., 2008). Previous publications have already investigated the activity of ribosome-inactivating proteins such as ricin (Li and Turner, 2017) and, occasionally, Stx (Basu et al., 2015). Therefore, in the following section, Stx activity was investigated at pH values between three and seven in 100 mM ammonium acetate (Figure 8). The curves were comparable for EDL933, stx1a / stx2a and 16-02409, stx2a. The negative controls EDL933, stxl / 2, and LB showed no nonspecific reactions at the pH values tested. For pH values 3 and 4, a significantly increased fluorescence signal (RFUpH3 = 16.862 and RFUpH4 = 26.113, respectively) was measured for EDL933 one hour after the start of the reaction. The curve at pH 4 showed 1.5-fold higher RFU values compared to pH 3.Increasing the pH to pH 5 resulted in a flatter curve, allowing a positive signal to be obtained after seven to eight hours of reaction time. Depurination buffers with pH values above pH 6 were unsuitable for detecting Stx activity in vitro, as they did not allow detection of Stx activity despite the Stx-positive culture supernatant.
[0253] It has been shown that acidic pH values (pH 3 and pH 4) are optimal for the detection of Stx activity. The fluorescence signal was amplified in 100 mM ammonium acetate, so the conditions were adjusted for subsequent experiments and 100 mM ammonium acetate with a pH of 4 was used for culture supernatants.
[0254] Example 4 - A preferred minimum oligonucleotide concentration for reliable Stx activity detection is 2 uM for the given experimental parameters
[0255] The activity of ricin and purified Stx has already been successfully tested using RNA substrates at concentrations between 10 nM and 2 pM (Basu et al., 2015), but not with DNA substrates. Due to the reduced sensitivity of DNA substrates, the studies were conducted with an SRL concentration in the pM range between 1 pM and 8 pM. For strain selection, the optimal concentration of the substrate 5'FAM-Stem-SRL ("StxSense4"; No. 4; SEQ ID NO: 7) was determined.
[0256] The determination was carried out using the same culture supernatants in the same 96-well plate under the same reaction conditions (100 mM ammonium acetate, 44 °C reaction temperature). Figure 9 shows the representative curves of the various SRL concentrations for EDL933 (A) and 16-02409 (B). The negative controls showed no nonspecific reaction. A positive RFU signal for EDL933, stx1a / 2a was detected at all SRL concentrations tested. Nevertheless, the curves of the various SRL concentrations differed in terms of their slope and fluorescence intensities. The higher the SRL concentration, the stronger the fluorescence signal for the same culture supernatant. At SRL concentrations above 4 pM, a saturation effect of the reaction was evident after approximately 4 hours of reaction time. A further increase in the SRL concentration did not lead to an increase in the RFU values.The various SRL concentrations led to comparable, yet different, curve progressions for 16-02409, stx2a. All SRL concentrations tested yielded a positive fluorescence signal after a reaction time of seven hours, which was particularly intense at SRL concentrations between 1 pM and 6 pM. However, no plateau of the fluorescence signal was detected. Furthermore, SRL concentrations above 5 pM showed a stronger saturation effect, which had a negative impact on the fluorescence signal at later time points. While SRL concentrations between 1 pM and 4 pM also resulted in an increasing fluorescence signal with increasing concentration, SRL concentrations above 5 pM led to lower fluorescence signals with higher concentrations. For the two STEC strains tested, Stx activity was shown to be optimally detected with an SRL concentration of 4 to 5 pM.This corresponds to substrate costs of approximately €0.4–€0.5 per sample. Based on the studies, an SRL concentration of 2 pM was also determined as the preferred minimum SRL concentration, which enables efficient Stx detection and ensures reliable detection. Considering the costs of developing this rapid test, the minimum SRL concentration of 2 pM was used for subsequent experiments, which corresponded to a reduction in the cost of SRL use by half.
[0257] Example 5 - Reaction temperatures of > 40 °C are advantageous for the detection of Stx activity in culture supernatants
[0258] Standard cultivation of STEC in the diagnosis of human infections is carried out at 37°C. However, better enrichment and recovery of STEC from food has been described with a cultivation temperature of 44°C (Tzschoppe et al., 2012; Amagliani et al., 2018). Therefore, a temperature range between 37°C and 57°C was investigated for the enzyme assay. Figure 10 shows the representative curves for the two STEC strains EDL933 (A) and 16-02409 (B). The graphs for the negative controls were considered negative with one exception: EDL933 .stxl / 2 showed a nonspecific reaction to the SRL substrate at temperatures above 57°C.
[0259] Stx activity increased with increasing temperature for EDL933 (A) and 16-02409 (B) in the temperature range between 37°C and 57°C. The RFU values for EDL933 were 1.25- to 5-fold lower than for 16-02409 at reaction temperatures below 55.8°C. An increase in RFU values was detected up to a reaction temperature of 57°C. All other reaction temperatures exhibited a flatter curve. For 16-02409, the increase in RFU values was smaller between 37°C and 49.5°C compared to reaction temperatures above 50°C. The curves rose more rapidly within the first two hours of reaction time for temperatures above 50°C, resulting in a steeper curve.
[0260] For EDL933, an overall reduced curve shape was observed for both the temperature gradient and the SRL substrate concentration compared to the STEC strain 16-02409. Since saturation effects during enzyme reactions can lead to reduced Stx activity (Bisswanger, 2014), Stx activity for EDL933 was determined using 1:2 and 1:5 diluted culture supernatants in a temperature gradient from 37 °C to 45 °C (Figure 10, C and D). The curve shapes exhibited the lowest RFU values in this range (cf. Figure 10, A). The reactions were carried out unchanged in 100 mM ammonium acetate, pH 4, with 2 pM SRL substrate. The negative controls showed no nonspecific reactions. At both dilutions, it was again shown that the higher the reaction temperature, the higher the RFU values and the curve shape. The temperature dependence was more pronounced the more the sample was diluted.By diluting the EDL933 culture supernatant, the RFU signal increased by 0.6-fold at 40 °C to 5-fold at 43.7 °C. Overall, a lower reaction temperature was achieved by diluting the sample. The adjusted conditions lead to Stx detection after a reaction time of 30 minutes to three hours. Both the dilution of the culture supernatants and the reaction temperature showed an influence on Stx activity. The reaction temperature was ideal for the given conditions at at least 44 °C.
[0261] Example 6 - Detection of Stx variants
[0262] Although STEC are characterized by great heterogeneity, for example, due to their serogroups, stx is defined as the virulence factor of all STEC. Stx is divided into two types based on their amino acid sequence: Stx1 and Stx2. They are approximately 56% identical in their sequence. These two Stx types are in turn divided into subtypes: For Stx1, three subtypes have currently been described (stx1a, stxlc, stxld), and for Stx2, following the introduction of the nomenclature in 2011 by Scheutz and colleagues (Scheutz et al., 2012), seven subtypes have been described: stx2a to stx2g. Although the Stx subtypes differ, the functionality of all Stx is similar and forms the basis for this enzyme assay. Therefore, different STEC strains were used to cover the diversity of Stx and tested for their activity.
[0263] Severe cases of HUS are particularly frequently caused by the Stx subtypes Stxla within Stxl, and by Stx2a and Stx2c within Stx2 (De Rauw et al., 2018; Byrne et al., 2020). Strains of the same serotype O157:H7 were selected for these Stx subtypes. Compared to the Stx2 culture supernatants, the Stx1 concentration was on average 7-fold lower. Overall, the Stx concentration varied considerably between the different strains under the same cultivation conditions. While the highest concentration was detected for Stx2a-d, the Stx concentration for Stx2e-g was 9- to 170-fold lower than for the heavily Stx2-producing STEC strains. This differential Stx expression could be demonstrated for all Stx-producing strains in both Western blot and Vero cell cytotoxicity assays.
[0264] Although the concentration of Stx1 in the culture supernatant is lower than that of Stx2 due to the lack of phage lysis (Wagner et al., 2002), the enzyme assay detected not only the Stx2 subtypes Stx2a-g used for the study, but also the Stx1 subtypes Stxl a and Stxl d (Figure 11, AB). The negative control EDL933 .stxl / 2 showed no Stx activity, thus confirming the negative results in the Western blot (Figure 11, C) and cytotoxicity assay (Figure 11, D). The Stx activity detected in the enzyme assay differed between the different strains. While the strongest signals after 12 hours of reaction time were detected for Stx2a with RFU = 97,309, Stx2b with RFU = 111,296 and Stx1a / 2a with RFU = 85,722, Stxla (RFU = 14,062), Stx2e (RFU = 19,653) and Stxld (RFU = 5,522) showed the lowest signals in the culture supernatant.
[0265] The gradation of Stx activity with the bands in the Western blot only approximated a correlation, so a high signal in the Western blot did not always equate with high Stx activity. The difference between Western blot signal and Stx activity was particularly evident when examining the two Stx1 a / 2a-producing strains EDL933 and 17-00261. While the signal in the Western blot showed comparable band intensity for both samples, the RFU signals differed by 2.5 times. Compared to EDL933, 17-00261 exhibited the stronger and overall third strongest fluorescence signal of all strains examined. This discrepancy in intensity was also evident in other strains. While a weaker signal was detected for the Stx2a-producing strain 16-02409 than for the two previously mentioned strains, the detected Stx activity was 1.1- and 2.7-fold higher, respectively.
[0266] Determination of the LOD showed that there was generally a correlation between Stx activity and Stx concentration (Stx ELISA) for StxIa, Stx2a, and Stx1a / 2a. To examine the extent to which this correlation allowed conclusions to be drawn from the measured fluorescence signal to the Stx concentration, the culture supernatants of eight of the previously tested strains were adjusted to a concentration of 80 ng / mL (results not shown). This concentration was within the linear range of the previously determined correlation lines. Direct comparison of the Stx activity of different Stx subtypes at the same concentration revealed differences in the fluorescence signals that differed by 3- to 5-fold.
[0267] Example 7 - STEC detection is independent of the serogroup
[0268] STEC are a diverse group of bacteria that are further characterized in diagnostics based, among other things, on the type of O and H antigens on their surface (Beutin et al., 2007). Currently, 185 O and 53 H antigens have been described, which can occur in various combinations in STEC (Iguchi et al., 2020). If STEC are grouped based on their O antigens, they belong to the same serogroup. O and H antigens in combination result in the serotype, for example, O157:H7. Since assessing the serogroup is particularly useful with regard to the development of HUS in STEC infections, 18 additional STEC strains from six different non-O157 serogroups (O26, O91, O111, O113, O121, O145) were analyzed. Three different strains from each serogroup were examined, one representative strain of which is shown in Figure 12.
[0269] Stx was detected in all strains by Western blot and cytotoxicity. The Stx subtypes of the tested strains determined by WGS included Stx1a, Stxlc, Stx2a, Stx2b, and Stx2d, whose activity was detected in the enzyme assay. Three of the strains exhibited a low fluorescence signal in the enzyme assay: 19-01474 (091, Stx1a / 2b), 19-01776 (091, Stx2d), and 16-03404 (0145, Stx2a). Comparison with the Western blot confirmed a low Stx concentration for these strains, thus demonstrating a correlation between Stx concentration and activity.
[0270] In the present example, a total of 64 STEC strains were examined, encompassing 21 different serogroups, and their Stx subtype, serogroup, and serotype were confirmed by whole genome sequencing (WGS). 38% of these strains were O157 (n = 27), and the remaining 62% were non-O157 (n = 37) from a total of 20 different serogroups. These strains also included three sorbitol-fermenting strains. Two of the 64 strains from different serogroups examined (3%) were negative in the enzyme assay using culture supernatants (O104 - Stxlc and O157 - Stx2c). All sorbitol-fermenting STEC O157:H strains were positive in the enzyme assay.
[0271] Example 8 - Stx-producing Shiaella can be detected with the Enzvmassav
[0272] Shiga toxin was originally described for the bacterium Shigella. Later studies were able to demonstrate the production of Stx in STEC and the close relationship between Stx. Similar to STEC, Shigella produces Stx1 and Stx2. Stx1 is produced by Shigella dysenteriae, and Stx2 by Shigella flexneri. Since Stx1 and Stx2 are comparable toxins to those produced by STEC, detection of Stx produced by Shigella was expected through the enzyme assay. To test this assumption, five S. dysenteriae and six S. flexneri strains were tested for their Stx production and Stx activity. The results for a representative strain are shown in Figure 13.
[0273] In all S. dysenteriae strains, as with Stx1-producing STEC, Stx1 production could be detected via its cytotoxic effect on Vero cells, but not in the enzyme assay. In S. flexneri, no Stx production could be detected in the Western blot and cytotoxicity assay, and no Stx activity could be detected in the enzyme assay for three of the six strains. For the remaining three S. flexneri strains, both Stx production and strong Stx activity could be demonstrated in the enzyme assay. Analogous to the Western blot signal and the observed cytotoxicity, Stx activity was stronger in all three cases than that of the reference strain EDL933. Based on the investigations, it was shown that Stx2-producing S. flexneri can be detected using the rapid test for Shigella by detecting Stx activity.
[0274] 9 - No cross-reactivity with other, stx-\ E. coli in
[0275] (Bloody) diarrhea and intestinal inflammation can be caused by other enteric pathogens besides STEC. Based on the type of diarrhea, an initial suspicion can narrow down the primary diagnostic workup. To rule out possible cross-reactivity of other enteric pathogens in the enzyme test for STEC, other pathogens causing diarrheal diseases were included in the study. The study focused on both other enteric pathogens E. coli, such as EAEC, and other enteric pathogens such as Yersinia. These studies were intended to assess the specificity of the enzyme test.
[0276] In addition to Shiga toxin-producing E. coli (STEC), other pathogenic E. coli can cause diarrheal diseases. These include EAEC, EPEC, EIEC, and ETEC. These pathogenic E. coli are related to STEC but do not produce Shiga toxin. To rule out potential nonspecific cross-reactivity, for example, due to other enzymes of pathogenic E. coli, six strains were included to investigate test accuracy.
[0277] Figure 14 shows the results of the investigations. No Shiga toxin production could be detected in the Western blot or cytotoxicity assay for the six strains tested. Vero cell viability was only slightly affected and, for the culture supernatants of pathogenic E. coli, was at the level of the negative control EDL933 1sfxf / 2. In the enzyme assay for the detection of Stx activity, Stx activity was detected only for the positive controls EDL933 (stx1a / 2a) and 16-02409 (stx2a), but not for EPEC, EAEC, or EIEC. This result was consistent with those for the detection of Stx. With the exception of one strain, the curves for the strains showed consistently low RFU values of 1200 after a reaction time of 12 hours. The curve of one strain (01-05814, EPEC) increased minimally from approximately 7 h of reaction time to an RFU of 1500. Nevertheless, the curve is significantly negative and approximately at the level of the negative control EDL933 1sfxf / 2.The two Stx-positive control strains were clearly positive in the enzyme assay after 1 h and 2 h reaction time, respectively, so that the slight increase in the curve of the EPEC strain 01-05814 represented normal behavior in the assay.
[0278] Example 10 - Other stx-negative, intestinal pathogens
[0279] Additional pathogens causing diarrheal diseases were included in the investigation of the accuracy of the enzyme assay, so that a total of four strains of Yersinia enterocolitica and six strains of Salmonella spp. were examined (Figure 15). For Salmonella, the four serovars S. Typhimurium, S. Enteritidis, S. Virginia, and S. Infantis were selected. Two strains each were examined for the two clinically relevant serovars S. Typhimurium and S. Enteritidis. For none of the strains, Stx production could be detected in the Western blot or cytotoxicity assay, nor could enzymatic activity be detected in the enzyme assay. At all time points during the reaction, the RFU values of all enteric pathogens were below the values of the negative control. After a reaction time of two hours, the positive control EDL933 was determined to be significantly positive.
[0280] Based on the strains of intestinal pathogenic E. coli and other pathogens examined, it was shown that these pathogens, which also cause diarrheal diseases, do not show any enzymatic activity in the enzyme assay towards the specific SRL substrate.
[0281] Example 11 - The detection limit of the enzyme assay is in the nq / mL range
[0282] The culture supernatants of the selected strains, quantified by Stx ELISA, were used to determine the detection limit of the method according to the invention ("enzyme assays"). Based on the calculated Stx concentration, a dilution series with eight dilution steps in arithmetic dilution was created for each of the three Stx-producing strains. The concentration ranges of the dilution series were approximately the same for EDL933, stx1a / 2a, between 1 ng / mL and 113 ng / mL, for 20-01044, stx1a, between 1 ng / mL and 126 ng / mL, and for 16-02409, stx2a, between 1 ng / mL and 138 ng / mL. The LOD was determined for three strains expressing different Stx subtypes, since no comparison of activities of different Stx subtypes has been described in the literature so far.
[0283] For all three STEC strains tested, comparable curves were observed between the Stx concentration used and the measured fluorescence (results not shown). The linear increase was between 35 ng / mL and 126 ng / mL for 20-01044, stx1a, for 16-02409, between 25 ng / mL and 138 ng / mL for stx2a, and between 30 ng / mL and 113 ng / mL for EDL933, stx1a / 2a. A positive Pearson correlation (p > 0.0001) was observed for all three graphs in the linear range. The higher the Stx concentration, the higher the measurable RFU values.
[0284] Using a linear regression over the entire curve, the respective detection limits were calculated for all three samples. The regression curve best approximated the measured values for Stxl a (R 2 = 0.9806), for Stx2a the worst in comparison (R 2= 0.8694). The resulting detection limits ranged between 11 and 29 ng / mL for the Stx activity of the culture supernatants used and differed slightly between the Stx subtypes.
[0285] Example 12 - Specific Detection of Stx Variants Using DNA Constructs The substrate StxSense4 was tested as a DNA- and RNA-based substrate using the standard assay conditions (see above). Compared to the DNA-based substrate, no specific Shiga toxin activity was detected for RNA StxSense4 (SEQ ID NO: 29) for the STEC strain EDL933 O157:H7, stx1a / 2a (Figure 20). Consequently, an RNA-SRL substrate (StxSense4 RNA; SEQ ID NO: 29), based on the successful DNA sequence StxSense4, is not suitable for the desired detection of Stx activity.
[0286] Example 13 - Additional DNA SRL substrates
[0287] In this experiment, the substrates StxSense1-4 (SEQ ID NO: 4-7) and six other DNA-SRL substrates (StxSense6, StxSense9, StxSense12, StxSense15, StxSense16, see Table 6) were tested in the enzyme assay according to the invention using the previous standard assay conditions (see above) with two STEC strains (Figures 17-18) and one Stx knockout mutant (Figure 19).
[0288] Table 6: Overview of the substrates used
[0289] In addition to the SRL substrate StxSense4 (SEQ ID NO: 7), the substrates StxSense12 (SEQ ID NO: 13), StxSense15 (SEQ ID NO: 16), and StxSense16 (SEQ ID NO: 17) were also suitable for positive Stx detection. A larger loop structure (StxSense12) in particular enhanced Stx activity and thus the RFU signal. Substrates without a loop structure (StxSense9; SEQ ID NO: 27) or the central sequence GAGA (StxSenseö; SEQ ID NO: 28), in contrast, significantly reduced the RFU signal. No nonspecific reaction was detected for any of the substrates with the knockout mutant EDL933 O157:H7 Astx1 / 2 or the culture medium LB.
[0290] Example 14 - Detection in stool samples
[0291] Sixteen stool samples (9 sfx-PCR positive, 6 sfx-PCR negative) and stool samples spiked with Stx culture supernatant were analyzed with the substrates according to the invention. The results showed that Stx could be detected directly in stool samples or after enrichment.
[0292] Referenzen
[0293] Amagliani, G., Rotundo, L, Carloni, E., Omiccioli, E., Magnani, M., Brandi, G., & Fratamico, P. (2018). Detection of Shiga toxin-producing Escherichia coli (STEC) in ground beef and bean sprouts: Evaluation of culture enrichment conditions. Food Research International, 103, 398-405. https: / / doi.Org / 10.1016 / J.FOODRES.2017.10.059
[0294] Basu, D., Li, X. P„ Kahn, J. N„ May, K. L, Kahn, P. C., & Turner, N. E. (2015). The A1 subunit of Shiga toxin 2 has higher affinity for ribosomes and higher catalytic activity than the A1 subunit of Shiga toxin 1. Infection and Immunity, 84(1), 149-161. https: / / doi.org / 10.1128 / IAI.00994-15
[0295] Becher F et al. Detection of functional ricin by immunoaffinity and liquid chromatography-tandem mass spectrometry. Anal Chem 2007 Jan 15;79(2):659-606.
[0296] Beddoe, T., Paton, A. W., Le Nours, J., Rossjohn, J., & Paton, J. C. (2010). Structure, Biological Functions and Applications of the AB5 Toxins. Trends in Biochemical Sciences, 35(7), 411 . https: / / doi.Org / 10.1016 / J.TIBS.2010.02.003
[0297] Bergan, J., Dyve Lingelem, A. B., Simm, R., Skotland, T., & Sandvig, K. (2012). Shiga toxins. Toxicon, 60(6), 1085-1107. https: / / doi.Org / 10.1016 / j.toxicon.2012.07.016
[0298] Beutin, L., Miko, A., Krause, G., Pries, K., Haby, S., Steege, K., & Albrecht, N. (2007). Identification of human-pathogenic strains of shiga toxin-producing Escherichia coli from food by a combination of serotyping and molecular typing of Shiga toxin genes. Applied and Environmental Microbiology, 73(15), 4769-4775. https: / / doi.Org / 10.1128 / AEM.00873-07 / ASSET / AA811C1 D-487C-40A3-8866- 00AA6F26DFC4 / ASSETS / GRAPHIC / ZAM0150780370002.JPEG
[0299] Brigotti, M., Carnicelli, D., Ravanelli, E., Vara, A. G., Martinelli, C., Alfieri, R. R., Petronini, P. G., & Sestili, P. (2007). Molecular damage and induction of proinflammatory cytokines in human endothelial cells exposed to shiga toxin 1 , shiga toxin 2, and a-sarcin. Infection and Immunity, 75(5), 2201-2207. https: / / doi.org / 10.1128 / IAI.01707-06
[0300] Byrne, L., Adams, N., & Jenkins, C. (2020). Association between Shiga Toxin-Producing Escherichia coli O157:H7 stx Gene Subtype and Disease Severity, England, 2009-2019. Emerging Infectious Diseases, 26(10), 2394. https: / / doi.org / 10.3201 / EID2610.200319
[0301] Chan YS, Ng TB. Shiga toxins: from structure and mechanism to applications. Appl Microbiol Biotechnol. 2016 Feb;100(4):1597-610.
[0302] COMMISSION Staff Working Document. Lessons learned from the 2011 outbreak of Shiga toxinproducing Escherichia coli (SEC) O104:H4 in sprouted seeds. Commission of the European Communities. https. / / ec.europa.eu / food / sites / food / files / safety / docs / biosafety-crisis- cswd_lesson_learned_en.pdf.
[0303] Croxen MA, Law RJ, Scholz R, Keeney KM, Wlodarska M, Finlay BB. Recent advances in understanding enteric pathogenic Escherichia coli. Clin Microbiol Rev. 2013 Oct;26(4):822-80. De Rauw, K., Jacobs, S., & Pierard, D. (2018). Twenty-seven years of screening for Shiga toxinproducing Escherichia coli in a university hospital. Brussels, Belgium, 1987-2014. PLOS ONE, 13(7), e0199968. https: / / doi.Org / 10.1371 / JOURNAL.PONE.0199968
[0304] Deleavey GF, Damha MJ. Designing chemically modified oligonuclotides for targeted gene silencing. Chem Biol. 2012 Aug 24;19(8):937-54.
[0305] Endo, Y., & Tsurugi, K. (1988). The RNA N-glycosidase activity of ricin A-chain. The characteristics of the enzymatic activity of ricin A-chain with ribosomes and with rRNA. Journal of Biological Chemistry, 263(18), 8735-8739. https: / / doi.Org / 10.1016 / S0021 -9258(18)68367-X
[0306] Epid Bull 2016;44:489-93.
[0307] Fagerquist CK et al. Top-Down proteomic identification of Shiga toxin 2 subtypes from Shiga toxinproducing Escherichia coli by matrix-assisted laser desorption ionization-tandem time of light mass spectrometry. Appl Environ Microbiol 2014 May;80(9):2928-40.
[0308] FDA Bacteriological Analytical Manual, 8th Edition 1995, Chapter 4, Feb;2(2):123-40.
[0309] Flieger A, Mielke M, Tietze E. Role of pathogen surveillance and subtyping for outbreak detection of foodborne bacterial infections – a microbiological perspective – goals, methods, and perspectives of pathogen subtyping. Federal Health Gazette Health Research Health Protection 2013;56(1):42-6.
[0310] Frank C et al. Epidemic profile of Shiga-toxin-producing Escherichia coli O104:H4 outbreak in Germany. N Engl J Med. 2011 Nov 10;365(19):1771-80.
[0311] Fruth A et al. Network for Molecular Surveillance of EHEC Infections in Germany.
[0312] Fruth A et al. Network for Molecular Surveillance of EHEC Infections in Germany. Epid Bull 2016;44:489-93.
[0313] Fruth A, Prager R, Tietze E, Rabsch W, Flieger A. Molecular epidemiological view on Shiga toxinproducing Escherichia coli causing human disease in Germany: Diversity, prevalence, and outbreaks. Int J Med Microbiol. 2015 Oct;305(7):697-704. Review.
[0314] Garcia A, Fox JG, Besser TE. Zoonotic enterohemorrhagic Escherichia coli: A One Health perspective. ILAR J. 2010;51 (3):221-32.
[0315] Garred O, van Deurs B, Sandvig K. Furin-induced cleavage and activation of Shiga toxin. J Biol Chem. 1995 May 5;270(18):10817-21 .
[0316] Glück, A., Endo, Y., & Wool, I. G. (1992). Ribosomal RNA identity elements for ricin A-chain recognition and catalysis: Analysis with tetraloop mutants. Journal of Molecular Biology, 226(2), 411- 424. https: / / doi.Org / 10.1016 / 0022-2836(92)90956-K
[0317] Gobert AP et al. Moculation of chemokine gene expression by Shiga-toxin producing Escherichia coli belonging to various origins and serotypes. Microbes Infect. 2008 Feb;10(2):159-65. Hull AE, Acheson DW, Echeverria P, Donohue-Rolfe A, Keusch GT. Mitomycin immunoblot colony assay for detection of Shiga-like toxin-producing Escherichia coli in fecal samples: comparison with DNA probes. J Clin Microbiol. 1993 May;31 (5):1167-72.
[0318] Iguchi, A., Nishii, H., Seto, K., Mitobe, J., Lee, K., Konishi, N., Obata, H., Kikuchi, T., & lyoda, S. (2020). Additional og-typing PCR techniques targeting escherichia coli-novel and shigella-unique O- antigen biosynthesis gene clusters. Journal of Clinical Microbiology, 58(11). https: / / doi.org / 10.1128 / JCM.01493-20 / SUPPL_FILE / JCM.01493-20-S0001.PDF lordanov, M. S., Pribnow, D., Magun, J. L., Dinh, T.-H., Pearson, J. A., Li, S., Chen, -Ye, & Magun, B. E. (1997). Ribotoxic stress response: activation of the stress-activated protein kinase JNK1 by inhibitors of the peptidyl transferase reaction and by sequence-specific RNA damage to the alpha- sarcin / ricin loop in the 28S rRNA. Molecular and Cellular Biology, 17(6), 3373-3381 . https: / / doi.Org / 10.1128 / MCB.17.6.3373
[0319] Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004.
[0320] Karch H et al. The enemy within us: lessons from the 2011 European Escherichia coli O104:H4 outbreak. EMBO Mol Med. 2012 Sep;4(9):841-8.
[0321] Case JA, Maunounen-Lasri A, Son I, Lin A, Hammack TS. Comparison of eight different agars for recovery of clinically relevant non-0157 Shiga toxin-producing Escherichia coli from baby spinach, cilantro, alfalfa sprouts and raw milk. Food Microbiology 46(2015):280-287
[0322] Kimmitt , PT , Harwood , CR , & Barer , MR (2000). Toxin gene expression by shiga toxin-producing Escherichia coli: the role of antibiotics and the bacterial SOS response. Emerging Infectious Diseases, 6(5), 458. https: / / doi.org / 10.3201 / EID0605.000503
[0323] Kurmanova A et al. Structural requirements for furin-induced cleavage and activation of Shiga toxin. Biochem Biophys Res Commun. 2007 May 25;357(1):144-9.
[0324] Lang C et al. Zinc metalloproteinase ProA directly activates Legionella pneumophila PlaC glycerophospholipid:cholesterol acyltransferase. J Biol Chem. 2012 Jul 6;287(28):23464-78.
[0325] Lang C, Hiller M, Flieger A. Disulfide loop cleavage of Legionella pneumophila PlaA boosts lysophospholipase A activity. Sei Rep. 2017 Nov 24;7(1):16313.
[0326] Li, X.-P., Turner, N. E., Barbier, J., & Gillet, D. (2017). Differences in Ribosome Binding and Sarcin / Ricin Loop Depurination by Shiga and Ricin Holotoxins. Toxins 2017, Vol. 9, Page 133, 9(4), 133. https: / / doi.Org / 10.3390 / TGXINS9040133
[0327] Mao, H., Luo, G., Zhan, Y., Zhang, J., Yao, S., & Yu, Y. (2018). The mechanism and regularity of quenching the effect of bases on fluorophores: the base-quenched probe method. Analyst, 143(14), 3292-3301. https: / / doi.org / 10.1039 / C8AN00116B
[0328] Marras SAE, Kramer FR, Tyagi S. Efficiencies of fluorescence resonance energy transfer and contact- mediated quenching in oligonucleotide probes. Nucleic Acids Research, 2002, 30(21): e122, Melton-Celsa AR, Kokai-Kun JF, O’Brien AD. Activation of Shiga toxin type 2d (Stx2d) by elastase involves cleavage of the C-terminal two amino acids of the A2 pepetide in the context of the appropriate B pentamer. Mol Microbiol. 2002 Jan;43(1):207-15.
[0329] Melton-Celsa AR, O’Brien AD. New Therapeutic Developments against Shiga Toxin-Producing Escherichia coli. Microbiol Spectr. 2014 Oct;2(5).
[0330] Noble, J. E., Wang, L, Cole, K. D., & Gaigalas, A. K. (2005). The effect of overhanging nucleotides on fluorescence properties of hybridising oligonucleotides labelled with Alexa-488 and FAM fluorophores. Biophysical Chemistry, 113(3), 255-263. https: / / doi.Org / 10.1016 / J.BPC.2004.09.012
[0331] Olsnes S, Reisbig R, Eiklid K. Subunit structure of Shigella cytotoxin. J Biol Chem. 1981 Aug 25;256(16):8732-8.
[0332] Perna, N. T., Plunkett, G., Burland, V., Mau, B., Glasner, J. D., Rose, D. J., Mayhew, G. F., Evans, P.
[0333] S., Gregor, J., Kirkpatrick, H. A., Posfai, G., Hackett, J., Klink, S., Boutin, A., Shao, Y., Miller, L, Grotbeck, E. J., Davis, N. W., Lim, A., ... Blattner, F. R. (2001). Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 2001 409:6819, 409(6819), 529-533. https: / / doi.Org / 10.1038 / 35054089
[0334] Persad AK, LeJeune JT. Animal Reservoirs of Shiga Toxin-Producing Escherichia coli. Microbiol Spectr. 2014 Aug;2(4):EHEC-0027-2014.
[0335] Prochnow H et al. Subecllular quantification of uptake in Gram-negative bacteria. Anal Chem 2018 Nov 28. doi: 10.1021 / acs.analchem.8b03586. [Epub ahead of print]
[0336] Robert Koch Institute (RKI). Infectious Epidemiological Yearbook of Notifiable Diseases for
[0337] 2016. Berlin 2017.
[0338] Robert Koch Institute (RKI). Infectious Epidemiological Yearbook of Notifiable Diseases for
[0339] 2017. Berlin 2018.
[0340] Roday, S., Sturm, MB, Blakaj, D., & Schramm, VL (2008). Detection of an abasic site in RNA with stem-loop DNA beacons: Application to an activity assay for Ricin Toxin A-Chain. Journal of Biochemical and Biophysical Methods, 70(6), 945-953. https: / / doi.Org / 10.1016 / J.JPROT.2007.12.010
[0341] Scheutz F et al. Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature. J Clin Microbiol. 2012 Sep;50(9):2951-63.
[0342] Scotland, S. M., Rowe, B., Smith, H. R., Willshaw, G. A., & Gross, R. J. (1988). Vero cytotoxin- producing strains of Escherichia coli from children with haemolytic uraemic syndrome and their detection by specific DNA probes. Journal of Medical Microbiology, 25(4), 237-243. https: / / doi.org / 10.1099 / 00222615-25-4-237 / CITE / REFWGRKS
[0343] Tesh, V. L, Burris, J. A., Owens, J. W., Gordon, V. M., Wadolkowski, E. A., O’brien, A. D., Samuel3, J. E., Wadolkowski, E. A., Sung, L. M., Burris, J. A., Samuel, J. E., & O’brien, A. D. (1993). Comparison of the relative toxicities of Shiga-like toxins type I and type II for mice. Infection and Immunity, 61 (8), 3392-3402. https: / / doi.Org / 10.1128 / IAI.61.8.3392-3402.1993 Tzschoppe, M., Martin, A., & Beutin, L. (2012). A rapid procedure for the detection and isolation of enterohaemorrhagic Escherichia coli (EHEC) serogroup 026, 0103, O111 , O118, 0121 , 0145 and 0157 strains and the aggregative EHEC O104:H4 strain from ready-to-eat vegetables. International Journal of Food Microbiology, 152(1-2), 19-30. https: / / doi.Org / 10.1016 / J.IJFOODMICRO.2011.10.009
[0344] Wagner, P. L, Livny, J., Neely, M. N., Acheson, D. W. K., Friedman, D. I., & Waldor, M. K. (2002). Bacteriophage control of Shiga toxin 1 production and release by Escherichia coli. Molecular Microbiology, 44(4), 957-970. https: / / doi.Org / 10.1046 / J.1365-2958.2002.02950.X
[0345] Wang J et al. Rapid Detection of Escherichia coli 0157 and Shiga Toxins by Lateral Flow Immunoassays. Toxins 2016,8;(4),92.
Claims
PATENT CLAIMS 1. Oligonucleotide comprising a) a nucleotide sequence of a sarcin-ricin loop (SRL) of a eukaryotic / mammalian 60S ribosomal subunit, wherein the SRL nucleotide sequence comprises at least one adenine, and b) at least one cleavage-dependent label, wherein the oligonucleotide is single-stranded and preferably forms at least one loop or stem-loop structure.
2. Oligonucleotide according to claim 1, wherein the at least one cleavage-dependent label comprises at least one fluorophore and at least one quencher, wherein preferably the at least one fluorophore and at least one quencher are arranged such that the at least one quencher quenches the fluorescence of the at least one fluorophore as long as the oligonucleotide is uncleaved.
3. Oligonucleotide according to one of the preceding claims, wherein the at least one cleavage-dependent label comprises at least one label at the 3' end and / or at least one label at the 5' end of the oligonucleotide.
4. Oligonucleotide according to one of the preceding claims, wherein the oligonucleotide is a single-stranded RNA (ssRNA) or DNA (ssDNA).
5. Oligonucleotide according to one of the preceding claims, wherein the oligonucleotide further comprises at least one linker sequence between the SRL nucleotide sequence and the at least one label, preferably wherein a 5' linker sequence comprises ACTT, and / or a 3' linker sequence comprises AGT.
6. Oligonucleotide according to one of the preceding claims, wherein the SRL nucleotide sequence comprises at least one GAGAG sequence.
7. Oligonucleotide according to one of the preceding claims, wherein the SRL nucleotide sequence comprises at least one sequence AGTACGAGAGGAAC (SEQ ID NO: 3).
8. Oligonucleotide according to one of the preceding claims, wherein the SRL nucleotide sequence comprises at least one sequence ACTTAGTACGAGAGGAACAGT (SEQ ID NO: 7).
9. Oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide forms a single loop or stem-loop structure, and preferably comprises less than 26 nucleotides.
10. Oligonucleotide according to one of the preceding claims, wherein the oligonucleotide is present in a reaction or detection solution or bacterial growth medium or in a mixture of the foregoing.
11. A method for detecting an active Shiga toxin in a sample comprising the steps: a) providing at least one single-stranded oligonucleotide according to claims 1-10, b) Providing a sample to be tested for Shiga toxin c) Incubating the sample with the at least one single-stranded oligonucleotide, d) Detecting a signal from a label, wherein a signal is indicative of the presence of a Shiga toxin in the sample.
12. The method according to claim 11, wherein in step c) a signal is generated as soon as a Shiga toxin depurinates the oligonucleotide at the at least one adenine, whereby the oligonucleotide is cleaved.
13. The method according to claim 11-12, wherein the Shiga toxin contained in the sample is selected from the group comprising Stx1, Stx2, Stx1a-d, and Stx2a-g or other Stx types or subtypes.
14. The method according to any one of claims 11-13, wherein the method comprises detecting a Shiga toxin-producing pathogen, wherein the Shiga toxin-producing pathogen is a Shiga toxin-producing E. coli bacterium (STEC), Acinetobacter bacterium or Shigella bacterium.
15. The method according to any one of claims 11-14, wherein the oligonucleotide in step a) is present in an agar medium and the sample in step b) is applied to the agar medium, and / or wherein the detection in step d) detects a signal recognition in the agar medium.
16. The method according to any one of claims 11-15, wherein the oligonucleotide in step a) is present in a liquid reaction solution or detection solution and the sample in step b) is introduced into the liquid reaction medium.
17. Kit comprising at least a) an oligonucleotide according to claim 1-10, and b) optionally at least one reaction and / or detection solution, wherein the reaction and / or detection solution is preferably a depurination buffer comprising ammonium acetate.