Plants with dual herbicide resistance
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-05-16
- Publication Date
- 2026-03-25
AI Technical Summary
Current crop plants lack dual resistance to HPPD-inhibiting and AHAS-inhibiting herbicides, necessitating the development of cultivars tolerant to both types of herbicides to effectively manage weeds without relying on a single mode of action.
Sorghum plants with specific mutations, including a serine residue at position 445 of the HPPD enzyme and an alanine to tyrosine substitution at position 93 of the AHAS enzyme, confer dual resistance to HPPD and AHAS inhibitor herbicides, allowing for tolerance to both herbicide types.
The dual-resistant sorghum plants exhibit enhanced biomass accumulation and survival when treated with both HPPD and AHAS inhibitor herbicides, offering improved weed control and reduced herbicide usage.
Smart Images

Figure IMGF000028_0001 
Figure IMGF000039_0001 
Figure IMGF000050_0001
Abstract
Description
[0001] PLANTS WITH DUAL HERBICIDE RESISTANCE CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No.63 / 502,737, filed May 17, 2023 which is incorporated herein by reference in its entirety. INCORPORATION OF SEQUENCE LISTING A sequence listing contained in the file name “txt_Plants with Dual Herbicide Resistance” which is 42,424 bytes and was created on April 19, 2024, is filed electronically herewith and incorporated by reference in its entirety. FIELD OF THE INVENTION The present invention is in the field of plants that are tolerant to HPPD-inhibiting herbicides and AHAS-inhibiting herbicides. BACKGROUND Weeds compete with crop plants for water, nutrients, sunlight, and space and may also harbor insect and disease pests. The growth of weeds in crop fields should therefore be avoided. Manual weeding has become very expensive as a result of increasing labour costs and farmers are therefore increasingly opting for cultivars tolerant to herbicides. Herbicides can be classified according to their mode of action. Classification by mode of action (MOA) indicates the first enzyme, protein, or biochemical step affected in the plant following application. Two well-known classes of herbicides target the enzymes 4- hydroxyphenylpyruvate dioxygenases (HPPD) and acetohydroxyacid synthase (AHAS / ALS). The 4-hydroxyphenylpyruvate dioxygenases (HPPDs) are enzymes which catalyze the reaction in which para-hydroxyphenylpyruvate, a tyrosine degradation product, is transformed into homogentisate, the precursor in plants of tocopherol and plastoquinone. Tocopherol acts as a membrane-associated antioxidant. Plastoquinone, firstly acts as an electron carrier between PSII and the cytochrome b6 / f complex and secondly, is a redox cofactor for phytoene desaturase, which is involved in the biosynthesis of carotenoids. While the overall products of this cycle are used to create energy, plants and higher order eukaryotes utilize HPPD for a much more important reason. In plants, HPPD helps to produce the cofactors plastoquinone and tocopherol which are essential for the plant to survive. When HPPD is inhibited, this leads to photosynthesis uncoupling, accessory light-harvesting pigments deficiency and, destruction of chlorophyll by UV-radiation and reactive oxygen species (bleaching) due to the lack of photo protection normally provided by carotenoids, thus leading to plant death. There are some molecules that inhibit HPPD and are known as HPPD inhibiting herbicides. There are various HPPD inhibiting herbicides that are commercially available and are important to control unwanted weeds in the field. To extend the scope of use of these herbicides there is a consistent effort to develop commercially important plant varieties that are resistant to such herbicides without underperforming other metabolic tolerance. Patent application WO 2009 / 144079 discloses a mutated hydroxyphenylpyruvate dioxygenase (HPPD) at position 336 of the Pseudomonas fluorescens HPPD protein and its use for obtaining plants which are tolerant to HPPD inhibitor herbicides. Patent application WO 2008 / 150473 discloses two distinct tolerance mechanisms - a modified Avena sativa gene coding for a mutant HPPD enzyme and a CYP450 Maize monooxygenase (nsf1 gene) - was exemplified to obtain an improved tolerance to HPPD inhibitor herbicides, but no data have been disclosed demonstrating the synergistic effects based on the combination of both proteins. Patent US8853496 discloses sequences encoding a hydroxyphenylpyruvate dioxygenase obtained from Blepharisma japonicum and the use of such nucleic acid sequences, proteins or chimeric genes for obtaining plants which are tolerant to HPPD inhibitor herbicides. The acetohydroxy acid or acetohydroxyacid synthase (AHAS) enzyme (also known as acetolactate synthase (ALS)) is a protein found in plants and micro-organisms. It catalyzes the first step in the synthesis of the branched-chain amino acids valine, leucine, and isoleucine. AHAS catalyzes the condensation of two molecules of pyruvate to form acetolactate and CO2, or the condensation of one molecule of pyruvate with one molecule of α-ketobutyrate to form α-aceto-α-hydroxybutyrate and CO2. The enzyme has two subunits: a catalytic subunit and a regulatory subunit. Branched-chain amino acids are essential for plant growth and development, and inhibition of their synthesis is lethal to many plant species. Inhibitors of AHAS are used as herbicides that slowly starve affected plants of these amino acids, which eventually leads to inhibition of DNA synthesis. They affect grasses and dicots alike. The AHAS inhibitor family includes sulfonylureas, imidazolinones, triazolopyrimidines pyrimidinyl oxybenzoates, and sulfonylamino carbonyl triazolinones. Several variant AHAS genes conferring imidazolinone tolerance were introduced in plants from existing germplasm, through mutagenesis or transgenesis and selection. Sebastian et al., (1989) Crop Sci., 29: 1403-1408 discloses a soybean mutation that leads to resistance to sulfonylurea herbicides. Sathasivan et al., (1991) Plant Physiol., 97: 1044-1050 describes an imazapyr-resistant mutant GH90 of Arabidopsis thaliana. Examples of other imidazolinone tolerant crops are maize (Zea mays L; Swanson et al., 1989 Theor. Appl. Genet. 78: 525-530; Newhouse et al., (1991) Theor. Appl. Genet., 83: 65-70), wheat (Triticum aestivum L), rice (Oryza sativa L; U.S. Patent No.5,545,822), oilseed rape (Brassica napus L) and sunflower (Helianthus annuus L; WO 2007 / 0118920). Plants resistant to herbicides of the imidazolinone or sulfonylurea type have also been detected in various germplasm. These plants have acquired resistance naturally and have been used for cross-breeding, resulting in herbicide-resistant varieties. From the analysis of resistant plants, a point mutation was determined in the AHAS protein of sunflower resulting in the substitution of the amino acid Ala by Val (White et al., (2003) Weed Sci., 51: 845-853). All these examples are related to crops that are resistant to one type of herbicide. However, one of the most important methods for preventing, delaying, or managing resistance is to reduce the reliance on a single herbicide mode of action. But when herbicides are used with two or more different modes of action it is also necessary to provide crop plants that are tolerant to the different herbicides used. SUMMARY OF THE INVENTION The present invention relates to plants that have a combined tolerance to HPPD inhibitors and AHAS inhibitors. The mutations leading to these tolerances are stacked in the plants of the invention. The plants of the invention are in particular sorghum plants. The tolerance to HPPD inhibitors is the result of a mutation which has been found to impart resistance or tolerance to an HPPD inhibiting herbicide in a sorghum plant. The mutation leads to a serine residue at amino acid position 445 of SEQ ID NO: 3. The presence of the serine residue at position 445 in SEQ ID NO: 3 has been shown to provide resistance or tolerance to an HPPD inhibiting herbicide in a plant. The tolerance to AHAS inhibitors is the result of a mutation that leads to an alanine to tyrosine substitution at position 93 of the large subunit of sorghum AHAS. These two mutations may also be introduced or induced in other crops to yield crops that are tolerant to both HPPD inhibitor herbicides and AHAS inhibitor herbicides. The amino acid substitution is then in an equivalent position. The combined tolerance or resistance to HPPD inhibiting herbicides and AHAS inhibiting herbicides will be called herein “dual resistance”. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 illustrates the dry matter for each genotype following herbicide treatment. FIG. 2 illustrates phototoxicity trials of single (A) and dual (B) herbicide tolerance. DETAILED DESCRIPTION As used in the specification and the appended claims, terms in the singular and the singular forms “a”, “an” and “the”, for example, include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “plant”, “the plant” or “a plant” also includes plurality of plants; also, depending on the context, use of the term “plant” can also include genetically similar or identical progeny of that plants; use of the term “a nucleic acid” optionally includes, as a practical matter, many copies of that nucleic acid molecule; similarly, the term “probe” optionally and typically encompasses many similar or identical probe molecules. Certain definitions used in claims and description are defined below to provide a clear and consistent understanding of the specification and claims including the scope to be given such terms. An “allele” refers to a genetic code in any of one or more alternative forms of a gene which relate to one trait or characteristic. In a diploid cell or organism, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes. With regard to a SNP marker, an allele refers to the specific nucleotide base present at the SNP locus in that individual plant. As used herein, “germplasm” means the genetic material that comprises the physical foundation of the hereditary qualities of an organism. Germplasm includes seeds and living tissue from which new plants may be grown; or, another plant part, such a leaf, stem, pollen, or cells, that may be cultured into a whole plant. Germplasm resources provide sources of genetic traits used by plant breeders to improve commercial cultivars. As used herein, “plant” refers to a whole plant or a cell or tissue culture derived from a plant, comprising any of: whole plants, plant components or organs (e.g., leaves, stems, roots, etc.), plant tissues, seeds, plant cells, and / or progeny of the same. A progeny plant can be from any filial generation, e.g., F1, F2, F3, F4, F5, F6, F7, etc. A plant cell is a biological cell of a plant, taken from a plant or derived through culture from a cell taken from a plant. Plant parts include harvestable parts and parts useful for propagation of progeny plants. Plant parts useful for propagation include, for example and without limitation: seed; fruit; a cutting; a seedling; a tuber; leaf, stem, bud, root, root tip, anther, seed, grain, embryo, pollen, ovule, flower, rootstock, cotyledon, pod, tissue culture, cell culture, or any biological material derived from the plant like nucleic acid, and the like. A harvestable part of a plant may be any useful part of a plant, including, for example and without limitation: flower; pollen; seedling; tuber; leaf; stem; fruit; seed; and root. Plant cells, as used herein, includes protoplasts and protoplasts with a cell wall. A plant cell may be a protoplast, a gamete producing cell, or a cell or collection of cells that can regenerate into a whole plan such as plant seeds, plant tissue suspension culture, plant tissue, plant tissue explant, plant embryo, plant parts, meristematic tissue, callus tissue, leaf, root, shoot, gametophyte, sporophyte, pollen, microspores and like. As used herein, “herbicides” are the chemicals that are used to kill unwanted plants. Here herbicides include herbicides that have mode of action of an HPPD inhibitor and or AHAS. Reference to a herbicide may include one or more herbicides. Herbicides include, but are not limited to, tolpyralate, fenquinotrione, mesotrione, tefuryltrione, isoxaflutole, pyrasulfotole, benzobicyclon, benzofenap, pyrazolynate, pyrazoxyfen, bicyclopyrone, sulcotrione, tembotrione, topramezone. “Sequence identity” is the percentage of nucleotides or amino acids that is identical between two sequences after proper alignment of those sequences. The person skilled in the art is aware of how to align sequences. To obtain the most significant result, the best possible alignment that gives the highest sequence identity score should be obtained. The sequences are compared over the length of the shortest sequence in the assessment. “Percentage of sequence identity” is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. The term “substantial identity” of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 25% sequence identity to a designated reference sequence. Alternatively, percent identity can be any integer from 25% to 100%, for example, at least: 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a reference sequence using the programs described herein; preferably BLAST using standard parameters, as described below. One of skill will recognize that the percent identity values above can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning and the like. The term “alternate codon” refers to the sequences that comprises different codons that codes for the same mutation; such as, any or all nucleotide sequences that can yield the amino acid sequence 95% similar, more preferably 99% to the SEQ ID NO: 1 provided the amino acid sequence has maintained the mutation. Alternate codons or alternative codons for the mutation of the invention are shown in SEQ ID NOs: 12 to 16. A “wild type plant”, as referred to herein, is a plant which does not comprise a mutation of the invention, or which would be killed or have their viability significantly affected by an HPPD and or AHAS-inhibiting herbicide. In a preferred embodiment, the mutation that leads to tolerance to HPPD inhibitors is a point mutation in the codon of the amino acid at position 445 of the amino acid sequence of SEQ ID NO: 3 from TGG (tryptophan) to TCG (serine). In an embodiment, the mutation is any substitution mutation at position 445 of the amino acid sequence of SEQ ID NO: 3, where tryptophan is replaced with serine. The wildtype codon TGG encoding tryptophan may also be replaced by another codon encoding the amino acid serine selected from TCT, TCC, TCA, AGT, AGC. The mutation as defined herein may be referred to herein as the mutation of the invention or the ADV-HT2 mutation. The mutation may be present in a gene located on chromosome 3. The mutation may be encoded by a nucleic acid sequence present in a region of chromosome 3, which encodes the amino acid sequence of SEQ ID NO: 3 comprising a serine residue at position 445. In an embodiment, a nucleic acid sequence which encodes the amino acid sequence of SEQ ID NO: 3 comprising a serine residue at position 445 may be the sequence of SEQ ID NO: 1 or may comprise a sequence which encodes a sequence substantially identical thereto and having a serine residue at a position corresponding to amino acid position 445 of SEQ ID NO: 3; such a substantially identical sequence may have one of Alternative Codons 1-5, as described in SEQ ID NO: 12 to 16, at the allele coding for the serine residue at position 445. The HPPD inhibiting herbicide-resistant or tolerant plants of the invention thus comprise a serine at position 445 in an amino acid sequence encoded by a nucleic acid sequence on chromosome 3. The nucleic acid sequence may comprise the nucleic acid sequence of SEQ ID NO: 1 or may be substantially identical to the sequence of SEQ ID NO. 1, and / or may have alternate codons that encode a serine residue at amino acid position 445 of SEQ ID NO: 3. In particular, the plants, plant parts, plant tissues, and plant seeds of the invention have an increased resistance to HPPD inhibiting herbicides when compared to a wild-type plant. A herbicide-resistant or tolerant plant of the invention may comprise a mutation on chromosome 3, comprising a G to C substitution at position 51 of SEQ ID NO: 8. The mutated AHAS gene comprises the nucleotide sequence set forth in SEQ ID NO: 17 encoding the polypeptide or AHAS large subunit having the sequence set forth in SEQ ID NO: 18. The amino acid sequence of SEQ ID NO: 18 corresponding to the large subunit of AHAS differs in one amino acid from the wild-type amino acid sequence of the large subunit of sorghum AHAS (SEQ ID NO: 19), said difference comprising an alanine to tyrosine substitution at position 93 of the large subunit of sorghum AHAS, or equivalent positions in other crops. The plants of the invention are tolerant or resistant to HPPD inhibitor herbicides selected from benzoylpyrazole herbicides, benzoylcyclohexanedione herbicides, aroylcyclohexanedione herbicides, oxazole herbicides, cyclopropylisoxazole herbicides, pyrazolone, carbobicyclic compounds, cyclic ketone compounds, benzoylpyrazole herbicides, pyrazole herbicides, triketone herbicides, aroylcyclohexanedione herbicides, and in particular from tolpyralate. fenquinotrione, mesotrione, tefuryltrione, isoxaflutole, pyrasulfotole, benzobicyclon, benzofenap, pyrazolynate, pyrazoxyfen, bicyclopyrone, sulcotrione, tembotrione, topramezone or combination thereof. The mutation resulting in plants that show improved resistance to herbicides targeting the AHAS enzyme, such as imidazolinones and sulfonylureas, as compared to wild-type plants may be the result of at least one polynucleotide in the genome of the plant that encodes a large subunit of AHAS having alanine to tyrosine substitution at position 93 of the large subunit of sorghum AHAS or an equivalent position in other crops. The sorghum plant may comprise in its genome, one, two, three or more copies of a polynucleotide encoding a mutated large subunit of sorghum AHAS or a sorghum AHAS polypeptide of the invention. In this context, the sorghum plant may be tolerant to any herbicide capable of inhibiting AHAS enzyme activity, i.e., the sorghum plant may be tolerant to herbicides of the imidazolinone type, such as, without limitation, imazethapyr, imazapir, and imazapic or to herbicides of the group of sulfonylureas, such as, without limitation, chlorosulfuron, metsulfuron methyl, sulfometuron methyl, chlorimuron ethyl, thiofensulfuron methyl, tribenuron methyl, bensulfuron methyl, nicosulfuron, ethametsulfuron methyl, rimsulfuron, triflusulfuron methyl, triasulfuron, primisulfuron methyl, cinosulfuron, amidosulfuron, fluzasulfuron, imazosulfuron, pyrazosulfuron ethyl, and halosulfuron. In a preferred embodiment, the HPPD inhibiting herbicide-resistant sorghum plant comprises the herbicide resistance trait as found in seeds deposited under accession number 43919, deposited under the Budapest Treaty on 10 December 2021 with NCIMB. The deposited seeds comprise the mutation that leads to the HPPD inhibiting herbicide-resistance and are therefore a source for the tolerance to the HPPD inhibiting herbicides in plants of the invention which show dual resistance. The HPPD inhibiting herbicide-tolerant sorghum plant germplasm of deposit NCIMB 43919 is thus useful for introducing the tolerance trait by introgression into other sorghum varieties that already have the mutation leading to tolerance to HPPD inhibiting herbicides. In a preferred embodiment, the mutant AHAS gene of the sorghum plant of the invention which gene provides resistance to herbicides belonging to the group of imidazolinones or sulfonylureas is as found in the sorghum line designated VT11-11331-BK which seeds were deposited with the NCIMB under Access No. NCIMB 41870, on October 12, 2011, under the terms of the Budapest Treaty. The deposited seeds comprise the mutation in the AHAS large subunit and are therefore a source for the tolerance to the AHAS inhibiting herbicides in plants of the invention which show dual resistance. The AHAS inhibiting herbicide-tolerant sorghum plant germplasm of deposit NCIMB 41870 is thus useful for introducing the tolerance trait by introgression into other sorghum varieties that already have the mutation leading to tolerance to HPPD inhibiting herbicides. In an embodiment a modified plant genome is provided wherein the genome comprises a first allele of an acetohydroxyacid synthase large subunit (AHASL) gene and a second allele of an hydroxyphenylpyruvate dioxygenases (HPPD) gene, wherein said first allele encodes an AHASL protein comprising an A93Y amino acid substitution and said second allele encodes an HPPD protein comprising a W445S amino acid substitution. Seeds of sorghum plants having both mutations are deposited with the NCIMB (Wellheads Place, Dyce, Aberdeen, AB217GB Scotland) under the Budapest Treaty on 3 May 2023 under accession number NCIMB 44143. Preferably, the invention relates to sorghum plants that have the herbicide resistance traits of deposits NCIMB 43919 and NCIMB 41870, and in particular the dual resistance as found in seeds and plants of deposit NCIMB 44143. “Tolerance” and “resistance” are used interchangeably in this application. Both terms mean that the plants showing such herbicide tolerance or resistance are capable of essentially the same or a higher biomass accumulation as plants not having the two mutations upon treatment with the two herbicides. More specifically, the terms "herbicide-tolerant" and "herbicide- resistant" are used interchangeably and are intended to have an equivalent meaning and an equivalent scope. Similarly, the terms "herbicide-tolerance" and "herbicide-resistance" are used interchangeably and are intended to have an equivalent meaning and an equivalent scope. Likewise, the terms "HPPD-resistant” or “AHAS-resistant" and "HPPD-resistance or AHAS- resistance" are used interchangeably and are intended to be of an equivalent meaning and an equivalent scope as the terms "HPPD-tolerant” or “AHAS-tolerant" and “HPPD-tolerance" or “HPPD-tolerance”, respectively. By “resistance” or “resistant” or “tolerance” or “tolerant” is meant that a plant is able to survive the effects of the herbicide, and show enhanced growth and survival compared to a control variety known to be susceptible to an HPPD inhibiting and / or AHAS inhibiting herbicide. By “susceptible” is meant that the herbicide in an effective amount has one or more of the following effects: chlorosis, necrosis, and growth retardation, death of the plant. Depending on the susceptibility of a plant, a plant may be scored as 1 to 9, wherein 1 = severe chlorosis and necrosis; 3 = severe necrosis and growth retardation; 5 = necrosis and growth retardation; 7 = mild necrosis; 9 = no damage lines. In one embodiment, the biomass accumulation of the plant with the two mutations is higher than a plant without the mutations when not sprayed with the herbicides. In a further embodiment, the biomass accumulation of the plant when sprayed with the herbicide is even higher than a plant carrying the two mutations that is not sprayed. This means that one or both mutations have an additional effect beyond conferring resistance or tolerance to the herbicide. The invention further relates to plants of other crops that have a combination of the described herbicide resistances as a result of mutations corresponding to the mutations leading to the dual resistance as found in NCIMB 44143. The present invention further includes progeny and seeds of plants comprising the two mutations of the invention in their DNA. The present invention also provides a method of producing a plant of the invention that is resistant or tolerant to two herbicides with different modes of action, in particular HPPD inhibiting herbicides and AHAS inhibiting herbicides. A method of producing a plant of the invention that is resistant or tolerant to the two herbicides with different modes of action may comprise introducing the two mutations of the invention into a plant. The present invention provides a method of producing a plant that comprises resistance or tolerance to a HPPD inhibiting herbicide and an AHAS-inhibiting herbicide, wherein the method comprises the cross-pollination of a first plant comprising the mutation leading to the Trp>Ser substitution at amino acid position 445 of SEQ ID NO: 3 with a second plant comprising the mutation leading to the Ala>Tyr substitution at position 93 of SEQ ID NO: 18 so as to produce hybrid seeds. In an alternative embodiment, the first mutation is first introgressed into the desired background and subsequently the other mutation is introgressed. The invention further relates to a method of producing a hybrid plant having the dual resistance of the invention. Suitably, both the first and second parent plants in this method comprise in their genome at least one copy of a mutation of SEQ ID NO: 1 or any Alternate Codons which encodes a serine residue at amino acid position 445 of SEQ ID NO: 3 and a mutation leading to the Ala93Tyr substitution in the AHAS large subunit. Preferably, both the first and second parent plants are homozygous for the two mutations such that the hybrid comprises both mutations homozygously. The seeds thus obtained can be sown and allowed to grow into a hybrid plant, particularly an F1 hybrid plant. The present invention further provides a method of detecting the alleles or genes comprising the mutations of the invention in a plant. Such a diagnostic detection method may for example involve polymerase chain reaction (PCR) amplification of specific regions of the plant located on chromosome 3 using primers designed to anneal to specific sites within the gene of interest, for example at sites that are at the vicinity of the mutation and PCR amplification of the gene encoding the AHAS large subunit. The regions which may be detected include a mutant allele of the ADV-HT2 allele as described herein, and / or a mutation on chromosome 3, comprising a G to C substitution at position 51 of SEQ ID NO: 8 and the mutation leading to the Ala93Tyr substitution in the AHAS large subunit. Primers and kits for the detection of such mutation are also provided. The invention also relates to a genetic marker that is indicative of a phenotype associated with HPPD-inhibiting herbicide tolerance or resistance and a genetic marker that is indicative of a phenotype associated with AHAS-inhibiting herbicide tolerance or resistance. The genetic markers may be the mutations of the invention, or markers which are in linkage disequilibrium with the mutations of the invention. A mutation which is in linkage disequilibrium with an ADV-HT2 mutation of the invention is the presence of the “C” at position 51 of SEQ ID NO: 8, which is indicative of HPPD-type herbicide resistance. The present invention also provides a method of controlling weeds that grow in the vicinity of a plant. Such a plant may comprise the two mutations of the invention and show resistance or tolerance to an HPPD-inhibiting herbicide and an AHAS-inhibiting herbicide. A weed to be controlled in this way may include, but is not limited to, grasses, such as Echinochloa colona, Echicochloa crus-galli, Digitaria sanguinalis, Eleusine indica; broad leaf weeds, such as Anoda cristata, Ipomoea purpurea, Amaranthus quitensis, Amaranthus hybridus, Portulaca oleracea, Raphanus sativus, Brassica campestris, Chenopodium album, Tagetes minuta, Datura ferox and parasitic weeds. A method of controlling the weeds that grows in the vicinity of a plant may comprise the application of an effective amount of an a HPPD-inhibiting herbicide and an AHAS-inhibiting herbicide to the weeds and to the plant, which suitably may be a plant that is both tolerant or resistant to a HPPD-inhibiting herbicide and an AHAS-inhibiting herbicide, which plant comprises the two mutations of the invention. The present invention further provides a method of selection of a tolerant or resistant plant comprising the two mutations of the invention. Such a method may comprise applying an effective amount of HPPD-inhibiting herbicide and AHAS-inhibiting herbicide on one or more plants, and selecting the plant that survives the application of such herbicides. The invention also involves one or more QTLs which map to a novel chromosomal region and to genetic markers that are indicative of phenotypes associated with HPPD-inhibiting herbicide tolerance and AHAS-inhibiting herbicide tolerance. A genetic marker may comprise the mutations of the invention, or a marker which is linked to the mutations of the invention. A marker which is linked to a marker of the invention may comprise a mutation on chromosome 3, comprising a G to C substitution at position 51 of SEQ ID NO: 8. Another aspect of the invention is to provide one or more molecular markers that can be used to identify and detect the mutation in chromosome 3 of a sorghum plant that shows HPPD-inhibiting herbicide resistance or tolerance and the AHAS-inhibiting herbicide resistance or tolerance. A suitable marker may be a mutation on chromosome 3, comprising a G to C substitution at position 51 of SEQ ID NO: 8, which is in linkage disequilibrium with the ADV-HT2 allele of the invention. A suitable marker to detect mutation on chromosome 3, may comprise the alternate codons which is in linkage disequilibrium with the ADV-HT2 allele of the invention. Another aspect of the invention is to provide a method and kits to detect the two mutations of the invention or alleles in linkage disequilibrium therewith. A method may detect a mutation in SEQ ID NO: 1 or a sequence substantially identical thereto, wherein the mutation leads to a codon that encodes a serine residue at position 445 of SEQ ID NO: 3. The mutation may be an Alternate Codons which encodes a serine residue at position 445 of SEQ ID NO: 3. The mutation may be a mutation of the invention as defined above. A method or kit may detect a mutation on chromosome 3, comprising a G to C substitution at position 51 of SEQ ID NO: 8. In addition, the method or kit detects the mutation leading to the Ala93Tyr substitution in the AHAS large subunit of sorghum. The method and kit may also detect the two mutations in corresponding positions in other crops. Another aspect of the invention is a method of breeding a novel mutant plant to provide a hybrid germplasm that confers resistance or tolerance to inhibition by one or more HPPD- inhibiting herbicides and to inhibition by one or more AHAS-inhibiting herbicides at levels of said one or more HPPD-inhibiting herbicide and AHAS-inhibiting herbicide that would normally inhibit the growth of a hybrid. Another aspect of the invention is a method of using an HPPD-inhibiting herbicide in combination with an AHAS-inhibiting herbicide to kill or reduce the viability of an unwanted plant in a field planted with a plant of the invention. The plant of the invention may be transgenic or non-transgenic and belong to any plant species suitable for agronomical use, or for other uses, such as ornamentals. The plant is in particular a sorghum plant. Further provided is a sorghum seed, comprising in its genome at least two polynucleotides, wherein one polynucleotide encodes a polypeptide having a tryptophan to serine substitution at position 445 of SEQ ID NO: 3 and wherein one polynucleotide encodes a polypeptide having an alanine to tyrosine substitution at position 93 of the sorghum AHAS protein large subunit. The seed upon germination produces a plant having increased resistance to one or more herbicides of HPPD-inhibiting herbicides and AHAS-inhibiting herbicides as compared to wild-type sorghum plants. In a preferred embodiment said seed is the seed deposited as NCIMB 44143. Further provided is a method for identifying a plant resistant to HPPD-inhibiting and AHAS- inhibiting herbicides from the group, comprising: a) supplying a nucleic acid sample from a sorghum plant; b) amplifying a region corresponding to an SEQ ID NO: 1 and a region corresponding to SEQ ID NO: 17 from a sorghum plant present in said nucleic acid sample; c) identifying a sorghum plant resistant to herbicides of the HPPD-inhibiting herbicides and AHAS-inhibiting herbicides, in particular of the imidazolinone group, based on the presence of at least one mutation in said amplified nucleic acid sample that confers resistance to HPPD- inhibiting herbicides and at least one mutation that confers resistance to imidazolinone herbicides. Further provided is a method for identifying a modified plant genome comprising resistance to HPPD-inhibiting and AHAS-inhibiting herbicides, which genome comprises a first allele of an acetohydroxyacid synthase large subunit (AHASL) gene and a second allele of an hydroxyphenylpyruvate dioxygenases (HPPD) gene, wherein said first allele encodes an AHASL protein comprising an A93Y amino acid substitution and said second allele encodes an HPPD protein comprising a W445S amino acid substitution by: a) supplying a nucleic acid sample from a sorghum plant; b) amplifying a region corresponding to SEQ ID NO: 1 and a region corresponding to SEQ ID NO: 17 from a sorghum plant present in said nucleic acid sample; c) identifying a sorghum plant resistant to herbicides of the HPPD-inhibiting herbicides and AHAS-inhibiting herbicides, in particular of the imidazolinone group, based on the presence of at least one mutation in said amplified nucleic acid sample that confers resistance to HPPD-inhibiting herbicides and at least one mutation that confers resistance to imidazolinone herbicides. In a preferred embodiment, plants comprising at least one mutation in SEQ ID NO: 1 such as the mutation in NCIMB 43919 and at least one mutation in AHAS (SEQ ID NO: 17) such as the mutation in NCIMB 41870 are selected, where said at least one mutation in SEQ ID NO: 1 encodes a polypeptide comprising a Trp445Ser substitution in SEQ ID NO: 3 as compared to SEQ ID NO: 2 and at least one mutation in the AHAS gene encodes a polypeptide or large subunit of AHAS (SEQ ID NO: 18) comprising a Ala93Tyr substitution as compared to the wild-type sorghum AHAS amino acid sequence (SEQ ID NO: 19). The plant may be a monocot or a dicot. Preferably the plant is a plant of agronomic interest, such as sorghum, rice, corn, soybean, wheat, oat, barley, rye, flax, cotton, sugarcane, sunflower, or the like. The plant is preferably a sorghum plant. The method of identification may employ a specific point mutation SNP marker. The present invention also provides an expression cassette, comprising at least one polynucleotide comprising the mutation leading to tolerance or resistance to HPPD-inhibiting herbicides and at least one polynucleotide comprising the mutation leading to tolerance or resistance to AHAS-inhibiting herbicides. The at least one polynucleotide comprising the mutation leading to tolerance or resistance to HPPD-inhibiting herbicides may be the ADV- HT2 allele which is found in a region of chromosome 3. A nucleic acid sequence encoding the mutant allele is provided herein as SEQ ID NO: 1 and SEQ ID NO: 12 to 16. These sequences encode a protein comprising a tryptophan to serine substitution at position 445 of SEQ ID NO: 3. A non-mutated sequence (also referred to as a wild type sequence) which encodes a protein having a tryptophan amino acid at a position corresponding to position 445 is encoded by SEQ ID NO: 2 or 10. Preferably, the mutation in the mutant ADV-HT2 allele is located at position 5283 of SEQ ID NO: 1 and may encode a polypeptide of SEQ ID NO: 2 in the wild type form or a sequence of polypeptide SEQ ID NO: 3 in the mutated form. The ADV-HT2 allele of the invention may comprise any one of the alternate codons as defined herein, each of which encode a serine residue. The alternate codons which encode a serine residue at position 445 of a protein of SEQ ID NO: 3 are shown in SEQ ID NO: 12 to 16. The at least one polynucleotide comprising the mutation leading to tolerance or resistance to AHAS-inhibiting herbicides having the following nucleotide sequence: SEQ ID NO: 17, a nucleotide sequence encoding the polypeptide set forth in SEQ ID NO: 18, a nucleotide sequence encoding a polypeptide having at least 95% sequence identity to amino acid sequence SEQ ID NO: 18, wherein the polypeptide exhibits herbicide-resistant AHAS activity; a nucleotide sequence having at least 85% identity to the nucleotide sequence set forth in SEQ ID NO: 17, wherein the nucleotide sequence encodes a polypeptide comprising a large subunit of AHAS and exhibits herbicide-resistant AHAS activity, or complementary sequences thereof. Preferably, the polynucleotide encodes a polypeptide of the large unit of AHAS comprising an Ala93Tyr substitution; said sequences being operably linked to a nucleotide sequence for conducting expression, for example one or more promoters, enhancers or other known regulatory sequences. The promoter may be a promoter for expression in plants, plant tissues, chloroplasts, animal, bacterial, fungal or yeast cells. The present invention provides a transformation vector comprising at least two polynucleotides, the first polynucleotide having one of the following nucleotide sequences: a1) the nucleotide sequence of SEQ ID NO: 1, b1) a sequence which encodes a sequence substantially identical to SEQ ID NO: 1 and having a codon that encodes a serine residue at a position corresponding to amino acid position 445 of SEQ ID NO: 3, c1) a nucleotide sequence encoding the polypeptide set forth in SEQ ID NO: 3, d1) a nucleotide sequence encoding a polypeptide having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 3, where the polypeptide exhibits resistance or tolerance to an HPPD-inhibiting herbicide, e1) the nucleotide sequence according to a) to d) but having one of Alternative Codons 1-5 at the allele coding for the serine residue at position 445, f1) a nucleotide sequence having at least 85% identity to the nucleotide sequence set forth in SEQ ID NO: 1, g1) a nucleotide sequence fully complementary to one of nucleotide sequences a1) to f1); and the second polynucleotide having one of the following nucleotide sequences: a2) the nucleotide sequence set forth in SEQ ID NO: 17, b2) a nucleotide sequence encoding the polypeptide set forth in SEQ ID NO: 18, c2) a nucleotide sequence encoding a polypeptide having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 18, where the polypeptide exhibits herbicide-resistant AHAS activity, d2) a nucleotide sequence having at least 85% identity to the nucleotide sequence set forth in SEQ ID NO: 17, where the nucleotide sequence encodes a polypeptide comprising a large subunit of AHAS and exhibits herbicide-resistant AHAS activity, e2) a nucleotide sequence fully complementary to one of nucleotide sequences a2) to d2), further comprising operably linked sequences driving the expression of the nucleotide sequence and selectable markers. The vector may be used for transforming bacteria, fungi, yeasts, plant cells or animal cells, being adapted for each particular case. The present invention provides a transformed plant comprising, integrated in its genome, at least one promoter operably linked to one of the polynucleotides described above and at least one promoter operably linked to the other polynucleotide described above. The promoter is a promoter driving polypeptide expression in plants, for example in plant tissues or chloroplasts. The transformed plants may be monocots, for example sorghum, corn, rice, or wheat; or dicots, for example sunflower, Arabidopsis, tobacco, or oilseed rape, and are in particular sorghum plants. The transformed plant is resistant to HPPD-inhibiting herbicides and AHAS-inhibiting herbicides as compared to the same wild-type plant when equal amounts of said herbicides are applied to both. The invention also provides a method for obtaining a herbicide-resistant plant or a plant having increased resistance to a herbicide, said method comprising the steps of i) transforming a plant cell with an expression cassette comprising the two polynucleotides; ii) regenerating the plant cell to obtain a herbicide-resistant plant, said polynucleotides having at least one of the nucleotide sequences described above. The present invention is in particular directed towards a plant that shows enhanced resistance or tolerance to both an HPPD-inhibiting herbicide, such as one or more of tembotrione, mesotrione, byciclopirona, tolpyralate, isoxaflutole and topremazone, and an AHAS-inhibiting herbicide, in particular imidazolinones and sulfonylureas, to improve weeds control in the crop field compared to a wild-type plant. The present invention is also directed towards the novel and distinctive allele and mutation designated as ADV-HT2, that confers non-transgenic resistance to the said HPPD-inhibiting herbicides in a plant and encodes a polypeptide having or comprising SEQ ID NO: 3, in combination with an allele encoding the Ala>Tyr mutation in the AHAS protein. HPPD-inhibiting herbicide-tolerant plants were obtained by treating seeds of endogamic sorghum (Sorghum bicolor) line BV94-4045 (Advanta proprietary elite line) with an aqueous solution of ethyl methanesulfonate (EMS). Treated seeds were planted and self-pollinated for advancing generation. 895 M1 plants were selected and two seeds of each plant were planted in a nursery, thereby obtaining a total of 1790 M2 plants. Pollen from both plants of each pair were collected, and the bulk was used for pollinating both plants of the pair. A bulk of M3 seeds from each pair was obtained from the 895 pollinated M2 pairs of plants. A total of 895 furrows were planted with the M3 progeny. Fifty plants from each M3 furrow were sprayed with 33.6 ml active ingredient / ha of topramezone. Six plants from the furrow number VT09-8800 showed normal growth and absence of symptoms after the treatment with herbicide and were considered as resistant to the herbicide and identified as BVT09-8800-1, BVT09-8800-2, BVT09-8800-3, BVT09-8800-4, BVT09- 8800-5, and BVT09-8800-6. The genealogy of the resistant plants from the furrows was identified and they were designated BV94-4045EMS1-256-2 (hereinafter referred to as ADV- HT2). Herbicide tolerant M7 mutant plants and seeds selected from the original ADV-HT2 mutant, designated as: Material ID = VT10-11924-1-BK and Inbred Code = BV10-11924, were obtained and deposited with the NCIMB collection with Access No. NCIMB 43919 under the terms of the Budapest Treaty. The present invention is not limited to herbicide resistant sorghum plants mutated with EMS. Within the scope of the present invention are plants, for example sorghum plants, obtained by other mutation methods, for example methods such as CRISPR / Cas, radiation and chemical mutagens, or by breeding or transgenic methods as described herein. Herbicide-resistant mutant plants can also be obtained by means of a process of selective pressure on cells cultured with a herbicide and selection of resistant cells to generate a herbicide-resistant plant. Details of mutation and breeding methods can be found in "Principles of Cultivar Development" Fehr, 1993, Macmillan Publishing Company, the disclosure of which is included herein by reference. The present invention includes within its scope any plant (including plant part, tissue, or seed) comprising the ADV-HT2 mutation as described herein, wherein the mutation confers HPPD tolerance or resistance on the plant and the AHAS mutation as described herein conferring resistance to imidazolinones and / or sulfonylureas. A plant of the present invention is preferably a cultivated plant having improved agronomic characteristics that make it suitable for commercial cultivation. Suitably, a plant, plant part, tissue, or seed as described herein may be a sorghum plant, plant part, tissue, or seed. A plant of the invention may comprise a wild type HPPD gene. The HPPD gene is located on chromosome 2 or chromosome 4 of the Sorghum plant. A plant of the invention may comprise a nucleic acid having at least 85% - 99% identity with SEQ ID NO: 1. Suitably, the nucleic acid sequence encodes a protein of SEQ ID NO: 3 or substantially identical thereto and having a serine residue at a position corresponding to position 445 of SEQ ID NO: 3. Suitably, the nucleic acid comprises a mutation as defined herein, encoding a serine residue at the position corresponding to position 445 of SEQ ID NO: 3. A plant of the invention may encode a protein sequence having at least 85% - 99% identity with SEQ ID NO: 3 and comprising a Serine residue at position 445 of SEQ ID NO: 3. More preferably the nucleic acid present in the plant possesses at least 95% identity to SEQ ID NO: 1, SEQ ID NO: 9 or SEQ ID NO: 11 to 16 and codes for a protein having at least 95% identity with SEQ ID NO: 3, and comprising a Serine residue at the position 445 of SEQ ID NO: 3. A plant of the invention may comprise any one of the following codons in the nucleic acid sequence on chromosome 3, which encodes a protein of SEQ ID NO: 3 or a protein substantially identical thereto: TCG, TCT, TCC, TCA, AGC, or AGT. These alternate codons each encode a serine residue. A plant of the invention comprises a tryptophan to serine substitution at position 445 of the protein sequence of SEQ ID NO: 3. A plant of the invention may comprise a nucleic acid sequence encoding said protein. In addition to the above described nucleotide sequence, the plant has a nucleotide sequence encoding a modified AHAS large subunit polypeptide. A plant of the invention may be used in a method of plant breeding. The two mutations of the invention may be introduced from another plant which comprises one or both of the mutation of the invention, through commonly used breeding techniques, such as crossing and selection, when the plants are sexually compatible. Alternatively, the mutations of the invention may be introduced into a plant using a transgenic approach. Suitable techniques include for example an Agrobacterium-mediated transformation method, or a genome editing method such as homologous recombination or the use of a CRISPR / Cas system. Such an introduction can be from a plant of the same species, that usually can be crossed easily, or from a plant of a related species. Difficulties in crossing can be overcome through techniques known in the art such as embryo rescue, or cis-genesis can be applied. Suitably markers are used to follow the incorporation of the allele or QTL, into another plant. In one of the embodiments, the method of producing the plant that comprises resistance or tolerance to HPPD-inhibiting herbicide and to an imidazoline herbicide comprises cross- pollination of a first plant with a second plant so as to produce hybrid seeds. The first and second plants may be sorghum plants. The first and second plants may be the same species or may be different species. The method may comprise growing a plant resulting from the cross, allowing the plant to grow fruit, and harvesting seeds from the fruit. The seeds produced can be sown and allowed to grow into a hybrid plant, particularly an F1 hybrid plant. A method of producing a plant that comprises resistance or tolerance to HPPD-inhibiting herbicides and AHAS-inhibiting herbicides as described herein may comprise one or more rounds of selfing, and / or crossing a plant from the F1 to generate a further generation. A method of producing a plant that comprises resistance or tolerance to HPPD-inhibiting herbicides and AHAS- inhibiting herbicides as described herein may further comprise crossing an F1 hybrid plant with a plant having another desired characteristic; and selecting desired backcross progeny. Other desirable characteristics can be selected from, but is not limited to, the following group: resistance to bacterial, fungal, or viral diseases, insect or pest resistance, improved germination, plant size, plant type, water stress and heat stress tolerance, and male sterility. In an embodiment, both hybrid’s parent plants comprise in their genome at least one copy of an allele of the novel mutation, as defined herein. Preferably, both hybrid’s parent sorghum plants are homozygous for a mutation of the ADV-HT2 allele and for the modified AHAS allele as defined herein, which ADV-HT2 encodes a serine residue at a position corresponding to position 445 of SEQ ID NO: 3. Both parent plants may comprise a mutation in the nucleic acid sequence on chromosome 3 as defined herein. In an embodiment, the nucleic acid sequence may comprise a C residue at position 5283 of SEQ ID NO: 1 or has alternate codons that code for a serine residue at position 445 of SEQ ID NO: 3. Alternate codons 1 to 5 are shown in SEQ ID NO: 12 to 16. In an embodiment, the first sorghum plant comprises in its genome at least one copy of an allele of each novel mutation as defined herein. The first sorghum plant may comprise a sequence encoding a protein of SEQ ID NO: 3 or a protein substantially identical thereto having a serine residue at a position corresponding to position 445 of SEQ ID NO: 3 and a sequence encoding a AHAS protein of SEQ ID NO: 18 or a protein substantially identical thereto having a tyrosine residue at a position corresponding to position 93 of SEQ ID NO: 18. The allele encoding the protein of SEQ ID NO: 3 may be one of the alternate codons defined herein. In one preferred embodiment of the invention, a hybrid plant of the invention is produced by crossing two plants heterozygous or homozygous for the alleles of the novel mutations as defined herein. The hybrid plant may comprise a nucleic acid sequence encoding a protein of SEQ ID NO: 3 or a protein substantially identical thereto having a serine residue at a position corresponding to position 445 of SEQ ID NO: 3 and a sequence encoding a AHAS protein of SEQ ID NO: 18 or a protein substantially identical thereto having a tyrosine residue at a position corresponding to position 93 of SEQ ID NO: 18. The allele of the nucleic acid sequence may be one of the alternate codons defined herein. All of the resulting hybrid seeds and hybrid plants grown from such seed are expected to comprise in their genomes the ADV- HT2 mutation and the AHAS mutation as defined above. In one preferred embodiment of the invention, a hybrid plant of the invention is produced by crossing two plants homozygous for mutation of the ADV-HT2 allele and AHAS allele as defined above. In one preferred embodiment of the invention, a hybrid plant of the invention is produced by crossing two plants heterozygous for a mutation of the ADV-HT2 allele and AHAS allele as defined above. In one preferred embodiment of the invention, a plant produced is heterozygous for a mutation of the ADV-HT2 allele and AHAS allele, as defined above. The mutations were found to have an intermediate effect, which means that when a modified allele is present in heterozygous form herbicide resistance is found. In one preferred embodiment of the invention, a plant produced is homozygous for a mutation of the ADV-HT2 allele and AHAS allele as defined above. In a further embodiment one allele may be homozygous and the other heterozygous. For the purposes of the present invention unless otherwise expressly indicated or apparent from the context, a "progeny plant" is any plant that is descended from at least one plant of the invention and includes, but is not limited to, first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth or any generation descendants of the plant of the invention. Preferably, such progeny or descendants comprise increased resistance to at least one HPPD-inhibiting herbicide when compared to a wild-type plant and such progeny or descendants further comprise an ADV-HT2 mutation as defined herein, and preferably as present in accession number NCIMB 43919. The method of producing a hybrid or inbred plant comprising the novel ADV-HT2 mutation and the mutation in the AHAS protein as defined herein may further involve growing a seed resulting from such crossing and selecting for at least one progeny plant with tolerance or resistance to HPPD-inhibiting herbicide and an AHAS-inhibiting herbicide. This selection may be made by applying the two herbicides to a population and selecting any tolerant or resistant plants. Such progeny can be also selected using genetic methods, such as PCR amplification, to determine the presence of ADV-HT2 mutation and AHAS mutation as defined herein. The present invention provides plants, or plant part, tissue or seed with increased resistance or tolerance to at least two herbicides, particularly an HPPD-inhibiting herbicide and an AHAS- inhibiting herbicide. The preferred amount or concentration of the herbicide is an "effective amount" or "effective concentration." By "effective amount" and "effective concentration" is intended an amount and concentration, respectively, that is sufficient to kill or inhibit the growth of a similar plant, plant tissue, plant cell, or host cell, but that said amount does not kill or inhibit as severely the growth of the herbicide-resistant plants, plant tissues, plant cells, and host cells of the present invention. Typically, the effective amount or effective concentration of a herbicide is an amount or concentration that is routinely used in agricultural production systems to kill weeds of interest. Such an amount is known to, or can easily be determined by, those of ordinary skill in the art. The sorghum of the present invention comprises commercially acceptable levels of resistance or tolerance to HPPD-inhibiting and AHAS-inhibiting herbicides. The effective amount or concentration that is routinely in the fields or otherwise to kill a weed or weeds of interest. The herbicide resistant or tolerant plants of the present invention thus find use in the methods for controlling weeds. For management of weeds in the vicinity of herbicide tolerant or resistant sorghum plant of present invention a wide variety of formulations can be employed for protecting plants from weeds to enhance plant growth and reduce competition of nutrients. A herbicide can be used for pre-emergence or post-emergence or pre-planting or at time of planting to control the weeds. The herbicide can be present with different additives. The herbicide may also be used as the seed-treatment. Additives present in the herbicide formulation may include but are not limited to other herbicides, detergents, adjuvants, spreading agents, sticking agents, stabilizing agents, or the like. The formulation can be a wet formulation or a dry formulation or any other suitable form like suspension concentrate, emulsion concentrate, encapsulated, non-encapsulated and others. The herbicide may be applied at the recommended concentration, or at a concentration of 0.5X- 5X, preferably in the range of 0.5X-4X, more preferably in the range of 1X-4X of the recommended dose. The herbicide formulations can be applied in accordance with the conventional methods, for example by spraying, dusting, irrigation and like. The present invention provides non-transgenic and transgenic seeds with increased tolerance to any HPPD-inhibiting herbicide and AHAS-inhibiting herbicide as compared to the wild type seeds. Suitably, a seed of the invention is a sorghum seed. Suitably, a seed of the invention has the ability to grow into a plant. A plant grown from a seed of the invention has tolerance or resistance to both an HPPD-inhibiting herbicide and an AHAS-inhibiting herbicide. The present invention provides amethod to identify the presence or absence of the novel mutation present on Chromosome 3 of sorghum plant that imparts HPPD-inhibiting herbicide tolerance or resistance to the plant and the presence or absence of the AHAS mutation. Any suitable method may be used. Suitable diagnostic methods are discussed below that can be used to detect the novel mutation in a commercial or experimental plant or its parts. Also, such methods can be used to confirm any sequence comprising one or both of the given mutations defined herein. A suitable method may comprise detection of an allele which is in linkage with a mutation of the invention, for example detection of a mutation on chromosome 3, comprising a G to C substitution at position 51 of SEQ ID NO: 8 for the ADV-HT2 mutation. A suitable method for determining the presence or absence of a mutation present on Chromosome 3 of a plant that imparts HPPD-inhibiting and a mutation that confers AHAS-inhibiting herbicide tolerance or resistance to the plant, or a mutation in linkage with a mutation of the invention as defined herein, may comprise PCR. A "primer" is a single-stranded oligonucleotide, having a 5' end and a 3' end, that is capable of annealing to an annealing site on a target DNA strand, and the primer serves as an initiation point for DNA synthesis by a DNA polymerase, particularly in a polymerase chain reaction (PCR) amplification. Such a primer may or may not be fully complementary to its annealing site on the target DNA. An "annealing" site on a strand of a target DNA is the site to which a primer is capable of annealing in the methods of the present invention. Generally, for the amplification of a fragment of a gene by PCR, a pair of primers that anneal to opposite strands of a double-stranded DNA molecule are employed. By standard convention and used herein unless otherwise indicated or apparent from the context, the "forward primer" anneals to the non-coding strand of the gene and the "reverse primer" primer anneals to the coding strand. The invention involves the use of a number of PCR amplifications. The primers for detecting the ADV-HT2 mutation are disclosed in Table 1. TABLE 1. Molecular Primers used to detect the mutation of the present invention. SEQ ID NO: SEQUENCE DESCRIPTION 5 GAAGGTGACCAAGTTCATGCTGGAGGGCGCCA Primer 1 TCTACCTCTC 6 GAAGGTCGGAGTCAACGGATTGAGGGCGCCAT Primer 2 CTACCTCTG 7 GTTGGAGCAGTTGTCCGGCAGT Reverse Primer 8 CCCGCTCGGTGAGGACAATGTGAAGGGCGGGG Amplicon AGGGCGCCATCTACCTCT[C / G]GGCCAAACTGC (probe) CGGACAACTGCTCCAACGATTTTGAAGTTGTC AGGTGGC In a preferred embodiment, the forward primer and reverse primer can comprise of any nucleotides length that ranges between the nucleotide number of SEQ ID NO: 1. In a preferred embodiment, the forward and reverse primers can span in the region of SEQ ID NO: 9. Preferably to detect the mutation, at least one of a pair of primers or probes contains the mutated nucleotide of the invention. In another preferred embodiment, one of a pair of primers or probes for determining the presence or absence of the mutation may span the region of sequence of SEQ ID NO: 8, where the presence of the “C” at position 51 of SEQ ID NO: 8 the allele is indicative of HPPD-type herbicide resistance. In another preferred embodiment, one of a pair of primers or probes for determining the presence or absence of the ADV-HT2 mutation may comprise the sequences that detect one of the Alternate Codons as defined herein. Primers suitable for use in the present invention may not be 100% complementary to a sequence provided herein including SEQ ID NO: 1, 8 or 9, but will have the ability to bind thereto in a manner which distinguishes between the wild type and mutant forms of the ADV-HT2 allele. The ADV-HT2 allele of the invention is located at position 1001 of SEQ ID NO: 9. A suitable primer or probe may therefore bind under stringent conditions, which will be known to a person skilled in the art. The results of PCR can be detected using KASP genotyping techniques and other standard used techniques including but not limited to gel electrophoresis, fluorescence assays. A method for determining resistance of a plant to HPPD resistance may comprise determining the presence or absence of a QTL associated with HPPD resistance. Such a QTL may be a sequence comprising or consisting of a sequence provided herein, for example SEQ ID NO: 1, 8 or 9, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. Such a QTL may comprise a mutant allele of the invention. The method may subsequently comprise determining the presence or absence of a mutation of the invention within said QTL. A similar method can be used to determine resistance to AHAS- inhibiting herbicides. A method for determining resistance of a plant to HPPD resistance may comprise determining the presence or absence of a molecular marker associated with HPPD resistance. A molecular marker may be a genetic marker. A molecular marker may be a mutation as described herein. A method for determining resistance may be performed in combination with one or more diagnostic methods as described herein. In addition to PCR amplification, the methods of the invention can involve various techniques of molecular biology including, for example, DNA isolation, particularly genomic DNA isolation, digestion of DNA or PCR products by restriction enzymes and nucleases, DNA ligation, DNA sequencing, agarose gel electrophoresis, polyacrylamide gel electrophoresis, gel electrophoresis in any other suitable matrix for the electrophoretic separation of DNA, the detection of DNA by ethidium-bromide staining, and the like. Such techniques are generally known in the art and are disclosed, for example, in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York). For the identification and detection methods of the present invention, genomic DNA of the plant can be isolated from whole plants or any part, organ, tissue, or cell thereof. For example, genomic DNA can be isolated from seedlings, leaves, stems, roots, inflorescences, seeds, embryos, tillers, coleoptiles, anthers, stigmas, cultured cells, and the like. Furthermore, the invention does not depend on the isolation of genomic DNA from plants or parts, organs, tissues, or cells thereof that are of any particular developmental stage. Furthermore, the invention does not depend on plants that are grown under any particular conditions. The plants can be grown, for example, under field conditions, in a greenhouse, or a growth chamber, in culture, or even hydroponically in a greenhouse or growth chamber. Typically, molecular markers are detected by any established method available, including, without limitation, allele specific hybridization (ASH), real-time PCR assays for detecting single nucleotide polymorphisms (SNP), amplified fragment length polymorphism (AFLP) detection, amplified variable sequence detection, randomly amplified polymorphic DNA (RAPD) detection, restriction fragment length polymorphism (RFLP) detection, self-sustained sequence replication detection, simple sequence repeat (SSR) detection, single-strand conformation polymorphisms (SSCP) detection, isozyme markers detection, or the like. In another embodiment the results of the mutation can also be assessed using protein assays, protein probes or different antigen detection techniques including but not limited to ELISA. The present invention also provides kits for performing the methods for genotyping a plant comprising an ADV-HT2 mutation, or an allele in linkage with a mutation of the invention, and comprising the AHAS mutation. Such kits may comprise two or more sets of forward and reverse primers. One set is for amplifying a region of chromosome 3, for example comprising the ADV-HT2 allele or a region comprising SEQ ID NO: 8. The other set is for amplifying the chromosome region comprising the AHAS mutation. For example, a kit may comprise one or more sets of primers for example as defined herein for amplifying a region of a nucleic acid sequence provided herein, including for example SEQ ID NO: 1, 8 or 9. In preferred embodiment the forward and reverse primers in the kit can be of any length and span in the region of any of the nucleic acid sequences provided herein. Suitably, for detecting the ADV-HT2 mutation the forward and reverse primers may be of any length and span in the region of SEQ ID NO: 9. Preferably, to detect the mutation at least one of the primer or probe designed contains the mutated nucleotide of SEQ ID NO: 1, 9, or 11 to 16. In preferred embodiment the forward primer and reverse primer for ADV-HT2 in the kit can comprise of any nucleotides length that ranges between the nucleotide number of SEQ ID NO: 1. In a preferred embodiment, the forward and reverse primers for ADV-HT2 in the kit can span in the region of SEQ ID NO: 9. Preferably to detect the mutation at least one of the primer or probe designed contains the mutated nucleotide of the invention. In another preferred embodiment the primers or molecular markers for detecting the ADV-HT2 mutation span in the region of sequence with SEQ ID NO. 8, where the “C” allele is indicative of HPPD-type herbicide resistance. In addition to primers and probes, the kits can optionally comprise one or more of the following: a polymerase, deoxyribonucleotide triphosphates, any preferred reagent, a label, and instructions for performing the method. The kits may further comprise a manual comprising instructions to carry out the method to detect the ADV-HT2 mutation and the AHAS mutation in the given sample. The mutations of the present invention may be used in the identification of further markers for HPPD-inhibiting herbicide and AHS-inhibiting herbicide tolerance or resistance, for example markers which are in linkage disequilibrium with the mutations of the invention and which have a phenotype of tolerance or resistance to a HPPD-inhibiting herbicide and a AHAS- inhibiting herbicide. It is to be understood that this invention is not limited to particular embodiments or examples, which can of course vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. The following examples are thus provided for elucidation of the invention only and are not intended to be limiting in any way. EXAMPLES Example 1. Field Testing of Dual Herbicide Tolerance This example determines the spectrum of tolerance to both HPPD-inhibiting and AHAS / ALS- inhibiting (imidazolinone) herbicides mode of action (MOA) using commercial active ingredient (AI) in grain sorghum inbred lines with mutations. Table 2 describes the genotypes of the lines tested. The wild-type line (Line #1) is the control, as this susceptible line has the same genetic background as the original line that was mutated to obtain the tolerant inbred lines. Table 2. Sorghum Lines tested for Herbicide Tolerance. Line# Genotype Code Tolerance 1 WT Susceptible wild type 2 ADV-IMI-R IMI tolerant ADV-HT2 HPPD tolerant 4 ADV-IMI-R / ADV-HT2 IMI + HPPD tolerant All herbicide treatments were applied as defined as detailed in Table 3. For the treatments IMI- 1X+TOP-1X field application were conducted in post emergence crop stage, 15 days after planting. For the treatment IMI-1X / TOP-1X, the application of IMI herbicide was conducted 15 days after planting, and for the HPPD-inhibiting herbicide at 21 days after planting. For the treatment TOP-1X / IMI-1X, the application of HPPD-inhibiting herbicide was conducted 15 days after planting, and for the IMI herbicide at 21 days after planting.
[0002] Table 3. Description of herbicide treatments. Label-recommended rate is considered as 1X. Herbicide # treatment Herbicide Active ingredient Type Rate Used Dose Code 1 CONTROL NA NA NA NA IMI-1X / TOP- IMAZETAPIR + 0.23 L / ha / 0.1 2 POE / POE 1X 1X IMAZAPIC / TOPRAMEZONE L / ha TOP-1X / IMI- TOPRAMEZONE / IMAZETAPIR 0.1 L / ha / 0.23 3 POE / POE 1X 1X + IMAZAPIC L / ha IMI-1X+TOP- IMAZETAPIR + 0.23 L / ha + 0.1 4 POE 1X 1X IMAZAPIC / TOPRAMEZONE L / ha For dry matter evaluations, all plots were harvested 55 days after planting. Ten plants from each plot were maintained for registering days to flowering and plant height at flowering. In FIG.1, the dry matter for each genotype and herbicide treatment is expressed as DM-%control (dry matter of each genotype *herbicide treatment as %control). It follows that the two mutations of the invention in combination lead to a comparable or even higher dry matter as compared to the control. The herbicide tolerance of the dual mutation is higher than the two separate mutations combined. Example 2. Phototoxicity Trials of Dual Herbicide Resistance To determine the range of two single and one stacked herbicide tolerance traits, sorghum inbred lines were treated with HPPD and AHAS / ALS-inhibiting MOA herbicides and their combinations. Four genotypes of grain sorghum (inbred lines) were evaluated under field conditions (Table 4) post-emergency (POE) herbicide treatments of 3 active ingredients of HPPD and 2 AHAS / ALS MoA herbicides and their combinations (Table 5) for crop phytotoxicity trials in one location. Table 4. Sorghum Lines Tested for Herbicide Resistance # Genotype Code Herbicide Tolerance 1 WT Susceptible wild 2 ADV-IMI-R ALS (IMI) tolerant 3 ADV-HT2 HPPD Tolerant 4 IMI+HT2 ALS (IMI) and HPPD Tolerant All genotypes were sown in trays with substrates. Plot size consisted of 25 plants / plot, 2 plots / tray. Herbicide treatments were applied 14 days after sowing for single herbicide treatments, and 14 and 16 days after sowing for two herbicides treatments, using an experimental sprayer. The experiment was designed as split-plot design with 3 replications where “Herbicide treatment” were assigned as main plot and Genotypes as split plot. The herbicides doses were 1X using as reference herbicide label recommendations (Table 5). Along with the herbicides, recommended surfactants were used during the application as recommended by the supplier for each product. Table 5. Herbicide Treatments. Label recommended rate is considered 1X. Herbicide Active Herbicide Herbicide Active Commercial Used # Treatment ingredient label MOA ingredient name doses Code % Dose 1 CONTROL NA NA NA NA NA NA IMAZAPYR- MAYORAL, 10.7 - 400 400 2 2IMI ALS IMAZAPIC ADAMA 31.8 ml / ha ml / ha CLEARSOL 100 3 IMI ALS IMAZAPYR 80.0 100 g / ha DF, BASF g / ha CONVEY, 100 100 4 TOP HPPD TOPRAMEZONE 33.6 BASF ml / ha ml / ha CALLISTO, 150 5 MES HPPD MESOTRIONE 48.0 150 g / ha BAYER g / ha LAUDIS, 500 6 TEM HPPD TEMBOTRIONE 20.0 500 g / ha BAYER g / ha 400 IMAZAPYR- ml / ha 7 2IMI+TOP ALS+HPPD IMAZAPIC + + 100 TOPRAMEZONE ml / ha 400 IMAZAPYR- ml / ha 8 2IMI+MES ALS+HPPD IMAZAPIC + + 150 MESOTRIONE g / ha 400 IMAZAPYR- ml / ha 9 2IMI+TEM ALS+HPPD IMAZAPIC + + 500 TEMBOTRIONE g / ha 100 IMAZAPYR + g / ha 10 IMI+TOP ALS+HPPD TOPRAMEZONE + 100 ml / ha 100 IMAZAPYR + g / ha 11 IMI+MES ALS+HPPD MESOTRIONE + 150 g / ha 100 IMAZAPYR + g / ha 12 IMI+TEM ALS+HPPD TEMBOTRIONE + 500 g / ha Ten days after first herbicide spraying (Days after Spray (DAS)), phytotoxicity (plants response to the herbicides) was recorded as follows: First, Shoot Green Matter (SGM) was measured: 10 DAS, all plants were harvested by cutting them at ground level and weighed. SGM each genotype in the CONTROL treatment was used as reference for each genotype on the others herbicide treatments. Where CONTROL treatment was assigned as 100% SMG using the following function: SGM %Control = (SGM * 100) / SGM Control. Where “SGM %Control” is SGM as percent of each genotype*herbicide treatment (Table 5); “SGM” is green matter mean for each genotype*herbicide treatment combination and “SGM Control” is SGM mean for each genotype in the treatment Control (untreated). Secondly, Shoot Dry Matter (SDM) was measured. After SGM was estimated, all plants in the plot were weighed after drying at 70°C for 48h, to determine the SDM of each plot. All data is referred as a percentage of its respective untreated Control using the following function: SDM %Control = (SDM * 100) / SDM Control. Where “SDM %Control” is SDM as percent of each genotype*herbicide treatment (Table 5); “SDM” is dry matter mean for each genotype*herbicide treatment combination and “SDM Control” is SDM mean for each genotype in the treatment CONTROL (untreated). The herbicide treatment applications were effective in all cases. Variance analysis (ANOVA) showed a significant interaction (p< 0.0001) between the main plot representing each herbicide treatment and the subplot representing each genotype, indicating than an analysis based on a test of difference of means is possible. For each genotype and herbicide treatment, SDM expressed as a percentage of the untreated control (SGM%Control) was calculated. As expected, a significant difference was observed for the genotype WT as response when treated and untreated control were compared, indicating that application was effective, FIG. 2A and 2B. As shown in FIG. 2A, the ADV-IMI-R line was resistant to IMI treatment (2IMI and IMI) and the ADV-HT2 line was resistant to HPPD treatment (TOP, MES, TEM). In addition, the IMI+HT2 line was resistant to both IMI and HPPD single treatments. As shown in FIG. 2B, the ADV-IMI-R line and the ADV-HT2 line were not resistant to the dual MOA treatment while the IMI+HT2 line displayed dual herbicide resistance. Only IMI+HT2 line showed no phytotoxicity response across herbicide treatment, with no significant differences between them; showing to be tolerant to all herbicide treatments, 2IMI, IMI, TOP, MES, TEM, 2IMI+TOP, 2IMI+MES, 2IMI+TEM, IMI+TOP, IMI+MES, and IMI+TEM. These phytotoxicity responses confirm that the stacked herbicide tolerance mutations are effective for conferring tolerance for both ALS and HPPD mode of actions herbicides. Having described the present disclosure and inventions in detail, it will be apparent that modifications, variations, and equivalent embodiments are possible without departing from the spirit and scope of the present disclosure as described herein and in the appended claims. Furthermore, it should be appreciated that all examples in the present disclosure are provided as non-limiting examples.
[0003] Sequence Information: Sequence Number (ID): 1 Length: 5497 Molecule Type: DNA Features Location / Qualifiers: - source, 1..5497 > mol_type, genomic DNA > organism, Sorghum bicolor - variation, 5283 Residues: atggttcacg gcgcctccgc gacaacgcaa ttcatgcgcg ccgcgacgca gcagcagcag 60 caaggaaagg accgcgtgcc cgtgggcgcc ggtcgacaaa aacctcctcg cccccggagg 120 ggcatcggat ccagccgaac cgcagcgtgt acgaccgcgg agcggcaagc ggcgcgaccc 180 gaacccgacg cgagctgccc gggcgcaccg gcagtccggc ctcgtgcttc tgcattgggt 240 cgcgatccaa atcctgggag gctctcctgt cttctctggc tatccgaaca ggtccgtccg 300 agcattattt gtcagatctc tttccgtctt gtcagttgtc cacggtctcc gagccctcct 360 atttgcatcc acgtagattg atgatagatt cctctcggaa gtgtctcgaa attttctaaa 420 ctctaaaatt agaaagttag tacttgtgaa attctttaaa aaaaaaatta ctagtaaaac 480 tgagctgcgc taaacagatt tcgccagatt tgaagatctg agatttcgag attatctagt 540 gcagagggac atttcttatt ttttaccttc tcaaatttga aacactaaac gacttctttt 600 ttcagcagga gagactcaga ttctgatcgc attttttttt cactgatcac atttgtgctt 660 ctctctcgta ggccttgttt agttccgaaa agtgaaaact ttttggaact gtagcatttt 720 cgtttgtttg atcatggact aactaggatc aaaagattcg tcttgtgatt tacagctaaa 780 ctgtgtaatt agtttttgtt ttcgtttata tttaatgttt catgcatgtg acacaagatt 840 cgatgtgacg ggaaatcttg aaaacttttt ggttttcagg gtaaactaaa caaggccgta 900 gtcgttctgg acaagttttg tcctaacgag cagaagcgta ctgacgaaac ttgtcttcac 960 tggcccattg gatcttgtgg cagctcatgc aaaaaatatt tcgatagttg cctatcacac 1020 gcatgtgttt actgtccaca gacgctgatt ctaaagaatc ttttcaccat caattggccg 1080 cgacattttg gcgatttctc tgcgagactc actgatgaca cattactttt gcatttatta 1140 aaaaatccaa tctttttgtc tctttttacc cgaaaaaagc tccctccttt tttgacccct 1200 cttccttccc ctgaaacgca cgcagacgca gctgagcctg aattcttatc cacccacggc 1260 gccaccctcc actcccggaa cgtaagccaa aagatcagag aaagagacag acagacaaga 1320 ttaaaagagt gacaaggcaa agagagagaa aaaagagtaa gaaaccgccc tagaatcttt 1380 tcagtttttc cctgtcttca tgtgtctttg ttatagagac gctgccttgt cggggcagca 1440 gacttgggac gagagagagg cctagagggg gaggagttgg tgagcgagct cgggatcagc 1500 gggtgacccc agaggttgtt gcctctggaa gttcccaatt ctttaacccc catcttcttc 1560 cacatgactt tggactcgct gctgttcttt tggttggtat atccttggat ctctgactcc 1620 gcctgttccc cgaaatttcc agttcttgct tcctcttgga ggagggctgc agcctgcacc 1680 ctgcagggga gagagagcag gaggggacgg agacatgggt agcttcgcta agctggcgaa 1740 gagggcggtg gagacggacg cgccggtcat ggtgaaggtg acgaatttct cctacctcgt 1800 cgaaatcgca tcttgactct ggagtttctt gggcttcctt ggtgagttct ttctaataag 1860 acgtcccttt ttcagataca agaactgctt cgaggggcca cggatgtcat gtcgcttgcg 1920 caggtatatg accataattt tctcgatttg gctgtgcaat ggtttcctgc tttgtgatgt 1980 tatttaaggt taatggaaca agcacgaaac ggaaagtcaa acgaaagcag aacggattaa 2040 tgggagtcga tcatcttata gcaattcgct cccaaatggt ttctgtcaat tgttcaagtt 2100 gaaatgtact actgtagttc ggtacagttc atttgctacg tttcgtgtaa caaatcatac 2160 tgtttttact tgctattcct gaatagttct tatgttgccg aagtgggaca ttcgtatgta 2220 atctaactag tgacatgcgt gtcttttagt gtcctattag catgacccga ccatatgata 2280 tttatttctg agaaattcgt ttctgttctt cactttttgt aaatcctgaa tgcagggagt 2340 tgtttactgg caacctcctg agtcagctct ggataagatc gaaaaaatcg tcagggaacc 2400 aacagtcagt aagtatggtt ctgatgatgg acttcctgag cttcgagaag cacttctcga 2460 aaaggtaact tctttttatc atagaatata taatatattt tgcccataca ctgactaaag 2520 caggccatgc tcttgagtat taccacattg ccatgccttt gtcattggga actagggatc 2580 ctgcttctaa accactacac cgtaaccaaa ttttaataga gatatttgat cttaactcac 2640 agtcgcatca gcaatctcaa gtgaccgatg caatggttca gaaattactt tgtcaaaaca 2700 aaggttccaa aaaatctttt tgttcccaga gttacattcc tgggaagcat ctaattttct 2760 gaatattggc agagtgtgtc ataaaactct ctattcatca actgagaaat gggaacaata 2820 ttcattattg tgagtttgtg actcctctgg aaattcagaa gagaaattca tggtggtgct 2880 aagagttgca aagtctctct gccatgttgt ttgtctaaca gttgagatga aatcctgaga 2940 tgatttaggt gctctaaccg ttagcctaaa tgctccacat cgcacagtta tctttagaat 3000 ttgttccacc gttttgtcac ctactgggct aagattttta ttgctgtttg gaccaccaat 3060 gtgttaaaat tagtactgca ttgcaagcat cttgtatatc tttcctgatg tctactgtat 3120 ttttggcagc tacgcagaga gaataagctt accaagtcat cagtcatggt cactgctggt 3180 gcaaatcagg taaaaactta ctttcctatt ttgccttgta aagttttcaa actgggcctt 3240 acgtttccca atttacttat gtttattact tctttagggg cacactcttc ctttcctttt 3300 tcactgctag accttgaact tgtcttacaa tctggtcttt tgttacattg attttttcag 3360 gcttttgtga acttggtcct cactctttgt gatgctggtg attctgttgt catgtttgca 3420 ccatattatt tcaatgccta catgtcattc cagatgacag gtgttactga catattaatt 3480 ggtggttgcg atcccaagac acttcatcct gatgttggta agatgattct cttcttcttt 3540 ctgtttcatt ggagaaattg gtgagatgtc ttatatcaat agtctgttgt aagaaatttg 3600 ttgtacttag tgctggttca ggagcatctg cttcattggc acatgttcaa tttccgttat 3660 aagtctacat tatcttttag ctgatgagaa gatatgcttt tgtaaaatac aacgcatcta 3720 gtataagaaa ttatgcattg gacgtagttg ataatatttc attttggaag catacattac 3780 aattatgtct aaaactgcag attggttgga gaaggttctg aaagaaaatg accctatccc 3840 taaacttgtt actgttgtga atccggggaa cccctctgga gcttttgttc ccaggcctat 3900 gcttgaggtc atctctctcc actaacactt gtgtttggaa tcactatcca atatttccta 3960 atattgcatt gtcattccag agaatttcag atctgtgcaa aaatgctggt gcatggcttg 4020 tggttgacaa tacctatgag taagtcaata ctgtaaagtg atcattttca caagcaatta 4080 tataatcttt tgtggtatct gttagagaga acttagaaga gccggggaat tatggttgta 4140 gtcaaaggga cagatcatat aagccattag agctcttctg cctcctcttg aatctgtgtc 4200 cagatgaaag acactctgat ggcatatagg atttctagta tctttgcagt ttccacaagg 4260 aagggaaaat cagaatattg tgcccatagg agattcagaa agtagtcgtc ctgcacagat 4320 atgttgtgtg agaatatgtc gaatacagtt atcctgtgtt tgtttttttg gtttaggata 4380 agttctctta ttcaaattca ttccagctgc caagccttta taaatacgtt ttaggctcta 4440 aacttggtga tgttaaaaat aagccctcca atcacactta ctgctttata ctttatacag 4500 gccagggttt atgtttgcct gaaagagtca ggtgttcagg tccatgttga ggaactaata 4560 gtaattaata aaggaccttt tccctctaag cttaaagaaa catacaagtt tttgtcgtgg 4620 agctgcgatt agccaaccat atttgaagtg gtagcataaa gaatggagtc caaacatgtc 4680 gagtggaaca cagaaagtgg cttattcctt ttactccctg caaacgaatt ctgctcctta 4740 ttggaattta gttatggtct ttagcatttg agctttgtaa gatttgatgc ttaggtcagt 4800 tttcctgtgt ctttttgcag atactttatg tatgatggaa tggagcacta ttgcttagaa 4860 gatactcata ttgtcaacct cttctcattc tcaaaggctt atggaatgat ggggtggcgt 4920 gtaggatacg tgagtgcatc atactcttcg tttatcattt tattatgctt tactccactt 4980 tttggctgct gctgctgtta attgtcactg taacagtaag tcatacatgg actgtctgct 5040 gcagattgca tttccaaatg aagctgatgg cttccacgat cagctcctca aagtgcaaga 5100 caacatacct atctgtgcct ccatcatcgg gcagcgcctg gcgctctact cactggaggc 5160 tggccccgag tggatcaaag aaagggtgaa agacttggtg aaaaaccgag cactgctcgt 5220 ggaggcgctg tccccgctcg gtgaggacaa tgtgaagggc ggggagggcg ccatctacct 5280 ctcggccaaa ctgccggaca actgctccaa cgattttgaa gttgtcaggt ggcttgcaaa 5340 caagcacggt gtcgctgtga tccctggcag cgccagtgga ggccccggat acatccgcgt 5400 ctccttcgga gggctcaaag aagaagacac caggctcgct gctgagaggc taaggcgcgg 5460 cttgcaggag ctggtgactg atggaatggt acagtaa 5497 Sequence Number (ID): 2 Length: 5497 Molecule Type: DNA Features Location / Qualifiers: - source, 1..5497 > mol_type, genomic DNA > organism, Sorghum bicolor Residues: atggttcacg gcgcctccgc gacaacgcaa ttcatgcgcg ccgcgacgca gcagcagcag 60 caaggaaagg accgcgtgcc cgtgggcgcc ggtcgacaaa aacctcctcg cccccggagg 120 ggcatcggat ccagccgaac cgcagcgtgt acgaccgcgg agcggcaagc ggcgcgaccc 180 gaacccgacg cgagctgccc gggcgcaccg gcagtccggc ctcgtgcttc tgcattgggt 240 cgcgatccaa atcctgggag gctctcctgt cttctctggc tatccgaaca ggtccgtccg 300 agcattattt gtcagatctc tttccgtctt gtcagttgtc cacggtctcc gagccctcct 360 atttgcatcc acgtagattg atgatagatt cctctcggaa gtgtctcgaa attttctaaa 420 ctctaaaatt agaaagttag tacttgtgaa attctttaaa aaaaaaatta ctagtaaaac 480 tgagctgcgc taaacagatt tcgccagatt tgaagatctg agatttcgag attatctagt 540 gcagagggac atttcttatt ttttaccttc tcaaatttga aacactaaac gacttctttt 600 ttcagcagga gagactcaga ttctgatcgc attttttttt cactgatcac atttgtgctt 660 ctctctcgta ggccttgttt agttccgaaa agtgaaaact ttttggaact gtagcatttt 720 cgtttgtttg atcatggact aactaggatc aaaagattcg tcttgtgatt tacagctaaa 780 ctgtgtaatt agtttttgtt ttcgtttata tttaatgttt catgcatgtg acacaagatt 840 cgatgtgacg ggaaatcttg aaaacttttt ggttttcagg gtaaactaaa caaggccgta 900 gtcgttctgg acaagttttg tcctaacgag cagaagcgta ctgacgaaac ttgtcttcac 960 tggcccattg gatcttgtgg cagctcatgc aaaaaatatt tcgatagttg cctatcacac 1020 gcatgtgttt actgtccaca gacgctgatt ctaaagaatc ttttcaccat caattggccg 1080 cgacattttg gcgatttctc tgcgagactc actgatgaca cattactttt gcatttatta 1140 aaaaatccaa tctttttgtc tctttttacc cgaaaaaagc tccctccttt tttgacccct 1200 cttccttccc ctgaaacgca cgcagacgca gctgagcctg aattcttatc cacccacggc 1260 gccaccctcc actcccggaa cgtaagccaa aagatcagag aaagagacag acagacaaga 1320 ttaaaagagt gacaaggcaa agagagagaa aaaagagtaa gaaaccgccc tagaatcttt 1380 tcagtttttc cctgtcttca tgtgtctttg ttatagagac gctgccttgt cggggcagca 1440 gacttgggac gagagagagg cctagagggg gaggagttgg tgagcgagct cgggatcagc 1500 gggtgacccc agaggttgtt gcctctggaa gttcccaatt ctttaacccc catcttcttc 1560 cacatgactt tggactcgct gctgttcttt tggttggtat atccttggat ctctgactcc 1620 gcctgttccc cgaaatttcc agttcttgct tcctcttgga ggagggctgc agcctgcacc 1680 ctgcagggga gagagagcag gaggggacgg agacatgggt agcttcgcta agctggcgaa 1740 gagggcggtg gagacggacg cgccggtcat ggtgaaggtg acgaatttct cctacctcgt 1800 cgaaatcgca tcttgactct ggagtttctt gggcttcctt ggtgagttct ttctaataag 1860 acgtcccttt ttcagataca agaactgctt cgaggggcca cggatgtcat gtcgcttgcg 1920 caggtatatg accataattt tctcgatttg gctgtgcaat ggtttcctgc tttgtgatgt 1980 tatttaaggt taatggaaca agcacgaaac ggaaagtcaa acgaaagcag aacggattaa 2040 tgggagtcga tcatcttata gcaattcgct cccaaatggt ttctgtcaat tgttcaagtt 2100 gaaatgtact actgtagttc ggtacagttc atttgctacg tttcgtgtaa caaatcatac 2160 tgtttttact tgctattcct gaatagttct tatgttgccg aagtgggaca ttcgtatgta 2220 atctaactag tgacatgcgt gtcttttagt gtcctattag catgacccga ccatatgata 2280 tttatttctg agaaattcgt ttctgttctt cactttttgt aaatcctgaa tgcagggagt 2340 tgtttactgg caacctcctg agtcagctct ggataagatc gaaaaaatcg tcagggaacc 2400 aacagtcagt aagtatggtt ctgatgatgg acttcctgag cttcgagaag cacttctcga 2460 aaaggtaact tctttttatc atagaatata taatatattt tgcccataca ctgactaaag 2520 caggccatgc tcttgagtat taccacattg ccatgccttt gtcattggga actagggatc 2580 ctgcttctaa accactacac cgtaaccaaa ttttaataga gatatttgat cttaactcac 2640 agtcgcatca gcaatctcaa gtgaccgatg caatggttca gaaattactt tgtcaaaaca 2700 aaggttccaa aaaatctttt tgttcccaga gttacattcc tgggaagcat ctaattttct 2760 gaatattggc agagtgtgtc ataaaactct ctattcatca actgagaaat gggaacaata 2820 ttcattattg tgagtttgtg actcctctgg aaattcagaa gagaaattca tggtggtgct 2880 aagagttgca aagtctctct gccatgttgt ttgtctaaca gttgagatga aatcctgaga 2940 tgatttaggt gctctaaccg ttagcctaaa tgctccacat cgcacagtta tctttagaat 3000 ttgttccacc gttttgtcac ctactgggct aagattttta ttgctgtttg gaccaccaat 3060 gtgttaaaat tagtactgca ttgcaagcat cttgtatatc tttcctgatg tctactgtat 3120 ttttggcagc tacgcagaga gaataagctt accaagtcat cagtcatggt cactgctggt 3180 gcaaatcagg taaaaactta ctttcctatt ttgccttgta aagttttcaa actgggcctt 3240 acgtttccca atttacttat gtttattact tctttagggg cacactcttc ctttcctttt 3300 tcactgctag accttgaact tgtcttacaa tctggtcttt tgttacattg attttttcag 3360 gcttttgtga acttggtcct cactctttgt gatgctggtg attctgttgt catgtttgca 3420 ccatattatt tcaatgccta catgtcattc cagatgacag gtgttactga catattaatt 3480 ggtggttgcg atcccaagac acttcatcct gatgttggta agatgattct cttcttcttt 3540 ctgtttcatt ggagaaattg gtgagatgtc ttatatcaat agtctgttgt aagaaatttg 3600 ttgtacttag tgctggttca ggagcatctg cttcattggc acatgttcaa tttccgttat 3660 aagtctacat tatcttttag ctgatgagaa gatatgcttt tgtaaaatac aacgcatcta 3720 gtataagaaa ttatgcattg gacgtagttg ataatatttc attttggaag catacattac 3780 aattatgtct aaaactgcag attggttgga gaaggttctg aaagaaaatg accctatccc 3840 taaacttgtt actgttgtga atccggggaa cccctctgga gcttttgttc ccaggcctat 3900 gcttgaggtc atctctctcc actaacactt gtgtttggaa tcactatcca atatttccta 3960 atattgcatt gtcattccag agaatttcag atctgtgcaa aaatgctggt gcatggcttg 4020 tggttgacaa tacctatgag taagtcaata ctgtaaagtg atcattttca caagcaatta 4080 tataatcttt tgtggtatct gttagagaga acttagaaga gccggggaat tatggttgta 4140 gtcaaaggga cagatcatat aagccattag agctcttctg cctcctcttg aatctgtgtc 4200 cagatgaaag acactctgat ggcatatagg atttctagta tctttgcagt ttccacaagg 4260 aagggaaaat cagaatattg tgcccatagg agattcagaa agtagtcgtc ctgcacagat 4320 atgttgtgtg agaatatgtc gaatacagtt atcctgtgtt tgtttttttg gtttaggata 4380 agttctctta ttcaaattca ttccagctgc caagccttta taaatacgtt ttaggctcta 4440 aacttggtga tgttaaaaat aagccctcca atcacactta ctgctttata ctttatacag 4500 gccagggttt atgtttgcct gaaagagtca ggtgttcagg tccatgttga ggaactaata 4560 gtaattaata aaggaccttt tccctctaag cttaaagaaa catacaagtt tttgtcgtgg 4620 agctgcgatt agccaaccat atttgaagtg gtagcataaa gaatggagtc caaacatgtc 4680 gagtggaaca cagaaagtgg cttattcctt ttactccctg caaacgaatt ctgctcctta 4740 ttggaattta gttatggtct ttagcatttg agctttgtaa gatttgatgc ttaggtcagt 4800 tttcctgtgt ctttttgcag atactttatg tatgatggaa tggagcacta ttgcttagaa 4860 gatactcata ttgtcaacct cttctcattc tcaaaggctt atggaatgat ggggtggcgt 4920 gtaggatacg tgagtgcatc atactcttcg tttatcattt tattatgctt tactccactt 4980 tttggctgct gctgctgtta attgtcactg taacagtaag tcatacatgg actgtctgct 5040 gcagattgca tttccaaatg aagctgatgg cttccacgat cagctcctca aagtgcaaga 5100 caacatacct atctgtgcct ccatcatcgg gcagcgcctg gcgctctact cactggaggc 5160 tggccccgag tggatcaaag aaagggtgaa agacttggtg aaaaaccgag cactgctcgt 5220 ggaggcgctg tccccgctcg gtgaggacaa tgtgaagggc ggggagggcg ccatctacct 5280 ctgggccaaa ctgccggaca actgctccaa cgattttgaa gttgtcaggt ggcttgcaaa 5340 caagcacggt gtcgctgtga tccctggcag cgccagtgga ggccccggat acatccgcgt 5400 ctccttcgga gggctcaaag aagaagacac caggctcgct gctgagaggc taaggcgcgg 5460 cttgcaggag ctggtgactg atggaatggt acagtaa 5497 Sequence Number (ID): 3 Length: 515 Molecule Type: AA Features Location / Qualifiers: - source, 1..515 > mol_type, protein > organism, Sorghum bicolor - VARIANT, 445 Residues: MVHGASATTQ FMRAATQQQQ QGKDRVPVGA GRQKPPRPRR GIGSSRTAAC TTAERQAARP 60 EPDASCPGAP AVRPRASALG RDPNPGRLSC LLWLSEQFLL PLGGGLQPAP CRGERAGGDG 120 DMGSFAKLAK RAVETDAPVM VKIQELLRGA TDVMSLAQGV VYWQPPESAL DKIEKIVREP 180 TVSKYGSDDG LPELREALLE KLRRENKLTK SSVMVTAGAN QAFVNLVLTL CDAGDSVVMF 240 APYYFNAYMS FQMTGVTDIL IGGCDPKTLH PDVDWLEKVL KENDPIPKLV TVVNPGNPSG 300 AFVPRPMLER ISDLCKNAGA WLVVDNTYEY FMYDGMEHYC LEDTHIVNLF SFSKAYGMMG 360 WRVGYIAFPN EADGFHDQLL KVQDNIPICA SIIGQRLALY SLEAGPEWIK ERVKDLVKNR 420 ALLVEALSPL GEDNVKGGEG AIYLSAKLPD NCSNDFEVVR WLANKHGVAV IPGSASGGPG 480 YIRVSFGGLK EEDTRLAAER LRRGLQELVT DGMVQ 515 Sequence Number (ID): 4 Length: 515 Molecule Type: AA Features Location / Qualifiers: - source, 1..515 > mol_type, protein > organism, Sorghum bicolor Residues: MVHGASATTQ FMRAATQQQQ QGKDRVPVGA GRQKPPRPRR GIGSSRTAAC TTAERQAARP 60 EPDASCPGAP AVRPRASALG RDPNPGRLSC LLWLSEQFLL PLGGGLQPAP CRGERAGGDG 120 DMGSFAKLAK RAVETDAPVM VKIQELLRGA TDVMSLAQGV VYWQPPESAL DKIEKIVREP 180 TVSKYGSDDG LPELREALLE KLRRENKLTK SSVMVTAGAN QAFVNLVLTL CDAGDSVVMF 240 APYYFNAYMS FQMTGVTDIL IGGCDPKTLH PDVDWLEKVL KENDPIPKLV TVVNPGNPSG 300 AFVPRPMLER ISDLCKNAGA WLVVDNTYEY FMYDGMEHYC LEDTHIVNLF SFSKAYGMMG 360 WRVGYIAFPN EADGFHDQLL KVQDNIPICA SIIGQRLALY SLEAGPEWIK ERVKDLVKNR 420 ALLVEALSPL GEDNVKGGEG AIYLWAKLPD NCSNDFEVVR WLANKHGVAV IPGSASGGPG 480 YIRVSFGGLK EEDTRLAAER LRRGLQELVT DGMVQ 515 Sequence Number (ID): 5 Length: 42 Molecule Type: DNA Features Location / Qualifiers: - source, 1..42 > mol_type, other DNA > organism, synthetic construct Residues: gaaggtgacc aagttcatgc tggagggcgc catctacctc tc 42 Sequence Number (ID): 6 Length: 41 Molecule Type: DNA Features Location / Qualifiers: - source, 1..41 > mol_type, other DNA > organism, synthetic construct Residues: gaaggtcgga gtcaacggat tgagggcgcc atctacctct g 41 Sequence Number (ID): 7 Length: 22 Molecule Type: DNA Features Location / Qualifiers: - source, 1..22 > mol_type, other DNA > organism, synthetic construct Residues: gttggagcag ttgtccggca gt 22 Sequence Number (ID): 8 Length: 101 Molecule Type: DNA Features Location / Qualifiers: - source, 1..101 > mol_type, other DNA > organism, synthetic construct - variation, 51 > allele, c or g Residues: cccgctcggt gaggacaatg tgaagggcgg ggagggcgcc atctacctct nggccaaact 60 gccggacaac tgctccaacg attttgaagt tgtcaggtgg c 101 Sequence Number (ID): 9 Length: 2001 Molecule Type: DNA Features Location / Qualifiers: - source, 1..2001 > mol_type, other DNA > organism, synthetic construct - misc_feature, 1001 > allele, c / g Residues: cccataggag attcagaaag tagtcgtcct gcacagatat gttgtgtgag aatatgtcga atacagttat cctgtgtttg tttttttggt ttaggataag ttctcttatt caaattcatt 120 ccagctgcca agcctttata aatacgtttt aggctctaaa cttggtgatg ttaaaaataa 180 gccctccaat cacacttact gctttatact ttatacaggc cagggtttat gtttgcctga 240 aagagtcagg tgttcaggtc catgttgagg aactaatagt aattaataaa ggaccttttc 300 cctctaagct taaagaaaca tacaagtttt tgtcgtggag ctgcgattag ccaaccatat 360 ttgaagtggt agcataaaga atggagtcca aacatgtcga gtggaacaca gaaagtggct 420 tattcctttt actccctgca aacgaattct gctccttatt ggaatttagt tatggtcttt 480 agcatttgag ctttgtaaga tttgatgctt aggtcagttt tcctgtgtct ttttgcagat 540 actttatgta tgatggaatg gagcactatt gcttagaaga tactcatatt gtcaacctct 600 tctcattctc aaaggcttat ggaatgatgg ggtggcgtgt aggatacgtg agtgcatcat 660 actcttcgtt tatcatttta ttatgcttta ctccactttt tggctgctgc tgctgttaat 720 tgtcactgta acagtaagtc atacatggac tgtctgctgc agattgcatt tccaaatgaa 780 gctgatggct tccacgatca gctcctcaaa gtgcaagaca acatacctat ctgtgcctcc 840 atcatcgggc agcgcctggc gctctactca ctggaggctg gccccgagtg gatcaaagaa 900 agggtgaaag acttggtgaa aaaccgagca ctgctcgtgg aggcgctgtc cccgctcggt 960 gaggacaatg tgaagggcgg ggagggcgcc atctacctct nggccaaact gccggacaac 1020 tgctccaacg attttgaagt tgtcaggtgg cttgcaaaca agcacggtgt cgctgtgatc 1080 cctggcagcg ccagtggagg ccccggatac atccgcgtct ccttcggagg gctcaaagaa 1140 gaagacacca ggctcgctgc tgagaggcta aggcgcggct tgcaggagct ggtgactgat 1200 ggaatggtac agtaactggt cccttggtgt aagtaaaaac gtagcattga agttttacag 1260 aactccaatt ttccaatggt ataattctat accgggatta attcgagaga agactatttt 1320 caagaataca ttgttcggac gagagccggg gacagaataa ataaaaggta tccggtctgc 1380 agagtaacct atgttataaa atataaatag tacatatatc atcagtgagt acttgtttct 1440 gtttgacatt cagttatcta tattactgat ggcagcaatt gtacacagtc aaaagtataa 1500 gcaagaattg tgagctgctc ttgacgtaca gagctgcctg ttagtaattt gcttggctta 1560 gcttgagaat gaatactaat gtccaaataa cgtcagcatc tgcctggata attcataatt 1620 caagtgtctg caagtaagat agatctacta tatctataaa gcagtgttaa aaaggactcc 1680 tcaagtttgc acatagaaat tacgggatta ataaaaaatg cagttggatt ttaagataat 1740 ctaatggtat agatgtacta gaaattacca gaaaatagaa ccaatggttt tttttaatga 1800 cctaatagtc taaatccaaa ggaaaatgta tgccaaatat aatctgcatt taaacttttt 1860 ccgtacctac ggtgctgtaa gccaaaaact cttctcctat tttaataaac acgtcttcaa 1920 ggaaaaatat aaaagtcatc aagaccaata aagtttattt atagaaaagt tacagacatc 1980 aaattacggt tggaagaata g 2001 Sequence Number (ID): 10 Length: 1548 Molecule Type: RNA Features Location / Qualifiers: - source, 1..1548 > mol_type, mRNA > organism, Sorghum bicolor Residues: atggttcacg gcgcctccgc gacaacgcaa ttcatgcgcg ccgcgacgca gcagcagcag 60 caaggaaagg accgcgtgcc cgtgggcgcc ggtcgacaaa aacctcctcg cccccggagg 120 ggcatcggat ccagccgaac cgcagcgtgt acgaccgcgg agcggcaagc ggcgcgaccc 180 gaacccgacg cgagctgccc gggcgcaccg gcagtccggc ctcgtgcttc tgcattgggt 240 cgcgatccaa atcctgggag gctctcctgt cttctctggc tatccgaaca gttcttgctt 300 cctcttggag gagggctgca gcctgcaccc tgcaggggag agagagcagg aggggacgga 360 gacatgggta gcttcgctaa gctggcgaag agggcggtgg agacggacgc gccggtcatg 420 gtgaagatac aagaactgct tcgaggggcc acggatgtca tgtcgcttgc gcagggagtt 480 gtttactggc aacctcctga gtcagctctg gataagatcg aaaaaatcgt cagggaacca 540 acagtcagta agtatggttc tgatgatgga cttcctgagc ttcgagaagc acttctcgaa 600 aagctacgca gagagaataa gcttaccaag tcatcagtca tggtcactgc tggtgcaaat 660 caggcttttg tgaacttggt cctcactctt tgtgatgctg gtgattctgt tgtcatgttt 720 gcaccatatt atttcaatgc ctacatgtca ttccagatga caggtgttac tgacatatta 780 attggtggtt gcgatcccaa gacacttcat cctgatgttg attggttgga gaaggttctg 840 aaagaaaatg accctatccc taaacttgtt actgttgtga atccggggaa cccctctgga 900 gcttttgttc ccaggcctat gcttgagaga atttcagatc tgtgcaaaaa tgctggtgca 960 tggcttgtgg ttgacaatac ctatgaatac tttatgtatg atggaatgga gcactattgc 1020 ttagaagata ctcatattgt caacctcttc tcattctcaa aggcttatgg aatgatgggg 1080 tggcgtgtag gatacattgc atttccaaat gaagctgatg gcttccacga tcagctcctc 1140 aaagtgcaag acaacatacc tatctgtgcc tccatcatcg ggcagcgcct ggcgctctac 1200 tcactggagg ctggccccga gtggatcaaa gaaagggtga aagacttggt gaaaaaccga 1260 gcactgctcg tggaggcgct gtccccgctc ggtgaggaca atgtgaaggg cggggagggc 1320 gccatctacc tctgggccaa actgccggac aactgctcca acgattttga agttgtcagg 1380 tggcttgcaa acaagcacgg tgtcgctgtg atccctggca gcgccagtgg aggccccgga 1440 tacatccgcg tctccttcgg agggctcaaa gaagaagaca ccaggctcgc tgctgagagg 1500 ctaaggcgcg gcttgcagga gctggtgact gatggaatgg tacagtaa 1548 Sequence Number (ID): 11 Length: 1548 Molecule Type: RNA Features Location / Qualifiers: - source, 1..1548 > mol_type, mRNA > organism, Sorghum bicolor - variation, 1334 Residues: atggttcacg gcgcctccgc gacaacgcaa ttcatgcgcg ccgcgacgca gcagcagcag 60 caaggaaagg accgcgtgcc cgtgggcgcc ggtcgacaaa aacctcctcg cccccggagg 120 ggcatcggat ccagccgaac cgcagcgtgt acgaccgcgg agcggcaagc ggcgcgaccc 180 gaacccgacg cgagctgccc gggcgcaccg gcagtccggc ctcgtgcttc tgcattgggt 240 cgcgatccaa atcctgggag gctctcctgt cttctctggc tatccgaaca gttcttgctt 300 cctcttggag gagggctgca gcctgcaccc tgcaggggag agagagcagg aggggacgga 360 gacatgggta gcttcgctaa gctggcgaag agggcggtgg agacggacgc gccggtcatg 420 gtgaagatac aagaactgct tcgaggggcc acggatgtca tgtcgcttgc gcagggagtt 480 gtttactggc aacctcctga gtcagctctg gataagatcg aaaaaatcgt cagggaacca 540 acagtcagta agtatggttc tgatgatgga cttcctgagc ttcgagaagc acttctcgaa 600 aagctacgca gagagaataa gcttaccaag tcatcagtca tggtcactgc tggtgcaaat 660 caggcttttg tgaacttggt cctcactctt tgtgatgctg gtgattctgt tgtcatgttt 720 gcaccatatt atttcaatgc ctacatgtca ttccagatga caggtgttac tgacatatta 780 attggtggtt gcgatcccaa gacacttcat cctgatgttg attggttgga gaaggttctg 840 aaagaaaatg accctatccc taaacttgtt actgttgtga atccggggaa cccctctgga 900 gcttttgttc ccaggcctat gcttgagaga atttcagatc tgtgcaaaaa tgctggtgca 960 tggcttgtgg ttgacaatac ctatgaatac tttatgtatg atggaatgga gcactattgc 1020 ttagaagata ctcatattgt caacctcttc tcattctcaa aggcttatgg aatgatgggg 1080 tggcgtgtag gatacattgc atttccaaat gaagctgatg gcttccacga tcagctcctc 1140 aaagtgcaag acaacatacc tatctgtgcc tccatcatcg ggcagcgcct ggcgctctac 1200 tcactggagg ctggccccga gtggatcaaa gaaagggtga aagacttggt gaaaaaccga 1260 gcactgctcg tggaggcgct gtccccgctc ggtgaggaca atgtgaaggg cggggagggc 1320 gccatctacc tctcggccaa actgccggac aactgctcca acgattttga agttgtcagg 1380 tggcttgcaa acaagcacgg tgtcgctgtg atccctggca gcgccagtgg aggccccgga 1440 tacatccgcg tctccttcgg agggctcaaa gaagaagaca ccaggctcgc tgctgagagg 1500 ctaaggcgcg gcttgcagga gctggtgact gatggaatgg tacagtaa 1548 Sequence Number (ID): 12 Length: 1548 Molecule Type: RNA Features Location / Qualifiers: - source, 1..1548 > mol_type, mRNA > organism, Sorghum bicolor - variation, 1334 - variation, 1335 Residues: atggttcacg gcgcctccgc gacaacgcaa ttcatgcgcg ccgcgacgca gcagcagcag 60 caaggaaagg accgcgtgcc cgtgggcgcc ggtcgacaaa aacctcctcg cccccggagg 120 ggcatcggat ccagccgaac cgcagcgtgt acgaccgcgg agcggcaagc ggcgcgaccc 180 gaacccgacg cgagctgccc gggcgcaccg gcagtccggc ctcgtgcttc tgcattgggt 240 cgcgatccaa atcctgggag gctctcctgt cttctctggc tatccgaaca gttcttgctt 300 cctcttggag gagggctgca gcctgcaccc tgcaggggag agagagcagg aggggacgga 360 gacatgggta gcttcgctaa gctggcgaag agggcggtgg agacggacgc gccggtcatg 420 gtgaagatac aagaactgct tcgaggggcc acggatgtca tgtcgcttgc gcagggagtt 480 gtttactggc aacctcctga gtcagctctg gataagatcg aaaaaatcgt cagggaacca 540 acagtcagta agtatggttc tgatgatgga cttcctgagc ttcgagaagc acttctcgaa 600 aagctacgca gagagaataa gcttaccaag tcatcagtca tggtcactgc tggtgcaaat 660 caggcttttg tgaacttggt cctcactctt tgtgatgctg gtgattctgt tgtcatgttt 720 gcaccatatt atttcaatgc ctacatgtca ttccagatga caggtgttac tgacatatta 780 attggtggtt gcgatcccaa gacacttcat cctgatgttg attggttgga gaaggttctg 840 aaagaaaatg accctatccc taaacttgtt actgttgtga atccggggaa cccctctgga 900 gcttttgttc ccaggcctat gcttgagaga atttcagatc tgtgcaaaaa tgctggtgca 960 tggcttgtgg ttgacaatac ctatgaatac tttatgtatg atggaatgga gcactattgc 1020 ttagaagata ctcatattgt caacctcttc tcattctcaa aggcttatgg aatgatgggg 1080 tggcgtgtag gatacattgc atttccaaat gaagctgatg gcttccacga tcagctcctc 1140 aaagtgcaag acaacatacc tatctgtgcc tccatcatcg ggcagcgcct ggcgctctac 1200 tcactggagg ctggccccga gtggatcaaa gaaagggtga aagacttggt gaaaaaccga 1260 gcactgctcg tggaggcgct gtccccgctc ggtgaggaca atgtgaaggg cggggagggc 1320 gccatctacc tctctgccaa actgccggac aactgctcca acgattttga agttgtcagg 1380 tggcttgcaa acaagcacgg tgtcgctgtg atccctggca gcgccagtgg aggccccgga 1440 tacatccgcg tctccttcgg agggctcaaa gaagaagaca ccaggctcgc tgctgagagg 1500 ctaaggcgcg gcttgcagga gctggtgact gatggaatgg tacagtaa 1548 Sequence Number (ID): 13 Length: 1548 Molecule Type: RNA Features Location / Qualifiers: - source, 1..1548 > mol_type, mRNA > organism, Sorghum bicolor - variation, 1334 - variation, 1335 Residues: atggttcacg gcgcctccgc gacaacgcaa ttcatgcgcg ccgcgacgca gcagcagcag 60 caaggaaagg accgcgtgcc cgtgggcgcc ggtcgacaaa aacctcctcg cccccggagg 120 ggcatcggat ccagccgaac cgcagcgtgt acgaccgcgg agcggcaagc ggcgcgaccc 180 gaacccgacg cgagctgccc gggcgcaccg gcagtccggc ctcgtgcttc tgcattgggt 240 cgcgatccaa atcctgggag gctctcctgt cttctctggc tatccgaaca gttcttgctt 300 cctcttggag gagggctgca gcctgcaccc tgcaggggag agagagcagg aggggacgga 360 gacatgggta gcttcgctaa gctggcgaag agggcggtgg agacggacgc gccggtcatg 420 gtgaagatac aagaactgct tcgaggggcc acggatgtca tgtcgcttgc gcagggagtt 480 gtttactggc aacctcctga gtcagctctg gataagatcg aaaaaatcgt cagggaacca 540 acagtcagta agtatggttc tgatgatgga cttcctgagc ttcgagaagc acttctcgaa 600 aagctacgca gagagaataa gcttaccaag tcatcagtca tggtcactgc tggtgcaaat 660 caggcttttg tgaacttggt cctcactctt tgtgatgctg gtgattctgt tgtcatgttt 720 gcaccatatt atttcaatgc ctacatgtca ttccagatga caggtgttac tgacatatta 780 attggtggtt gcgatcccaa gacacttcat cctgatgttg attggttgga gaaggttctg 840 aaagaaaatg accctatccc taaacttgtt actgttgtga atccggggaa cccctctgga 900 gcttttgttc ccaggcctat gcttgagaga atttcagatc tgtgcaaaaa tgctggtgca 960 tggcttgtgg ttgacaatac ctatgaatac tttatgtatg atggaatgga gcactattgc 1020 ttagaagata ctcatattgt caacctcttc tcattctcaa aggcttatgg aatgatgggg 1080 tggcgtgtag gatacattgc atttccaaat gaagctgatg gcttccacga tcagctcctc 1140 aaagtgcaag acaacatacc tatctgtgcc tccatcatcg ggcagcgcct ggcgctctac 1200 tcactggagg ctggccccga gtggatcaaa gaaagggtga aagacttggt gaaaaaccga 1260 gcactgctcg tggaggcgct gtccccgctc ggtgaggaca atgtgaaggg cggggagggc 1320 gccatctacc tctccgccaa actgccggac aactgctcca acgattttga agttgtcagg 1380 tggcttgcaa acaagcacgg tgtcgctgtg atccctggca gcgccagtgg aggccccgga 1440 tacatccgcg tctccttcgg agggctcaaa gaagaagaca ccaggctcgc tgctgagagg 1500 ctaaggcgcg gcttgcagga gctggtgact gatggaatgg tacagtaa 1548 Sequence Number (ID): 14 Length: 1548 Molecule Type: RNA Features Location / Qualifiers: - source, 1..1548 > mol_type, mRNA > organism, Sorghum bicolor - variation, 1335 - variation, 1334 Residues: atggttcacg gcgcctccgc gacaacgcaa ttcatgcgcg ccgcgacgca gcagcagcag 60 caaggaaagg accgcgtgcc cgtgggcgcc ggtcgacaaa aacctcctcg cccccggagg 120 ggcatcggat ccagccgaac cgcagcgtgt acgaccgcgg agcggcaagc ggcgcgaccc 180 gaacccgacg cgagctgccc gggcgcaccg gcagtccggc ctcgtgcttc tgcattgggt 240 cgcgatccaa atcctgggag gctctcctgt cttctctggc tatccgaaca gttcttgctt 300 cctcttggag gagggctgca gcctgcaccc tgcaggggag agagagcagg aggggacgga 360 gacatgggta gcttcgctaa gctggcgaag agggcggtgg agacggacgc gccggtcatg 420 gtgaagatac aagaactgct tcgaggggcc acggatgtca tgtcgcttgc gcagggagtt 480 gtttactggc aacctcctga gtcagctctg gataagatcg aaaaaatcgt cagggaacca 540 acagtcagta agtatggttc tgatgatgga cttcctgagc ttcgagaagc acttctcgaa 600 aagctacgca gagagaataa gcttaccaag tcatcagtca tggtcactgc tggtgcaaat 660 caggcttttg tgaacttggt cctcactctt tgtgatgctg gtgattctgt tgtcatgttt 720 gcaccatatt atttcaatgc ctacatgtca ttccagatga caggtgttac tgacatatta 780 attggtggtt gcgatcccaa gacacttcat cctgatgttg attggttgga gaaggttctg 840 aaagaaaatg accctatccc taaacttgtt actgttgtga atccggggaa cccctctgga 900 gcttttgttc ccaggcctat gcttgagaga atttcagatc tgtgcaaaaa tgctggtgca 960 tggcttgtgg ttgacaatac ctatgaatac tttatgtatg atggaatgga gcactattgc 1020 ttagaagata ctcatattgt caacctcttc tcattctcaa aggcttatgg aatgatgggg 1080 tggcgtgtag gatacattgc atttccaaat gaagctgatg gcttccacga tcagctcctc 1140 aaagtgcaag acaacatacc tatctgtgcc tccatcatcg ggcagcgcct ggcgctctac 1200 tcactggagg ctggccccga gtggatcaaa gaaagggtga aagacttggt gaaaaaccga 1260 gcactgctcg tggaggcgct gtccccgctc ggtgaggaca atgtgaaggg cggggagggc 1320 gccatctacc tctcagccaa actgccggac aactgctcca acgattttga agttgtcagg 1380 tggcttgcaa acaagcacgg tgtcgctgtg atccctggca gcgccagtgg aggccccgga 1440 tacatccgcg tctccttcgg agggctcaaa gaagaagaca ccaggctcgc tgctgagagg 1500 ctaaggcgcg gcttgcagga gctggtgact gatggaatgg tacagtaa 1548 Sequence Number (ID): 15 Length: 1548 Molecule Type: RNA Features Location / Qualifiers: - source, 1..1548 > mol_type, mRNA > organism, Sorghum bicolor - variation, 1333 - variation, 1335 Residues: atggttcacg gcgcctccgc gacaacgcaa ttcatgcgcg ccgcgacgca gcagcagcag 60 caaggaaagg accgcgtgcc cgtgggcgcc ggtcgacaaa aacctcctcg cccccggagg 120 ggcatcggat ccagccgaac cgcagcgtgt acgaccgcgg agcggcaagc ggcgcgaccc 180 gaacccgacg cgagctgccc gggcgcaccg gcagtccggc ctcgtgcttc tgcattgggt 240 cgcgatccaa atcctgggag gctctcctgt cttctctggc tatccgaaca gttcttgctt 300 cctcttggag gagggctgca gcctgcaccc tgcaggggag agagagcagg aggggacgga 360 gacatgggta gcttcgctaa gctggcgaag agggcggtgg agacggacgc gccggtcatg 420 gtgaagatac aagaactgct tcgaggggcc acggatgtca tgtcgcttgc gcagggagtt 480 gtttactggc aacctcctga gtcagctctg gataagatcg aaaaaatcgt cagggaacca 540 acagtcagta agtatggttc tgatgatgga cttcctgagc ttcgagaagc acttctcgaa 600 aagctacgca gagagaataa gcttaccaag tcatcagtca tggtcactgc tggtgcaaat 660 caggcttttg tgaacttggt cctcactctt tgtgatgctg gtgattctgt tgtcatgttt 720 gcaccatatt atttcaatgc ctacatgtca ttccagatga caggtgttac tgacatatta 780 attggtggtt gcgatcccaa gacacttcat cctgatgttg attggttgga gaaggttctg 840 aaagaaaatg accctatccc taaacttgtt actgttgtga atccggggaa cccctctgga 900 gcttttgttc ccaggcctat gcttgagaga atttcagatc tgtgcaaaaa tgctggtgca 960 tggcttgtgg ttgacaatac ctatgaatac tttatgtatg atggaatgga gcactattgc 1020 ttagaagata ctcatattgt caacctcttc tcattctcaa aggcttatgg aatgatgggg 1080 tggcgtgtag gatacattgc atttccaaat gaagctgatg gcttccacga tcagctcctc 1140 aaagtgcaag acaacatacc tatctgtgcc tccatcatcg ggcagcgcct ggcgctctac 1200 tcactggagg ctggccccga gtggatcaaa gaaagggtga aagacttggt gaaaaaccga 1260 gcactgctcg tggaggcgct gtccccgctc ggtgaggaca atgtgaaggg cggggagggc 1320 gccatctacc tcagtgccaa actgccggac aactgctcca acgattttga agttgtcagg 1380 tggcttgcaa acaagcacgg tgtcgctgtg atccctggca gcgccagtgg aggccccgga 1440 tacatccgcg tctccttcgg agggctcaaa gaagaagaca ccaggctcgc tgctgagagg 1500 ctaaggcgcg gcttgcagga gctggtgact gatggaatgg tacagtaa 1548 Sequence Number (ID): 16 Length: 1548 Molecule Type: RNA Features Location / Qualifiers: - source, 1..1548 > mol_type, mRNA > organism, Sorghum bicolor - variation, 1333 - variation, 1335 Residues: atggttcacg gcgcctccgc gacaacgcaa ttcatgcgcg ccgcgacgca gcagcagcag 60 caaggaaagg accgcgtgcc cgtgggcgcc ggtcgacaaa aacctcctcg cccccggagg 120 ggcatcggat ccagccgaac cgcagcgtgt acgaccgcgg agcggcaagc ggcgcgaccc 180 gaacccgacg cgagctgccc gggcgcaccg gcagtccggc ctcgtgcttc tgcattgggt 240 cgcgatccaa atcctgggag gctctcctgt cttctctggc tatccgaaca gttcttgctt 300 cctcttggag gagggctgca gcctgcaccc tgcaggggag agagagcagg aggggacgga 360 gacatgggta gcttcgctaa gctggcgaag agggcggtgg agacggacgc gccggtcatg 420 gtgaagatac aagaactgct tcgaggggcc acggatgtca tgtcgcttgc gcagggagtt 480 gtttactggc aacctcctga gtcagctctg gataagatcg aaaaaatcgt cagggaacca 540 acagtcagta agtatggttc tgatgatgga cttcctgagc ttcgagaagc acttctcgaa 600 aagctacgca gagagaataa gcttaccaag tcatcagtca tggtcactgc tggtgcaaat 660 caggcttttg tgaacttggt cctcactctt tgtgatgctg gtgattctgt tgtcatgttt 720 gcaccatatt atttcaatgc ctacatgtca ttccagatga caggtgttac tgacatatta 780 attggtggtt gcgatcccaa gacacttcat cctgatgttg attggttgga gaaggttctg 840 aaagaaaatg accctatccc taaacttgtt actgttgtga atccggggaa cccctctgga 900 gcttttgttc ccaggcctat gcttgagaga atttcagatc tgtgcaaaaa tgctggtgca 960 tggcttgtgg ttgacaatac ctatgaatac tttatgtatg atggaatgga gcactattgc 1020 ttagaagata ctcatattgt caacctcttc tcattctcaa aggcttatgg aatgatgggg 1080 tggcgtgtag gatacattgc atttccaaat gaagctgatg gcttccacga tcagctcctc 1140 aaagtgcaag acaacatacc tatctgtgcc tccatcatcg ggcagcgcct ggcgctctac 1200 tcactggagg ctggccccga gtggatcaaa gaaagggtga aagacttggt gaaaaaccga 1260 gcactgctcg tggaggcgct gtccccgctc ggtgaggaca atgtgaaggg cggggagggc 1320 gccatctacc tcagcgccaa actgccggac aactgctcca acgattttga agttgtcagg 1380 tggcttgcaa acaagcacgg tgtcgctgtg atccctggca gcgccagtgg aggccccgga 1440 tacatccgcg tctccttcgg agggctcaaa gaagaagaca ccaggctcgc tgctgagagg 1500 ctaaggcgcg gcttgcagga gctggtgact gatggaatgg tacagtaa 1548 Sequence Number (ID): 17 Length: 2001 Molecule Type: DNA Features Location / Qualifiers: - source, 1..2001 > mol_type, genomic DNA > organism, Sorghum bicolor Residues: tcgaggctct tgagcgctgc ggcgtccgcg acgtcttcgc ctaccccggc ggcacgtcca 60 tggagatcca ccaggcactc acccgttccc ccgtcatcgc caaccacctc ttccgccacg 120 agcaagggga ggccttcgcc gcctctggct tcgcgcgctc ctcgggccgc gtcggcgtct 180 gcgtcgccac ctccggcccc ggcgccacca acctagtctc cgcgctcgcc gacgcgctgc 240 tcgactccgt ccccatggtc gccatcacgg gacaggttcc gcggcgcatg attggcaccg 300 acgccttcca ggagacgccc atcgtcgagg tcacccgctc catcaccaaa cataactacc 360 tggtcctcga cgtcgacgac atcccccgcg tcgtgcagga ggctttcttc ctcgcctcct 420 ccggtcgccc gggaccggtg cttgtcgaca tccccaagga catccagcag cagatggccg 480 tgccggtctg ggacacgccc atgagtctgc ctgggtacat tgcgcgcctt cccaagcctc 540 ctgcgactga attgcttgag caggtgctgc gtcttgttgg tgaatcaagg cgccctgttc 600 tttatgttgg tggtggctgc gcagcatctg gcgaggagtt gcgccgcttt gtggagatga 660 ctggaatccc agtcacaact actcttatgg gccttggcaa tttccctggc gacgacccac 720 tgtctctgcg catgcttggt atgcatggca cggtgtatgc aaattatgca gtggataagg 780 cggatctgtt gcttgcattt ggtgtgcggt ttgatgatcg tgtgacaggg aagattgagg 840 cttttgcaag cagggctaag attgtgcaca ttgatattga tcccgctgag attggcaaga 900 acaagcagcc acatgtgtcc atctgtgcag acgttaagct tgctttgcag ggcatgaatg 960 ctcttctgga aggaagcaca tcaaagaaga gctttgactt tggctcatgg caagctgagt 1020 tggatcagca gaagagagag ttcccccttg ggtataaaac ttttgatgac gagatccagc 1080 cacaatatgc tattcaggtt cttgatgagc tgacaaaagg ggaggccatc attgccacag 1140 gtgttgggca gcaccagatg tgggcggcac agtactacac ttacaagcgg ccaaggcagt 1200 ggttgtcttc agctggtctt ggggctatgg gatttggttt gccggctgct gctggcgctg 1260 ctgtggccaa cccaggtatc actgttgttg acatcgacgg agatggtagc ttcctcatga 1320 acattcagga gctagctatg atccgaattg agaacctccc agtgaaggtc tttgtgctaa 1380 acaaccagca cctggggatg gtggtgcagt gggaggacag gttctataag gccaatagag 1440 cacacacata cttgggaaac ccagagaatg aaagtgagat atatccagat ttcgtgacaa 1500 ttgccaaagg gttcaacatt ccagcagtcc gtgtgacaaa gaagagcgaa gtccatgcag 1560 caatcaagaa gatgcttgag actccagggc catacctctt ggatataatc gtcccgcacc 1620 aggagcatgt gttgcctatg atccctagtg gtggggcttt caaggatatg atcctggatg 1680 gtgatggcag gactgtgtat tgatctaaat ttcagcatgc acatctccct gcctttcttt 1740 gacatgcata tgagctggta caagggtgat gtgttattta tgtgatgttc tcctgtgttc 1800 tatctttttg taagccgtca gctatctata gtgtgcttgt ttgatgtact ctgttatggt 1860 aatcttaagt agtttcctac cttgtagtgg tgtagtctgt tgtttcgtgc tggcatatct 1920 gtcatcagag gtcatgtaag tgccttttgc tacagataaa taaggaaata agcattgcta 1980 tgcagtggtt ctgtacgcct c 2001 Sequence Number (ID): 18 Length: 737 Molecule Type: AA Features Location / Qualifiers: - source, 1..737 > mol_type, protein > organism, Sorghum bicolor - VARIANT, 93 Residues: MATTAAAAAA ALAGATTAAP KARRRAHLLA ARRALAAPIR CSAAPPATLT VTAPPATPLR 60 PWGPTDPRKG ADILVEALER CGVRDVFAYP GGTSMEIHQA LTRSPVIANH LFRHEQGEAF 120 AASGFARSSG RVGVCVATSG PGATNLVSAL ADALLDSVPM VAITGQVPRR MIGTDAFQET 180 PIVEVTRSIT KHNYLVLDVD DIPRVVQEAF FLASSGRPGP VLVDIPKDIQ QQMAVPVWDT 240 PMSLPGYIAR LPKPPATELL EQVLRLVGES RRPVLYVGGG CAASGEELRR FVEMTGIPVT 300 TTLMGLGNFP GDDPLSLRML GMHGTVYANY AVDKADLLLA FGVRFDDRVT GKIEAFASRA 360 KIVHIDIDPA EIGKNKQPHV SICADVKLAL QGMNALLEGS TSKKSFDFGS WQAELDQQKR 420 EFPLGYKTFD DEIQPQYAIQ VLDELTKGEA IIATGVGQHQ MWAAQYYTYK RPRQWLSSAG 480 LGAMGFGLPA AAGAAVANPG ITVVDIDGDG SFLMNIQELA MIRIENLPVK VFVLNNQHLG 540 MVVQWEDRFY KANRAHTYLG NPENESEIYP DFVTIAKGFN IPAVRVTKKS EVHAAIKKML 600 ETPGPYLLDI IVPHQEHVLP MIPSGGAFKD MILDGDGRTV YWEDRFYKAN RAHTYLGNPE 660 NESEIYPDFV TIAKGFNIPA VRVTKKSEVH AAIKKMLETP GPYLLDIIVP HQEHVLPMIP 720 SGGAFKDMIL DGDGRTV 737 Sequence Number (ID): 19 Length: 737 Molecule Type: AA Features Location / Qualifiers: - source, 1..737 > mol_type, protein > organism, Sorghum bicolor Residues: MATTAAAAAA ALAGATTAAP KARRRAHLLA ARRALAAPIR CSAAPPATLT VTAPPATPLR 60 PWGPTDPRKG ADILVEALER CGVRDVFAYP GGASMEIHQA LTRSPVIANH LFRHEQGEAF 120 AASGFARSSG RVGVCVATSG PGATNLVSAL ADALLDSVPM VAITGQVPRR MIGTDAFQET 180 PIVEVTRSIT KHNYLVLDVD DIPRVVQEAF FLASSGRPGP VLVDIPKDIQ QQMAVPVWDT 240 PMSLPGYIAR LPKPPATELL EQVLRLVGES RRPVLYVGGG CAASGEELRR FVEMTGIPVT 300 TTLMGLGNFP GDDPLSLRML GMHGTVYANY AVDKADLLLA FGVRFDDRVT GKIEAFASRA 360 KIVHIDIDPA EIGKNKQPHV SICADVKLAL QGMNALLEGS TSKKSFDFGS WQAELDQQKR 420 EFPLGYKTFD DEIQPQYAIQ VLDELTKGEA IIATGVGQHQ MWAAQYYTYK RPRQWLSSAG 480 LGAMGFGLPA AAGAAVANPG ITVVDIDGDG SFLMNIQELA MIRIENLPVK VFVLNNQHLG 540 MVVQWEDRFY KANRAHTYLG NPENESEIYP DFVTIAKGFN IPAVRVTKKS EVHAAIKKML 600 ETPGPYLLDI IVPHQEHVLP MIPSGGAFKD MILDGDGRTV YWEDRFYKAN RAHTYLGNPE 660 NESEIYPDFV TIAKGFNIPA VRVTKKSEVH AAIKKMLETP GPYLLDIIVP HQEHVLPMIP 720 SGGAFKDMIL DGDGRTV 737
[0004] CLAIMS 1. A dual herbicide-resistant plant comprising in its genome a first allele of an acetohydroxyacid synthase large subunit (AHASL) gene and a second allele of an hydroxyphenylpyruvate dioxygenases (HPPD) gene, wherein said first allele encodes an AHASL protein comprising an A93Y amino acid substitution and said second allele encodes an HPPD protein comprising a W445S amino acid substitution. 2. The plant of claim 1, wherein said dual herbicide-resistant plant is resistant to at least one AHAS-inhibiting herbicide and at least one HPPD-inhibiting herbicide. 3. The plant of claim 2, wherein said AHAS-inhibiting herbicide is selected from the group consisting of: imidazolinone herbicides, sulfonylurea herbicides, triazolopyrimidine herbicides, pyrimidinyloxybenzoate herbicides, sulfonylamino-carbonyltriazolinone herbicides, and mixtures thereof. 4. The plant of claim 2, wherein said HPPD-inhibiting herbicide is selected from the group consisting of benzoylpyrazole herbicides, benzoylcyclohexanedione herbicides, aroylcyclohexanedione herbicides, oxazole herbicides, cyclopropylisoxazole herbicides, pyrazolone, carbobicyclic compounds, cyclic ketone compounds, benzoylpyrazole herbicides, pyrazole herbicides, triketone herbicides, aroylcyclohexanedione herbicides, and mixtures thereof. 5. A seed of plant as claimed in claim 1. 6. The plant of claim 1, wherein said plant is a sorghum plant. 7. A method of producing a hybrid plant, said method comprising crossing a first plant with a second plant, wherein said first plant comprises in its genome at least one copy of a first allele of an AHASL gene and said second plant comprises in its genome at least one copy of a second allele of an HPPD gene, and wherein said first allele encodes an AHASL protein comprising a A93Y amino acid substitution and said second allele encodes an HPPD protein comprising a W445S amino acid substitution. 8. The method of claim 7, further comprising harvesting a seed resulting from said crossing. 9. The method of claim 7, wherein said first plant is homozygous for said first allele and said second plant is homozygous for said second allele. 10. The method of claim 7, further comprising selecting at least one progeny plant from said 12. The method of claim 11, wherein said AHAS-inhibiting herbicide is selected from the 15. The method of claim 12, wherein said sulfonylurea herbicide is selected from the group tolpyralate. fenquinotrione, mesotrione, tefuryltrione, isoxaflutole, pyrasulfotole, benzobicyclon, benzofenap, pyrazolynate, pyrazoxyfen, bicyclopyrone, sulcotrione, tembotrione, topramezone or combination thereof.
Claims
17. A sorghum seed comprising at least one copy of the AHASL A93Y allele and at least one copy of the HPPD W445S allele.
18. The sorghum seed of claim 17, a representative sample of said seed having been deposited under accession number NCIMB 44143.
19. A method for identifying a dual herbicide-resistant plant comprising in its genome a first allele of an acetohydroxyacid synthase large subunit (AHASL) gene and a second allele of an hydroxyphenylpyruvate dioxygenases (HPPD) gene, said method comprising the steps of: (a) obtaining genomic DNA from a plant; (b) using said DNA as a template for a first amplification reaction, wherein said reaction detects the nucleotide sequence set forth in SEQ ID NO: 1; (c) using said DNA as a template for a second amplification reaction, wherein said reaction detects the nucleotide sequence set forth in SEQ ID NO: 17; and (d) detecting the products of said first and said second amplification reactions.
20. A kit for genotyping a dual herbicide-resistant sorghum plant comprising in its genome a first allele of an acetohydroxyacid synthase large subunit (AHASL) gene and a second allele of an hydroxyphenylpyruvate dioxygenases (HPPD) gene wherein said first allele encodes an AHASL protein comprising an A93Y amino acid substitution and said second allele encodes an HPPD protein comprising a W445S amino acid substitution, said kit comprising (a) a first pair of primers or probes for determining the said first allele wherein the primers or probes anneal to the nucleotide sequence comprising the nucleotide sequence set forth in SEQ ID NO: 18; (b) a second pair of primers or probes for determining the presence or absence of the second allele wherein the primers or probes anneal to the nucleotide sequence comprising the nucleotide sequence set forth in SEQ ID NO:
8.
21. The kit of claim 20, wherein the second pair of primers or probes further comprises the nucleotide sequence set forth in SEQ ID NO: 5 or 6 and SEQ ID NO:
7.
22. A modified plant genome comprising a first allele of an acetohydroxyacid synthase large subunit (AHASL gene and a second allele of an hydroxyphenylpyruvate dioxygenases (HPPD) gene, wherein said first allele encodes an AHASL protein comprising an A93Y amino acid substitution and said second allele encodes an HPPD protein comprising a W445S amino acid substitution.
23. An expression cassette, comprising at least one polynucleotide comprising the mutation leading to tolerance or resistance to HPPD-inhibiting herbicides and at least one polynucleotide comprising the mutation leading to tolerance or resistance to AHAS-inhibiting herbicides, wherein the mutation are as defined in claim 1.
24. A transformation vector, comprising at least two polynucleotides, the first polynucleotide having one of the following nucleotide sequences: a1) the nucleotide sequence of SEQ ID NO: 1, b1) a sequence which encodes a sequence substantially identical to SEQ ID NO: 1 and having a codon that encodes a serine residue at a position corresponding to amino acid position 445 of SEQ ID NO: 3, c1) a nucleotide sequence encoding the polypeptide set forth in SEQ ID NO: 3, d1) a nucleotide sequence encoding a polypeptide having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 3, where the polypeptide exhibits resistance or tolerance to an HPPD-inhibiting herbicide, e1) the nucleotide sequence according to a) to d) but having one of Alternative Codons 1-5 at the allele coding for the serine residue at position 445, f1) a nucleotide sequence having at least 85% identity to the nucleotide sequence set forth in SEQ ID NO: 1, g1) a nucleotide sequence fully complementary to one of nucleotide sequences a1) to f1); and the second polynucleotide having one of the following nucleotide sequences: a2) the nucleotide sequence set forth in SEQ ID NO: 17, b2) a nucleotide sequence encoding the polypeptide set forth in SEQ ID NO: 18, c2) a nucleotide sequence encoding a polypeptide having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 18, where the polypeptide exhibits herbicide-resistant AHAS activity, d2) a nucleotide sequence having at least 85% identity to the nucleotide sequence set forth in SEQ ID NO: 17, where the nucleotide sequence encodes a polypeptide comprising a large subunit of AHAS and exhibits herbicide-resistant AHAS activity, e2) a nucleotide sequence fully complementary to one of nucleotide sequences a2) to d2), further comprising operably linked sequences driving the expression of the nucleotide sequence and selectable markers.ABSTRACT The present invention relates to a plant that is tolerant to HPPD-inhibiting herbicides and AHAS-inhibiting herbicides, such as imidazolinones and / or sulfonylurea herbicides. The invention also relates to a method of producing such a plant, and a method of identifying and selecting such a plant. The invention also relates to progeny, plant parts, plant tissues and plant seeds of such a plant. The invention also provides related methods of using the plants, parts thereof, and the mutations described herein. The invention also provides a method of applying herbicides combination to the plant that is tolerant to HPPD-inhibiting herbicides and AHAS-inhibiting herbicides.
23. An expression cassette, comprising at least one polynucleotide comprising the mutation leading to tolerance or resistance to HPPD-inhibiting herbicides and at least one polynucleotide comprising the mutation leading to tolerance or resistance to AH AS -inhibiting herbicides, wherein the mutation are as defined in claim 1.
24. A transformation vector, comprising at least two polynucleotides, the first polynucleotide having one of the following nucleotide sequences: al) the nucleotide sequence of SEQ ID NO: 1, bl) a sequence which encodes a sequence substantially identical to SEQ ID NO: 1 and having a codon that encodes a serine residue at a position corresponding to amino acid position 445 of SEQ ID NO: 3, cl) a nucleotide sequence encoding the polypeptide set forth in SEQ ID NO: 3, dl) a nucleotide sequence encoding a polypeptide having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 3, where the polypeptide exhibits resistance or tolerance to an HPPD-inhibiting herbicide, el) the nucleotide sequence according to a) to d) but having one of Alternative Codons 1-5 at the allele coding for the serine residue at position 445, fl) a nucleotide sequence having at least 85% identity to the nucleotide sequence set forth in SEQ ID NO: 1, gl) a nucleotide sequence fully complementary to one of nucleotide sequences al) to fl); and the second polynucleotide having one of the following nucleotide sequences: a2) the nucleotide sequence set forth in SEQ ID NO: 17, b2) a nucleotide sequence encoding the polypeptide set forth in SEQ ID NO: 18, c2) a nucleotide sequence encoding a polypeptide having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 18, where the polypeptide exhibits herbicide-resistant AHAS activity, d2) a nucleotide sequence having at least 85% identity to the nucleotide sequence set forth in SEQ ID NO: 17, where the nucleotide sequence encodes a polypeptide comprising a large subunit of AHAS and exhibits herbicide-resistant AHAS activity, e2) a nucleotide sequence fully complementary to one of nucleotide sequences a2) to d2), further comprising operably linked sequences driving the expression of the nucleotide sequence and selectable markers.