Ultra-sensitive detection method using photoluminescent particles

EP4758219A1Pending Publication Date: 2026-06-17ECOLE POLYTECHNIQUE +2

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
ECOLE POLYTECHNIQUE
Filing Date
2024-08-09
Publication Date
2026-06-17

Smart Images

  • Figure EP2024072670_20022025_PF_FP_ABST
    Figure EP2024072670_20022025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a method for ultra-sensitive in vitro detection and / or quantification of a biological or chemical substance of interest in a sample by detecting the emission of luminescence emitted by inorganic photoluminescent nanoparticles, comprising at least the steps of: arranging inorganic photoluminescent nanoparticles with a vanadate or vanadate / phosphate matrix of a particular formula coupled to a coupling agent for coupling to the substance of interest; placing the photoluminescent particles in contact with the substance of interest under conditions for coupling the substance of interest with the coupling agent; exciting the matrix of inorganic photoluminescent nanoparticles, by radiation with a wavelength of 240 nm to 330 nm; detecting the emission of luminescence by the inorganic photoluminescent nanoparticles; and determining the presence and / or concentration of the substance of interest by interpreting the measurement of the emission of luminescence by the particles.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Description

[0002] Title: Ultra-sensitive detection method using photoluminescent particles

[0003] The present invention relates to the field of research, bioanalysis and in vitro diagnosis. More particularly, it relates to a method for the ultra-sensitive in vitro detection and / or quantification of substances of biological or chemical interest, for example biomarkers, proteins, peptides, hormones, antibodies, DNA, RNA and other compounds, in a sample, in particular a biological sample, by detecting the emission of luminescence by photoluminescent inorganic nanoparticles with controlled optical and physicochemical properties.

[0004] Technical field

[0005] The detection and / or quantification of concentrations of biomarkers, antibodies or DNA and RNA in biological samples (blood, serum, saliva, urine, cerebrospinal fluid, etc.) is essential for medical diagnosis.

[0006] In the field of research, in vitro or ex vivo diagnostics, medical analysis and bioanalysis, a number of methods have been proposed to detect and / or measure the presence of specific substances.

[0007] These methods are generally based on the use of a probe implemented to detect and / or quantify a concentration in solution. These probes are coupled to a recognition compound, or targeting agent, allowing them to bind to the molecular species to be analyzed. This recognition compound can be a molecule, DNA, aptamer, protein or antibody. Then, the probes that have bound to the molecular species to be analyzed thanks to the recognition compound can be detected using one or more methods based for example on their luminescence, their absorbance, their chemical reactivity, their radioactivity, etc.

[0008] The most commonly implemented biochemical assays, particularly for protein detection, are enzyme-linked immunosorbent assays (ELISAs), which generally rely on the use of horseradish peroxidase as an enzyme to induce a reaction with a substrate and quantify the chemical reaction taking place by measuring the absorbance of the reaction product in the solution. The choice of the molecular recognition compound to which the probe is coupled is crucial for the effectiveness of these probes. More specifically, the effectiveness of these methods depends on the specific affinity of the recognition compound with the target substance. As examples, the referenced publications [1] and [2] detail the characteristics of these mechanisms.

[0009] Luminescent probes generally lead to more sensitive detection than probes detected by their absorbance because, in the former case, the light intensity measurements are made on a dark background, while in the latter, it is a question of measuring a variation in light intensity (measurements on a bright background).

[0010] Other assay methods currently proposed include electrochemiluminescence assay (ECLIA), fluorescence immunoassay (FIA), and radioimmunoassay (RIA).

[0011] However, these methods have various drawbacks that limit their final detection sensitivity, in particular limitations in terms of the luminescence properties of the probes used (ECLIA, FIA), safety risks, expensive equipment and the need for specialized users (not automated machines) to conduct RIA-type tests.

[0012] In particular, currently available luminescent probes have several disadvantages that prevent their full potential as diagnostic probes from being fully exploited. These disadvantages include, for example, the photobleaching phenomenon in the case of organic fluorophores, which, following irreversible chemical modifications induced by illumination, results in a disappearance of fluorescence, or the phenomenon of emission blinking for semiconductor nanocrystals, or "quantum dots", the probes then periodically ceasing to emit and being consequently unsuitable for producing a constant signal. Other disadvantages result, for example, from the width of the emission spectrum of luminescent probes. In fact, an emission spectrum that is too broad makes it difficult to filter out any background signal that may be present, and has an impact on the quality of the signal and, in particular, on the signal-to-noise ratio.In addition to the optical factors that contribute to the effectiveness of the probe in a biological test, the practicality and ease of use of the probe should also be considered. Thus, some particles, such as semiconductor nanocrystals, lose their luminescence characteristics after freezing, which is a disadvantage for the storage of bioconjugated agents. The ease of coupling the probes to the molecular compound to target the desired molecules is also an aspect to be considered when choosing the appropriate probe. Thus, a number of particles, including semiconductor nanocrystals, are synthesized in organic solvents.It follows that use for biological applications requires additional surface preparation steps to achieve dispersion of these particles in water, a process which can be complex to implement and not very stable over time [3]. Their functionalization with chemical groups, allowing coupling to molecular compounds for recognition of target molecules, also relies on weak chemical bonds, which consequently limits their stability and is detrimental to the reproducibility of detection tests.

[0013] Furthermore, the colloidal properties of the particles / probes are decisive for the conduct of biological tests. In fact, solutions with good colloidal stability are able to provide media with good homogeneity for the tests, and therefore better reproducibility in the results of these tests.

[0014] Finally, complexity and cost are important aspects in the choice of probes for diagnosis. For example, gold nanoparticles, and their surface plasmon resonance properties, have been proposed as diagnostic probes, but have not been successful as probes for in vitro diagnosis, possibly due to the complexity of the detection method [4], or possibly high cost.

[0015] On the other hand, the currently available in vitro detection methods are not entirely satisfactory, particularly in terms of the detection sensitivity that can be achieved, in order to broaden the scope of application of in vitro diagnostic methods, for example by enabling earlier detection of diseases or by enabling diagnosis of the development of a disease or the effect of a therapeutic treatment.

[0016] To improve detection sensitivity, two commercial ultrasensitive immunoassay techniques have been developed. These are the methods developed by Quanterix and Singulex, notably as explained in patent applications US7914734. They rely on the use of functionalized magnetic beads as reactive surfaces for capturing target molecules. Quanterix's technology then captures individual functionalized beads with antibodies directed against the antigens. Each bead is trapped in a well and analyzed using an ELISA-type test. Singulex, on the other hand, uses the beads to concentrate the trapped analytes and then determines their concentration by counting fluorescent signals using a confocal detection device and an excitation laser that sweeps the sample in a helical manner.

[0017] These two techniques, although they allow to achieve performances in terms of detection sensitivity higher than the conventional detection technologies discussed previously, are however highly complex and expensive. They require the use of equipment specifically dedicated to these detection techniques, and not compatible with current automated in vitro diagnostic devices.

[0018] Semiconductor nanocrystals or quantum dots have also been proposed in ultrasensitive detection tests ([5], [6], [7], [8] and [9]). However, the effectiveness of these tests is limited by the disadvantages associated with this type of luminescent probes, as discussed previously: complexity and high cost of their synthesis and functionalization, unsatisfactory colloidal stability, loss of luminescence properties after freezing.

[0019] Finally, methods based on the use of gold nanoparticles by exploiting phenomena such as surface plasmon detection, fluorescence quenching, silver deposition on gold nanoparticles, etc. ([9] to

[0013] ) make it possible to achieve high detection sensitivities but are generally highly complex.

[0020] There therefore remains a need to develop a detection / quantification method that can achieve higher detection sensitivity performance than conventional technologies such as ELISA, ECLIA, FIA or RIA, and that does not have the disadvantages, particularly in terms of complexity and cost, of the ultrasensitive methods already proposed.

[0021] When it comes to nucleic acid detection, the most common ultra-sensitive detection techniques are PCR, qPCR, or LAMP, with qPCR being the most sensitive technique. However, qPCR requires expensive equipment, skilled personnel, and a high cost per test. All of these techniques use enzymes and amplification of the initial nucleic acid, which increases their sensitivity to impurities and their cost. On the other hand, PCR and LAMP techniques are less expensive but do not allow quantification of the nucleic acid concentration in the sample.

[0022] To avoid the disadvantages of these techniques, as mentioned in the article Sakharov Y.

[0014] , ELISA-type methods have been developed but suffer from low sensitivity. There are also ELISA-type methods, as described in the article Lorenzo et al

[0015] , which are more sensitive but this increased sensitivity is achieved through combinations of complex and difficult-to-develop nanomaterials. Thus, there is currently no simple solution to combine ultra-sensitivity in the detection of nucleic acids with low cost and complexity.

[0023] Rare earth-based photoluminescent nanoparticles have already been proposed as luminescent probes in various applications

[0016] ,

[0024] For example, Dosev et al.

[0017] take advantage of the luminescence properties of Eu:Gd2O3 luminescent nanoparticles by excitation of the Gd2O3 matrix, for the detection of protein microstructures deposited on a substrate. As for Yi et al.

[0018] , they use photon up-conversion phosphors of NaYF4:Yb,Er nature, which absorb two near-IR photons for the emission of one photon in the visible.

[0025] Rare earth based photoluminescent nanoparticles have also already been implemented for single particle detection as well as for single molecule tracking, taking advantage of the absence of blinking for single particle detection, compared to semiconductor nanoparticles or Quantum Dots (

[0019] and

[0020] ). However, it was by no means foreseeable that these lanthanide ion based nanoparticles could be used for ultra-sensitive detection and quantification of biomolecules, in the case of ensemble detection of biomolecules. Indeed, apart from the absence of blinking, the luminescence properties of rare earth based luminescent nanoparticles are considered inferior to those of Quantum Dots.In these particles, particularly those consisting of a metal oxide matrix where some ions are substituted by rare earth ions, the excitation of luminescence can be done either by excitation of the matrix followed by a transfer of energy to the luminescent rare earth ions, or by direct excitation in the visible of the luminescent rare earth ions. Concerning the excitation of the matrix, its absorption band is generally located in the UV, which has two disadvantages: few lasers are currently available at these wavelengths and existing lasers are bulky and expensive; and, at these wavelengths, biomolecules absorb and emit strongly, which can produce a significant parasitic background signal that should be avoided.Regarding the direct excitation of rare earth ions, the extinction coefficient for a nanoparticle is lower than that of Quantum Dots but can be comparable to that of an efficient organic fluorophore

[0016] .

[0026] Yuan et al.

[0021] , in a review article, present time-resolved biological luminescence assays using lanthanide-based nanoparticles. Lanthanide-based luminescent probes are particles comprising lanthanide complexes, which limits the number of lanthanide ions per particle for a given particle volume, or "up-conversion" nanoparticles. For example, in publications using nanoparticles comprising lanthanide complexes, small diameter nanoparticles (8-9 nm) contain only between 3000 and 5000 ions

[0028] , Only nanoparticles of much larger sizes, in particular greater than 100 nm, can contain on the order of 30,000 ions or more

[0022] and

[0023] ,

[0027] Similarly, Corstjens et al.

[0024] use up-converting nanoparticles for the in vitro detection of IFN-gamma in human peripheral blood mononuclear cells. Up-converting nanoparticles are suitable for deep tissue imaging (typically near-IR excitation of 1' Yb 3+ where tissues absorb little compared to the visible). On the other hand, because excitation requires the absorption of two photons, high excitation intensities are necessary. In addition, the quantum efficiency of these systems is low, of the order of 1%. Thus, the number of photons emitted is relatively low.

[0028] Lanthanide complexes or chelates are also proposed as luminescent probes for immunoassays in publications

[0023] ,

[0025] ,

[0026] and

[0027] . However, these complexes or chelates typically contain only one lanthanide ion or, at best, a few (less than ten) lanthanide ions.

[0029] Finally, we can also cite the publication Zhou et al.

[0028] which proposes a method of detection with improved sensitivity from inorganic nanoparticles doped with lanthanides, following a complex protocol of dissolution of the nanoparticles and detection of the emission of the micelles containing the lanthanides thus formed.

[0030] As for document EP 1 282 824, it describes the use of surface-modified inorganic luminescent nanoparticles as probes for detecting a biological or other organic substance. The detection method proposed in this document is based on the principle of ELISA detection. However, this document does not propose their use for ultra-sensitive detection. We can also cite document US 7 550 201 which proposes the use of inorganic nanoparticles doped with lanthanide ions, in particular for their application in diagnosis. However, this document does not propose their use for an ultra-sensitive detection method.

[0031] Also, the publications Son et al.

[0029] and Nichkova et al.

[0030] propose the implementation of Eu:Gd2O3 nanoparticles as an alternative to organic fluorophores as probes for DNA detection and for phenoxybenzoic acid detection, respectively. However, these documents do not suggest their implementation for ultra-sensitive detection.

[0032] The publication Mousseau et al.

[0039] proposes, in the case of a membrane detection method, the detection of luminescence emitted by photoluminescent nanoparticles containing lanthanide ions within a vanadate matrix. The vanadate matrix is ​​excited by radiation in the UV range at a wavelength of 278 nm, the energy is transmitted to photoluminescent lanthanide ions and a smartphone camera detects the emission of these ions. The matrix is ​​excited with a low intensity in order to limit parasitic emissions and to avoid detection by the camera of a residual excitation signal.

[0033] The Applicant proposed in application WO 2019 / 025618 an ultrasensitive detection method based on the direct excitation of rare earth ions of luminescent nanoparticles by laser radiation. In this approach, the absorption of the nanoparticles remains low and their excitation typically requires a 1W laser to achieve ultrasensitive detection. Such laser equipment is unfortunately expensive to implement.

[0034] Statement of the invention

[0035] The present invention aims precisely to propose a new ultrasensitive detection method, based on the use of particular luminescent nanoparticles doped with rare earth ions, (i) freeing itself from the constraints of implementing expensive laser equipment and (ii) improving the detection sensitivity.

[0036] The invention relates more particularly, according to a first of its aspects, to a method for ultra-sensitive detection and / or quantification in vitro of a substance of biological or chemical interest in a sample to be analyzed, in particular a biological sample, by detection of the luminescence emission emitted by photoluminescent inorganic nanoparticles, comprising at least the following steps:

[0037] (i) arrangement of photoluminescent particles formed in whole or in part from a photoluminescent inorganic nanoparticle with a vanadate or vanadate / phosphate matrix, of formula (I):

[0038] Al- x Ln x VO4(ly)(PO4)y (I) in which:

[0039] • A is chosen from yttrium (Y), gadolinium (Gd), lanthanum (La) and their mixtures, in particular A represents Y;

[0040] • Ln is chosen from europium (Eu), dysprosium (Dy), thulium (Tm), samarium (Sm), neodymium (Nd), erbium (Er), ytterbium (Yb) and mixtures thereof, in particular Ln represents Eu;

[0041] • 0 < x < 1; in particular 0.02 < x < 0.5, in particular 0.05 < x < 0.4 and more particularly x is 0.4, 0.2, 0.1 or 0.05; and

[0042] • 0 < y < 1, in particular y is 0, the photoluminescent inorganic nanoparticles being coupled to a direct or indirect coupling agent to the substance of interest,

[0043] (ii) bringing said photoluminescent particles into contact with the substance of interest under conditions of direct or indirect coupling of the substance of interest with the coupling agent,

[0044] (iii) excitation of the matrix of photoluminescent inorganic nanoparticles of formula (I), by radiation of wavelength between 240 nm and 330 nm;

[0045] (iv)detection of luminescence emission by photoluminescent inorganic nanoparticles, in particular time-resolved detection, and

[0046] (v) determination of the presence and / or concentration of the substance of interest by interpretation of said measurement of the luminescence emission by the particles.

[0047] The coupling agent may be a substance of interest targeting agent that couples directly to the substance of interest in step (ii).

[0048] Alternatively, the coupling agent is a molecule allowing the attachment of a targeting agent to the substance of interest, in particular the targeting agent being attached to the substance of interest prior to bringing the photoluminescent particles into contact with the substance of interest. In this case, the method may comprise bringing the substance of interest into contact with the targeting agents under conditions of coupling the targeting agents with the substance of interest between steps (i) and (ii), the coupling of the substance of interest with the coupling agent being done indirectly by coupling the targeting agent with the molecule.

[0049] Preferably, the excitation of the matrix of photoluminescent inorganic nanoparticles of formula (I) is carried out by radiation with an emission wavelength of between 260 and 330 nm, better between 260 nm and 310 nm, better between 270 and 290 nm.

[0050] Preferably, the excitation of the matrix of photoluminescent inorganic nanoparticles of formula (I) is carried out by radiation in the UV-B and / or UV-C range.

[0051] For the purposes of the invention, the “analysis” of the substance in a sample covers the detection aspect or even qualitative characterization of the presence or absence of said substance, and also the dosage aspect or even quantitative characterization of said substance.

[0052] The method of the invention is thus based on the excitation of the vanadate or vanadate / phosphate matrix of the luminescent nanoparticles Ai- x Ln x VO4(iy)(PO4)y by UV radiation, in particular UV-B and / or UV-C radiation, typically at a wavelength of about 280 nm, and transferring the energy to the luminescent rare earth ions.

[0053] Contrary to what the person skilled in the art might think, that is to say that we will have too many parasitic emissions when exciting in the UV, this latter drawback is counterbalanced by the fact that the absorption of the matrix is ​​much greater when we excite in the UV than when we directly excite the lanthanide ions, as is the case in international application WO 2019 / 025618.

[0054] As illustrated in the following examples, the inventors have shown that it is possible, despite the use of excitation wavelengths, to achieve ultrasensitive detection.

[0055] In fact, if it is known that the absorption at the excitation peak of the vanadate matrix of vanadate-type nanoparticles enriched in lanthanides is strong, an excitation of these nanoparticles in UV wavelengths is typically contraindicated in ultrasensitive detection applications, due to the parasitic emission, excited at these wavelengths, of signals from autofluorescent materials and molecules on the supports and in the analyzed media.

[0056] Preferably, the detection of the luminescence emission by the particles is a time-resolved detection. For the purposes of the invention, the term "time-resolved detection" means either a detection that is sufficiently rapid to measure the rise and fall of the luminescence signal following the start and stop of the excitation or a delayed detection of the luminescence signal emitted by the photoluminescent particles used according to the invention, i.e. after the end of the parasitic emission of the autofluorescent materials and molecules. A time-resolved measurement of luminescence has, for example, been described in document WO 03008974.This is possible because the parasitic emission of autofluorescent materials and molecules typically has a lifetime of the order of a nanosecond, while the lifetime of the emission of inorganic photoluminescent nanoparticles with a vanadate or vanadate / phosphate matrix is ​​a few hundred microseconds, particularly in the case of europium.

[0057] The invention allows in particular “ultra-sensitive” detection, in particular the method has a sensitivity of detection of the substance of biological or chemical interest in the sample less than or equal to 10 pM, better less than or equal to 1 pM, or even less than or equal to 0.1 pM, or even less than or equal to 0.01 pM (i.e. 10 fM), or even less than or equal to 1 fM, even better less than or equal to 0.1 f (i.e. 100 aM), even better less than or equal to 0.01 fM (i.e. 10 aM). Such detection is possible without amplification and / or without the use of enzymes. It is possible to exploit the spectral width of the fine emission of rare earth ions, in particular less than 10 nm in the case of the emission of europium at 617 nm to reject with an effective emission filter the broadband contributions of the parasitic emissions.

[0058] Furthermore, the inventors have shown that the use of time-resolved detection makes it possible to still effectively circumvent the problem of parasitic emissions at the wavelengths used, and to achieve so-called "ultra-sensitive" detection.

[0059] The invention thus takes advantage of the long emission duration specific to the nanoparticles of formula (I), in particular greater than 1 ps, or even greater than 10 ps, ​​or even greater than 100 ps, ​​unlike the short lifetimes, of the order of a few nanoseconds for fluorescent molecules, to at least partially overcome the parasitic background signal by carrying out delayed detection of the luminescence signal. Advantageously, the time-resolved luminescence detection can be implemented using unsophisticated and inexpensive equipment, in particular modulation of the supply current of the excitation source, a conventional photomultiplier and a 100 kHz AD converter, as described in the remainder of the text. It is also possible to modulate the excitation source by a mechanical chopper or by any other method known to those skilled in the art.

[0060] The photomultiplier can be configured to detect only visible light and not UV light. This helps limit interference from stray signals caused by residual excitation light, which improves detection sensitivity.

[0061] The method of the invention thus advantageously makes it possible to achieve a performance in terms of detection sensitivity that is much higher than the performance of conventional detection techniques such as ELISA, ECLIA, FIA or RIA for the detection of proteins or peptides or organic molecules such as hormones. For nucleic acids, the method of the invention makes it possible to achieve a performance approaching the detection sensitivity of PCR without using amplification or the enzymes necessary for the amplification of DNA, while allowing quantification of the concentration.

[0062] Advantageously, the ultrasensitive method of the invention thus allows detection at least 10 times, in particular at least 50 times, better still at least 100 times more sensitive than the ELISA type enzymatic immunodetection method using the same recognition and targeting antibodies.

[0063] The ultrasensitive method according to the invention thus allows detection and / or quantification of a substance of interest present in a sample in a content strictly less than 100 pM, or even less than 10 pM, or even less than 1 pM, even better less than 0.1 pM, or even less than 0.01 pM (10 fM), or even less than or equal to 1 fM, even better less than 0.1 f (i.e. 100 aM), even better less than 0.01 fM (i.e. 10 aM). These concentrations depend on the target molecule and, in particular, on the affinity of the recognition compound, or targeting compound, coupled to the probe, but are comparable to those detectable by ultra-sensitive methods (Quanterix or Singulex). Advantageously, the ultra-sensitive method of the invention, while making it possible to achieve detection performances comparable to the ultra-sensitive technologies already proposed, proves to be particularly advantageous in terms of ease of implementation and cost.

[0064] Preferably, the step of arranging photoluminescent particles comprises arranging a plurality of photoluminescent particles, the excitation (iii) comprises, in particular consists of, the simultaneous excitation of the matrices of a plurality of photoluminescent inorganic nanoparticles of formula (I) and the detection (iv) comprises, in particular consists of, the simultaneous detection of the emission of luminescence by the photoluminescent inorganic nanoparticles excited in the excitation step (iii).

[0065] Preferably, the excitation and the detection are carried out in an analysis space, preferably fixed during the analysis, comprising a plurality of photoluminescent particles and the determination of the presence and / or concentration of the substance of interest (v) is carried out by interpretation of the measurement carried out in said analysis space.

[0066] Preferably, the excitation, detection and determination of the presence and / or concentration of the substance of interest are carried out without scanning the sample during the analysis.

[0067] Thus, unlike the complex technologies developed by Quanterix and Singulex, the latter requiring in particular scanning of the sample, the ultrasensitive method of the invention uses detection equipment of small size, limited cost and each element of which is easily available for purchase, for the excitation and measurement of luminescence emitted by the nanoparticles, as detailed in the rest of the text, and does not require any equipment element specifically dedicated to the ultra-sensitive detection method of the invention. Advantageously, it is thus compatible with integration into an automated analysis device, subject to limited ergonomic adaptation.

[0068] Also, the excitation of the nanoparticle matrix, carried out in the wavelength range specified above, can be implemented using a light-emitting diode type source with reduced power which is much less expensive than laser illumination devices, such as a laser diode, used in the methods described previously. Furthermore, the method of the invention is, furthermore, suitable for multiplexed analyses. Thus, the method of the invention can be implemented for the simultaneous detection and / or quantification of at least two different substances in a sample, in particular following a procedure presented later.

[0069] The method of the invention can be implemented for the analysis of substance(s) of biological or chemical interest in various samples, also called "analyte". The sample can be in particular a biological sample, in particular a sample of human collection, for example chosen from blood, serum, plasma, saliva, urine and cerebrospinal fluid. The sample can also be diluted fecal matter, vaginal swab or nasopharyngeal swab or sputum. A diluent can be used with the sample to be analyzed, in particular when the liquid sample is plasma, serum, whole blood, nasal or vaginal swab or sputum for example.

[0070] At least one nanoparticle can be coupled with a plurality of coupling agents, the method comprising a step of coupling the nanoparticles with the coupling agents comprising dissolving the nanoparticles with a proportion of coupling agent greater than the proportion of nanoparticles, in particular with a ratio of at least two coupling agents for one nanoparticle or even at least 10 coupling agents per nanoparticle, or even between 10 and 80 coupling agents.

[0071] It may also be a solution containing biological molecules.

[0072] The method of the invention can be implemented, for example, for the detection and / or quantification of biomarkers, antibodies, DNA and / or RNA. It can be implemented to detect human, animal, bacterial, viral or circulating DNA and / or RNA. It can also make it possible to provide a genotype in a biological sample. It can in particular be any type of nucleic acid including tRNA, mRNA, miRNA, dsRNA, circRNA, ncRNA, IncRNA.

[0073] The invention relates, according to another of its aspects, to the use of the method defined above for in vitro diagnostic purposes. Advantageously, the possibility of using the ultra-sensitive method to detect ultra-low levels of certain substances in biological samples allows, for example, the use of the method of the invention for earlier detection of diseases, or even diagnosis of the development of a disease or the effect of a therapeutic treatment. In addition, this ultra-sensitive detection method allows the use as biomarkers of substances whose concentration is currently too low to be detected with conventional methods. It also makes them detectable in easily accessible biological media (saliva, urine, blood, etc.) biomarkers whose concentration is too low to be detected with conventional methods and requires invasive methods such as sampling cerebrospinal fluid, for example.

[0074] According to yet another of its aspects, the invention relates to an in vitro diagnostic assembly, comprising

[0075] ■ at least photoluminescent particles formed in whole or in part from a photoluminescent inorganic nanoparticle as defined above, said particles being coupled to a coupling agent, in particular the coupling agent being a surface functionalization with chemical groups, for example carboxyl, amino, thiol, aldehyde or epoxy groups, provided by molecules, for example citric acid or polyacrylic acid, and / or coupled to molecules, for example streptavidin, said chemical groups or molecules being capable of allowing the coupling of said particles with an agent for targeting the substance of interest; or an agent for targeting the substance of interest; and

[0076] ■ a detection and / or quantification system comprising at least:

[0077] • an illumination device, preferably of the light-emitting diode type, with an emission wavelength of between 260 and 330 nm, better still between 260 nm and 310 nm, better still between 270 and 290 nm, which may have a power of less than or equal to 500 mW, better still less than or equal to 200 mW, for example between 50 and 150 mW;

[0078] • a device for detecting the light intensity emitted by the particles; the detection and / or quantification system comprising a device for collecting and spectrally filtering the emitted luminescence, a photomultiplier and / or a photodiode and an AD converter which may also comprise equipment for implementing the time-resolved detection of the luminescence emission, in particular a system for electronically modulating the power of the excitation source, a mechanical chopper, a photomultiplier and an AD converter.

[0079] The illumination device can be in UV-B or UV-C.

[0080] The photomultiplier can be configured to detect only visible light and not UV light. This helps limit interference from stray signals caused by residual excitation light, which improves detection sensitivity.

[0081] Preferably, the detection and / or quantification system is fixed during the analysis.

[0082] Preferably, the detection device is devoid of a confocal detection device.

[0083] Such an in vitro diagnostic set allows the easy implementation of an ultra-sensitive detection and / or quantification method according to the invention, for example for measuring biomarkers or antibodies in a biological sample.

[0084] The diseases that can be diagnosed with the in vitro diagnostic kit of the invention are not limited and include all diseases revealed by the presence of a specific marker of the disease, of the molecule of biological interest type (protein, nucleic acid, etc.), for which there is one or more specific binding partner(s) (ligand, antibody, complementary nucleic acids, aptamers, etc.).

[0085] Examples include infectious diseases (bacterial, parasitic, or viral, such as AIDS), inflammatory and autoimmune diseases, cardiological, neurological, or oncological diseases (for example, solid cancers such as breast or prostate cancer).

[0086] The ultra-sensitive detection method of the invention is not limited to the aforementioned applications. It can thus be implemented for the detection of GMO DNA in seeds, for example, or for the detection of a pollutant or a pathogen in water or in food intended for consumption.

[0087] The applications of the ultra-sensitive detection method according to the invention can thus extend from immunological fields to molecular genetics or to the detection of DNA and RNA. It can be used to label one or more strands of RNA from a biological sample, with a partially complementary probe fragment linked to a nanoparticle, then detect them by hybridization on complementary fragments of another region grafted onto a solid substrate, following an approach similar to DNA chips, of the Affymetrix type. One advantage of the invention then lies in the absence of an amplification step usually necessary for these approaches.

[0088] In the remainder of the text, the photoluminescent inorganic nanoparticle of formula (I) of the invention will be referred to more simply as "nanoparticle".

[0089] Other characteristics, variants and advantages of the method according to the invention will become more apparent on reading the description, examples and figures which follow, given for illustrative and non-limiting purposes of the invention.

[0090] In the rest of the text, the expressions "between ... and ...", "ranging from . . . to ..." and "varying from ... to ..." are equivalent and are intended to mean that the limits are included, unless otherwise stated.

[0091] Unless otherwise indicated, the expression "comprising a" must be understood as "comprising at least one".

[0092] Luminescent particles of the invention

[0093] As indicated previously, the ultra-sensitive detection method according to the invention is based on the detection of the luminescence emission of photoluminescent particles comprising, in particular being formed from, a photoluminescent inorganic nanoparticle with a vanadate or vanadate / phosphate matrix as described previously, and coupled to at least one direct or indirect coupling agent with the substance of interest.

[0094] Photoluminescent inorganic nanoparticle

[0095] As indicated previously, the photoluminescent nanoparticles used according to the invention are of formula (I):

[0096] Al- x Ln x VO4(ly)(PO4)y (I) in which:

[0097] A is selected from yttrium (Y), gadolinium (Gd), lanthanum (La) and mixtures thereof, in particular A represents Y;

[0098] Ln is selected from europium (Eu), dysprosium (Dy), thulium (Tm), samarium (Sm), neodymium (Nd), erbium (Er), ytterbium (Yb) and mixtures thereof, in particular Ln represents Eu; 0 < x < 1; in particular 0.02 < x < 0.5, in particular 0.05 < x < 0.4 and more particularly x is 0.4, 0.2, 0.1 or 0.05; and

[0099] 0 < y < 1, in particular y is 0.

[0100] The properties of the nanoparticles used will determine the sensitivity that can be achieved by the method of the invention.

[0101] The inorganic nanoparticles of the invention are advantageously formed from a vanadate or vanadate / phosphate crystalline matrix having at least 10 3 rare earth ions.

[0102] The rare earth ions in the nanoparticles of the invention are not in the form of rare earth ion complexes or chelates, formed of rare earth ions in combination with suitable organic ligands, as for example described in the publication Yuan et al.

[0021] ,

[0103] Preferably, the nanoparticles of the invention comprise between 1,000 and 6,000,000 rare earth ions, in particular between 5,000 and 500,000 and more particularly between 20,000 and 100,0000 rare earth ions.

[0104] The nanoparticles of the invention may be doped with rare earth ions of the same or different natures. According to an alternative embodiment, as detailed in the rest of the text, the method of the invention uses at least two distinct types of nanoparticles, distinguished by the nature of the rare earth ions. The simultaneous use of nanoparticles enriched in different lanthanides allows multiplexing of the detection of different substances, for example different biomarkers, within the same sample.

[0105] The photoluminescent nanoparticles of the invention may have an average size greater than or equal to 20 nm and strictly less than 1 pm.

[0106] In particular, they have an average size of between 20 nm and 500 nm, in particular between 20 nm and 200 nm and notably between 20 nm and 100 nm.

[0107] In particular, the average size of the photoluminescent nanoparticles of the invention may be greater than or equal to 20 nm, in particular greater than or equal to 30 nm, in particular between 30 and 60 nm.

[0108] In particular, as illustrated in the examples which follow, the photoluminescent nanoparticles according to the invention may have an average size of the order of 20 to 50 nm. Nanoparticles of larger sizes may, for example, be obtained by size sorting by centrifugation of the particles as exemplified, in order to retain, in the size distribution, only the particles of the largest sizes, or may be obtained by grinding the bulk material. Any other technique known to those skilled in the art may also be used.

[0109] The photoluminescent nanoparticles used in the method of the invention thus advantageously have a volume sufficient to contain a large number of rare earth ions, and therefore emit a luminescent signal sufficient to allow the detection of low concentrations. For example, a spherical nanoparticle YO.ÔEU o,4V04 with a diameter of 30 nm contains 70,000 Eu ions 3+ (calculation of the number of ions according to reference

[0031] Casanova et al. APL 2006). Furthermore, the photoluminescent nanoparticles should not be too large to avoid steric hindrance when they are associated with the substance to be measured, immobilized for example on the surface of a support, as described in the rest of the text.

[0110] The average size can be measured by transmission electron microscopy. Transmission electron microscopy images can be used to determine the shape of nanoparticles (spherical, ellipsoidal) and to deduce the average dimensions of the nanoparticles. In the case of globally spherical particles, the average size is defined as the average particle diameter.

[0111] In the case of ellipsoid-shaped particles, the average size is the average size of a sphere of the same volume as the ellipsoid. It is generally assumed that the third axis of the ellipsoid, not visible in transmission images which are 2D projections, is of length equal to the smallest size axis.

[0112] According to a particular embodiment, the nanoparticles of the invention are of a generally elongated ellipsoidal shape (“prolate” in English).

[0113] They may more particularly have a major axis length, denoted a, of between 20 and 60 nm; and a minor axis length, denoted Z>, of between 10 and 30 nm. In particular, the nanoparticles of the invention may have an average major axis length value, a, of 40 nm and an average minor axis length value, b, of 20 nm. Advantageously, the nanoparticles of the invention have low polydispersity. The polydispersity index, which can be deduced from TEM measurements, may in particular be strictly less than 0.2.

[0114] Advantageously, the nanoparticles used in the context of the method of the invention are capable of emitting more than 10 8 photons before emission stops, especially more than 10 9 , or even more than IO 10 photons. In many cases, particularly in the case of Eu-doped YVO4 or GdVCL particles, no emission cessation is observed.

[0115] Furthermore, advantageously, the nanoparticles of the invention have a long emission lifetime. In particular, they may have an emission lifetime greater than or equal to 5 ps, in particular greater than or equal to 10 ps, ​​in particular greater than or equal to 20 ps, ​​or even greater than or equal to 50 ps, ​​or even greater than or equal to 100 ps.

[0116] The emission lifetime is understood as the lifetime of the excited state of the emitting nanoparticle, and is determined in practice by the duration of the emission of luminescence photons after stopping the excitation, i.e. the characteristic time of the decline of luminescence after stopping the excitation.

[0117] As discussed previously, the ultra-sensitive method of the invention can take advantage of the long emission duration of the particles of the invention (a few hundred ps in the case of YI particles. X EU XVO4, compared to the lifetimes of usual fluorophores of the order of a nanosecond), to carry out time-resolved detection with sufficient temporal resolution, in particular less than 100 ps, ​​better still less than 10 ps, ​​in particular delayed detection of the emission.

[0118] Advantageously, the nanoparticles used according to the invention do not lose their luminescence after freezing.

[0119] In a particular embodiment, the nanoparticles used are of the abovementioned formula (I) in which y is 0. In other words, the nanoparticles used in the method of the invention may be of formula Ai- x Ln x VO4 (!'), in which A, Ln and x are as defined previously.

[0120] According to a particular embodiment, A in formula (I) or (T) represents yttrium (Y). According to another particular embodiment, Ln in formula (I) or (F) represents Eu.

[0121] Thus, according to an alternative embodiment, the particles of the invention comprise a nanoparticle of formula YI. X EU X VO4 in which 0 < x < 1, in particular 0.02 <x<0,5, en particulier 0,05<x<0,4 et plus particulièrement x vaut 0,4, 0,2, 0,1 ou 0,05.

[0122] The nanoparticles according to the invention are predominantly crystalline and polycrystalline in nature, in particular of average crystallite size, deduced by X-ray diffraction, as detailed in example 1 below, between 3 and 40 nm.

[0123] According to another particular embodiment, the nanoparticles are monocrystalline with an olive shape and with sizes between 30 and 200 nm.

[0124] Preparation of nanoparticles

[0125] The nanoparticles with a crystalline matrix doped with rare earth ions used in the process of the invention can be prepared by any conventional method known to those skilled in the art. Nanoparticles based on yttrium vanadate doped with rare earths have for example been described in detail in articles

[0032] and

[0033] ,

[0126] Advantageously, the nanoparticles of the invention are synthesized easily, in an aqueous medium, which has the advantage of avoiding any subsequent solvent transfer step.

[0127] In particular, the nanoparticles can be formed by coprecipitation reaction, in an aqueous medium, from precursors of said elements A and Ln, and in the presence of orthovanadate ions (VO4 3 ) and possibly phosphate ions (PO4 3 ).

[0128] The precursors of elements A and Ln can be present, in a conventional manner, in the form of salts of said elements, for example nitrates, chlorides, perchlorates or acetates, in particular nitrates. The precursors of elements A and Ln, and their quantity, are of course chosen appropriately with regard to the nature of the desired nanoparticle.

[0129] For example, the synthesis of nanoparticles of formula Yi. x I x VO4 can use, as precursor compounds of yttrium and europium, yttrium nitrates (YfNChF) and europium nitrates (EufNChF). According to a particularly preferred embodiment, orthovanadate ions (VO4 3 ) are generated in situ from a metavanadate salt, preferably ammonium metavanadate (NH4VO3).

[0130] Orthovanadate ions can be more particularly formed in situ by reaction of said metavanadate salt with a base (more precisely with two or three equivalents of strong base) as described in the article Neouze et al

[0034] ,

[0131] In the case of phosphate ions, a phosphate salt, such as sodium phosphate or ammonium phosphate, is added.

[0132] Thus, according to a particularly advantageous embodiment variant, the method of the invention comprises at least the steps consisting of:

[0133] (a) preparing an aqueous solution (1) by mixing, in an aqueous medium, a metavanadate salt, in particular ammonium metavanadate (NH4VO3), and optionally a phosphate salt, and a base, optionally a source of tetraalkylammonium cations, in particular a tetraalkylammonium hydroxide;

[0134] (b) adding to the aqueous solution (1), an aqueous solution (2) comprising said precursors of elements A and Ln, in particular in the form of salts, in particular nitrates; under conditions conducive to the formation by co-precipitation of said nanoparticles; and

[0135] (c) recover the nanoparticles following elimination of the counterions.

[0136] In a particular embodiment, the aqueous solution (2) containing the precursors of the elements A and Ln may also comprise complexing agents of these elements, such as citrate, for example tetraalkylammonium citrate.

[0137] According to a particular embodiment, the addition in step (b) of solution (2) to solution (1) is carried out drop by drop.

[0138] According to another particularly preferred embodiment, the nanoparticles are prepared by colloidal conversion of rare earth hydroxycarbonate particles (see example 1.2).

[0139] Thus, according to one variant, the method of the invention comprises at least the steps consisting of:

[0140] (a) preparing an aqueous solution (1) by mixing, in an aqueous medium, a metavanadate salt, in particular ammonium metavanadate (NH4VO3), and optionally a phosphate salt;

[0141] (b) prepare hydroxycarbonate nanoparticles of formula Ai- x Ln x 3+ CO3OH from precursors of elements A and Ln, in particular in the form of salts, in particular nitrates, and a source of bicarbonate ions, in particular in excess, in particular urea, under conditions conducive to the formation by co-precipitation of said nanoparticles of hydroxy carbonates,

[0142] (b') adding the aqueous solution (1) to the hydroxy carbonate nanoparticles in colloidal suspension under conditions conducive to the formation by co-precipitation of the nanoparticles according to formula I; and

[0143] (c) recovering the nanoparticles according to formula I.

[0144] According to a particular embodiment, the addition in step (b') of the solution (1) to the hydroxycarbonate nanoparticles is carried out drop by drop.

[0145] According to another embodiment, the solution (1) can be mixed with the solution (2) or the hydroxycarbonate nanoparticles in one go, and not drop by drop.

[0146] The aqueous medium of the solutions is more particularly formed of water and / or a mixture of water and ethylene glycol.

[0147] It is up to the person skilled in the art to adequately adjust the quantities of the various reagents, in particular the precursors of the metavanadate ions, possibly phosphate, of said elements A and Ln, and of urea with regard to the desired nature of the nanoparticle according to the invention.

[0148] In particular, the stoichiometric proportions of the different reagents according to the above-mentioned formulas must be respected.

[0149] Advantageously, the process for preparing the nanoparticles does not require any heating of the solution, unlike in particular the hydrothermal methods proposed in publications

[0026] to

[0029] . In particular, all of the steps (a) to (c) for the synthesis of the particles according to the invention can advantageously be carried out at room temperature (20-25°C).

[0150] Step (c) consists more particularly in purifying the solution of particles obtained, in particular to eliminate the excess counter-ions.

[0151] The purification steps may more particularly comprise steps of dialysis or centrifugation and redispersion of the particles in an aqueous medium, for example by sonication. The particles may be redispersed in an aqueous medium, in particular in water. The synthesis of luminescent nanoparticles according to the invention, in particular of larger sizes, greater than a few tens of nanometers, may be carried out by any other approach known to those skilled in the art, for example by grinding the bulk material.

[0152] Preferably, the nanoparticles, in particular recovered in step (c) above, are mixed with a protective agent and then the mixture obtained is subjected to post-synthesis annealing at a temperature between 500°C and 1500°C, more particularly between 800°C and 1300°C, then the protective agent is removed by a suitable method depending on the protective agent, in particular by acid dissolution. This step (d) is preferably carried out before the coupling of the nanoparticle with the coupling agent, in particular before its bonding with a targeting agent or before its functionalization. Alternatively, the nanoparticles are subjected to post-synthesis annealing under hydrothermal conditions, in particular at a temperature between 120°C and 300°C. Annealing makes it possible to reduce the photoreduction effect of the nanoparticles when they are subjected to excitation. It also makes it possible to increase the quantum efficiency of nanoparticle emission.

[0153] Targeting agent

[0154] The particles used as luminescent probes according to the method of the invention can be coupled (or grafted) to at least one targeting agent coupling the substance to be measured in the sample to be analyzed.

[0155] By "targeting agent" we mean a compound allowing a bond with a substance of biological or chemical interest, and the identification of which is sought.

[0156] The nature of the targeting agents used is of course chosen with regard to the substance of interest in the sample.

[0157] The particles used in the ultra-sensitive method according to the invention are perfectly suited to a wide variety of biological targeting, the specificities being dependent on the nature of the targeting agent(s) grafted to the surface of the nanoparticle.

[0158] The targeting agent may be more particularly chosen from a polyclonal or monoclonal antibody, an antibody fragment, a nanobody, an oligonucleotide, a peptide, a hormone, a ligand, a cytokine, a peptidomimetic, a protein, a carbohydrate, a chemically modified protein, a chemically modified nucleic acid or oligonucleotide, a chemically modified carbohydrate that targets a known cell surface protein, an aptamer, an assembly of proteins and DNA / RNA or a chloroalkane used by HaloTag type markings. A SNAP-Tag or CLIP-Tag type approach may also be used.

[0159] According to a particular embodiment, it is an antibody or antibody fragment or an oligonucleotide or oligonucleotide fragment.

[0160] Suitable antibody fragments comprise at least one variable domain of an immunoglobulin, such as single variable domains Fv, scFv, Fab, (Fab') 2and other proteolytic fragments or “nanobodies” (single-domain antibodies such as VHH fragments obtained from camelid antibodies or VNAR obtained from cartilaginous fish antibodies).

[0161] The term "antibody" according to the invention includes chimeric antibodies; human or humanized antibodies, recombinant and modified antibodies, conjugated antibodies, and fragments thereof.

[0162] According to a particular embodiment, the antibodies or antibody fragments used according to the invention target specific markers of cancer cells.

[0163] The targeting agent may also be derived from a molecule known to bind a cell surface receptor. For example, the targeting moiety may be derived from low-density lipoproteins, transferrin, EGF, insulin, PDGF, fibrinolytic enzymes, anti-HER2, anti-HER3, anti-HER4, annexins, interleukins, interferons, erythropoietins, or colony-stimulating factors.

[0164] Coupling of the particle with the targeting agent

[0165] It is up to the person skilled in the art to implement the appropriate coupling / grafting methods to adequately prepare the particles coupled to one or more targeting agents. The quantity of targeting agent(s) used is adjusted with regard to the quantity of particles or vice versa.

[0166] The targeting agent can be grafted directly, or via a spacer (also referred to as a “linker” or “spacer”), to the nanoparticle.

[0167] The methods of coupling (also called grafting) particles to biomolecules are well known to those skilled in the art. This generally involves coupling by covalent bonding, by surface complexation, by electrostatic interactions, by encapsulation, or by adsorption. In certain cases, including the case of coupling by covalent bonding, the particles may be previously functionalized by chemical groups capable of subsequently reacting with another chemical group carried by the targeting agent to form a covalent bond.

[0168] Examples of chemical groups that may be present on the surface of nanoparticles include carboxyl, amino, thiol, aldehyde and epoxy groups.

[0169] Silica coating of the particles can be used to facilitate subsequent functionalization of the particles.

[0170] Amino groups can be provided by molecules such as amino organosilanes, such as aminotriethoxy silane (APTES). The advantage of APTES is that it forms a capsule around the nanoparticle via covalent bonds. The amines provided by APTES are therefore very stable over time. Amino groups can be transformed into carboxyl groups by reaction with succinic anhydride.

[0171] Carboxyl groups can be provided by molecules such as citric acid or polyacrylic acid (PAA).

[0172] The nanoparticles may further comprise polyethylene glycol (PEG) molecules on their surface to minimize non-specific adsorption of the nanoparticles to the detection surface. Preferably, the PEG may have a molar mass of 500 to 20,000 g. mol' 1 .

[0173] In other cases, the particles may be pre-coupled to molecules capable of enabling subsequent coupling with a targeting agent.

[0174] For example, the particles may be coupled to streptavidin capable of enabling coupling with a biotinylated targeting agent.

[0175] As an example, Example 1 illustrates the coupling of nanoparticles with biotinylated antibodies by coupling the streptavidin-coupled nanoparticles with biotinylated antibodies.

[0176] In other cases, the coupling of nanoparticles with antibodies can be carried out directly by coupling the antibodies onto nanoparticles functionalized with APTES. The amino groups provided by APTES can be transformed in a first step into carboxyl groups by reaction with succinic anhydride, as mentioned above. Then, the carboxyl groups can be activated according to any technique known to those skilled in the art, in particular by reaction with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) and N-hydroxysuccinimide (NHS), to then react with the amine functions on the surface of a polypeptide and form a covalent amide bond, when the targeting agent is a protein or an antibody.

[0177] The functionalization of nanoparticles with APTES can be done advantageously following the covering of the nanoparticles with a layer of silica.

[0178] The coupling of the targeting agent to the surface of the nanoparticles can also be done by any other method known to those skilled in the art.

[0179] It can also be done advantageously by covering the nanoparticles with a layer of silica, followed by a covering reaction with APTES (3-aminopropyltriethoxysilane), the amine functions of which are used to react with a bifunctional crosslinking agent comprising two NHS functions. Subsequently, the nanoparticles coupled to the crosslinking agents can react with the amine functions on the surface of a protein (antibody, streptavidin, etc.). This type of coupling process is described in particular in references

[0035] and

[0036] ,

[0180] Advantageously, the particles used in the ultra-sensitive detection method according to the invention have a low polydispersity. It is preferable that the polydispersity index, which can be deduced from TEM measurements or dynamic light scattering (DLS) measurements, is strictly less than 0.2. When this is not the case in the synthesis or functionalization of the particles, a lower polydispersity can be obtained by size sorting by centrifugation or by any other technique known to those skilled in the art.

[0181] As mentioned previously, the method according to the invention can further implement several means of amplifying the luminescence signal emitted by the photoluminescent particles per analyte, in particular by varying the characteristics of the coupling of the photoluminescent nanoparticles with one or more targeting agents.

[0182] At least one nanoparticle can be coupled with a plurality of coupling agents, in particular targeting agents or molecules capable of allowing subsequent coupling with a targeting agent, the method comprising a step of coupling the nanoparticles with the coupling agents comprising dissolving the nanoparticles with a proportion of coupling agent greater than the proportion of nanoparticles, in particular with a ratio of at least two coupling agents for one nanoparticle or even at least 10 coupling agents per nanoparticle, or even between 10 and 80 coupling agents.

[0183] The photoluminescent particles may each comprise a plurality of nanoparticles linked together, in particular by the coupling agents, to form an aggregate of nanoparticles, preferably the photoluminescent particles being in colloidal dispersion in the solution in step (ii) of contact with the sample to be analyzed.

[0184] Thus, in a particular embodiment, at least one nanoparticle can be coupled with a plurality of targeting agents, in particular identical, in particular biotinylated, in order to advantageously lead to the formation of controlled aggregates of streptavidin-functionalized nanoparticles linked together via the targeting agents. These aggregates of nanoparticles can be formed by using, during the coupling of the nanoparticles with the targeting agent, a proportion of targeting agent greater than the proportion of nanoparticles, in particular with a ratio of at least two targeting agents for one nanoparticle. Preferably, the ratio is adjusted so as to lead to aggregate sizes making it possible to maintain good colloidal dispersion in the medium in which the photoluminescent particles are used, in particular in an aqueous medium.

[0185] Any other mode of controlled nanoparticle aggregate formation can be implemented. For example, it is possible to add complementary oligonucleotides to the surface of the nanoparticles in addition to coupling agents that will lead to the formation of nanoparticle aggregates.

[0186] The implementation of particles formed from aggregates of photoluminescent nanoparticles makes it possible to amplify the luminescence signal per analyte, and thus further improve the sensitivity of the detection.

[0187] In another particular embodiment, the ultrasensitive detection method according to the invention uses at least two types of distinct photoluminescent particles each comprising nanoparticles according to formula (I), which are coupled to distinct coupling agents, capable of binding to distinct sites of the same analyte. For example, the particles can be coupled to distinct oligonuclides recognizing different regions of the nucleic acid type analyte. The use of photoluminescent particles associated with different sites on the surface of the analyte advantageously makes it possible to bind two or more nanoparticles to a single analyte molecule and thus to amplify the luminescence signal per analyte, and to further lower the sensitivity threshold that can be achieved by the method of the invention.

[0188] The nanoparticles may each be coupled to a plurality of coupling agents, each to a region of a substance of interest, in particular a plurality of oligonucleotides configured to bind to different regions of a nucleic acid, in particular distinct regions, preferably separated from each other by a distance less than or equal to the size of the particle. Said coupling agents may be identical or different. When a single nanoparticle binds to the substance of interest with more than one coupling agent, this makes it possible to use the biochemical principle of avidity and to improve the binding of the nanoparticle with the analyte, which limits the risk of loss of binding between the two during washing. In addition, this allows several nanoparticles to bind to different sites of the same analyte, which, as previously, makes it possible to increase the detection sensitivity.

[0189] It is understood that these particular embodiments may be combined to achieve maximum amplification of the luminescence signal per analyte in the sample to be analyzed.

[0190] Association of luminescent probes with the substance of interest

[0191] In a first step of the ultra-sensitive detection method according to the invention, the photoluminescent particles are associated with the substance of the sample to be analyzed.

[0192] This step can be carried out, in a similar manner to conventional methods, for example the ELISA immuno-enzymatic method, on the surface of a support, as shown schematically in Figure 1a.

[0193] The ultra-sensitive detection method is preferably different from a membrane migration method.

[0194] This variant of implementation will be explained in more detail later in the text.

[0195] It involves in particular the prior immobilization, as described in example 2, of the substance of the sample to be analyzed, on the surface of a support.

[0196] In particular, the method may comprise the functionalization of a support by additional coupling agents of the substance of interest, bringing the substance of interest into contact under recognition conditions with the additional coupling agents of the support, followed by bringing into contact a solution comprising the particles as described previously in suspension, in particular in the form of a colloidal dispersion.

[0197] The support can be of different natures. It can be coverslips, for example glass coverslips, multi-well plates like those used in the examples, microplates, membrane gels, strips or microchannels. It can also be a plastic of good optical quality or any other material of sufficient optical quality.

[0198] Preferably, the support is other than a strip-type support with a filtration membrane.

[0199] Preferably, the surface of the support is previously passivated so that the luminescent particles do not attach to it in the absence of the substance of interest.

[0200] Surface passivation can be carried out by any method known to those skilled in the art.

[0201] This may involve, for example, passivation of the glass surface using a molecule comprising polyethylene glycol (PEG), for example using silane-PEG molecules. Preferably, the PEG may have a molar mass of 500 to 20,000 g. mol' h The longer the PEG, the better the resulting passivation. However, the PEG should advantageously not be too long so as not to present a steric hindrance for the attachment of the substance of interest and to allow interaction between the targeting agent attached to the surface and the target. In particular, the smaller the coupling agent, the shorter the PEG should be.

[0202] The support is further functionalized on the surface by a first agent for targeting the substance to be detected / quantified. This may more particularly be an antibody, called a capture antibody, as represented in phase 1 of Figure 1a, in particular when the substance of interest is of the biomarker, protein or polypeptide type.

[0203] When the substance of interest is of the antibody type, the targeting agent can be of the antigen type specific to the antibody to be detected.

[0204] Surface functionalization can be carried out by any method known to those skilled in the art. It can, for example, be carried out by adsorption following prolonged contact lasting several hours, by spotter printing (deposition of microdrops of solutions containing the targeting molecules on the surface using a robot), by a contact printing technique allowing molecules to be transferred by contact between the topological patterns of a stamp (for example a PDMS polydimethylsiloxane stamp) and the surface of the substrate, or by other means known to those skilled in the art allowing the targeting agents to be deposited on the surface of the support.

[0205] The sample to be analyzed is then brought into contact with the functionalized surface of said support so as to allow the association of the substance to be detected / dosed with the targeting agent carried by the support (phases 2 and 3 of Figure 1a).

[0206] This step involves, like for example a classic ELISA test, a step of incubation of the sample on the surface of the support, and washing / rinsing of the support in order to remove the solution and the unbound molecules. After rinsing, only the targeting agent / substance to be assayed complexes, for example antibody / antigen, remain attached to the surface of the support except for rare molecules which may have been able to bind in a non-specific manner.

[0207] Finally, the photoluminescent particles, as described previously, formed in whole or in part from a photoluminescent nanoparticle and coupled to a coupling agent of the substance of interest, for example an antibody, are coupled with the substance of interest immobilized on the surface of the support (phase 4 of Figure 1a).

[0208] This step involves incubating the photoluminescent particle solution on the functionalized support surface and then washing / rinsing the support to remove particles not bound to the support. After rinsing, only the targeting agent / dose substance / particle complexes coupled to at least one coupling agent, e.g., monoclonal antibody / antigen / polyclonal antibody-nanoparticle, remain attached to the support surface, apart from rare nanoparticles that may have attached non-specifically. The incubation time can be adjusted by prior testing to maximize the luminescence emission signal. Generally, it can be between 30 minutes and 2 hours.

[0209] The coupling of the particles coupled to a coupling agent with the substance of interest may for example involve recognition of a ligand / anti-ligand pair, for example biotin or biotinylated compounds / avidin or streptavidin, hapten / antibody, antigen / antibody, peptide / antibody, such as digoxigenin (DIG) / anti-DIG antibody, sugar / lectin, polynucleotide / polynucleotide complement, etc., it being understood that one of the elements of these pairs constitutes the substance of interest, or the targeting agent or another element coupled to the substance of interest. Thus, in one embodiment, step (i) comprises at least the following steps:

[0210] (a) having a support whose surface is previously passivated and functionalized with an agent for capturing the substance of interest, for example a monoclonal antibody, called a capture antibody;

[0211] (b) bringing said sample to be analyzed into contact with the support of step (a) under conditions conducive to the association of said substance of interest with the capture agent; and

[0212] (c) bringing the photoluminescent particles coupled to at least one coupling agent into contact with said support resulting from step (b) to directly or indirectly associate the particles with said substance immobilized on the surface of the support.

[0213] The association may be direct or indirect, in particular the coupling agent may be a targeting agent for the substance of interest or a molecule capable of binding to a targeting agent coupled to the substance of interest. In the latter case, the method may comprise bringing the substance of interest into contact with targeting agents prior to bringing it into contact with the particles. This contact may be carried out before the capture of the substance of interest on the support or after the capture of the substance of interest. Preferably, the targeting agent is different from the capture agent.

[0214] It is understood that the substance of interest can be immobilized in several predefined and distinct areas of the surface of the support.

[0215] This can be achieved in particular by implementing a localized functionalization of the surface of the support by said targeting agent (for example, capture antibody), as is the case when functionalizing multiple wells of a multi-well plate. This can involve deposition in several predefined areas of the same targeting agent. In this case, these multiple areas are used to detect the same substance in several different samples.

[0216] Such an implementation is more particularly carried out when using the ultra-sensitive detection method according to the invention for a multiplexed analysis.

[0217] In the context of multiplexed analysis, allowing the simultaneous detection and / or quantification of at least two different substances in a sample, the different substances to be analyzed in the sample can be immobilized in predefined and distinct areas on the surface of the support, for example by locally functionalizing the surface of the support with targeting agents specific to each of the substances to be analyzed. The surface is previously passivated so that the photoluminescent particles do not attach to it in the absence of the substances to be analyzed.

[0218] In this case, the particles used must have multiple different targeting agents on their surface, and, more specifically, at least one targeting agent specific to each of the substances to be analyzed. In this way, the substances to be analyzed will be quantified thanks to the emission intensity of the particle on each area, the spatial location of the area in question indicating the nature of the substance.

[0219] It is also possible to combine multiplexed approaches for several samples and for several substances to be analyzed by locally functionalizing predefined and distinct areas of the support surface with targeting agents specific to each of the substances to be analyzed and this repeatedly as many times as the number of samples to be analyzed. In this case, the emission intensity of the particle on each area provides information on the presence and / or concentration of each substance of interest in each sample, the spatial location of the area in question indicating both the nature of the substance and the number of samples.

[0220] Also, it is possible for multiplexed detection to implement at least two types of nanoparticles, doped with distinct rare earth ions, with distinct emission wavelengths, for example YVO4:Eu and YAG:Ce, and coupled to coupling agents each to one of two different substances of interest. The detection of the luminescence signal using two different emission filters makes it possible to detect and / or measure each of the substances to be analyzed.

[0221] Preferably, in the context of such a multiplexed detection variant, at least two types of nanoparticles having distinct emission wavelengths, and each coupled to targeting agents for each of the substances to be analyzed can be used, so as to separate the luminescence signals obtained.

[0222] The combination of the two approaches can also be used (analysis of several different samples and several different substances in each sample), in particular for the comparison of the concentrations of target molecules between at least two samples, this being carried out by comparing the intensities of the emission colors of each of the nanoparticles, each coupled to the specific targeting agent of each substance of interest, and this for several deposition zones each corresponding to a different sample.

[0223] Alternatively, the combination of the two approaches can also be used - analysis in several different samples (sample of different origin, or of the same origin at different times, in different conditions, under different stimuli, etc.) of several different substances in each sample -, in particular for the comparison of the concentrations of target molecules between at least two samples. This is carried out by comparing the intensities of the emission colors of each of the nanoparticles, each coupled to the specific targeting agents of each substance of interest, and this for several deposition zones corresponding to different target molecules. In this case, the comparison of the emission colors to a reference deposition zone provides a comparison of the concentrations of a molecule between the two samples.

[0224] Various other combinations of these approaches can be considered: for example, analyzing four substances using two types of nanoparticles with two different emission colors, each coupled to two of the four different coupling agents necessary for the recognition of the four substances to be analyzed, and two distinct areas of the support surface locally functionalized by two of the four coupling agents specific to each of the substances to be analyzed.

[0225] For example, multiplexing can be implemented for the identification of viral variants in the case of virus genome detection.

[0226] The invention is of course not limited to the implementation variant described below in which the substance of interest is immobilized on the surface of a support (of the glass slide type or multi-well plates for example).

[0227] Other configurations are conceivable for the association of the photoluminescent particles of the invention with the substance of interest.

[0228] Alternative embodiments may, for example, use a gel to separate the biological molecules according to their size and / or their charge followed by transfer to a membrane where the molecules are specifically detected by the nanoparticles coupled to the targeting agent, similar to the “Western blot” method.

[0229] In other variants, the reaction surface is not of the solid support type, but may be, for example, another magnetic nanoparticle, a magnetic microbead, etc. A magnetic field may then capture the luminescent nanoparticles associated with the analyte and the magnetic nanoparticles or beads in the vicinity of a surface before proceeding to the measurement of the luminescence.

[0230] The measurement can, for example, be carried out directly within the sample to be analyzed. In the case where the sample is gaseous, this sample support can take the form of a closed volume to prevent dispersion of the sample to be tested. The sample support can also take the form of a tank or cuvette, particularly in the case where the sample is in the form of a solution.

[0231] The ultra-sensitive method of the invention can also be adapted to be implemented in flow cytometry technologies (in English "Fluorescence-activated cell sorting" or FACS). In this case, particles of the invention, coupled with targeting agents aimed at the recognition of molecules specific to the cell type to be analyzed, are brought into contact with the cells and the cytometry system must be adapted to include an excitation source, preferably a UV laser diode, at a wavelength adapted to the excitation of the nanoparticle matrix.

[0232] The ultra-sensitive method of the invention can also be adapted for implementation in immunocytochemistry and immunohistochemistry type technologies.

[0233] Luminescence measurement

[0234] As indicated previously, the ultra-sensitive method according to the invention more particularly implements a step (iii) of excitation by UV-B and / or UV-C radiation of the photoluminescent particles coupled to the substance of interest and a step (iv) of detection of the luminescence emitted by the particles.

[0235] Detection assembly

[0236] The ultra-sensitive method according to the invention is advantageously implemented using unsophisticated and inexpensive equipment.

[0237] More specifically, it generally includes:

[0238] - an illumination device at a wavelength between 240 nm and 330 nm, better between 260 and 330 nm, better between 260 nm and 310 nm, better between 270 and 290 nm, preferably of the light-emitting diode type, preferably having a power less than or equal to 500 mW, better still less than or equal to 200 mW, for example between 50 and 500 mW, better still between 50 and 150 mW; and

[0239] - a device for detecting the light intensity emitted by the nanoparticles in step (iii). Preferably, the illumination device emits in the UV-B and / or UV-C range.

[0240] Preferably, the detection device is devoid of a confocal system.

[0241] Reference will be made in the remainder of the text to the attached figures 2 and 3, which represent, schematically and partially, installations suitable for implementing the ultra-sensitive method of the invention.

[0242] The apparatus may further comprise a suitable support for immobilizing the substance of interest in said sample during the process, as described above.

[0243] According to an alternative embodiment, the apparatus according to the invention comprises a system for translating the support or the illumination device, making it possible to successively illuminate different localized zones of the support, for example different wells of a multi-well plate. Such an alternative is notably used for implementing the detection method of the invention for spatial multiplexing and / or for measuring several samples, the translation system allowing the successive illumination of each of the predefined zones containing the substances to be analyzed in the same sample, or even in several different samples.

[0244] The illumination device may consist solely of a light-emitting diode positioned as close as possible to the immobilization surface and a diaphragm ensuring localized excitation only at the immobilization surface.

[0245] The illumination device may also comprise an optical assembly, in particular a system of at least one lens, arranged on the path of the excitation beam so as to control the size and / or the opening angle of the beam at the area of ​​the support presenting the particles associated with the substance of interest.

[0246] The optical assembly for shaping the beam may conventionally comprise a system for collimating and reducing the size of the beam, for example using lenses, in particular two lenses. It then makes it possible to control the illuminated area at the level of the area of ​​the support presenting the particles associated with the substance of interest so as to obtain an appropriate intensity (for example 10 W / cm 2 ) and illumination whose dimensions are close to or smaller than those of the deposition spot (for example 1 mm in diameter).

[0247] Time-resolved detection can be achieved by mechanical or electronic chopping of the excitation beam. To enable such time-resolved detection, the apparatus, in particular the illumination device, may comprise a mechanical chopper placed in the path of the excitation beam. Chopping of the illumination can also be achieved electronically by modulating the current supplying the illumination source or in any other manner known to those skilled in the art, such as by using an acousto-optic crystal.

[0248] Such time-resolved detection thus advantageously makes it possible to limit the contribution to the luminescence signal of parasitic species present in the sample (serum, blood, etc.) or in the solid substrates used (glass, plastic, etc.), in particular biomolecules, by temporally separating parasitic luminescence signals from the signal emitted by the nanoparticles, because these parasitic signals generally have characteristic lifetimes of less than 1 ps, or even less than 100 ns, or even less than 10 ns.

[0249] The detection of luminescence emission can be carried out by measuring the light intensity emitted at a luminescence wavelength of the photoluminescent particles used. For example, in the case of the use of YI nanoparticles. X EU X VO4, the emitted light intensity can be measured at the luminescence wavelength of Eu 3+ , namely 617 nm.

[0250] The detection device may comprise a single detector, in particular of the photomultiplier, photodiode, avalanche photodiode type, or a detector of the array type of photosensitive devices consisting of a 2D surface of detection pixels such as a CCD or EM-CCD camera or CMOS camera. A 2D detection device makes it possible to simultaneously measure the emission signal of nanoparticles coming from the different areas corresponding to different samples and / or different substances to be analyzed on the surface of the support and does not require movement of the support or the excitation beam.

[0251] Preferably, the light intensity detection device comprises a single detector, in particular a photomultiplier, which makes it possible to produce a less expensive detection device. The photomultiplier can be configured to detect only light in the visible range and not detect light in the UV range. This makes it possible in particular to limit disturbances linked to parasitic signals due to residual excitation light. This improves the detection sensitivity.

[0252] Preferably, the detection device does not detect the excitation wavelength. It may also comprise an optical assembly for collecting the emitted luminescence, in particular a system of at least one lens with a high numerical aperture, for focusing the luminescence emission towards the detector, in particular towards the photomultiplier.

[0253] Interference filters can also be placed in the path of the emitted beam to spectrally eliminate unwanted signals.

[0254] Detection can be carried out in reflection, in other words on the side of the face of the support receiving the excitation beam, in particular by an epifluorescence device. Such detection makes it possible to reduce the background noise of the measurement which is a particularly sensitive parameter and which makes it possible to improve the sensitivity of the measurement.

[0255] Alternatively, it can be operated in transmission.

[0256] Analysis of luminescence measurement

[0257] The method of the invention finally comprises a step (v) of determining the presence and / or concentration of the substance by interpretation of the luminescence measurement.

[0258] It is understood that the detection device according to the invention may further comprise any means making it possible to analyze the luminescence emission, for example a converter making it possible to record and use the luminescence signal.

[0259] Interpretation of the luminescence measurement can be carried out by reference to a pre-established standard or calibration.

[0260] More precisely, the quantity of the substance of interest in the sample can be determined by reference to a pre-established calibration curve by means of measurements carried out with samples with a known quantity of said substance, preferably under conditions identical to those of the study of the sample, these identical conditions including in particular the solvent and the pH of the medium.

[0261] Advantageously, as illustrated in example 3, the ultra-sensitive method according to the invention makes it possible to detect and quantify a substance of interest in a sample in a content strictly less than 10 pM, in particular less than 1 pM, or even less than 0.1 pM, or even less than 0.01 pM (i.e. 10 fM), or even less than 1 fM, even better less than 0.1 f (i.e. 100 aM), even better less than 0.01 fM (i.e. 10 aM). In fact, it allows detection at least ten times, in particular at least 100 times, or even 1000 times more sensitive than the ELISA type enzymatic immunodetection method, using the same recognition and targeting antibodies.

[0262] In vitro diagnostic set

[0263] The invention also relates, according to another of its aspects, to an in vitro diagnostic assembly, in particular for implementing the method as described previously, comprising at least:

[0264] - luminescent particles formed in whole or in part from a photoluminescent inorganic nanoparticle as defined above, said particles being coupled to one or more coupling agents, in particular being surface functionalized with chemical groups, for example carboxyl, amino, thiol, aldehyde or epoxy groups, provided by molecules, for example APTES, and / or coupled to molecules, for example streptavidin, said chemical groups or molecules being capable of allowing the coupling of said particles with an agent for targeting the substance of interest; or being already coupled to at least one agent for targeting the substance of interest;

[0265] • a detection and / or quantification system comprising at least: o an illumination device as described previously, o a device for detecting the light intensity emitted by the particles, the detection and / or quantification system being able to comprise equipment allowing time-resolved detection of the luminescence emission, in particular a system for modulating the current supplying the illumination source, a photomultiplier and an AD converter.

[0266] Silica coating of the particles can be used to facilitate subsequent functionalization of the particles.

[0267] The photomultiplier can be configured to detect only light in the visible range and not detect light in the UV range.

[0268] The in vitro diagnostic kit according to the invention may further comprise a suitable support for immobilizing the substance of interest in said sample, as described above. This may be a support whose surface has been passivated and functionalized with a capture agent, in particular a targeting agent, of the substance to be detected / quantified, for example with a first antibody, as described above.

[0269] In a first embodiment variant, the in vitro diagnostic assembly according to the invention may comprise photoluminescent particles according to the invention already coupled to a targeting agent, in particular to antibodies, called “revealing antibodies” to distinguish them from the capture antibodies immobilized at the level of the support.

[0270] The particles coupled to the targeting agent can be obtained as described above. In another embodiment, the in vitro diagnostic kit can comprise particles that are not coupled to a targeting agent, from which the user can prepare the particles coupled to one or more targeting agents for implementation in the ultra-sensitive method according to the invention.

[0271] According to a particular embodiment, the in vitro diagnostic assembly according to the invention can thus comprise several containers comprising, in isolation, said uncoupled particles on the one hand and, on the other hand, one or more targeting agents.

[0272] Alternatively, the in vitro diagnostic kit according to the invention does not comprise a targeting agent, the user being able to obtain separately the targeting agent, for example biotinylated, of his choice, from any competent supplier.

[0273] The preparation of the particles coupled to the targeting agents involves, in the context of this embodiment variant, the mixing of the uncoupled particles according to the invention with the targeting agent, in concentration ratios predetermined by the contents of the containers in the case of the presence of the targeting agent within the in vitro diagnostic assembly according to the invention, or determined by the user, for example as described in example 1.

[0274] The particles not coupled to a targeting agent used in an in vitro diagnostic assembly according to the invention may in particular be particles coupled to molecules, for example streptavidin, capable of allowing the coupling of said particles with a targeting agent, for example biotinylated, for example a biotinylated antibody.

[0275] Other pairs of molecules can be considered for this type of coupling, for example hapten / antibody, antigen / antibody, peptide / antibody, such as digoxigenin (DIG) / anti-DIG antibody, sugar / lectin and polynucleotide / polynucleotide complement.

[0276] Alternatively, the particles not coupled to a targeting agent used in an in vitro diagnostic assembly according to the invention may in particular be particles functionalized on the surface with chemical groups capable of allowing the coupling of said particles with a targeting agent of the substance of interest, for example carboxyl, amino, thiol, aldehyde or epoxy groups, provided by molecules, such as for example APTES.

[0277] It is understood that the functionalization of the surface of the nanoparticles may comprise more than one layer. For example, as mentioned above, the particles of the invention may comprise a layer for preparing or stabilizing the surface of the nanoparticles, such as a layer of silica, followed by a layer of functionalization by active chemical groups, such as a layer consisting of APTES (aminopropyl tri ethoxy silane).

[0278] The examples and figures presented below are given solely for illustrative purposes and are not intended to limit the invention.

[0279] Brief description of the drawings

[0280] [Fig la] schematically represents a principle of detection and quantification of biomolecules: surface functionalized with a capture antibody (55) (phase 1); contacting the sample to be analyzed (phase 2), washing (phase 3) and association of the photoluminescent particles coupled to a targeting agent (42) (here an antibody) with the substance of interest (40), here immobilized on the surface of the support followed by washing to eliminate the non-immobilized particles (phase 4);

[0281] [Fig 1b] schematically represents a principle for detecting DNA / RNA nucleic acids using the particles according to the invention: single-stranded DNA (55) partially complementary to the strand to be detected is fixed on a support. The single-stranded DNA constitutes a capture agent for the DNA or RNA to be detected. Then, the sample containing the DNA or RNA to be detected (40) is incubated with the functionalized support (phase A). After rinsing, the nanoparticles (38) coupled to single-stranded DNA (42), forming a targeting agent for the DNA or RNA to be detected, partially complementary to at least one unpaired part of the DNA or RNA to be detected, are incubated with the support (phase B). After rinsing, only the nanoparticles (38) immobilized on the surface of the support after pairing with the DNA or RNA to be detected are present (phase C). They can be detected and quantified as described in the text.Contrary to what is shown schematically in the figure, it is preferable to have spacers between the surface and the area complementary to the substance of interest of the capture agent and between the surface of the nanoparticle and the area complementary to the targeting agent.

[0282] [Fig 2] schematically represents a simple device for UV excitation of nanoparticles and detection of their luminescence in transmission according to the invention.

[0283] [Fig 3a] schematically represents a UV excitation device;

[0284] [Fig 3b] schematically represents a reflection detection device according to the invention;

[0285] [Fig 3c] schematically represents an assembly of the UV excitation device of Fig. 3a and the detection device of Fig. 3b. The additional lenses compared to the transmission device of Fig. 2 allow better control of the collimation of the UV LED, the size and angles of the excitation beam at the sample as well as the size and angles of the collected luminescence when focused on the photomultiplier.

[0286] [Fig 4] represents the detection of recombinant insulin in solution up to concentrations of 834 aM (10 fg / mL) with the detection device of Figure 2 and annealed YVCUEu (20%) nanoparticles synthesized as indicated in Example 1 below. The nanoparticles are coupled to streptavidin in a ratio relative to nanoparticles 40:1 and coupled to biotinylated antibodies in a ratio relative to nanoparticles 60:1. The same antibodies as the antibodies in the ELISA kit were used. The black line indicates the average signal of the “blank” samples. The gray line indicates the signal value corresponding to the average signal of the “blank” samples plus 3 times the standard deviation of the “blank” samples.

[0287] [Figure 5] represents the detection of interferon gamma in solution in buffer (Figure 5a) or serum (Figure 5b) up to concentrations of 2.6 fM (50 fg / mL) with the detection device of Figure 2 and annealed YVCUEu (20%) nanoparticles synthesized as shown in Example 1 below. The capture antibody is the same as that of the Thermofischer 13-7319-81 kit, the detection antibody is the full-length antibody while the kit contains a Fab fragment of the same antibody. The nanoparticles are coupled to streptavidin in a ratio to nanoparticles 40:1 and coupled to biotinylated antibodies in a ratio to nanoparticles 30:1. The black line indicates the average signal of the “blank” samples. The gray line indicates the signal value corresponding to the mean signal of the “blank” samples plus 3 times the standard deviation of the “blank” samples.

[0288] [Fig 6] represents the detection of interferon gamma in solution in buffer (Figure 6a) or serum (Figure 6b) by a Thermofischer 88-7316-88 ELISA kit. The detection limit of the kit indicated by the supplier is 260 fM (5 pg / mL);

[0289] [Fig 7] represents the detection of HIV-p24 in solution by the antibodies of a QC221 Quantikine Immunoassay Control Set 896 HIV-1 Gag p24 Biotechne kit as capture and coupling agent. The detection is carried out with the detection device of Figure 2 and annealed YVO4:Eu (20%) nanoparticles synthesized as indicated in Example 1 below; The detection antibody of the kit was biotinylated upstream to form the coupling antibody coupled to the nanoparticles in order to target the substance of interest during detection.

[0290] [Fig 8] schematically represents a detection principle optimized for nucleic acids: surface functionalized with a capture oligonucleotide (55) (phase 1); bringing the sample to be analyzed into contact, after denaturation, with detection oligonucleotides forming targeting agents (42) to couple the nucleic acid of interest (40) of the sample with the detection oligonucleotide (42) (phase 2), association of the nucleic acid-detection oligonucleotide conjugates with the functionalized surface (phase 3) and association of the photoluminescent particles (38) coupled to molecules allowing the attachment of the targeting agent (here streptavidin molecules) (44) with the detection oligonucleotide (42) in solution and the nucleic acid-detection oligonucleotide conjugates (phase 4), followed by washing to remove the non-immobilized particles, i.e. not coupled to the nucleic acid-detection oligonucleotide conjugates;detection of luminescence emission by immobilized nanoparticles after excitation with UV-B and / or UV-C light at a wavelength of 280 nm with an intensity of 4.5 mW / cm; 2 (phase 5).

[0291] [Fig 9] represents the detection of the ni gene of double-stranded SARS-CoV-2 in solution obtained by PCR up to concentrations of 50 fM with the detection device of Figure 2 and annealed YVO4:Eu(20%) nanoparticles synthesized as indicated in Example 1 (Figure 9a). Detection of the ni gene of synthesized double-stranded SARS-CoV-2 (detection up to concentrations of 5 fM, Figure 9b) and single-stranded (detection up to concentrations of 0.5 fM, Figure 9c). The nanoparticles coupled to streptavidin in a ratio relative to the nanoparticles 40:1 and coated with biotinylated detection oligonucleotides complementary to the DNA to be detected in a ratio relative to the number of streptavidin molecules 1:180 (excess streptavidin). Here the average signal of the "blank" samples has been subtracted from all measured values. Thus, the average signal of the "blank" samples appears as 0.The gray line indicates the signal value corresponding to the mean signal of the “blank” samples plus 3 times the standard deviation of the “blank” samples.

[0292] [Fig 10] represents the detection of the single-stranded SARS-CoV-2 ni gene with the device of Figure 2 and YVO4:Eu(5%) nanoparticles annealed at 1000°C synthesized as indicated in Example 1.2, detection up to concentrations of 10 aM. The nanoparticles were coupled to streptavidin in a ratio relative to the nanoparticles of 40:1 and coated with biotinylated detection oligonucleotides complementary to the DNA to be detected in a ratio relative to the number of streptavidin molecules 1:180 (excess streptavidin). Thus, the average signal of the “blank” samples is indicated by a black line. The gray line indicates the signal value corresponding to the average signal of the “blank” samples plus 3 times the standard deviation of the “blank” samples.

[0293] [Fig 11] schematically represents a coupling of nanoparticles (38) coupled with streptavidin (44) which fixes biotinylated antibodies (40) (42) in a proportion at least twice that of the nanoparticles to form aggregates, certain biotinylated antibodies coupling to at least two nanoparticles;

[0294] [Fig 12] schematically represents a coupling of nanoparticles 38 coupled with streptavidin (44) fixing biotinylated carbon chains (46) (42) comprising an arm linked to detection DNA (complementary to the target DNA) (48) and at least two arms linked to biotin (42), the carbon chains being in proportion at least twice that of the nanoparticles to form aggregates, certain carbon chains (46) coupling to at least two nanoparticles via biotin

[0295] [Fig 13] schematically represents a coupling of nanoparticles 38, each coupled with detection oligonucleotides (42i to 42s) different from the other nanoparticles, detection oligonucleotides complementary to different areas of a target nucleic acid (40) fixed in a well functionalized by capture agents (55), for example oligonucleotides complementary to the target nucleic acid; and

[0296] [Fig 14] schematically represents a coupling of a nanoparticle (38) coupled with different detection oligonucleotides (42i to 424) oligonucleotides complementary to a target nucleic acid (40) fixed in a well functionalized by capture agents (551 to 55s), for example oligonucleotides complementary to the target nucleic acid, at least two different oligonucleotides of the nanoparticle attaching to different areas but close to the same nucleic acid and at least two targeting agents attaching to different areas of the target nucleic acid.

[0297] [Fig. 15] represents the detection signal of the phagemid modified to introduce the ni gene of SARS-CoV-2 for different concentrations of phagemid in solution [DNAphagemide] with the detection device of Figure 2 and annealed YVO4:EU(20%) nanoparticles synthesized as indicated in Example 1 (Figure 15a) and YVO4:Eu(5%) nanoparticles annealed at 1000°C synthesized as indicated in Example 1.2 (Figure 15a). The error bars represent the standard deviation of the measurements carried out in triplicate. The black line indicates the signal value corresponding to the average signal of the “blank” samples and the red line the signal value corresponding to the average of the “blank” samples plus 3 times the standard deviation of the “blank” samples. Thus, the detection limit is at 50 fM (Figure 15a) and 5 fM (Figure 15b).

[0298] Detailed description

[0299] Preparation of luminescent particles of formula Yo,6Euo,4V04

[0300] YVO4 nanoparticles doped with 20% Europium are prepared by a known method, in particular by the method as described in detail in application WO 2019 / 025618 or by the method described below.

[0301] A 10 mL aqueous solution of 0.1 M NH4VO3 and 0.3 M N(CHs)4OH (solution 1) is freshly prepared. A 10 mL volume of another solution of 0.1 M Y(NOs)3 and EU(NOS)3 in ions (Y 3+ + Eu 3+ ) is added dropwise using a syringe pump into solution 1 at a flow rate of 1 mL / min. The molar concentration ratio between Y(NOS)3 and Eu(NO3)3 is chosen based on the ratio between Y ions 3+ and Eu 3+ desired in the nanoparticle, typically the molar ratio Y 3+ :Eu 3+is 0.8:0.2. Upon addition of the Y(NO3)2 / Eu(NO3)3 solution, the solution becomes diffusive and appears white / milky. The synthesis continues until the total addition of the Y(NO3)2 / EU(NO3)3 solution. The solution is then left stirring for 15 days at room temperature. The final 20 mL solution must now be purified to remove excess counterions. To do this, centrifugations (typically three) at 11,000 g (Sigma 3K10, Bioblock Scientific) for 80 minutes each followed by redispersion by sonication (Branson Sonifier 450 operating at 50% with a power of 540 W) are used until a conductivity strictly lower than 100 pS.cm' is reached 1 .

[0302] The obtained nanoparticles are annealed under hydrothermal conditions at 220°C for 2 hours in an autoclave. Such annealing improves crystallinity and thus reduces the photoreduction effect of the nanoparticles when excited in UV-B and / or UV-C.

[0303] Preparation of luminescent particles of formula Yo,9sEuo,sV04

[0304] Vanadate nanoparticles of formula Yo.95Euo.5VO4 were prepared via the colloidal conversion of rare earth hydroxycarbonate particles in two steps. In a general procedure, 20 mL of a solution of 0.1 mol L' 1of RE(NÛ3)3 [RE = (Y0.95Eu0.05)], 100 mL of Milli-Q water, 80 mL of ethylene glycol (EG), and 15 g of urea were added to a three-necked flask (500 mL). The final H2O / EG volume ratio was 3 / 2 (i.e., a 40% volume fraction of EG in water). The mixture was homogenized with vigorous stirring at room temperature for 30 minutes. Then, the flask was connected to a condenser and heated to 95 °C for 2 hours. The resulting suspension was centrifuged at 26323 g for 25 minutes. The pellet was redispersed in Milli-Q water and centrifuged again (final conductivity less than 100 pS cm-1). Finally, the RECO3OH nanoparticles were redispersed in 200 mL of Milli-Q water and heated to 100 °C. After 20 minutes, a 0.1 mol L NH4VO3 solution 1(2 mmol, 20 mL, Sigma-Aldrich) was rapidly added to the colloid while stirring. The system was maintained at 100 °C for 2 hours, and the particles were collected by centrifugation (26323 g, 30 minutes) and purified by dialysis against Milli-Q water for 24 hours.

[0305] Observation of the particles by electron microscopy shows that they have an olive shape with average dimensions of 153 nm in length and 67 nm in width.

[0306] In a typical protected annealing procedure, a silica polymer sol was prepared under acidic conditions by mixing TEOS (Si(OC2Hs)4), water (pH 1.25), and ethanol in a molar ratio of 1:5:3.8 and aging it for 1 h at 60 °C. To facilitate the dissolution of this silica matrix, a porous structure was prepared from silica gelation around self-organized micellar assemblies of a surfactant copolymer. Pluronic PE6800 (EO73PO28EO73) copolymer, with a molar weight of 8080 g / mol (BASF Europe), was dissolved in ethanol at 40.4 g / L. The final solution was obtained by mixing the colloidal solution of the nanoparticles, the silica solution, and the PE6800 solution.For YVO4:Eu particles, the basic character of the colloidal solution implies the use of surfactant concentrations in the sol that do not systematically lead to an organized silica matrix (usual V:Si:PE6800 molar ratios are 1:5:0.05). The gel was dried at 90 °C for more than 6 h and the resulting powder was annealed in air at 1000 °C in two steps. A first anneal was performed at 500 °C with a rate of 100 °C / h and a final step of 1 h and a second anneal at 1000 °C with a rate of 100 °C / h comprising 2 h at 500 °C and 10 min at 1000 °C. The first anneal is necessary for the complete removal of organic matter (polymers P AA and PE6800).

[0307] The silica powder containing the particles was dissolved by excess 2% hydrofluoric acid for 3 h in a Si:HF molar ratio of 1:9. The hydrofluoric acid and dissolved silica were then removed by two centrifugations at 14000 g, the first for 1 min and the second for 10 min. The precipitate was diluted in pure water and a few drops of sodium hydroxide were added to set the pH at 10-11. The final solution was stabilized by the addition of PAA (V:PAA 1:0.05) and sonication in a cold bath for 5 min.

[0308] Coupling of nanoparticles with the protein streptavidin

[0309] Following the synthesis of the nanoparticles and annealing, the nanoparticles are functionalized as explained in international application WO2019 / 025618 by a silicatation step, an amination step using APTES and then a step of transforming the amines into carboxylic acid using anhydride. For greater versatility, the nanoparticles are coupled with a 40:1 ratio of streptavidin:nanoparticles using the method detailed below.

[0310] The appropriate volume is pipetted to obtain 150 pL of -COOH-coated nanoparticles at a concentration of 200 nM. The sample is then centrifuged for 15 minutes at 13700 g and the supernatant is discarded. 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) and N-hydroxy succinimide (NHS) are solubilized at a concentration of 50 mg / mL each in 50 mM 2-(N-morpholino)ethanesulfonic acid (MES) buffer at pH 5.5. This solution is rapidly added to the nanoparticle pellet and the sample is sonicated for 15 seconds at 50% amplitude (GEX130 ultrasonic processor, tip ref. 423-A). After incubation at room temperature for 25 minutes with shaking, the sample is centrifuged for 15 minutes at 15,000 g and the nanoparticle pellet is redispersed in 50-mM phosphate buffer pH 7.4 by sonication for 15 seconds at 50%.40 equivalents of streptavidin (Sigma, s4762- 10MG) are then added and the sample is incubated at 25 °C with shaking at 800 rpm (Eppendorf Thermomixer C) for 2.5 hours. The sample is centrifuged for 15 minutes at 13700 g and the pellet is resuspended in 500 μL of blocking buffer (50-mM phosphate buffer pH 7.4 containing 2% mPEG-NH2 500 (MF001005-500 Biochempeg) by pulsed sonication Is on / ls off for 10 s at 20% amplitude on ice. The sample is then incubated at room temperature for 1 hour with shaking, centrifuged for 15 minutes at 13700 g, and the pellet, corresponding to the streptavidin-nanoparticle conjugates, is redispersed in a preservation buffer (20 mM Tris, pH 8, 1% BSA) and stored at -80°C.

[0311] Coupling of streptavidin-coupled nanoparticles (SA-Nanoparticles) with biotinylated antibodies

[0312] The nanoparticles coupled with streptavidin are then coupled to a biotinylated antibody, specific for the substance to be assayed, by a known method, in particular as described in the protocols below by adapting the ratio of biotinylated antibody and nanoparticles depending in particular on the target substance to be assayed (insulin, interferon gamma (IFN-gamma) or HIV-I-p24 protein as described below).

[0313] Preferably, as illustrated in Figure 10, the amount of biotin 42 is greater than that of the nanoparticles 38 and the antibodies 40 so that the nanoparticles 38 group together in an aggregate. Such an aggregate makes it possible to improve the detection sensitivity by increasing the amount of nanoparticles bound to each molecule of the substance of interest. Indeed, it is no longer a nanoparticle which binds to a substance of interest but an aggregate of nanoparticles which exhibits a much greater luminescence signal.

[0314] Coupling of streptavidin-coupled nanoparticles with biotinylated oligonucleotides Alternatively, when detecting nucleic acids, as illustrated in FIG. 11, the nanoparticles 38 coupled with streptavidin 44 can couple with carbon chains 46 comprising at least two biotinylated arms 42 and one arm carrying a detection oligonucleotide. The fact that the carbon chains comprise two or more biotinylated arms allows them to attach to two streptividines, in particular of different nanoparticles, which allows the formation of a complex.

[0315] As illustrated in Figure 12, the nanoparticles 38 can be coupled with different targeting agents 42i to 42s, in particular different complementary oligonucleotides, to target different areas of a substance of interest 40 fixed on a support, in particular a nucleic acid. This makes it possible to improve the sensitivity by allowing the fixing of several nanoparticles on the same molecule of the substance of interest.

[0316] As illustrated in Figure 13, each nanoparticle 38 may comprise several different targeting agents 42i to 424, in particular different complementary oligonucleotides, to target different but sufficiently close areas of a substance of interest 40, in particular a nucleic acid. This makes it possible to improve the coupling strength of the nanoparticle 38 with the substance of interest 40 by reducing the dissociation rate. The capture surface may also be functionalized with targeting agents 551 to 55s, in particular different complementary oligonucleotides, to bind to different areas of the substance of interest 52.

[0317] The nanoparticles can be added to a support container, such as the microwells of a plate, and then the sample to be analyzed is incubated in the same microwell.

[0318] Preparation of the capture surface: fixation of antibodies.

[0319] 100 pL of capture antibodies are taken from the commercial kit as indicated in the kit protocol in the kit's binding buffer and are incubated in each well of a multiwell plate (655097, Greiner) for 16 h at 4 °C with shaking at 300 rpm. The wells are then washed twice with the commercial diluent provided with the kit or with PBS Tween 0.01% if it is not present. Then, 200 pL of the blocking is added per well to decrease non-specific interactions for 2 h at 4 °C with shaking at 300 rpm.

[0320] Preparation of the capture surface: oligonucleotide fixation. The anti-digoxigenin antibody (Ab64509, Abeam) is applied to the bottom of the multi-well plates at 10 pg / mL in 100 pL of PB S buffer pH 7.2 and incubated overnight at 4°C with shaking. The plate is washed three times with 200 pL of modified 5X SSC (SSC: 750 mM NaCl, 75 mM sodium citrate, 0.05% SDS, 0.05% lauroylsarcosine). The wells are blocked with PBS 3% BSA buffer pH 7.2 for 2 hours at 4°C with shaking and washed once with 200 μl of 5X SSC. 100 µl of Digoxigenin-5' capture oligo (5'-capture oligonucleotide) 16.5 pM is added and the plates are kept at 4°C with shaking.

[0321] Experimental setup for measuring luminescence

[0322] The detection setup includes an illumination device and a luminescence detection device shown in Figure 2. This setup was used for all the results presented below.

[0323] In the detection setup of Figure 2, the illumination device is composed of a light-emitting diode (1) associated with a 1 mm diaphragm positioned at a distance of 3 mm from the diode (1). The light-emitting diode (Hex-S6060-DR250- W275-P100-V6.5, Laser Components) emits in the UV-C at a wavelength of 275 nm and with a power of 100 mW. This makes it possible to illuminate a single well of the multi-well plate, the bottom of each well being positioned at a distance of 20 mm from the diode. The detection device is composed of a collimating lens (20) of the light emitted by the nanoparticles in the sample, by a converging lens (26) which focuses the emitted light on a photomultiplier type detection module (28) (PMM02, Thorlabs) equipped with an interference filter which filters the light emitted at 617 nm. This photomultiplier can be configured not to detect radiation in the UV range.This makes it possible to limit detection to the visible and to avoid residual radiation in the UV.

[0324] An alternative version of the detection setup is shown in Figure 3a-c. The detection setup is explained in the following. The illumination device (Figure 3a) is composed of a light-emitting diode (1) emitting in the UV-C at a wavelength of 275 nm and with a power of 100 mW and a system for collimating and reducing the size of the laser beam (2).The system for collimating and reducing the size of the beam (2) shown is made up, starting from the diode towards the sample, of a collimating lens (3), a set of diaphragms (4) (two iris diaphragms, a so-called field diaphragm and a diaphragm allowing the total stopping of the beam), a converging lens (6), an iris diaphragm, called an aperture diaphragm (8) at the focal point of the converging lens, a collimating lens (10), a focusing lens (12), a dichroic mirror adapted to reflect the illumination light and transmit the light emitted by the sample (35), an objective (16) with a large numerical aperture, for example having a numerical aperture equal to 0.79, and finally an illumination diaphragm (18).The illumination device could however only include the diode and a suitable diaphragm to limit the so-called "cross talk" effect, as illustrated in Figure 2, to avoid simultaneously illuminating several wells of the multi-well plate.

[0325] The detection device (Figure 3b) comprises, following the path of the light from the sample, the objective (16) for collecting and collimating the luminescence emitted by the nanoparticles in the sample, a converging lens (22), a spectral filter (27) filtering the light at 617 nm comprising a collimating lens, an interference filter at 617 nm and a converging lens, and a photomultiplier type detection module (28) (PMM02, Thorlabs). Figure 3c shows the entire detection assembly comprising the illumination device and the detection device.

[0326] An analog-to-digital converter (NI9215, National Instrument) allows the signal to be recorded using Labview software.

[0327] All detection elements can be located on the same axis or not (through the appropriate use of one or more mirrors). A slide support translation system (Z8253, KCH301 Thorlabs) was implemented in order to be able to observe several biological samples successively by scanning.

[0328] Time-resolved detection for measuring the quantity of nanoparticles in the presence of parasitic signals

[0329] The light-emitting diode can be powered by voltage slots by an NI-9215 input module, National Instruments, to create UV excitation slots in order to eliminate parasitic signals thanks to time-resolved detection. Indeed, when the biological sample is illuminated by the diode, molecules other than the nanoparticles of interest emit fluorescence. The use of UV excitation slots and a signal detection frequency by the photomultiplier of 100 kHz (one signal acquisition every 10 μs) makes it possible to overcome this parasitic fluorescence. It is thus possible, due to the long emission duration by the particles of the invention, to perform time-resolved detection of the emission, in particular delayed detection of the emission, as described in detail below.

[0330] Time-modulated illumination limits the contribution to the luminescence signal of parasitic species present in the sample (serum, blood, etc.) or in the solid substrates used (glass, plastic, etc.). Indeed, the nanoparticles used (YVCUEu or GdVCU:Eu for example) can be placed in a long-lived excited state, of the order of a few hundred ps, compared to the lifetimes of usual fluorophores, which are in the nanosecond range. This allows the temporal separation of parasitic luminescence signals from the signal emitted by the nanoparticles.

[0331] The modulated signal obtained is the alternation of a decay phase (stopping illumination) and a luminescence return phase (starting illumination) of all the emitters present in the sample. The decay / return of the luminescence signal is determined by two distinct parameters: (i) the lifetimes of the excited states of the emitters, and (ii) the dynamics of the ignition and shutdown time of the excitation beam.

[0332] Variants of the experimental setup

[0333] The luminescence emission of the nanoparticles is collected:

[0334] . either in transmitted light (figure 2),

[0335] . either in reflected light (figures 3a to 3c) using a dichroic mirror (30) at 347 nm.

[0336] For each sample concentration to be detected, several wells N of a multiwell plate can be used, typically 3. The measurement points for each concentration are then presented as the mean and standard deviation of the N values ​​obtained for each well. The measured value for each well is the average of 60,000 values ​​recorded for 600 ms with an acquisition rate of 100 kHz (1 voltage value recorded every 10 ps).

[0337] Typically, the limit of detection (LOD) is considered to be determined by the concentration generating a signal equal to or greater than the sum of the signal obtained at zero concentration ("blank") and 3 times the standard deviation of the "blank" signal. The limit of quantification can be considered as the concentration generating a signal 10 times greater than this standard deviation. However, an experimental determination of the limit of quantification is preferable. Calibration of the detection device

[0338] Prior to the measurements, the detection device was calibrated with known concentrations of the substance to be detected.

[0339] Detection and quantification of a substance in a sample

[0340] The concentration of a substance in a sample is considered detectable when the signal obtained is at least equal to or greater than the sum of the signal for a sample of the same composition containing a zero concentration of the substance, called a "blank" sample, and three times the standard deviation of the signal of the "blank" sample.

[0341] To perform the quantification of the substance of interest (i.e. determine its concentration), the following protocol must be implemented: i) perform a series of calibration measurements with the substance of interest at different known concentrations, for example from substances obtained commercially or from a purification. As far as possible, the calibration samples must be prepared with the same composition as the samples to be measured or with a composition as close as possible. Make an adjustment of the points obtained (signal in mV versus concentration of the substance of interest); ii) perform the measurements of the samples to be analyzed (obtaining the value of the signal in mV); iii) assign to each measured sample a concentration value of the substance from the measured signal (in mV) and from the calibration curve produced in step i) and its adjustment.

[0342] To determine from which concentration the substance in a sample is quantifiable with a given coefficient of variation (CV), e.g. 25%, 20%, 15% or 10%, the following protocol must be implemented: i) Carry out a sufficient number of measurements for samples of different known increasing concentrations above the limit of detection LOD; ii) Determine the standard deviation and the coefficient of variation related to the variability of the measurement for each of these concentrations as well as the concentration from the calibration curve; iii) Determine the coefficient of variation related to the bias, i.e. the standard deviation between the nominal concentration and the concentration determined from the measurement, normalized to the value of the concentration; iv) If one of these two determined coefficients of variation is higher than the predetermined coefficient of variation, repeat measurements at higher concentrations of the substance.

[0343] The limit of quantification for a given CV corresponds to the concentration of the substance for which the coefficient of variation linked to the variability of the measurement and that linked to the bias are equal to or less than the predetermined CV.

[0344] Comparison of detection sensitivity between commercial ELISA tests and the method of the invention

[0345] For each analyte to be detected, the same 96-well plates, the same antibodies and substantially the same buffer solutions as those of the commercial ELISA tests are used, with the difference that the HRP (HorseRadish Peroxidase) enzyme is replaced by nanoparticles of formula Yo.6Euo.4V04, obtained by the manufacturing process described above, functionalized on the surface with streptavidin molecules and coupled with biotinylated antibodies of each of the substances to be analyzed, prepared in Example 1. Detection of insulin

[0346] The sample analyzed is recombinant insulin (ELIS kit A Abeam ab 100578).

[0347] For nanoparticle-based detection, we use the same multiwell plates coated with commercial capture antibodies, the same biotinylated detection antibodies, insulin, and Diluent A, B, and Wash Buffer solutions as provided in the Abeam kit above.

[0348] An insulin solution is prepared in diluent A to obtain a concentration of 10 ng.mL-1. Then, the solution is diluted in cascade by a factor of 10 (triplicate for each concentration and fifty “blank” samples) and the microwell plate is incubated for 2h30 at 25°C with shaking at 300 rpm (Eppedorf Thermomixer C).

[0349] In parallel, the streptavidin-nanoparticle conjugates are incubated with 60 eq of biotinylated detection antibodies in phosphate-buffered saline (PBS) pH 7.4 for 1h30 at 25°C. The solution is then centrifuged for 15 minutes at 13,000 g. The pellet is resuspended in diluent B by pulsed sonication 10 s Is on / ls off in ice to obtain a final nanoparticle concentration of 4.5 nM. The microwell plate is washed three times with the wash buffer. Then, 100 μL of nanoparticle-antibody conjugate solution is added and the plate is incubated for 1h30 at 25°C with shaking at 300 rpm. The plate is washed three times with the wash buffer and once with PBS pH 6.6. Then, 200 µl of PBS pH 6.6 is added to each well and the plate is read.

[0350] The standard deviation for the zero concentration is 28 mV (see Figure 4). The measured signal value for the 10 fg / mL (or 834 aM) concentration is 409 mV, above the limit value of 289 mV equal to the mean of the "blank" samples plus 3 times the standard deviation determined for the "blank" samples.

[0351] For comparison, the lowest detectable concentration indicated by the ELISA kit supplier is 50 pg / mL (or 4.17 pM).

[0352] The minimum concentration that can be detected with the ultra-sensitive detection method according to the invention is thus 5000 times lower than the concentration detectable by ELISA using the same antibodies as the ELISA kit.

[0353] Detection of gamma interferon

[0354] The sample analyzed is interferon gamma (Thermofisher ELISA kit 88-7316-88).

[0355] For nanoparticle-based detection, 100 pL of capture antibody from the commercial kit is diluted 250-fold in the kit's binding buffer and incubated in each well of the multi-well plate for 16 h at 4 °C with shaking at 300 rpm. The wells are then washed twice with the commercial Elisa / Elispot diluent provided with the kit. Then, 200 pL of the Elisa / Elispot diluent is added per well for a blocking step for 2 h at 4 °C with shaking at 300 rpm.

[0356] A range of interferon gamma concentrations is prepared in the commercial diluent (250 pg.mL-1 to 25 fg.mL-1). 100 pL is added to each well in triplicate and the plate is incubated for 16 hours at 4°C, shaking at 300 rpm. The wells are then washed three times with PBS. In parallel, the YVOLEu 20%: streptavidin 1:40 nanoparticles are mixed with 60 equivalents of detection antibody (4S.B3 Thermofischer 13-7319-85) in PBS pH 7.4 for 1 hour at room temperature with gentle shaking. The mixture is centrifuged for 15 minutes at 13,700 g. The pellet is suspended in PBS by pulsed sonication 10 s Is on / ls off in ice to obtain a nanoparticle concentration of 4.5 nM. Then, 100 pL of nanoparticle / 4S.B3 solution is added to each well and the plate is incubated for 1 h 30 at 25 ° C 300 rpm. The plate is washed three times with PBS pH 7.4 and read with the in-house reader (Figure 2).

[0357] The results are shown in Figure 5. In buffer (Figure 5a), the measured signal value for the 160 fg / mL concentration is 160.8 mV, above the detection limit value of 149.1 mV equal to the mean of the “blank” samples (133.8 mV) plus 3 times the standard deviation determined for the “blank” samples. In serum (Figure 5b), the measured signal value for the 800 fg / mL concentration is 149.7 mV, above the detection limit value of 148.3 mV equal to the mean of the “blank” samples (138.5 mV) plus 3 times the standard deviation determined for the “blank” samples.

[0358] For comparison, the detection of gamma interferon was carried out according to the conditions of the ELISA kit. The experimental conditions followed are those indicated by the supplier of the ELISA kit. The result is shown in Figure 6a for measurements in buffer and in Figure 6b for measurements in serum. The lowest concentration measured is 5 pg / mL in buffer and 62.5 in serum.

[0359] The minimum concentration that can be detected with the ultra-sensitive detection method according to the invention is thus 31 times lower than the concentration detectable by ELISA when the measurements are made in buffer and 78 times lower than the concentration detectable by ELISA when the measurements are made in serum.

[0360] Detection of HIV-p24

[0361] The sample analyzed is HIV-p24 (QC221 Quantikine Immunoassay Control Set 896 HIV-1 Gag p24 Biotechne).

[0362] For nanoparticle-based detection, 100 pL of Biotechne capture antibody, MAB73602-100pL at 10 pg / pL is diluted in PBS and incubated in each well of the multi-well plate for 16 h at 4 °C with shaking at 300 rpm. In parallel, the streptavidin-nanoparticle conjugates are incubated with 30 eq of biotinylated detection antibody (Biotechne, NBP3-06466-100pL) in PBS pH 7.4 for 1 h 30 min at 25 °C. The solution is then centrifuged for 15 minutes at 13,000 g. The pellet is resuspended in PBS by pulsed sonication 10 s Is on / ls off in ice to obtain a final nanoparticle concentration of 4.5 nM.

[0363] The microwell plate is washed three times with PBS 7.4, Tween 20 0.01% wash buffer recommended by the antibody supplier. Then, 100 μL of nanoparticle-antibody conjugate solution is added and the plate is incubated for 1 h 30 at 25°C with shaking at 300 rpm. The plate is washed three times with the wash buffer and once with PBS pH 6.6. Then, 200 μL of PBS pH 6.6 is added to each well and the plate is read with the reader in Figure 2.

[0364] The standard deviation for the zero concentration is 5.4 mV. The signal value measured for the 500 fg / mL (or 20.8 fM) concentration is 251 mV, above the limit value of 246 mV equal to the average of the “blank” samples plus 2 times the standard deviation determined for the “blank” samples in accordance with the definition of the commercial test (see Figure 7).

[0365] For comparison, the lowest detectable concentration reported by the antibody supplier is 15.6 pg / mL (or 650 fM), Biotechne HIV-1 Gag P-24 DuoSet ELISA kit. This detection limit was defined as the concentration giving a signal equal to or greater than the mean signal of the "blank" samples plus 2 times the standard deviation of the "blank" samples.

[0366] With the ultra-sensitive detection method according to the invention, the lowest measurable concentration being 500 fg / mL (or 20.8 f), with the device of Figure 2, the minimum concentration that can be detected is thus 32 times lower than the concentration detectable by ELISA using the same antibodies.

[0367] Detection of the SARS-CoV-2 gene

[0368] The optimal scheme used for detection is shown in Figure 8. The analyzed sample is the PCR product of the ni gene of SARS-CoV-2. The anti-digoxigenin antibody (Ab64509, Abeam) is applied to the bottom of the multiwell plates at 10 pg / mL in 100 pL of PB S buffer pH 7.2 and incubated overnight at 4°C with shaking. The plate is washed three times with 200 pL of modified 5X SSC (750 mM NaCl, 75 mM sodium citrate, 0.05% SDS, 0.05% lauroylsarcosine). The wells are blocked with PBS 3% BSA buffer pH 7.2 for 2 hours at 4°C with shaking and washed once with 200 pL of modified 5X SSC. 100 pL of the capture oligo Digoxigenin-5' (5'- GACCCCAAAATCAGCGAAAT) 16.5 pM is added and the plates are kept at 4°C with shaking.In parallel, 60 pL of the target DNA at 43 nM is denatured for each concentration at room temperature for 15 minutes in a solution [0.1 M NaOH, 0.01% Tween 20], then 540 pL of the detection oligo 3'-biotin (5'-CAGATTCAACTGGCAGTAACCAGA) at 40 nM in modified 5X SSC is added. After washing the wells with 200 pL of modified 5X SSC, 100 pL of this target DNA-detection oligo conjugate solution is added to the wells of the plate. The plate is kept at 4°C with shaking for 30 minutes. 100 pL of 20% YVO4:EU nanoparticle-streptavidin conjugates at 4.5 nM are added and the samples are incubated for.

[0369] 1 hour at 4°C with shaking. The wells are then washed 5 times with modified 5X SSC and

[0370] 2 times with PB S before being read with the homemade UV reader in Figure 2.

[0371] The standard deviation for the “blank” samples is 22.8 mV. The signal value measured for the 50 fM concentration is 348 mV, just above the limit value of 335 mV equal to the average of the “blank” samples plus three times the standard deviation determined for the “blank” samples. Thus the detection limit for the SARS-CoV-2 double-stranded ni gene is 50 fM (Figure 9a). When the substance of interest is the synthesized SARS-CoV-2 double-stranded ni gene (Eurogentec) the lowest detectable concentration is 5 fM (Figure 9b). When the substance of interest is the synthesized SARS-CoV-2 single-stranded ni gene (Eurogentec), the lowest detectable concentration is 0.5 fM (Figure 9c). This detection limit compares favorably with literature results obtained without enzyme and without nucleic acid amplification

[0014] ,

[0372] Detection of the SARS-CoV-2 gene using nanoparticles annealed at 1000°C

[0373] The nanoparticles of formula Yo.95Euo.5VO4, obtained according to the method described above, were functionalized and coupled to streptavidin as described above and then coupled to biotinylated oligonucleotides as described above. Then, the same protocol as in the previous example concerning the detection of the SARS-CoV-2 ni gene was implemented. The signal value measured for the 10 aM concentration is 524.6 mV, well above the limit value of 508 mV equal to the average of the “blank” samples plus three times the standard deviation determined for the “blank” samples. In this case, thanks to the higher number of photons emitted per unit of time by these nanoparticles, linked to the higher number of ions, i.e.Due to the larger size of the nanoparticles and their higher quantum yield, a sensitivity limit of <10 aM was obtained, which is comparable to the detection limit of conventional PCR (approximately 1 aM, corresponding to 30,000 nucleic acid molecules / mL). This result was therefore obtained without amplification and without the use of enzymes.

[0374] Detection of the phagemid carrying the SARS-CoV-2 ni gene The optimal scheme used for detection is shown in Figure 15. The sample analyzed is the phagemid carrying the SARS-CoV-2 ni gene produced according to the protocol of the article referenced

[0037] in the XLl-Blue MRF' strain. Its construction was carried out on the plasmid pTA131 via a SLIC protocol of the article referenced

[0038] using the restriction enzymes EcoRI and NotI. The anti-digoxigenin antibody (Ab64509, Abeam) is applied to the bottom of the multi-well plates at 10 pg / mL in 100 pL of PBS buffer pH 7.2 and incubated overnight at 4°C with shaking. The plate is washed three times with 200 μL of modified 5X SSC (750 mM NaCl, 75 mM sodium citrate, 0.05% SDS, 0.05% lauroylsarcosine). The wells are blocked with PBS buffer, 3% BSA, supplemented with salmon sperm DNA, pH 7.2, for 2 hours at 4°C with shaking and washed once with 200 μL of modified 5X SSC.100 pL of the capture oligo Digoxigenin-5' (5'- GACCCCAAAATCAGCGAAAT) 16.5 pM is added and the plates are kept at 4°C with shaking. In parallel, 16.5 pL of the target phagemid at 18 nM is denatured at room temperature for 15 minutes in a solution [0.1 M NaOH, 0.01% Tween 20], 43.55 pL of modified 5X SSC is added, then 540 pL of the detection oligo 3'-biotin (5'-CAGATTCAACTGGCAGTAACCAGA) at 40 nM in modified 5X SSC is added. A 10-fold cascade dilution is performed on 6 concentrations ranging from 500 pM of phagemid to 5 f in modified 5X SSC containing 40 nM of the detection oligo 3'-biotin. After washing the wells with 200 pL of modified 5X SSC, 100 pL of each concentration of phagemid DNA-detection oligo conjugate is added to the wells of the plate. The plate is kept at 4°C with shaking for 30 minutes.100 μL of 20% YVCLUu nanoparticle-9 nM streptavidin conjugates are added and the samples are incubated for 1 hour at 4°C with shaking. The wells are then washed 5 times with modified 5X SSC and 2 times with PBS before being read with the homemade UV reader in Figure 2.

[0375] The standard deviation for the blank samples is 17.3 mV. The signal value measured for the 50 fM concentration is 268 mV, above the limit value of 261 mV equal to the mean of the blank samples plus three times the standard deviation determined for the blank samples. Thus, the detection limit for the phagemid containing the ni gene of SARS-CoV-2 is 50 fM, as shown in Figure 15a.

[0376] Detection of Phagemide carrying the SARS-CoV-2 ni gene with nanoparticles annealed at 1000°C The nanoparticles of formula Yo.95Euo.5VO4, obtained according to the method described above, were functionalized and coupled to streptavidin as described above and then coupled to biotinylated oligonucleotides as described above. Then, the same protocol as in the previous example concerning the detection of the SARS-CoV-2 ni gene was implemented, except that the detection range is between 50 pM and 5 aM. The signal value measured for the 5 fM concentration is 348.4 mV, just above the limit value of 338.8 mV equal to the average of the “blank” samples plus three times the standard deviation determined for the “blank” samples. In this case, thanks to the greater number of photons emitted per unit of time by these nanoparticles, linked to the greater number of ions, i.e.With the larger size of the nanoparticles, and their higher quantum yield, the sensitivity limit was increased, as illustrated in Figure 15b.

[0377] These two examples demonstrate our ability to detect long single-stranded nucleic acids with increased detection sensitivity, the phage genome comprising 3657 bases.

[0378] List of cited documents

[0379] [1] Hermanson, Bioconjugate Techniques, Academie Press, 1996;

[0380] [2] Mason, Fluorescent and Luminescent Probes for Biological Activity. A Practical Guide to Technology for Quantitative Real-Time Analysis, Second Edition, Academie Press, 1999;

[0381] [3] Medintz et al., Nat. Mat., 2005, 4, pp. 435-446;

[0382] [4] Nam et al., Science, 2003, 301, pp. 1884-1886;

[0383] [5] H. Li et al., Analyst, 2011, 136, pp. 1399-1405;

[0384] [6] Z. Cao et al., Anal. Chim. Acta, 2011, 698, pp. 44-50 ;

[0385] [7] Pisanic et al., Analyst, 2014, 139(12), pp. 2968-2981 ;

[0386] [8] Geissler et al., Angewandte Chemie International Edition, 2010, 49(8), pp. 1396-1401 ;

[0387] [9] Howes ét al., Bionanotechnology, 2014, 346(6205), pp.53-63 ;

[0388]

[0010] Giljohann et al., Angewandte Chem, 2010, 49, pp. 3280-3294 ;

[0389]

[0011] De La Rica ét al., Nature Nanotechnology, 2012, 7, pp. 821-824;

[0390]

[0012] Zhu et al., Anal. Chem., 2013, 85(2), pp 1058-1064;

[0391]

[0013] Cordeiro ét al., Diagnostics, 2016, 6(4):43;

[0014] Sakharov Y., Sensors 2018, Microplate Chemiluminescent Assay for DNA Detection Using Apoperoxidase-Oligonucleotide as Capture Conjugate and HRP- Streptavidin Signaling System;

[0392]

[0015] Lorenzo E., Guttierez-Galvez L., Taianta 2022, Electrochemiluminescent nanostructured DNA biosensor for SARS-CoV-2 detection;

[0393]

[0016] Bouzigues et al., ACS Nano, 2011, 5(11) pp. 8488-8505 ;

[0394]

[0017] Dosev et al., J. Biomed. Opt., 2005, 10(6), 064003 ;

[0395]

[0018] Yi et al., Nano Letters, 2004, 4(11), pp. 2191-2196 ;

[0396]

[0019] Beaurepaire et al., Nano Letters, 2004, 4(11), pp. 2079-2083 ;

[0397]

[0020] Turkcan et al., Biophysical Journal, 2012, 102, pp. 2299-2308;

[0398]

[0021] Yuan et al., Trends in Analytical Chemistry, 2006, 25(5), pp.490-500 ;

[0399]

[0022] Tang et al., Clin Vaccine Immunol, 2009, 16(3), pp. 408-413 ;

[0400]

[0023] Harma et al., 2001, Clinical Chemistry, 47(3), pp. 561-568 ;

[0401]

[0024] Corstjens et al., Clinical Biochemistry, 2008, 41(6) pp. 440-444 ;

[0402]

[0025] Hemmila et al., Analytical Biochemistry, 1984, 137(2), pp. 335-343 ;

[0403]

[0026] Jiang et al., Journal of Fluorescence, 2010, 20(1), pp 321-328 ;

[0404]

[0027] Tanja et al., Analytical and Bioanalytical Chemistry, 2004, 380(1), pp 24- 30 ;

[0405]

[0028] Zhou et al., Angewandte Chimie, 2014, 126(46), pp. 12706-12710 ;

[0406]

[0029] Son et al., Journal of Nanoscience and Nanotechnology, vol. 8, 2463-2467, 2008 ;

[0407]

[0030] Nichkova et al., Anal. Chem. 2005, 77, 6864-6873.

[0408]

[0031] Casanova et al., Appl. Phys. Lett, 2006, 89, 253103;

[0409]

[0032] Riwotzki et al., J. Phys. Chem. B, 1998, 105, pp. 12709-127 ;

[0410]

[0033] Hui gnard et al., Chem. Mater., 2000, 12, pp. 1090-1094 ;

[0411]

[0034] Neouze et al, Langmuir 2020, 36, 31, 9124-9131

[0412]

[0035] Casanova et al., J. Am. Chem. Soc., 2007, 129, 12592 ;

[0413]

[0036] Giaume c / a / ., Langmuir, 2008, 24, pp. 11018-11026 ;

[0037] Nafisi, P., Aksel, T. & Douglas, S. Construction of a novel phagemid to produce custom DNA origami scaffolds. Synth. Biol. 3, (2018).

[0414]

[0038] Li, M. Z. & Elledge, S. J. Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC. Nat. Methods 4, 251-256 (2007).

[0039] Mousseau, F. et al. Nanoscale, 2021, vol. 13, no. 35, pp. 14814-14824;

Claims

Claims 1. Method for ultra-sensitive in vitro detection and / or quantification of a substance of biological or chemical interest (40) in a sample (35), in particular a biological sample, by detection of the luminescence emission emitted by photoluminescent inorganic nanoparticles, comprising at least the following steps: (i) arrangement of photoluminescent particles (38) formed in whole or in part from a photoluminescent inorganic nanoparticle with a vanadate or vanadate / phosphate matrix of formula (I): Al- x Ln x VO4(ly)(PO4)y (I) in which: . A is chosen from yttrium (Y), gadolinium (Gd), lanthanum (La) and mixtures thereof, in particular A represents Y; . Ln is selected from europium (Eu), dysprosium (Dy), thulium (Tm), samarium (Sm), neodymium (Nd), erbium (Er), ytterbium (Yb) and mixtures thereof, in particular Ln represents Eu; . 0 < x < 1; in particular 0.02 < x < 0.5, in particular 0.05 < x < 0.4 and more particularly x is 0.4, 0.2, 0, 1 or 0.05; and . 0 < y < 1, in particular y is 0, the photoluminescent inorganic nanoparticles being coupled to a direct (42) or indirect (44) coupling agent to the substance of interest, (ii) bringing said photoluminescent particles (38) into contact with the substance of interest (40) under conditions of coupling of the substance of interest (40) with the coupling agent (42, 44), (iii) excitation of the matrix of photoluminescent inorganic nanoparticles of formula (I), by radiation of wavelength between 240 nm and 330 nm, the radiation being emitted by an illumination device having a power between 50 mW and 500 mW; (iv) detection of luminescence emission by photoluminescent inorganic nanoparticles, in particular time-resolved detection, and (v) determination of the presence and / or concentration of the substance of interest by interpretation of said measurement of the luminescence emission by the particles, the method having a sensitivity of detection of the substance of biological or chemical interest in the sample less than or equal to 10 pM.

2. Method according to claim 1, having a sensitivity of detection of the substance of biological or chemical interest in the sample of less than 1 pM, or even less than 0.1 pM, or even less than 0.01 pM, or even less than or equal to 1 fM, even better less than or equal to 0.1 fM (i.e. 100 aM), even better less than or equal to 0.01 fM (i.e. 10 aM), in particular without amplification and without the use of enzymes.

3. Method according to any one of the preceding claims, in which the coupling agent is a targeting agent (42) of the substance of interest coupling directly to the substance of interest in step (ii) or a molecule (44) allowing the attachment of a targeting agent of the substance of interest, in particular attached to the substance of interest prior to bringing the photoluminescent particles into contact with the substance of interest.

4. Method according to any one of the preceding claims, in which at least one nanoparticle is coupled with a plurality of coupling agents, the method comprising a step of coupling the nanoparticles with the coupling agents comprising dissolving the nanoparticles with a proportion of coupling agent greater than the proportion of nanoparticles, in particular with a ratio of at least two coupling agents for one nanoparticle or even at least 10 coupling agents per nanoparticle, or even between 10 and 80 coupling agents.

5. Method according to claim 4, in which the photoluminescent particles each comprise a plurality of nanoparticles linked together, in particular by the coupling agents, to form an aggregate of nanoparticles, preferably the photoluminescent particles being in colloidal dispersion in the solution in step (ii) of contacting with the substance of interest.

6. Method according to any one of the preceding claims, using at least two types of distinct photoluminescent particles each comprising nanoparticles according to formula (I), which are coupled to distinct coupling agents, capable of attaching to distinct sites of the same analyte, in particular coupled to distinct oligonucleotides recognizing different regions of the nucleic acid analyte.

7. Method according to any one of the preceding claims, in which the nanoparticles are each coupled to a plurality of coupling agents to several areas of an analyte, in particular a plurality of oligonucleotides chosen to bind to different areas of a nucleic acid.

8. Method according to any one of the preceding claims, in which the substance of interest of said sample in step (i) is previously immobilized on the surface of a support, said surface being passivated so that said luminescent particles do not attach to it in the absence of the substance of interest, in particular step (i) comprises at least the following steps: (a) having a support whose surface is previously passivated and functionalized with an agent for capturing the substance to be detected / quantified, for example a monoclonal antibody, called a capture antibody; (b) contacting said sample to be analyzed with the support of step (a) under conditions conducive to the association of said substance with the capture agent; and (c) bringing the photoluminescent particles coupled to at least one coupling agent into contact with said support resulting from step (b) to directly or indirectly associate the particles with said substance immobilized on the surface of the support.

9. Method according to any one of the preceding claims, implementing at least two types of nanoparticles, doped with distinct rare earth ions, having distinct emission wavelengths and coupled to distinct direct or indirect coupling agents each to one of two different substances of interest.

10. Method according to any one of the preceding claims, implemented using an apparatus comprising - an illumination device at a wavelength between 240 nm and 330 nm, better between 260 and 330 nm, better between 260 nm and 310 nm, better between 270 and 290 nm, preferably of the light-emitting diode type (1), preferably having a power between 50 and 500 mW, even better between 50 and 150 mW; and - a device for detecting the light intensity emitted by the nanoparticles in step (iii), in particular a single detector, by example of a photomultiplier type detecting only visible light, photodiode, avalanche photodiode, or a photosensitive device array type detector consisting of a 2D surface of detection pixels such as a CCD or EM-CCD camera or CMOS camera.

11. A method according to any preceding claim, wherein the detection is time-resolved, the time-resolved detection being achieved by electronic or mechanical chopping of the incident UV-B and / or UV-C beam.

12. Method according to any one of the preceding claims, the nanoparticles being prepared by colloidal conversion of rare earth hydroxy carbonate particles, in particular by at least the steps consisting of: (a) preparing an aqueous solution (1) by mixing, in an aqueous medium, a metavanadate salt, in particular ammonium metavanadate (NH4VO3), and optionally a phosphate salt; (b) prepare hydroxy carbonate nanoparticles of formula Ai- x Ln x 3+CO3OH from precursors of elements A and Ln, in particular in the form of salts, in particular nitrates, and a source of bicarbonate ions, in particular in excess, in particular urea, under conditions conducive to the formation by co-precipitation of said nanoparticles of hydroxy carbonates, (b') adding the aqueous solution (1) to the hydroxycarbonate nanoparticles in colloidal suspension under conditions conducive to the formation by co-precipitation of the nanoparticles according to formula I; and (c) recovering the nanoparticles according to formula I.

13. Method according to any one of the preceding claims, comprising in step (i), preferably before coupling the nanoparticle with the coupling agent, mixing the nanoparticles with a protective agent then post-synthesis annealing at a temperature between 500°C and 1500°C, more particularly between 800°C and 1300°C, then removing the protective agent by a suitable method depending on the protective agent, in particular by acid dissolution.

14. Use of the method as defined according to any one of the preceding claims, for in vitro diagnostic purposes.

15. In vitro diagnostic kit, in particular for implementing the method according to any one of claims 1 to 13, comprising at least: photoluminescent particles formed in whole or in part from a photoluminescent inorganic nanoparticle with a vanadate or vanadate / phosphate matrix of formula (I): Al- x Ln xVO4(ly)(PO4)y (I) in which: . A is chosen from yttrium (Y), gadolinium (Gd), lanthanum (La) and mixtures thereof, in particular A represents Y; . Ln is selected from europium (Eu), dysprosium (Dy), thulium (Tm), samarium (Sm), neodymium (Nd), erbium (Er), ytterbium (Yb) and mixtures thereof, in particular Ln represents Eu; . 0 < x < 1; in particular 0.02 < x < 0.5, in particular 0.05 < x < 0.4 and more particularly x is 0.4, 0.2 or 0.1 or 0.05; and . 0 < y < 1, in particular y is 0, said particles being surface functionalized with chemical groups, for example carboxyl, amino, thiol, aldehyde or epoxy groups, provided by molecules, for example citric acid or polyacrylic acid, and / or coupled to molecules, for example streptavidin, said chemical groups or molecules being capable of allowing the coupling of said particles with an agent for targeting the substance of interest; or said particles already being coupled to at least one agent for targeting the substance of interest;and a detection and / or quantification system comprising at least: an illumination device at a wavelength between 240 nm and 330 nm, better between 260 and 330 nm, better between 260 nm and 310 nm, better between 270 and 290 nm, preferably of the light-emitting diode type (1), preferably having a power between 50 and 500 mW, even better between 50 and 150 mW, and a device for detecting the light intensity emitted by the particles, and; optionally a suitable support for the immobilization of the substance of interest in said sample.