PROCEDE DE RETABLISSEMENT DE LA REPRODUCTION SEXUEE CHEZ LE CHAMPIGNON TRICHODERMA REESEI

Abstract

The present invention relates to a method for restoring sexual reproduction between two female sterile strains of Trichoderma reesei using an AMAT helper strain, said helper strain being a female fertile strain of Trichoderma reesei in which the MAT mating type locus has been invalidated.

Description

To test sexual reproduction in industrial strains, a QM6a MAT1-1 strain was constructed by genetic engineering (Seidl et al., 2009). Sexual reproduction between compatible QM6a strains does not produce stromata because these strains are female sterile (Figure 2B) (Seidl et al., 2009). All known existing industrial strains of T. reesei were generated from the natural strain QM6a. Since the natural strain QM6a is of the MAT1-2 mating type, all industrial strains of T. reesei today are of the MAT1-2 mating type, and are female sterile but male fertile. Sexual reproduction can be a rapid and effective breeding tool, but if it cannot occur between industrial strains, its usefulness remains limited. Scientific studies have attempted to understand why industrial strains of T. reesei are female sterile and how to overcome this. This research identified the idcl gene as the determinant of female sterility and showed that replacing the defective gene with a functional one restored female fertility in the QM6a strain and enabled sexual reproduction (Kubicek et al., 2014 (WO2014 / 102241); Linke et al., 2015). However, this strategy has a major drawback. Indeed, it requires introducing the functional gene into each of the industrial strains to be reproduced in order to restore the female fertility of the industrial strains. On the other hand, this strategy does not take into account the fact that the industrial strains are the result of successive mutagenesis and that it is possible that other genes important for female fertility have been modified. Thus, the contribution of the functional idcl gene will not be sufficient to restore female fertility and thus restore sexual reproduction between two sterile female strains of T. reesei. Thus, being able to restore female fertility in the QM6a strain does not mean that it can be restored in the industrial strains generated from said QM6a strain. There is therefore a need for a method to re-establish sexual reproduction between two sterile female strains of T. reesei, in particular the QM6a strain or the female sterile industrial strains derived from strain QM6a or any other female sterile strain of T. reesei. The inventors of the present invention have thus developed a strategy for restoring sexual reproduction between two sterile female strains of T. reesei which does not require introducing into the sterile female strains a functional version of the idcl gene, which does not require verifying whether the presence of a functional version of the idcl gene is sufficient or not to restore sexual reproduction, nor even having to identify and replace other genes which could be defective. The inventors of the present invention have thus developed a strategy for restoring sexual reproduction between two sterile female strains of T. reesei which is simple and effective to implement. The present invention is indeed based on the inventors' results according to which the use of an AMAT helper strain (i.e. a fertile female strain of T. reesei in which the mating type locus, either MAT1-1 or MAPI-2, has been invalidated) in combination with sequential watering of the conidia of a sterile female strain of T. reesei of a first mating type, then of the conidia of a sterile female strain of T. reesei of a second mating type made it possible to re-establish sexual reproduction between these two sterile female strains. The use of a helper strain has already been used but not in the species T. reesei (Silar, P. (2014)). More specifically, Jamet-Vierny et al. described the use of a helper strain that provides the IDC1 proteins necessary for the development of stromata in the reproduction of Podospora anserina strains. This method, which is based on the production of tricaryons, makes it possible to restore the fertility of Podospora anserina strains. However, it should be noted that this method cannot be used with T. reesei strains: in fact, the sole use of the tricaryon method does not allow the restoration of sexual reproduction between two sterile female strains of T. reesei (see example 2a). The inventors of the present invention have nevertheless shown, surprisingly, that the trikaryon method made it possible to reestablish sexual reproduction between two sterile female strains of T. reesei when used in combination with the sequential watering technique (i.e. watering with conidia from a sterile female strain of T. reesei of a first mating type, then conidia from a sterile female strain of T. reesei of a second mating type). This sequential watering, used in combination with a A MAT helper strain, allows sexual reproduction to be reestablished between two sterile female strains of T. reesei, and allows stromata to be obtained repeatedly (see example 2i). In a first aspect, the invention thus relates to a method for reestablishing sexual reproduction between two sterile female strains of Trichoderma reesei comprising the following steps: an incubation in a suitable medium of an AMAT helper strain, said strain being a fertile female strain of Trichoderma reesei in which the MAT mating type locus has been invalidated, a first watering of said AMAT assistant strain with conidia of a first strain of Trichoderma reesei of a first sexual type, a second watering of said AMAT assistant strain and conidia of a first strain of Trichoderma reesei of a first mating type with conidia of a second strain of Trichoderma reesei of a second mating type. The "restoration of sexual reproduction" according to the invention means obtaining stromata from conidia of a first female sterile strain of T. reesei of a first mating type and a second female sterile strain of T. reesei of a second mating type, using an AMAT strain. A "female sterile strain of T. reesei" according to the invention means all strains of T. reesei which are female sterile and male fertile. These are strains of T. reesei whose female fertility can be restored and which can be used in a method for restoring sexual reproduction according to the invention. Such strains are for example strains QM6a, NG14, RUTC30, QM9414, CL847, QM9136, QM9978, QM9979, PC3-7, TU-6, ... In other words, these are all strains produced from strain QM6a and which are female sterile but they can also be strains of T. reesei from other geographical isolates and which are female sterile and male fertile. An "incubation in a suitable medium" according to the invention means an incubation in a culture medium suitable for the growth of fungi. Such a medium is for example PDA medium (Potato Dextrose Agar), SDA medium (Sabouraud Dextrose Agar), SPDA medium (Sweet Potato Dextrose Agar), MEA medium (Malt Extract Agar), Oatmeal Agar medium, Cornmeal Agar medium, and is preferably a complete medium. A complete medium according to the invention is a medium which contains in addition to the components of the minimum medium, the final metabolites which are necessary for the growth, such as amino acids, vitamins, bases, etc., unlike the minimum environment which is an environment containing the chemical elements strictly necessary for the growth of an organism. An "AMAT helper strain" according to the invention means a strain of T. reesei in which the mating-type locus MAT1-1 or MAT1-2 has been invalidated. Said AMAT helper strain can be obtained by any gene / locus invalidation techniques well known to those skilled in the art, or for example by the method described in Example 1. The strain from which the AMAT helper strain is obtained must be female fertile. Although belonging to the species T. reesei, this helper strain does not fall within the definition of a "female sterile strain of T. reesei" according to the invention, due to the invalidation of the mating-type locus MAT1-1 or MAT1-2. This helper strain does not participate in the karyogamy process since it has been invalidated from the mating-type locus which regulates said process. The mechanism of the helper strain is unknown, but hypotheses as to its operation are as follows: In the case of sexual reproduction between two sterile female strains: there may be fusion of the nuclei, but as the idclUa gene and IDC1 protein are defective, there is no recruitment of hyphae for the construction and development of the stromata in which karyogamy and the development of the offspring will take place. In the case of reproduction between two sterile female strains and in the presence of the helper strain (Figure 3): there may be fusion of the parental nuclei. In this case there is expression of the idcl gene by the helper strain, and thus synthesis of the IDCL protein. Given that there is fusion of nuclei and presence of IDC1 proteins, there may be recruitment of hyphae for the construction and development of stromata in which karyogamy and the development of the offspring can take place. The female tissues are provided by the AMAT strain, while the zygotic tissues are provided by the sterile female strains. The term "conidia" according to the invention means a spore resulting from the vegetative multiplication of a fungus (such as T. reesei). The conidia of a T. reesei strain of the MAT1-1 mating type or of the MAT1-2 mating type are obtained under the same conditions. For example, the conidia according to the invention of a first type or of a second mating type can be obtained by culturing and incubating in an appropriate medium (such as PDA), respectively, a T. reesei strain of a first mating type or a T. reesei strain of a second mating type, until the appearance of conidia. Preferably, the strains are incubated in the light, and at a temperature of approximately 24-30°C until the appearance of conidia. The conidia can then be recovered by rinsing the culture dish with distilled / sterile water. The term "conidia of a first strain of T. reesei of a first mating type" according to the invention means the conidia of one of the two strains of T. reesei used in the method for restoring sexual reproduction according to the invention. The term "conidia of a second strain of T. reesei of a second mating type" according to the invention means the conidia of a strain of T. reesei, compatible with the first strain. According to the invention, the sexual type of the first strain of T. reesei is MAT1-1 or MAT1-2, in particular MAT1-1. According to the invention, the sexual type of the second strain of T. reesei is MAT1-1 or MAT1-2, in particular MAT1-2. The terms "MAT1-1 or MAT1-2" refer to the sexual characteristics of the fungi. These are the two compatible sexual types. Since T. reesei is a so-called heterothallic fungus, if the sexual type of the first strain of T. reesei is MAT1-1, then the sexual type of the second strain of T. reesei is necessarily MAT1-2. Conversely, if the sexual type of the first strain of T. reesei is MAT1-2, then the sexual type of the second strain of T. reesei is necessarily MAT1-1. In a preferred embodiment according to the invention, the sexual type of the first strain of T. reesei is MAT1-1, and the sexual type of the second strain of T. reesei is MAT1-2. The first strain and the second strain of T. reesei used in a method for restoring sexual reproduction according to the invention may be identical or different strains, provided that the mating types are compatible. For example, when the strains are identical, the first strain may be a QM6a MAT1-1 strain and the second strain may be a QM6a MAT1-2 strain. Conversely, when the strains are different, the first strain may be a NG14 MAT1-1 strain and the second strain may be a RUTC30 MAT1-2 strain. According to the invention, the T. reesei strain is any female sterile strain, such as strain QM6a or a strain derived from strain QM6a. Thus, in one embodiment of the invention, the first T. reesei strain is QM6a MAT1-1 or a derived strain, and the second T. reesei strain is QM6a MAT1-2 or a derived strain. In another embodiment of the invention, the first T. reesei strain is QM6a MAT1-2 or a derived strain, and the second T. reesei strain is QM6a MAT1-1 or a derived strain. In a preferred embodiment according to the invention, the first T. reesei strain is QM6a MAT1-1 or a derived strain, and the second T. reesei strain is QM6a MAT1-2 or a derived strain. Preferably, strain QM6a MAT1-2 refers to the strain deposited under reference ATCC® 13613. A female sterile MAT1-1 strain (such as QM6a MAT1-1) may be obtained (i) by replacing the MAT1-2 locus with the MAT1-1 locus, (e.g. according to the method described in the article Linke, R. et al. (2015)); (ii) by crossing (for example, a QM6a MAT1-2 strain is crossed with a natural isolate of mating type MAT1-1. Among the resulting offspring, individuals of mating type MAT1-1 that are fertile females can be backcrossed with, for example, the QM6a MAT1-2 strain. This process is repeated at least 7 times. By systematically backcrossing the offspring with the QM6a MAT1-2 parent seven times in a row, a final offspring is obtained that has a genetic identity identical to that of the QM6a MAT1-2 strain except for the mating type, which will be MAT1-1. This is a backcross. The final offspring is of mating type MAT1-1 and is female sterile.An example of backcrossing is given in international application WO2014 / 102241). However, at each stage of these backcrosses, sterile strains MAT1-1 or MAT1-2 can be obtained and used in the process. The term "strain derived from strain QM6a" according to the invention means all strains obtained from the natural isolate QM6a. This includes in particular all industrial strains of T. reesei known to date or all sterile female strains of T. reesei. The term "watering" according to the invention means pouring a solution containing conidia of a first mating type (e.g. 10 to 10 of MAT1-1 conidia) or pouring a solution containing conidia of a second mating type (e.g. 10 to 10 of MAT 1-2 conidia). According to a preferred embodiment of the invention, watering is carried out only with conidia of a first and / or a second mating type (e.g. without adding cell extract). Thus, in a preferred embodiment of the invention, watering is carried out using a suitable solution containing only conidia of a first and / or a second mating type. A suitable solution is understood to be, for example, water such as distilled water or sterile water. According to a preferred embodiment of the invention, the incubation in a suitable medium of said AMAT helper strain is a dark incubation. Darkness limits the production of conidia and promotes access of the female sexual organs by the male sexual organs. According to a preferred embodiment of the invention, the incubation in a suitable medium of said AMAT helper strain lasts at least 4 days, preferably between 4 and 5 days. Incubation for 4 to 5 days makes it possible to optimize the recovery process (example 2i). According to a preferred embodiment of the invention, the conidia of the first strain of T. reesei of a first mating type and / or the conidia of the second strain of T. reesei of a second mating type are present at a concentration of at least 106 conidia / ml, in particular 10 to 10 conidia / ml, and preferably 10 to 10 conidia / ml. A 7 8 concentration of 10 to 10 conidia / ml allows the recovery process to be optimized (see example 2i). The optimal conditions for sequential watering are incubation (or preincubation) of the AMAT helper strain for 4 or 5 days, and a conidia concentration of 10 to 10 conidia / ml (see example 2i). According to a preferred embodiment of the invention, the incubation in a suitable medium of said AMAT helper strain is carried out at room temperature, in particular at 24°C. According to a preferred embodiment of the invention, said method for restoring sexual reproduction between two sterile female strains of T. reesei further comprises, between the first and second watering, a step of incubation in a suitable medium of said helper strain AMAT and conidia of a first strain of T. reesei of a first sexual type. According to a preferred embodiment of the invention, said incubation, in a suitable medium of said helper strain AMAT and conidia of a first strain of T. reesei of a first sexual type, is an incubation in alternating day / night. Preferably, the alternating day / night is an alternation of 12 hours of light and 12 hours of darkness. This is the most favorable condition for sexual reproduction (Seidl, V., et al. (2009)). According to a preferred embodiment of the invention, said incubation, in a suitable medium of said helper strain AMAT and conidia of a first strain of T. reesei of a first mating type, lasts 5 to 7 days, preferably 7 days. According to a preferred embodiment of the invention, said incubation, in a suitable medium of said AMAT helper strain and conidia of a first strain of T. reesei of a first sexual type, is carried out at room temperature, in particular at 24°C. According to a preferred embodiment of the invention, said method for reestablishing sexual reproduction between two sterile female strains of T. reesei further comprises a step of obtaining stromata. According to the invention, the term "stromata" means the macroscopic structures (diameter 3-4mm to 2cm) which result from sexual reproduction. These structures are made up of tissues of maternal origin (the tissues which constitute come from the assistant strain playing the role of female) and are pigmented (brown color) on the surface. According to a preferred embodiment of the invention, said method for restoring sexual reproduction between two sterile female strains of T. reesei further comprises, after the second watering, a step of incubation in an appropriate medium of the helper strain AMAT, conidia of a first strain of T. reesei of a first sexual type and conidia of a second strain of T. reesei of a second sexual type, in particular until the appearance of the stromata, and more particularly until the pigmented stromata are visible to the naked eye. According to a preferred embodiment of the invention, said incubation, in a suitable medium of said AMAT helper strain, of the conidia of a first strain of T. reesei of a first mating type and of the conidia of a second strain of T. reesei of a second mating type, is an incubation in alternating day / night. Preferably, the alternating day / night is an alternation of 12 hours of light and 12 hours of darkness. According to a preferred embodiment of the invention, said incubation, in a suitable medium of said AMAT helper strain, of the conidia of a first strain of T. reesei of a first sexual type and of the conidia of a second strain of T. reesei of a second sexual type, is carried out at room temperature, in particular at 24°C. According to a particularly preferred embodiment of the invention, said method is a method for reestablishing sexual reproduction between two sterile female strains of T. reesei, comprising the following steps: incubation, in particular in the dark, in a suitable medium of an AMAT helper strain, said strain being a fertile female strain of T. reesei in which the MAT mating type locus has been invalidated, a first watering of said assistant strain AMAT with conidia of a first sterile female strain MAT1-1, an incubation step, in particular alternating day / night, of said AMAT helper strain and the conidia of the first sterile female strain MAT1-1, a second watering of said assistant strain AMAT and conidia of the first sterile female strain MAT1-1, with conidia of a second sterile female strain MAT 1-2, an incubation step, in particular alternating day / night, of said AMAT helper strain and the conidia of the first sterile female strain MAT1-1, with conidia of the second sterile female strain MAT1-2, notably until the appearance of the stromata. According to a particularly preferred embodiment of the invention, said method is a method for reestablishing sexual reproduction between two sterile female strains of T. reesei, comprising the following steps: incubation, in particular in the dark, in a suitable medium of an AMAT helper strain, said strain being a fertile female strain of T. reesei in which the MAT mating type locus has been invalidated, a first watering of said AMAT helper strain with conidia of a first strain QM6a MAT1-1 or of a sterile female strain MAT1-1, an incubation step, in particular alternating day / night, of said AMAT helper strain and conidia of the strain QM6a MAT1-1 or of a sterile female strain MAT1-1, a second watering of said AMAT helper strain and conidia of the QM6a MAT1-1 strain, or of a female sterile MAT1-1 strain, with conidia of a second QM6a MAT1-2 strain or of a strain derived from the QM6a MAT1-2 strain or of a female sterile MAT1-2 strain, an incubation step, in particular alternating day / night, of said AMAT helper strain and conidia of the QM6a MAT1-1 strain, or of a sterile female MAT1-1 strain, with conidia of the QM6a MAT1-2 strain or of a strain derived from the QM6a MAT1-2 strain or of a sterile female MAT1-2 strain, in particular until the appearance of the stromata. According to a preferred embodiment of the invention, said restoration method further comprises obtaining a strain of T. reesei. Obtaining this new strain of T. reesei, derived from sterile female T. reesei strains, means that the restoration of sexual reproduction between two sterile female strains of T. reesei has been successfully restored according to the method of the invention. In a second aspect, the invention thus relates to the use of a strain of T. reesei obtained by the above-mentioned method for the production of cellulases or biofuel. The invention will be better illustrated by the following examples and figures. The following examples are intended to clarify the subject matter of the invention and illustrate advantageous embodiments, but in no way are they intended to restrict the scope of the invention. FIGURES Figure 1 represents the principle of sexual reproduction in the filamentous fungus T. reesei. Figure 2 represents sexual reproduction in T. reesei. Panel (A) represents sexual reproduction between two natural isolates (A) and panel (B) represents sexual reproduction between two QM6a strains. Figure 3 represents the principle of the assistant strain method. Figure 4 represents the protocol for implementing the assistant strain method according to the present invention. Figure 5 represents the stromata obtained following the implementation of the helper strain method according to the present invention. Figure 6 represents the final assembly of the invalidation cassette in plasmid pUC19 (plasmid used to obtain the helper strain AMAT according to the present invention). The lines correspond to the primers which are not positioned to scale. The numbers correspond to the primers: 1 = 5'matl-2-F; 2 = 5'matl-2-R; 3 = matl-2 / Hph-F; 4 = matl-2 / Hph-R; 5 = 3'matl-2-F; 6 = 3'matl-2-R; 7 = K7 Del Matl-2-F and 8 = K7-Del-Matl-2-R. Figure 7 shows the position of the primers chosen for the amplification of the different fragments of the invalidation cassette. The number "(1)" represents the "Flank5' + marker" fragment, and the number "(2)" represents the "marker + flank3'" fragment. EXAMPLES Example 1: Materials & Methods The present invention involves three different strains. The three strains that were used in the examples are as follows: The two sterile strains to be crossed: strain QM6a MAT1-1 and strain QM6a MAT1-2. To obtain strain QM6a MAT1-1, the MAT1-2 locus was replaced by the MAT1-1 locus in strain QM6a MAT1-2. Strain QM6a MAT1-2 was obtained from ATCC (reference ATCC® 13631). This is the natural isolate from which all industrial strains originate. The AMAT helper strain is a strain in which the MAT mating type locus has been invalidated. This strain can be constructed according to the protocol indicated below: Construction of the AMAT assistant strain This strain must be constructed from a fertile female strain that can cross with the two sterile strains to be crossed before genetic manipulation. To construct the MAT1-2 knockout cassette, the hygromycin B resistance gene and the 5' and 3' sequences of the MAT1-2 locus were assembled into a pUC19 plasmid (Figure 6) using the Gibson Assembly Kit (New England Biolabs) following the manufacturer's recommendations. The hygromycin B resistance gene was used as a selection marker in the present invention, but another selection marker can also be used. The recipient plasmid pUC19 was previously digested with the enzymes XbaI and EcoRI. The approximately 1000 bp sequences upstream and downstream of the MAT1-2 locus were amplified using primers 5'matl-2-F and 5'matl-2-R for the upstream region and 3'matl-2-F and 3'matl-2-R for the downstream region (Table 1). These primers contain regions of homology allowing recombination with pUC19 on one side and the hygromycin resistance gene on the other. The hygromycin B resistance gene was amplified from plasmid pUTH40 using primers matl-2 / Hph-F and matl-2 / Hph-R. These primers contain regions of homology allowing recombination with the MAT1-2 locus on one side and pUC19 on the other. In a second step, the invalidation cassette was amplified from bacterial DNA using primers K7-Del-Matl-2-F and K7-Del-Matl-2-R. The resulting PCR products were purified using the PCR Purification Kit (Qiagen) and transformed into protoplasts of the fertile wild-type strain B31 using CaCh and polyethylene glycol (PEG). A strain other than B31 could have been used, provided that it was female fertile. The sequence of the plasmid used to transform the B31 strains is represented by SEQ ID NO: 17. Strain B31 (matting type MAT 1-2) is a descendant of T. reesei strain CBS999.97 (ATCC® 204423) (Sexually Competent, Sucrose- and Nitrate-Assimilating Strains of Hypocrea jecorina (Trichoderma reesei) from South American Soils). It is equivalent to strain CBS999.97 MAT1-2 from the article by Seidl et al. (2009). Transformants were stabilized and regenerated on PDA medium containing 0.8 M sucrose and 100 µg / ml hygromycin B. Colonies were then subcultured and purified by conidial isolation on PDA-hygromycin selection medium. They were then subjected to phenotypic screening which consists of crossing B31 transformants with the natural isolate A2 which is of the MAT1-1 mating type and which is compatible with the B31 strain: if the MAT locus has been invalidated, then there will be no sexual reproduction and therefore absence of stromata. PCR amplification then verifies that the native gene has been replaced by the invalidation cassette. This validation is done in two steps. The first consists of verifying the invalidation of the gene by performing a PCR with the primers used to amplify the gene (internal Matl-2-F and internal Matl-2-R) (Error! Reference source not found.7). If the latter is indeed invalidated, no amplification should be obtained. However, in order to verify that this result is indeed a consequence of the absence of the gene and not of a malfunction of the PCR, a pair of control primers (EF1 and EF2) allowing the amplification of an internal fragment of 880 bp of the tefl gene (coding for the translation elongation factor al) present in the genome of all T. reesei strains is also used.In a second step, the amplification of the “5' flank + marker” and “marker + 3' flank” fragments is carried out in order to verify the presence of the invalidation cassette at the locus. The position of the chosen primers is presented in Figure 7. To validate the insertion of the genetic cassette at the site, the primers must be chosen downstream of the 5' flank fragment and upstream of the 3' flank fragment (primers Dmatl-2verif5F associated with verifHygro5' and Dmatl-2verif3R associated with verifHygro3'). The sequences of the primers used in the present invention are shown in Table 1 below. Name of the Primer Sequence (5' -> 3') primers <h2 style=";text-align:left;direction:ltr">5'matl-2-F TGCATGCCTGCAGGTCGACTCTAGACCCTTCCTGACCCTGGACTG (SEQ ID NO: 1) 5'matl-2-R GGTACACTTGGACTGCGTTGACTGATGGTG (SEQ ID NO: 2) matl-2 / Hph-F CAACGCAGTCCAAGTGTACCTGTGCATTCTG (SEQ ID NO: 3) matl-2 / Hph-R CCTTTGCCAAGGCAGTGCTAGTGTGTGTAC (SEQ ID NO: 4) 3'matl-2-F TAGCACTGCCTTGGCAAAGGCTAGACACTAC (SEQ ID NO: 5) 3'matl-2-R TTGTAAAACGACGGCCAGTGAATTCATGTACAATTACCACATGCG (SEQ ID NO: 6) K7-Del-Matl-2-F CCAGGGCTTTGAGAGCAGTA (SEQ ID NO: 7) K7-Del-Matl-2-R CTGGTGGCTGACACTTGCTA (SEQ ID NO: 8) Dmatl-2verif5F GTACTGGTTGTTGGGCTGTG (SEQ ID NO: 9) Dmatl-2verif3R CGGAGCAACTCTCAGGAAAC (SEQ ID NO: 10) verifHygro5' CTCCGTAACACCCAATACGC (SEQ ID NO: 11) verifHygro3' CTCTGGGCAAAGCACCAATC (SEQ ID NO: 12) Matl-2-F interne TTCAGTGTTGGCCATTTTGA (SEQ ID NO: 13) Matl-2-R interne GCTTCTCAAGCAAGGCAAGT (SEQ ID NO: 14) EF1 ATGGGTAAGGAGGACAAGAC (SEQ ID NO : 15) EF2 GGAAGTACCAGTGATCATGTT (SEQ ID NO : 16)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Table 1: Recapitalization of household appliances for reinvalidation and location replacement MAST Plasmid sequence (SEQ ID NO: 17) tgcagcactggggccagatggtaagccctccgtatcgtagttatctacaccgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgt cagaccaagtttatcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatccttttgataatctcatgacaaaatcccttaacgtgagtttcgttccactgagcgtcagacccc gtagaaaagatcaaaggatcttcttgagatccttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaaaccaccgctaccagcggtggttgtttgccggatcaagagctaccaactctttttccgaaggtaactg gcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgccagtggcgat aagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacgggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctaca gcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggacttccagggggaaaacgcctggtatctttata gtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggccttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacg caaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggcttta cactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcttgcatgcctgcaggtcgactctagacccttcctgaccctggactg tccagtggccaccggggcgtggctccagggctttgagagcagtaattggtgggagtttggtagttgacatggctgcgaaaattggtgtccttcagaagttggtcaaggttgattattgaatcagtttgcttcgagtg gtgatgaagaaatccccagagtatgagggtatgggatcagtgggatgttgaaggtgagaataacaggtctgcgaaggggccgccgagtccgtgtggggtcttcttcaggttgctaaggttctactctctgcaag tgaaataaaagtgaaggatcgaggtgaatggacgcttgtgcccatgagttcacctcacttttaactcactctgctgcatctgagaccctgcagaagtaaggcgaaagcttgtcagtgggaaaagacccacggca ccatttaaatgtttacgtatgtggatatccgctaaatacgcctgctgtttgtgttggctcttgccaagatcaatttcagcttctgccagtatttcaagtcaaacgttgtcatgaactacctccatgttgaaattcttcatggatcgtacactgtccgtttggaatctcagatctgaatcgtatgaaataacagaatcgagctttcgcaactagatgtcccagcaacattgcgcccctggaaagtgataaactgcaactgcatttgtgtgaaaccattggc ataagtgattgcgctctctggcggaacggacgaagacatgttgcttgatcttatcctttccatggagatcgtatatattctgatttgatgcaaatggtatgtacataaatgtccttcacgaactttcaggttgttcccaaa gctaaacttcacgcgcatcttgggtgaagtactgcctcgaacgtcatgcacacctggagagcattttgctggtgtgcgaaatgaggatatctccacggtgggcgtattgttacgaagatgcacaccctctggcga tgggcgggtgggactgctagattctagccccaacacttcctttagaaggtacctaggtacgcttgcaaggttccttaggaggtagcttgtcgttggcaagcagaaatacatattacctagtagtacctaggtttcta ccttaccttcttacatatcagtagtacctagtcatttttccccaaggagggagggtgagaaaagagagataggtggggagcgcgcactgacctggcgctaaataacggaggggctgggggggcactattcag attcactcgctttgggttggcagctctcatcaataaaggccagtaagttgaatcaccacggcacgttccggctcacttgtagctcaccctccacccacagccttttcaattcttcaaagcattacctaggcgaccga aaacttcctacctctcaagttcctcctatcttccaactcctgcatcaacgttcatatcccatcttctcgcgatatattaccagagcaagcccgcaccatcagtcaacgcagtccaagtgtacctgtgcattctgggtaaacgactcataggagagttgtaaaaaagtttcggccggcgtattgggtgttacggagcattcactaggcaaccatgcatccttactattgtataccatcttagtaggaatgatttcgaggtttatacctacgatgaatgt gtgtcctgtaggcttgagagttcaaggaagaaacatgcaattatctttgcgaacccagggctggtgacggaattttcatagtcaagctatcagagtaaagaagaggagcatgtcaaagtacaattagagacaaat atatagtcgcgtggagccaagagcggattcctcagtctcgtaggtctcttgacgaccgttgatctgcttgatctcgtctcccgaaaatgaaaatagctctgctaagctattcttctcttcgccggagcctgaaggcgt tactaggttgcagtcaatgcattaatgcattgcagatgagctgtatctggaagaggtaaacccgaaaacgcgttttattcttgttgacatggagctattaaatcactagaaggcactctttgctgcttggacaaatgaa cgtatcttatcgagatcctgaacaccatttgtctcaactccggctagcgaattctcgactcattcctttgccctcggacgagtgctggggcgtcggtttccactatcggcgagtacttctacacagccatcggtccag acggccgcgcttctgcgggcgatttgtgtacgcccgacagtcccggctccggatcggacgattgcgtcgcatcgaccctgcgcccaagctgcatcatcgaaattgccgtcaaccaagctctgatagagttggt caagaccaatgcggagcatatacgcccggagtcgtggcgatcctgcaagctccggatgcctccgctcgaagtagcgcgtctgctgctccatacaagccaaccacggcctccagaagaagatgttggcgacctcgtattgggaatccccgaacatcgcctcgctccagtcaatgaccgctgttatgcggccattgtccgtcaggacattgttggagccgaaatccgcgtgcacgaggtgccggacttcggggcagtcctcggccc aaagcatcagctcatcgagagcctgcgcgacggacgcactgacggtgtcgtccatcacagtttgccagtgatacacatggggatcagcaatcgcgcatatgaaatcacgccatgtagtgtattgaccgattcct tgcggtccgaatgggccgaacccgctcgtctggctaagatcggccgcagcgatcgcatccatagcctccgcgaccggttgtagaacagcgggcagttcggtttcaggcaggtcttgcaacgtgacaccctgt gcacggcgggagatgcaataggtcaggctctcgtaaactccccaatgtcaagcacttccggaatcgggagcgcggccgatgcaaagtgccgataaaacataacgatctttgtagaaaccatcggcgcagct atttacccgcagcatatccacgccctcctacatcgaaggctgaaagcacgagattcttcgccctccgagagctgcatcaggtcggagacgctgtcgaacttttcgatcagaaacttctcgacagacgtcgcgg tgagttcaggctttttcatgatggccctcctaccggtgatctcagctgtaggaagaagaagagaagagaagagaattagtagtcgacatggtggccctcctatagtgagtcgtattatactatgccgatatactatgccgatgattaat tgtcaacactaggcgccggtcacaactaggatatagacttaccttacgtgttgagaggcggcatgcgataagaggtgtaattacctgagaacatcttgttgccctgctttccgtgcgaaatactaccggtactttgggaa acaagggaacaggaggcgctgctgtgcgcggttctgagtgttcaggattgaagctgagaaggtgctgagaagcgtagaactgttgcggacgcgagttctgagaagagctgtaccgattggtgaaagcc gaaagtgagttggtgccctgttgcctggataatgtttgcaactcgctggttctgcagagacggagacaaatgctggctacgatgtgtgctgattcaggttgatacctcggtcgagacactgtttggtttgatagggtggatttggttgcagagaagagaaaggaaggtcaaagagggaaaactgggcggagggaaggattttgtatcaggcagcaaactgccactgcagtggccctggcagtgccgggcgaggcacccacgca cggccgcgcaaccggttggtccttgcccaccacgaaacccttctgaaaggtcagatggaagtgtgcgacagtgcgcgtccccaagccaatgcaggcgccatgcactccccacccgcaagattcactgtgcg ttcttattggttgccgcaaggccagccaaagggggaagtatgagtcacagcaccgatacaagaaaattgcagaactaacatatggatgcgcgcgctattctgtagagctctgggcaaagcaccaatcctgcgg gtcggtacacacactagcactgccttggcaaaggctagacactacggaaatctcgcttcggtccttatagattctgtgagatattgtcgcttgtgccaatggtaaggccgaaatgatgcttttaatggaacagctca tctaacaggccacagatgatttcatagctaggctgaatgcctcgggcagtttcgggcatggtacaaacagagtaccacgtccctaaaacaggcggaactttcaccgctcagtttcctcgacagctttcagaggttt gtaagtgcaccttgctatctatttctctggacggcacagtaactgatcattgttacatgaacagtagttcttgccttggtggacgaggaaacagaccacttcataggaaatctttttggaacgacctgcagagatgtg caactacacaccgagttacccagactacaagttcagggccatggagccttgggcggagactacctaatatcagagagcaagctgtggctgcctctacaccgggtcaagcattggaatcaggctgtgtttttcaagatagcgagagctttggttgtaatagggttccatcagcatactatgccgattgcctagtaggcactcataaccgtggcaaccaagccggacacaggtccttctagatcacagttccatattcttcgagatgataaat taaagtcaaatgctaccatctacaacctccaatctgcaactttgcttctctttcacactagacctctcgcctcccgtcactctgccaatgatgaacactagcatctcgtatatcgtgaaaggtttagctaccctcaaact tgagttgtggagatcaactgatctcgttcggactacattgcggcgacaacttgaattggacacgataaggaaaaggccaaactttgtgaggtgctgagggcagtaagcacgacagtctaaagagaaagaaatg ccgcgttcactacagccatttgaggtctaacaacaagctgattcaactgcaacaggcgctatgtcaagaaggtgatccgttccaatcgctgctccaaatgaaagtaccgcaccgccactcagagcctcgttcttt ctcgccggagggacctagcggccgggcgcagatatagaacgaccttcctgttagcaagtgtcagccaccagctggtctgcgcatgtggtaattgtacatgaattcactggccgtcgttttacaacgtcgtgact gggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgcc tgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggt taatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaa taatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgca cgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggca agagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacac tgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgag cgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcat________________________________________________________________ Table 2: Sequence of the plasmid used to transform the B31 strains Following these phenotypic and molecular verifications, the helper strain B31::AMAT-hph was obtained. This is an AMAT helper strain (a T. reesei strain in which the MAT mating type locus has been invalidated) according to the present invention. Example 2: Comparative examples with different processes aimed at restoring sexual reproduction between two industrial QM6a strains of T. reesei All tests were carried out in Petri dishes containing PDA medium. This is the most optimal environment for sexual reproduction of T. reesei. a / Method 1: making a tricaryon This is the same method as that described in P. anserina (Jamet-Vierny, C., Debuchy, R., Prigent, M. & Silar, P. (2007). IDC1, a pezizomycotina-specific gene that belongs to the PaMpkl MAP kinase transduction cascade of the filamentous fungus Podospora anserina. Fungal genetics and biology: FG & B 44, 1219-1230). To obtain a tricaryon, the strains were incubated separately for a maximum of two days at 30°C to avoid the formation of conidia and to obtain only mycelium. After two days of growth, a 0.5 cm by 0.5 cm agar implant of each of the strains involved (three for a tricaryon) was cut out and placed in an Eppendorf tube of 2 ml containing 500 pL of sterile water. The mycelia were mixed using a FastPrep®-24 (MP Biomedicals) for 20 seconds at a speed of 4 m / s, and 10 pL of the homogenate was deposited on the Petri dishes. The dishes were incubated in an incubator at 24°C with an alternation of 12 hours of light and 12 hours of darkness. The experiment was carried out a first time in triplicate. No stromata were obtained. The dishes were kept in the incubator until the medium dried, approximately 1 month. Since obtaining a tricaryon is a rare event, the experiment was repeated and 10 different Petri dishes were inoculated. No stromata were obtained. b / Method 2: making a tricaryon This method is identical to method 1 but differs in its incubation. Here, the Petri dishes are not placed in an incubator where it is 24°C and where there are 12 hours of light and 12 hours of darkness, but are left on the laboratory bench where the temperature is not constant (daily variation) and where there is no control of the brightness (natural brightness). The mixture of the three strains was inoculated on 10 different Petri dishes. No stromata were obtained. d Method 3: comparison of the three strains The three strains were inoculated onto a Petri dish at equal distance from each other and at maximum distance from the center of the Petri dish. The dish was incubated at 24°C with a day / night cycle (12 hours of light and 12 hours of darkness). No stromata were obtained. d! Method 4: Mix the three strains in the center of a Petri dish The three strains were inoculated individually on a cellophane sheet placed on a Petri dish. After 2-3 days of growth in the dark, the mycelia were collected, ground using beads in a Fastprep®, mixed in a 1:1:1 ratio and then placed in the center of a Petri dish with different concentrations (1, 1 / 10, 1 / 100, 1 / 1000). No stromata were obtained. e! Method 5: Isolated inoculation of the three strains The three strains were inoculated individually on a cellophane sheet placed on a Petri dish. After 2-3 days of growth in the dark, the mycelia were collected, ground using beads in a Fastprep, then mixed in a 1:1:1 ratio. This mixture was inoculated into PD (Potatoes Dextose Broth) liquid medium supplemented with 1% KH2PO3 and incubated (with or without shaking) for one to two days and then placed in the center of a Petri dish with different concentrations (1, 1 / 10), with or without the addition of 5mM ascorbic acid. No stromata were obtained. f / Method 6: inoculation of the three strains The three strains were inoculated together from conidia in PD (Potatoes Dextose Broth) liquid medium supplemented with 1% KH2PO3, and incubated (with or without shaking) for 1 to 2 days and then placed in the center of a PDA dish with different concentrations (1, 1 / 10), with or without the addition of 5 mM ascorbic acid. No stromata were obtained. g! Method 7: Isolated inoculation of the three strains The three strains were inoculated individually onto a cellophane sheet placed on a Petri dish. After 2-3 days of growth in the dark, the mycelia were collected, ground using beads in a Fastprep, and then mixed with a ratio of 1:1:1 (QM6a 1-1: QM6a 1-2: AMAT), or 1:1:2 or 1:1:5. The mixture was (i) either spread over the entire dish, (ii) or inoculated in the center of the dish with different dilutions (1, 1 / 10 and 1 / 100) on PDA medium, with or without the addition of 5 mM ascorbic acid. The dishes were then incubated at 24°C, (i) either alternating day / night, (ii) or for overnight incubation in the dark followed by alternating day / night, (iii) either in the dark for three days followed by alternating day / night, (iv) or in the dark for 15 days followed by alternating day / night. No stromata were obtained. h / Method 8: Sequential watering with addition of cell extracts Fertile wild isolates of T. reesei strains were placed in confrontation on a cellophane sheet placed on PDA. The biological material of these crosses was recovered from T=0 to T=96h after inoculation and subjected to protein extraction. The protein extracts were sterilized by filtration. Finally, the watering method was applied and the different cell extracts obtained were added to the conidia. A first watering with MAT1-1 conidia, then a second watering with MAT1-2 conidia (or vice versa) was carried out. No stromata were obtained. U Method 9: sequential watering according to the invention Obtaining conidia: Four to six days before watering, Petri dishes are inoculated with each of the conidial donor strains (MAT1-1 then MAT 1-2) which will be used for watering the assistant strain, and incubated at 30°C in the light so that conidia are produced. On the day of irrigation, 4 ml of sterile water is placed on the donor strain (MAT1-1 or MAT1-2) and the conidia are harvested. The conidia are counted and their concentration is adjusted between 106 and 108 conidia / ml. Watering: In the watering technique, the AMAT helper strain has the function of female strain which will provide the maternal tissues necessary for the production of stromata. The helper strain will be successively watered by the MAT1-1 then MAT1-2 conidia. The AMAT helper strain is watered evenly with 1 ml of conidia of the first mating type, then incubated for 7 days, watered with 1 ml of conidia of the second mating type and incubated until stromata are obtained. The helper strain AMAT was cultured on PDA medium and incubated at 24°C for 4 days in the dark. After 4 days of incubation, the helper strain was watered with 1 mL of MAT1-1 mating-type conidia and incubated at 24°C for 7 days with alternating 12 h of light and 12 h of darkness. Finally, the helper strain was watered with 1 mL of MAT1-2 conidia and incubated at 24°C with an alternation of 12 h of light and 12 h of darkness until stromata appeared. This method allowed the production of stromata. Six different experiments (exp 1 to exp 6) were carried out. These differed in the pre-incubation time (4, 5 or 6 days) and in the number of conidia that were watered. The results are presented in Table 3 below. 1 Watering Exp 1 = preincubation 4 days Exp 2 = preincubation 5 days Exp 3 = preincubation 6 days Exp 4 = preincubation 4 days Exp 5 = preincubation 5 days Exp 6 = preincubation 6 days | 106 1 3 1 0 0 0 । 11)7 53 46 37 1 î Many pigmented J structures* 0 1 61 28 1 0 Table 3: Total number of stromata obtained with the 6 boxes *: Many pigmented structures that resemble stromata, but are very small (about 2mm) have been obtained. There are so many of them that they are stuck together. 5 to each other, which makes counting them difficult. The sequential watering technique allows for the repetitive production of stromata. The optimal conditions for producing stromata are as follows: Pre-incubation of the helper strain: 4 or 5 days; 7 8 10 - Concentration of conidia: 10 and 10 conidia / ml. Example 3: Different sequential watering conditions according to the invention In this example, and as shown in Table 4, the assistant strain was watered by: 15 - A strain of mating type MAT1-1 then the same strain of mating type MAT1-2, or A strain of mating type MAT1-2 then the same strain of mating type MAT1-1, or Water at each watering (negative control). Watering 1 Watering 2 Assistant strain AAI Al' MAT 1-1 MAT 1-2 Assistant strain AMAT MAT 1-2 MAT 1-1 Assistant strain AMAT H2O H2O Table 4: Summary of the different conditions tested Between watering 1 and watering 2, there is an incubation for 7 days at 24°C with an alternation of 12 hours of light and 12 hours of darkness. The results are presented in Table 5 below. Watering 1 Watering 2 Number of stromata obtained on 2 boxes MAT1-1 MAT 1-2 40 MAT 1-2 MAT 1-1 12 H2O H2O 0 Table 5: Total number of stromata obtained with the 2 boxes A first watering with a strain of mating type MAT1-1 thus promotes the production of a large number of stromata, in comparison with a first watering with a strain of mating type MAT1-2. References: Jamet-Viemy, C., Debuchy, R., Prigent, M., and Silar, P. (2007). IDC1, a pezizomycotina-specific gene that belongs to the PaMpkl MAP kinase transduction cascade of the filamentous fungus Podospora anserina. Fungal genetics and biology: FG & B 44, 1219-1230. Kubicek, C., Linke, R., Seiboth, B., Haarmann, T. and Lorenz, P. (2014). Genes / Genetic Elements Associated With Mating Impariment In Trichoderma reesei QM6a And Its Derivatives And Process For Their Identification (WO2014 / 102241). Linke, R., Thallinger, G.G., Haarmann, T., Eidner, J., Schreiter, M., Lorenz, P., Seiboth, B., and Kubicek, C.P. (2015). Restoration of female fertility in Trichoderma reesei QM6a provides the basis for inbreeding in this industrial cellulase producing fungus. Biotechnology for biofuels 8, 155. Seidl, V., Seibel, C., Kubicek, C.P., and Schmoll, M. (2009). Sexual development in the industrial workhorse Trichoderma reesei. Proceedings of the National Academy of Sciences of the United States of America 106, 13909-13914. Silar, P. (2014). Simple Genetic Tools to study fruiting body development in Fungi. The Open Mycology Journal, 8, 148-155); Jamet-Viemy, C., Debuchy, R., Prigent, M. & Silar, P. (2007). IDC1, a pezizomycotina-spécifie gene that belongs to the PaMpkl MAP kinase transduction cascade of the filamentous fungus Podospora anserina. Fungal genetics and biology : FG &B 44, 1219-1230

Claims

CLAIMS 1. Method for reestablishing sexual reproduction between two sterile female strains of Trichoderma reesei comprising the following steps: 5 - a) incubation in a suitable medium of an AMAT helper strain, said strain being a female fertile strain of Trichoderma reesei in which the MAT mating type locus has been invalidated, - b) a first watering of said AMAT assistant strain with conidia of a first strain of Trichoderma reesei of a first sexual type, 10 - c) a second watering of said assistant strain AMAT from step b) with conidia of a second strain of Trichoderma reesei of a second mating type.

2. A method of restoring sexual reproduction between two sterile female strains of Trichoderma reesei according to claim 1, wherein the first mating type of the first strain of Trichoderma reesei is MA Tl-1 or Mi Tl-2, in particular MA Tl-1.

3. A method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei according to claim 1, wherein the second sexual type of the second strain of Trichoderma reesei is MATl-1 or MATl-2, in particular MA Tl-2. 20 4. A method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei according to one of the preceding claims, wherein the strain of Trichoderma reesei is the strain QM6a or a strain derived from the strain QM6a. 25 5, Process for restoring sexual reproduction between two female strains sterile strains of Trichoderma reesei according to one of the preceding claims, wherein step a) of incubation in a suitable medium of said AMAT helper strain lasts at least 4 days, preferably between 4 and 5 days. 30 6. Process for restoring sexual reproduction between two female strains sterile strains of Trichoderma reesei according to one of the preceding claims, wherein the conidia of the first strain of Trichoderma reesei of a first mating type and / or the conidia of the second strain of Trichoderma reesei of a second mating type are present at a concentration of at least 10° conidia / ml, in particular from 10° to 108 conidia / ml, and preferably from 10'' to 108 conidia / ml.

7. Method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei according to one of the preceding claims, further comprising, between the first and second watering, a step of incubation in a suitable medium of said assistant strain AMA T' resulting from step b).

8. Method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei according to one of the preceding claims, further comprising, after the second watering, a step of incubation in a suitable medium of the AMA Tissue helper strain of step c), in particular until the appearance of stromata.

9. A method of restoring sexual reproduction between two sterile female strains of Trichoderma reesei according to one of the preceding claims, further comprising obtaining a strain of Trichoderma reesei.

Images