Composition and method for genome editing

Abstract

The invention relates to a molecular complex comprising: a first single-stranded nucleic acid molecule having at least two transposase binding half-sites, and a second single-stranded nucleic acid molecule having at least one transposase binding half-sites, said complex being such that the first and second single-stranded nucleic acid molecules are paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites for said transposase. The invention further relates to the use of this complex, in particular for DNA editing. Figure for the abstract: Fig. 10

Description

Description Title of the invention: Composition and method for editing genomics

[0001] = The invention relates to a composition and a method for editing genomics.

[0002] — The desire to understand the effects of modifications to the genetic information of living cells dates back to the early days of genetics.

[0003] — First, classical genetics attempted to understand the genetic modifications netics, and the resulting phenotype, by selecting specific genetic sites- finished.

[0004] — Subsequently, biochemists used radiation and mutagenic agents chemicals to increase the likelihood of genetic mutations in organisms experimental. Although very useful, these methods are expensive and do not allow to simply control the modifications introduced into the genetic material.

[0005] — Molecular biology and knowledge of the molecular mechanisms of re- The preparation or defense of cells against host organisms has made it possible to develop numerous technologies, enabling the development of so-called genetics inverse, whose objective is the opposite of so-called classical genetic screening.

[0006] Reverse genetics aims to introduce mutations into the genetic material- netic techniques for the purpose of measuring and analyzing the resulting phenotypic effects.

[0007] Genome editing strategies have evolved over the past three decades, and the most recent innovation and revolution in gene modification targeted corresponds to the CRISPR / CRISPR system associated with protein 9 (Cas9) (CRISPR / Cas-9). Examples include the two patents EP 3,144,390 B1 and US 8,697. 359 B1, which both describe this technology.

[0008] = The CRISPR / Cas-9 system has therefore become established as the reference tool for the genetic modifications. Nevertheless, this CRISPR revolution is similar to molecular scissors, which is not sufficient to allow recombination total of an entire exon.

[0009] = More recently, the transposase encoded by the CRISPR system (Transposon-encoded CRISPR-Cas systems) is a partial answer to the shortcomings of the CRISPR technology. Indeed, this technology uses both targeted integration via the Tn7 transposon and then an addition of sequence to the genome by the CRISPR technology. But in no way is this a recombination.

[0010] — Prine Editing technology is also a possible replacement genetic engineering combining the CRISPR tool with a reverse transcriptase. The latter Evolution in genome editing allows for size-dependent replacement of one of the two DNA strands, which remains a strong inherent limitation dependent on the cellular integration and repair system. Therefore, the invention aims to overcome these drawbacks of the prior art. One of the goals of the invention is to provide a recombination tool enabling genome editing. Another aim of the invention is that this new tool is not dependent on the size of the sequence being manipulated, and that this system is controlled and controllable by the user. Yet another aim of the invention is to provide a tool which allows, at the user's discretion, a single-strand or double-strand replacement of a molecule of interest, and by using the DNA repair system in a controlled and limited manner. The invention relates to a first single-stranded nucleic acid molecule comprising or essentially consisting of a sequence A allowing the insertion of a complementary sequence of a nucleic acid of interest, said sequence A being linked at its 5' end to a first T-rich sequence of 40 to 60 nucleotides in length and at its 3' end to a second T-rich sequence of 40 to 60 nucleotides in length, said first and second T-rich sequences comprising respectively a first and a second GC-rich domain of 6 to 12 nucleotides, the sequence of the first domain being complementary to the sequence of the second domain, said first and second domains being positioned 15 to 52 nucleotides from said sequence A, said first molecule comprising at its 5' end a first 5'-3" oriented transposase recognition sequence and at its 3' end at least one second transposase recognition sequence The invention also relates to a molecular complex comprising: - a first single-stranded nucleic acid molecule comprising or essentially consisting of a sequence A allowing the insertion of a complementary sequence of a nucleic acid of interest, said sequence A being linked at its 5' end to a first A / T-rich, particularly T-rich, sequence of 40 to 60 nucleotides in length and at its 3' end to a second A / T-rich, particularly T-rich, sequence of 40 to 60 nucleotides in length, said first and second A / T-rich, particularly T-rich, sequences comprising respectively a first and a second GC-rich domain of 6 to 12 nucleotides, the sequence of the first domain being complementary to the sequence of the second domain, said first and second domains being positioned 15 to 52 nucleotides from said sequence A, said first molecule comprising at its 5' end a first 5'-3° oriented transposase recognition sequence and at its 3° end at least a second transposase recognition sequence; and - a second single-stranded nucleic acid molecule comprising or essentially consisting at its 5' end of at least one sequence complementary to said second recognition sequence of said transposase, said complex being such that the first and second single-stranded nucleic acid molecules are paired according to the complementarity of bases defined by Watson and Crick so as to define two double-stranded binding sites of said transposase. This means that the invention relates to a molecular complex comprising a first single-stranded nucleic acid molecule and a second single-stranded nucleic acid molecule, said second single-stranded nucleic acid molecule comprising or essentially consisting at its 5' end of at least one sequence complementary to said second recognition sequence of said transposase, said complex being such that the first and second single-stranded nucleic acid molecules are paired according to the complementarity of bases defined by Watson and Crick so as to define two double-stranded binding sites of said transposase. The invention is based on the unexpected observation made by the inventor that the use of specific single-strand guides capable of targeting a region of a nucleic acid of interest makes it possible to mobilize transposases in a controlled and "site-specific" manner, and thus use the recombination properties of said transposases to perform sequence replacement in molecules of interest. The aforementioned molecular complex is, in fact, the basic unit of the technology defined in the invention. This basic unit serves to guide recombinases to a specific site where recombination, and therefore sequence replacement, must take place. Unlike the CRISPR / Cas9 system, which requires the presence of PAM (NGG)-type sequences, the molecular tool defined here can be used on any target sequence, regardless of its specific nature. The aforementioned molecular complex is therefore the basic unit which must be completed by: - a homology region of the target sequence and - a replacement region for the target sequence. This is therefore an intermediate product of the tool as described below. The molecular complex consists of two single-stranded nucleic acid molecules, which can be DNA molecules, RNA molecules, or mixed RNA and DNA molecules. These two molecules are partially complementary to each other, according to the complementarity of nucleic acid bases defined by Watson and Crick, that is to say that an Adenine pairs with a Thymidine or a Uracil, and a Cytosine pairs with a Guanine, and vice versa. More specifically, the two molecules forming the aforementioned complex com- Each molecule takes the sequence of one strand of a double-stranded molecule corresponding to the binding sequence of a transposase. Therefore, each single-stranded molecule contains a "half-sequence" of the transposase and cannot interact with the corresponding transposase. However, when the two molecules of the complex interact through base pairing as defined above, a double-stranded molecule is formed, reconstituting a double-strand binding site for the transposase, which can then interact with the newly formed molecule. The first molecule. The first molecule of the complex is the molecule that, once modified, will contain a nucleic acid sequence specifically targeting a region of interest within a target nucleic acid molecule. This sequence of interest will be chosen by the system user based on the selected target. This sequence will be inserted into the first molecule of the complex at region A. This region A corresponds to at least two nucleic acids, between which the sequence targeting the target molecule will be inserted. Given the oriented structure of nucleic acids (5'-3" direction), it is crucial that the sequence targeting the region of interest is positioned correctly to ensure successful matching with the target sequence. Also, advantageously, region A includes one or more sites recognizing restriction enzymes to promote oriented insertion. Obviously, in the context of a chemical synthesis of the first molecule, it is not necessary to have cloning (or insertion) sites of the sequence to target the target region, but to take care to provide a correctly oriented sequence. The first molecule is further composed, on either side of region A, of A / T-rich sequences, or, in the case of RNA, A / U-rich sequences, to allow for some structural flexibility. In the invention, "A / T-rich" or "A / U-rich" means a sequence comprising more than 50% A, T, or U, preferably more than 50% T or U, relative to the total number of nucleotides constituting the sequence. These sequences on either side of region A have a nucleotide length ranging from 40 to 60 nucleotides. The flexibility of these flanking sequences of the A region, due to the presence of many A, T or U, can have the effect of allowing recombination via recombinases that is too uncontrolled, or even when the complex has not yet recognized the target molecule. Therefore, in order to overcome this problem, GC-rich sequences are introduced into each of the A / T-rich sequences, particularly T-rich or A / U-rich sequences, bordering the region A. These G / C rich regions consist of 6 to 12 nucleotides, of which the amount of C or G is greater than 50% of the nucleotides contained in said G / C rich sequence. To stabilize the structure of the first molecule, and as described above to avoid untimely recombination, the G / C-rich regions are positioned 15 to 52 nucleotides from the end of the A region. For clarity, if region A consists of 3 nucleotides, with the central nucleotide corresponding to position 0, the A / T or A / U rich region will begin on the left at position -2, and on the right at position +2. Therefore, on the left, the G / C rich region will be positioned from position -17 to position -54, and on the right from position +17 to position +54. Another important element is that the G / C-rich sequence to the right (or 5') of the A region is necessarily complementary (according to the Watson-Crick pairing principle) to the G / C-rich region to the right (or 3") of the A region. Also, the first single-stranded molecule pairs with itself at the G / C-rich regions, which prevents any recombination by transposases, as long as there is no interaction with the complementary target sequence of the region that will be inserted into the A region of the first molecule. Finally, the first molecule includes at its 5' end a sequence corresponding to a first binding site for a transposase, and at its 3' end a second binding site for said transposase. The first and second binding sites are advantageously the same, and, more importantly, both correspond to the same strand of the double-stranded binding site of said transposase. This means that the first transposase binding site present in the 5' region of the first molecule cannot fully, and therefore stably, pair with the transposase binding site present in the 3' region. The first and second binding sites are advantageously the same, but each corresponds to a different strand of the double-stranded transposase binding site. Thus, for example, if the first transposase binding site corresponds to the sense strand, the second transposase binding site corresponds to the sequence of the complementary strand. Two configurations are then possible: i) either the second binding site, which corresponds to the complementary strand, is oriented in the 3°-5' direction, in which case it can pair with the first transposase binding site and form the double-stranded site; ii) or the second binding site, which corresponds to the complementary strand, is oriented in the 5'-3° direction, and in this case cannot pair with the first transposase binding sequence, as the sequences are not complementary due to their orientation.In case i) mentioned above, if the first single-stranded molecule self-pairs at the level of the first and . second binding site, it will not be possible to form the aforementioned complex, because there will no longer be a single-stranded complementary region available to pair with the second molecule so as to form two double-strand binding sites to the transposase. Also, the first molecule, when it lacks a complementary sequence to the target region in part A, or when it contains such a target sequence but the latter does not interact (does not pair) with said target sequence, forms a three-dimensional structure where the whole molecule is single-stranded except for the region corresponding to the G / C-rich regions which pair with each other. A schematic linear representation of the first molecule is shown in [Fig.1], and a schematic representation of the paired form is shown in [Fig.2]. The second molecule. The second molecule of the aforementioned complex is simpler than the first. Its 5' end contains a transposase-binding site that complements the transposase-binding site present in the 3' end of the first molecule. Therefore, when the complex is formed, the single-stranded transposase-binding site located at the 3' end of the first molecule could pair with the single-stranded transposase-binding site located at the 5' end of the second molecule to form a double-stranded transposase-binding site, to which the transposase can then bind. In the 3' region of the second molecule, there is a region similar to region A of the first molecule. This region can accommodate a specific sequence, corresponding to the sequence we wish to insert in place of the target molecule of interest. The process of preparing a second molecule to perform this substitution will be described in more detail later. The complex The complex formed by the first molecule and the second molecule is schematically represented in [Fig.3]. The complex is such that when the first and second molecules are paired, via the transposase binding half-sites, the complex is able to bind a transposase dimer, a functional dimer that will allow recombination. Furthermore, either the first or second molecule includes a complementary sequence to the transposase-binding half-site located at the 5' end of the first molecule. This complementary region to the transposase-binding site located at the 5' end of the first molecule can be located at the 5' or 3' end of the first molecule, or even at the 5' end of the second molecule, preferably at the 5' end of the complementary sequence to the transposase-binding site located at the 3' end of the first molecule. molecule. Two options, which are detailed below, are schematically represented in [Fig4]. Advantageously, the invention relates to the aforementioned complex, where said sequence A comprises a complementary sequence of a nucleic acid of interest. As mentioned previously, the A region can contain a complementary sequence of a nucleic acid of interest. More specifically, the sequence contained in the A region of the first molecule of the aforementioned complex is complementary to a 5' or 3' sequence of a sequence of a molecule of interest, such that the complex allows the specific recognition of this region of the nucleic acid molecule, and allows the complex to replace a region adjacent to the complementary region of the sequence contained in the A region. In other words, the invention advantageously relates to the aforementioned complex, said complex comprising: - a first single-stranded nucleic acid molecule comprising or essentially consisting of a sequence A comprising a complementary sequence of a nucleic acid of interest, said complementary sequence being linked at 5' to a first A / T-rich sequence, particularly T-rich, of 40 to 60 nucleotides in length and at 3' to a second A / T-rich sequence, particularly T-rich, of 40 to 60 nucleotides in length, said first and second A / T-rich sequences, particularly T-rich, comprising respectively a first and a second GC-rich domain of 6 to 12 nucleotides, the sequence of the first domain being complementary to the sequence of the second domain, said first and second domains being positioned 15 to 52 nucleotides from said sequence A,said first molecule comprising at its 5' end a first oriented 5'-3' transposase recognition sequence and at its 3' end at least a second transposase recognition sequence; and, - a second single-stranded nucleic acid molecule comprising or essentially consisting at its 5' end of at least one sequence complementary to said second recognition sequence of said transposase, the first and second single-stranded nucleic acid molecules being paired according to the complementarity of bases defined by Watson and Crick so as to define two double-stranded binding sites of said transposase. In an advantageous embodiment, the invention relates to the aforementioned complex, wherein said first molecule comprises at its 5' end a first oriented 5'-3' transposase recognition sequence and at its 3° end a second oriented 5'-3° transposase recognition sequence and where the second molecule comprises at its 5' end a first sequence complementary to said first recognition sequence of said transposase followed by a second sequence complementary to said second recognition sequence of said transposase. In this advantageous embodiment of the complex of the invention, the first molecule comprises a first transposase recognition sequence at the 5' position and a second transposase recognition sequence at the 3' position. The second molecule comprises, at the 5' position, a first sequence complementary to the first transposase recognition sequence of the first molecule, followed by a second sequence complementary to the second transposase recognition sequence of the first molecule. Furthermore, each molecule of the complex comprises two transposase-binding half-sites, such that when the complex is formed—that is, when the first molecule pairs with the second molecule—two adjacent double-stranded transposase-binding sites are reformed, and a transposase dimer can then bind to them. Figure 5 schematically represents this embodiment. Advantageously, the invention relates to the aforementioned complex, wherein said first molecule comprises at its 5' end a first oriented 5'-3° transposase recognition sequence and at its 3' end a second transposase recognition sequence, followed by a first sequence complementary to said first transposase recognition sequence and where the second molecule comprises at its 5' end a sequence complementary to said second recognition sequence of said transposase. In this advantageous embodiment of the complex of the invention, the first molecule comprises a first transposase recognition sequence at position 5° and a second transposase recognition sequence at position 3°, the latter being immediately followed by a first sequence complementary to the transposase recognition sequence located at position 5° of the first molecule. The second molecule comprises, at position 5', a second sequence complementary to the second transposase recognition sequence of the first molecule. Thus, in this embodiment, the first molecule can reform a double-stranded transposase recognition site by pairing the first recognition sequence at the 5' end of the first molecule with the first recognition sequence at the 3' end of the second molecule. The second molecule, in turn, must pair with the first molecule to reconstitute the second double-stranded transposase binding site using the second recognition sequence at the 3' end of the first molecule and the second complementary recognition sequence. of the transposase located at the 5' end of the second molecule. Figure [Fig. 6] schematically represents this embodiment. It is also possible to consider another advantageous embodiment of the complex according to the invention in which the first molecule comprises, at position 5', a first sequence complementary to a first transposase recognition site, followed by another first transposase recognition site. Furthermore, at position 3°, the first molecule comprises a second transposase recognition site. The second molecule remains unchanged from the embodiment described above. Here, the 5° part of the first molecule will fold back on itself so as to reconstitute, by pairing, a double-stranded transposase recognition site using the first recognition site and the immediately adjacent complementary sequence. This embodiment is shown in [Fig.7]. An additional similar embodiment exists where the first molecule includes in 5' the first complementary sequence of the first transposase site followed immediately by the first recognition site of the first transposase. Advantageously, the aforementioned transposase is a bacterial-type transposase chosen from the transposase of transposon Tn5, transposase of transposon Tn9, transposase of transposon Tn10, Tn903, Tn602 or even transposase of transposon Tcl, or more generally from the superfamily of mariner transposons. Other examples of transposases that can be used in the context of the invention are: Vibrio harveyi transposase (transposase characterized by Agilent and used in the SureSelect QXT product), MuA transposase and a Mu transposase recognition site comprising the terminal sequences R1 and R2, Staphylococcus aureus Tn552 transposase, Tn7 transposase, Tn / O and IS10 transposase, and Tn3 transposase. The Tn5 transposase is the best known. It is encoded by the Tnp gene of the Tn5 transposon. The transposase initiates transposition by forming a transposase dimer which binds to its target sequences. In the context of this complex, the transposase then catalyzes four phosphoryl transfer reactions (DNA cleavage, DNA hairpin formation, hairpin resolution and strand transfer into the target DNA) resulting in the integration of the transposon into its new DNA site: this is called tagmentation. The invention is based on the principle of this tagmentation. By using the tagmentation properties of transposases, it is possible to insert one sequence into another in a targeted manner, thanks to the aforementioned complex. Also, within the framework of the invention, when reference is made to a transposase, it is refers to one of the aforementioned transposases, namely the transposases of Tn5, Tn9, Tn10 or Tc1 / mariner transposons (or transposases mutated to increase their transposition or tagmentation activity). In the invention, when several transposases are used simultaneously, one binding to the complex formed by the first molecule and the third molecule, and the other binding to the complex formed by the second molecule and the third molecule, pairs of transposases derived from Tn5 and Tn10 transposons will be preferred. In an advantageous embodiment, the invention relates to a kit comprising a vector enabling the expression of the first molecule of the aforementioned complex, and a vector enabling the expression of the second aforementioned molecule. Within the framework of this kit, the vectors are preferentially circular, double-stranded DNA molecules which possess all the elements enabling their replication in host cells (prokaryotic and / or eukaryotic) and which have elements enabling the expression of the first or second molecule of the aforementioned complex. Assuming that a first and second molecule must be in the form of single-stranded DNA molecules, the sequence of each of these first and second molecules is controlled by a mechanism enabling the synthesis of single-stranded DNA from double-stranded DNA. This is the case, for example, with the origin of replication sequence of bacteriophage f1 contained in phagemid-type vectors. In the presence of an M13 helper phase, which carries all the genes necessary for the activation of the f1 sequence, the vector will therefore produce single-stranded DNA from the double-stranded plasmid DNA. The kit can therefore contain either two independent vectors, each containing the sequence of one or the other of the first and second molecules forming the aforementioned complex, or a single vector comprising both sequences, but genetically isolated from each other. The aforementioned kit may also contain other elements such as a transposase enabling transposition. Advantageously, the aforementioned complex is such that the first and second transposase recognition sequences are Tn5 transposase recognition sequences having one of the following sequences: - CTG(CTCTTataCAcA(cT (SEQ ID NO: 1), - CTGACTCTTataCACAagT (SEQ ID NO: 2), and - CTGt(CTCTTgatCAgATCT (SEQ ID NO: 3). Consequently, the corresponding complementary sequences are as follows: - AgaTgTGtatAAGAGaCAG (SEQ ID NO: 4), - ActTGTGtatAAGAGTCAG (SEQ ID NO: 5), and - AGATeTGatcAAGAGaCAG (SEQ ID NO: 6). Advantageously, the first G / C-rich domain of the first molecule corresponds to the following sequence: GGCGATCGC, so that the second G / C-rich domain, which is complementary, corresponds to the following sequence: GCGATCGCC In an advantageous embodiment, the A / T-rich sequences of the first molecule of said complex are essentially made up of, or made up of, A or T. Even more advantageously, the A / T-rich sequence of the first molecule of said complex consists of T. Even more advantageously, the aforementioned complex is such that it comprises the following sequence corresponding to the first molecule: S'-TGCAGCTGCTGTCTCTTATACACATCTTTTITTITITITITTTITIT TTTGGCGATCGCTTTTTTTTTTTITTTTTTTTXTTTTTTTTTTTTTTTTTTGC GATCGCCTTTTTTTTTTITTTTTTGATACATGTTTAGATGTGTATAAGAGACÇA GCTGTAAGC-3' (SEQ ID NO: 7), where X represents no nucleotides, two nucleotides, or at least one restriction site. The first transposase binding site is shown in a box and the second transposase binding site is shown underlined. Even more advantageously, the aforementioned complex is such that it comprises the following sequence corresponding to the second molecule: S'-AGATOIGTATAAGAGAÇAGCAGCTGCAGACAAAGCTTACAGCTGTCTC TTATACACATCTTTTITTTTTTTITTTTTTTTTTTcatatgccaagtY-3' (SEQ ID NO: 8) where Y represents no nucleotides, two nucleotides, or at least one restriction site. The first transposase binding site is shown in a box and the second transposase binding site is shown underlined. Advantageously, the aforementioned complex is such that it comprises the following sequence corresponding to the first molecule: S'-ATCATCCTGTCTCTTATACACATCTTTITITTITITTTTTTTGATAGTAGC IGTCTCTTATAÇACÇATCTTTTTTTTTTTTTTTTTTTTTTTGGCGATCGCTTTTT TTTITTITTTTXTTTTTTTTTTTTTTTTGCGATCGCCTTTTTTTTTTTTTGATAC ATTTAGATGTGTATAAGAGACAGGATGAT-3' (SEQ ID NO: 9) where X represents no nucleotides, two nucleotides, or at least one restriction site. The complementary sequence of the first transposase binding site is shown in a box, and the second transposase binding site is shown underlined. The first transposase binding site is highlighted in italics. In this embodiment, the aforementioned complex is such that it comprises the following sequence corresponding to the second molecule: S'-YacttggrTAATTAATTTTITTITITTTITTITITTTTTGATGTGTATAAGAGAC AGCTACTATC-3' (SEQ ID NO: 10) where Ÿ represents no nucleotide, two nucleotides or at least one restriction site. The complementary sequence of the second transposase binding site is shown underlined. In another aspect, the invention relates to an assembly comprising - a first single-stranded nucleic acid molecule comprising or consisting essentially of a sequence A allowing the insertion of a complementary sequence of a nucleic acid of interest, or comprising a complementary sequence of a nucleic acid of interest, said complementary sequence being linked at 5' to a first A / T-rich sequence, particularly T-rich, of 40 to 60 nucleotides in length and at 3' to a second A / T-rich sequence, particularly T-rich, of 40 to 60 nucleotides in length, said first and second A / T-rich sequences, particularly T-rich, comprising respectively a first and a second GC-rich domain of 6 to 12 nucleotides, the sequence of the first domain being complementary to the sequence of the second domain, said first and second domains being positioned 15 to 52 nucleotides from said sequence A,said first molecule comprising at its 5' end at least a first 5'-3' oriented transposase recognition sequence and at its 3' end a second transposase recognition sequence, - a second single-stranded nucleic acid molecule comprising or consisting essentially of a B sequence allowing the insertion of a complementary sequence of a nucleic acid of interest, or comprising a complementary sequence of a nucleic acid of interest, said complementary B sequence being linked at 5' to a third T-rich sequence of 40 to 60 nucleotides in length and at 3' to a fourth T-rich sequence of 40 to 60 nucleotides in length, said third and fourth T-rich sequences comprising respectively a third and fourth GC-rich domain of 6 to 12 nucleotides, the sequence of the third domain being complementary to the sequence of the fourth domain, said third and fourth domains being positioned 15 to 52 nucleotides from said B sequence,said second molecule comprising at its 5' end at least the first oriented 5'-3° sequence for recognition of said transposase and at its 3° end the second sequence for recognition of said transposase, said sequence B being a complementary sequence of said nucleic acid of interest, sequence A being positioned at 5° of a region of interest of said nucleic acid of interest and sequence B positioned at 3' of the region of interest of said nucleic acid of interest, and - a third single-stranded molecule comprising in its part 5', at least one complementary sequence of said second recognition sequence of said transposase (of the first molecule), in its part 3” at least one complementary sequence to said first recognition sequence of said transposase (of the second molecule), and - a region located between the complementary sequence of said second recognition sequence of said transposase (of the first molecule) and the complementary sequence of said first recognition sequence of said transposase (of the second molecule) allowing the insertion of a replacement nucleic acid molecule (single strand), the first and third single-stranded nucleic acid molecules being paired according to the complementarity of bases defined by Watson and Crick so as to define two double-stranded binding sites of said transposase and the second and third single-stranded nucleic acid molecules being paired according to the complementarity of bases defined by Watson and Crick so as to define two double-stranded binding sites of said transposase. The aforementioned assembly therefore includes the molecular complex described above. Consequently, all embodiments and technical details described above for the molecular complex apply mutatis mutandis to the aforementioned assembly. In this aspect of the invention, a set of three molecules is described that allows for the precise replacement of a sequence contained in a nucleic acid of interest by a chosen sequence. The assembly according to the invention is based on the above-described complex, the latter being supplemented by a third molecule similar to the first molecule. Figure 8 schematically illustrates the assembly according to the invention. The first molecule of the complex corresponds to the first molecule of the set, the second molecule of the complex corresponds to the third molecule of the set, and the third molecule of the set is added and is structurally similar to the first molecule of the set or complex. The assembly according to the invention, when the three molecules are correctly paired, comprises two pairs of double-strand binding sites for transposase recognition: - the first pair being obtained by hybridizing the first molecule with the third molecule, and - the second pair being obtained by hybridizing the second molecule with the third molecule. The sequence A contained in the first molecule of the set is complementary to the same strand of nucleic acid that is complementary to the sequence B contained in the second molecule. In other words, the sequence A contained in the first molecule and the sequence B contained in the second molecule are capable of hybridizing to the same nucleic acid simultaneously, because the two sequences A and B do not recognize the same sequence. To further clarify, the advantage of the assembly defined in the present invention is that it provides a first molecule and a second molecule, both as defined above, with their respective sequences A and B being such that they are capable of recognizing, for the first, a sequence located at the 5' end of the target sequence of the nucleic acid of interest, and for the second, a sequence located at the 3' end of the same target sequence of the nucleic acid of interest. Sequences A and B are therefore complementary to regions bordering the sequence of interest, which we wish to replace, in the nucleic acid molecule of interest. The first and second molecules of interest are therefore essential to specifically target the molecule of interest, in order to frame the sequence to be replaced. The third molecule in the set, meanwhile, is the one that provides the nucleic acid molecule that contains the replacement sequence. From a mechanistic point of view, the assembly according to the invention is such that it consists of its three molecules, the first and second molecules being structurally organized in space so that their G / C rich regions are paired. On either side of the third molecule, that is to say in 5' and in 3', due to hybridization with the first and second molecules, two pairs of transposase binding sites allow, when present, transposase dimers to bind to the whole. It should be noted that the transposase binding sites of the first molecule may be the same as those of the second molecule, or they may be different. If the binding sequences are the same, the transposase dimers at the 5' end of the third molecule (by hybridization of the 5' end of the third molecule with the first molecule) and at the 3' end of the third molecule (by hybridization of the 3' end of the third molecule with the second molecule) will be identical. Therefore, for example, if all the binding sites are Tn5 transposase binding sites, the entire molecule will be associated with two Tn5 transposase dimers. It is also possible that the binding sites of the first and second molecules do not recognize the same transposase. In this case, and according to the definition of the set given above, part 5° of the third molecule will form by hybridization with the first molecule two double-strand binding sites to a first transposase, and part 3° of the third molecule will form by hybridization with the second molecule two double-strand binding sites to a second transposase. If the aforementioned complex, bound to two transposase dimers, is now brought into contact with a nucleic acid molecule of interest whose 5' region is complementary to sequence A of the first molecule in the complex and whose 3' region is complementary to sequence B of the second molecule in the complex, then pairing will occur between the nucleic acid molecule of interest and the complex at the A and B regions described above. This interaction will break the interaction between the two G / C-rich sequences of each of the first and second molecules in the complex.From then on, the third molecule and the nucleic acid molecule of interest will be brought closer together spatially and the transposases will be able to exert their tagmentation activity, the result of which will be the replacement of the sequence of the molecule of interest, bordered by the complementary sequences of sequences A and B, by the sequence of the third molecule of the set, which is located between the half-sites of binding to the transposases in 5° and in 3°. . In the invention, the first, second and third molecules of the assembly are advantageously molecules made up of deoxyribonucleotides, in order to form single-stranded DNA molecules. Even more advantageously, the first, second, and third molecules of the assembly are DNA / RNA hybrid molecules, where the "backbone" of the molecules is DNA, and the recognition sequences A and B of the nucleic acid molecule of interest, and the central region of the third molecule, are RNA. This is particularly advantageous when the sequence replacement enabled by the invention must be performed directly on an RNA molecule. Figure [Fig.9]-A illustrates the interaction between the molecule of interest and the assembly according to the invention. In one particular aspect of the invention, the first molecule of the assembly may contain, in its 5' portion, more precisely between the first transposase binding site and region A, one or more modified nucleotides. Similarly, the third molecule of the assembly may contain, in its 3° portion, more precisely between the first transposase binding site and region 3, one or more modified nucleotides. This modified nucleotide is notably modified by grafting a substituted carbon chain with a protein tag, or a molecule allowing a specific interaction such as streptavidin or biotin. Such modifications then make it possible to link specifically to the first This molecule is one of the enzymes that can be used to promote tagmentation and sequence replacement. It will be particularly advantageous to have, for example, a steptavidin graft, which will allow the grafting of a biotinylated helicase (or conversely, a helicase grafted to steptavidin and a biotinylated nucleotide) used to open a double-stranded molecule. It is also possible to consider grafting with a biotinylated ligase (or one coupled to steptavidin) to link the recombinant strand at the 3° end. It is also possible to associate an oligonucleotide with the first or second molecule of the assembly, so that said oligonucleotide will bind to a predetermined region of said first or second molecule. This oligonucleotide is then advantageously coupled to a grafting molecule as explained above. The above-described set is suitable for single-strand sequence replacement, such as replacing a sequence on a single-stranded DNA molecule or RNA. To replace the two strands of a double-stranded molecule, it will then be useful to use two of the aforementioned sets, these two sets being such that - the first set includes the first, second and third molecules as defined above, - the second set comprises a fourth, a fifth and a sixth sequence, so that: - the third and sixth sequences each include a strand of the replacement sequence, these sequences being complementary according to the Watson and Crick matching; - the first and fourth sequences comprise, in region A and region A° (region A' being the equivalent of the fourth molecule of region A of the first molecule) a sequence recognizing the 5' part of the region to be replaced and the 3' part of the complementary strand of the region to be replaced, respectively, and - the second and fifth sequences comprise, in region B and region B° (region B° being the equivalent of the fifth molecule of region B of the second molecule) a sequence recognizing the 3' part of the region to be replaced and the 5' part of the complementary strand of the region to be replaced, respectively, This double complex or double set is then represented in [Fig.10] -A. In yet another aspect, the invention relates to a kit, or a kit, comprising at least one vector enabling the expression of a recombinase and the first, second and third molecules of the set as defined above. The kit consists of either one container containing all 3 molecules of the set, or several separate containers. The transposase contained in the aforementioned kit is a transposase capable of recognizing the binding sites formed by the interaction between the first molecule and the third molecule of the complex, and / or the second molecule and the third molecule of the complex. Assuming the complex contains two binding sites for two different transposases, the kit will then include two different vectors, each encoding one of the transposases. The kit may also contain, as discussed above, other enzymes, such as a helicase or a ligase. The kit according to the invention advantageously comprises what is needed to form two sets as defined above. The invention also relates to the use of the assembly as defined above for nucleic acid engineering, in particular for substituting a target sequence with a sequence of interest. The aforementioned use is specifically subject to the condition that it does not include a method for modifying the germline genetic identity of human beings and / or that said use is not a method for treating the human or animal body by surgery or therapy. As explained above, the aforementioned set allows for the specific targeting of a target region and its replacement with a sequence of interest, using the tagmentation properties of transposases. The assembly according to the invention is particularly advantageous in carrying out targeted gene modifications (and in particular gene replacements, or replacements of non-coding sequences) in different living organisms, for example in plants to obtain transgenic plants, or in animals to create models of human diseases, or living therapeutic tools, allowing the testing of drugs provided that it is not a process for the modification of the germline genetic identity of human beings and that it is not a method for the treatment of the human or animal body by surgery or therapy. Furthermore, the invention relates to the aforementioned assembly, for its use as a medicinal product, more particularly as a gene therapy medicinal product, notably for treating or preventing a disease related to a modification of a nucleic acid. Since the aforementioned set allows for specific sequence substitution, it is possible to design first and second molecules that specifically recognize a mutated gene, through a modification such as a substitution, deletion, or insertion, and to design a third molecule comprising the wild-type reference sequence of said mutated gene. Also, in the presence of the appropriate transposase, it will be possible to replace the sequence of the mutated gene with the wild-type sequence, and thus treat an individual suffering from a disease whose cause is the mutation of said gene. The invention also relates to the use of the aforementioned complex for the manufacture of a drug to treat or prevent a disease related to a modification of a nucleic acid. These drugs are not intended to alter the germline identity of human beings, nor are they intended to create unjustified suffering in animals. The invention also relates to a method, particularly in vitro, for replacing a target region of a nucleic acid molecule with a region of interest from another nucleic acid molecule, so as to obtain a hybrid nucleic acid molecule, said method comprising: - bringing into contact an assembly as defined above, with the nucleic acid comprising the target region, said assembly being such that sequence A of said first molecule comprises a sequence complementary to the region immediately at 5° of the target region, Sequence B of said first molecule comprises a sequence complementary to the region immediately at 3° of the target region, and the third molecule comprises said region of interest in the region located between the complementary sequence of said second recognition sequence of said transposase of the first molecule and the complementary sequence of said first recognition sequence of said transposase of the second molecule, in order to obtain a replacement complex, - the interaction of the replacement complex with a transposase recognizing the double-strand binding sites of said transposase contained within said complex, to obtain a recombination complex, and - the recombination of the combination complex to obtain the hybrid nucleic acid molecule comprising the region of interest in place of the target region. It should be noted that during replacement, i.e., tagmentation by the transposase, the 3' end of the replacement fragment will be linked by a phosphodiester bond to the 5' end of the sequence immediately following the sequence that was replaced. This ligation occurs during tagmentation. Conversely, the 3rd end of the sequence located just before the replaced sequence and the 5th end of the replacement strand will not be linked together. Therefore, to finalize the replacement, it will be necessary, using a ligase, to link these two ends. It should also be noted that at the replacement site the replacement molecule is bordered at 3' and 5' by a transposase recognition sequence. The replacement mechanism for a single-strand target is shown in [Fig.9]. Initially, the set consisting of the first, second and third molecules, comprising respectively the complementary region of the 5' part of the target sequence, the complementary region of the 3° part of the target sequence, and the sequence of interest, are organized in space so that the GC-rich complementary regions of the first molecule are paired with each other and those of the second molecule are paired with each other ([Fig.9] -A). In the presence of the target sequence, the complementary regions of the 5° and 3' parts of the target sequence, contained respectively in the first and second molecules, will pair with their respective complementary regions to form a four-molecular-weight complex containing the target molecule and the three molecules of the complex. The interaction (or pairing) between the first and second molecules and their targets breaks the interaction of the GC-rich regions, so that the transposase binding sites, on which the transposase dimers are positioned, become spatially close to the target molecule. The transposases can then exert their activity and cleave both the target molecule and the molecule of interest (between the two binding sites), as shown in [Fig. 9]-B. From then on, the tagging will occur in such a way that - The 3' end of the third molecule will be bound to the free 5' end generated by the transposase in the 3' region of the target sequence. This junction will be covalent, formed by ligation of the two ends. The 5' end of the third molecule will be positioned opposite the free 3' end generated by the transposase in the 5' region of the target sequence. A 9-base-pair deletion is generated by the transposase in the 5' region of the target sequence (represented by the dashed circle in [Fig. 9]-C). In order to recover an entire molecule with the sequence of interest located between the 5' and 3' regions of the initial target sequence, ligation will be necessary. The final molecule, resulting from the tagmentation, will consist, in the 5'->3" direction, of a part of the 5° region of the initial target sequence, partially deleted by 9 base pairs, followed by the second transposase-binding sequence, followed by the sequence of interest itself, followed by the first transposase-binding sequence, and finally a part of the 5° region of the initial target sequence. In yet another aspect, the invention relates to a method, particularly in vitro or ex vivo, for editing the genome of a cell, allowing the replacement of a fragment specific to the double-stranded DNA of said genome of said cell by another double-stranded DNA fragment of interest, to obtain a recombinant hybrid genome comprising the other double-stranded DNA fragment of interest in place of the specific double-stranded DNA fragment, said method comprising: - the preparation of a first set as defined above, where the sequence A of the first molecule includes a sequence complementary to the region adjacent at 5° of the specific fragment; where sequence B of the second molecule comprises a sequence complementary to the region adjacent to the 3° of the specific fragment; and where the third molecule comprises, between the region located between the complementary sequence of said second recognition sequence of said transposase of the first molecule and the complementary sequence of said first recognition sequence of said transposase of the second molecule, a sequence of one of the strands of said specific fragment; - and possibly the preparation of a second set as defined above, where the sequence A of said complementary region of the first molecule of the second set comprises a sequence complementary to the 5' adjacent region of the specific fragment; where sequence B of said complementary region of the second molecule of the second set comprises a complementary sequence of the 3' adjacent region of the specific fragment; and where the third molecule of the second set comprises, between the region located between the complementary sequence of said second recognition sequence of said transposase of the first molecule of the second set and the complementary sequence of said first recognition sequence of said transposase of the second molecule of the second set, the sequence of the complementary strand of said specific fragment contained in the third sequence of the first set; where the complementary sequence of the 5' adjacent region of the specific fragment contained in region A of the first molecule of the first set is at most 95% complementary to the complementary sequence of the 5' adjacent region of the specific fragment contained in region A of the first molecule of the second set; and where the complementary sequence of the 3' adjacent region of the specific fragment contained in region B of the first molecule of the first set is at most 95% complementary to the complementary sequence of the 3' adjacent region of the specific fragment contained in region B of the first molecule of the second set; to obtain a recombination complex; - bringing said cell into contact with said recombination complex, to obtain a cell ready to be edited, - the expression in said cell ready to be edited of said transposase, to obtain an edited cell, - the selection of the edited cell, where the genome of said edited cell includes, instead of the specific fragment of double-stranded DNA, the other double-stranded DNA fragment of interest, provided that said method is not a process for modifying the germline genetic identity of human beings and that said method is not a method for treating the human or animal body by surgery or therapy. Advantageously, the invention relates to a method for editing the genome of a cell, enabling the replacement of a specific fragment of the double-stranded DNA of said cell's genome with another double-stranded DNA fragment of interest, to obtain a recombinant hybrid genome comprising the other double-stranded DNA fragment of interest in place of the specific double-stranded DNA fragment, said method comprising: - the preparation of a first set as defined above, where the sequence A of the first molecule includes a sequence complementary to the region adjacent at 5° of the specific fragment; where sequence B of the second molecule comprises a sequence complementary to the region adjacent to the 3° of the specific fragment; and where the third molecule comprises, between the region located between the complementary sequence of said second recognition sequence of said transposase of the first molecule and the complementary sequence of said first recognition sequence of said transposase of the second molecule, a sequence of one of the strands of said specific fragment; - and the preparation of a second set as defined above, where the sequence A of said complementary region of the first molecule of the second set comprises a sequence complementary to the 5' adjacent region of the specific fragment; where sequence B of said complementary region of the second molecule of the second set comprises a complementary sequence of the 3' adjacent region of the specific fragment; and where the third molecule of the second set comprises, between the region located between the complementary sequence of said second recognition sequence of said transposase of the first molecule of the second set and the complementary sequence of said first recognition sequence of said transposase of the second molecule of the second set, the sequence of the complementary strand of said specific fragment contained in the third sequence of the first set; where the complementary sequence of the 5' adjacent region of the specific fragment contained in region A of the first molecule of the first set is at most 95% complementary to the complementary sequence of the 5' adjacent region of the specific fragment contained in region A of the first molecule of the second set; and where the complementary sequence of the 3' adjacent region of the specific fragment contained in region B of the first molecule of the first set is at most 95% complementary to the complementary sequence of the 3' adjacent region of the specific fragment contained in region B of the first molecule of the second set; to obtain a recombination complex; - bringing said cell into contact with said recombination complex, to obtain a cell ready to be edited, - the expression in said cell ready to be edited of said transposase, to obtain an edited cell, - the selection of the edited cell, where the genome of said edited cell includes, instead of the specific fragment of double-stranded DNA, the other double-stranded DNA fragment of interest, provided that said method is not a process for modifying the germline genetic identity of human beings and that said method is not a method for treating the human or animal body by surgery or therapy. Since this genome editing method is based on the single-molecule re-placement method described above, and uses a set described above, all the previously detailed characteristics and variants apply here mutatis mutandis. In this aspect of the invention, it should be noted that the first molecule of the assembly considered (first or second) is always positioned at 5° of the third molecule of said assembly considered. Therefore, the first molecule of the first set will be positioned "above" the second molecule of the second set, and vice versa. Furthermore, the aforementioned 5'->3' orientations allow for the correct positioning of the sequence of interest relative to the target sequence. Genome editing involves modifying the genome of a cell with high precision. It is possible to inactivate a gene, introduce a targeted mutation, correct a specific mutation, or insert a new gene. This genetic engineering technique uses nucleases, in this case transposse, capable of cutting nucleic acids at the phosphodiester bonds. Within the framework of the invention, and as explained previously, the first and second molecules of the assembly according to the invention allow the assembly to be positioned at the level of the target region so as to frame the target region so that it is replaced by the sequence of interest contained in the third sequence. In the context of editing a double-stranded molecule, it is necessary to have, in order to simultaneously replace the two strands of the target molecule, two sets according to the invention, each set specifically targeting one of the two strands of the target molecule. It should be noted that the complementary sequence contained in sequence A of the first molecule of the first set is not complementary to the complementary sequence contained in sequence A of the first molecule of the second set. Similarly, sequence B of the second molecule of the first set is not complementary to the complementary sequence contained in sequence B of the second molecule of the second set. Furthermore, it is advantageous for the complementary sequence contained in sequence A of the first molecule of the first set to be offset relative to the complementary sequence contained in sequence B of the second molecule of the first set, with these two molecules being one "above" the other. This means that the recognition region of these complementary sequences is at most 95%. In other words, if the complementary sequence contained in sequence A and sequence B is twenty nucleotides long, the complementary sequences will only be complementary to each other by a maximum of 19 nucleotides. However, it is preferable that these complementary regions be as little complementary as possible to each other, or even not complementary at all. To illustrate this point, if we consider the 5' part of the target sequence as comprising 40 nucleotides, then it would be appropriate for the complementary region contained in sequence A of the first molecule of the first set to be complementary to the first 20 nucleotides, while the complementary region contained in sequence B of the second molecule of the second set to be complementary to the last 20 nucleotides of the sequence complementary to the 5' part of the target sequence. This offset, even if the sequence orientations do not allow it, avoids any incorrect orientation of the sequence of interest. The sequence of tagmentation steps and the resultant are described in [Fig.10]. In order to obtain the final molecule, and due to the deletion of 9 base pairs in the 5' position Following tagmentation, the cell will need to mobilize its repair system to fill the gap, notably by using a DNA polymerase that will copy the complementary strand whose 3' end was joined during tagmentation. Brief description of the figures The invention will be better understood by reading the following examples and figures: [Fig. 1] [Fig. 1] is a schematic representation of the first nucleic acid molecule in linear form. Rectangles with arrowheads represent transposase binding sites, and rectangles with slashes represent G / C-rich regions. [Fig.2] [Fig.2] is a schematic representation of the first nucleic acid molecule in structured form. The legends are the same as for [Fig.1]. [Fig.3] [Fig.3] is a schematic representation of the complex according to the invention. The legends are the same as for [Fig.1]. [Fig. 4] [Fig. 4] is a schematic representation of two versions of the complex according to the invention. The legends are the same as for [Fig. 1]. The different options are represented by dotted lines. [Fig. 5] [Fig. 5] is a schematic representation of a first embodiment of the complex according to the invention. The legends are the same as for [Fig. 1]. [Fig. 6] [Fig. 6] is a schematic representation of a second embodiment of the complex according to the invention. The legends are the same as for [Fig. 1]. [Fig. 7] [Fig. 7] is a schematic representation of a third embodiment of the complex according to the invention. The legends are the same as for [Fig. 1]. [Fig.8] [Fig.8] is a schematic representation of an assembly according to the invention. The legends are the same as for [Fig.1]. [Fig.9] [Fig.9] is a schematic representation of the sequence of certain steps of replacement of a target sequence of a single-stranded molecule by a sequence of interest. A: represents the target molecule and the unpaired set. B: represents the target molecule and the paired set. Transposases are shown as dashed lines, and cuts are represented by scissors. Note that the cut on the third molecule of the set occurs between the two transposase binding sites, on either side of the molecule (two cuts). C: represents the molecule resulting from the tagmentation. The dotted line represents the deletion of 9 bases at the 5° position of the replaced region. [Fig.10] The [Fig. 10] is a schematic representation of the sequence of certain steps of replacement of a target sequence of a double-stranded molecule by a sequence of interest, itself double-stranded. A: represents the target molecule and the unpaired set. B: represents the target molecule and the paired set. Transposases are shown as dashed lines, and cuts are represented by scissors. Note that the cut on the third molecule of the set occurs between the two transposase binding sites, on either side of the molecule (two cuts). C: represents the molecule resulting from the tagmentation. The dotted line represents the deletion of 9 bases at the 5° position of the replaced region. [Fig. 11] [Fig. 11] shows agarose gels displaying the tagmentation according to the invention. a. Agarose gel with 3 groups of samples; testing of different transposase complexes (negative control, TnS WT, Tn5 Me and Tn5S DREAMT, i.e., according to the invention) with mCherry-CD9 plasmid, PCR amplification of total HEK293T mRNAs, and PCR amplification of total HEK293T mRNAs transfected with the mCherry-CD9 plasmid (addition of PCR + / - control). b. Agarose gel of the different transposase mixes (see a.) ten times more concentrated on mCherry-CD9 plasmids. [Fig. 12] [Fig. 12] represents the Sanger sequencing result of the positive amplified band (Gel [Fig. 10] a) for the Tn5 DREAMT mix. The obtained sequence and the corresponding chromatogram are shown. [Fig.13] [Fig.13] represents an agarose gel with 3 groups of samples; testing of different transposase complexes (negative control, Tn5 WT, Tn5 Me and Tn5 DREANMT) with mCherry-CD9 plasmid, PCR amplification of total cDNA from HEK293T, and PCR amplification of total cDNA from HEK 293T transfected with mCherry-CD9 plasmid (addition of PCR + / - control). [Fig. 14] [Fig. 14] shows the Sanger sequencing result of the positive amplified band (Gel [Fig. 13]) for the Tn5 DREAMT mix. The resulting sequence and the corresponding chromatogram are presented. [Fig.15] [Fig.15] represents an agarose gel with 3 groups of samples; testing of different transposase complexes (negative control, Tn5 WT, Tn5 Me and Tn5 DREAMT) with mCherry-CD9 plasmid, PCR amplification of total cDNA from HEK293T, and PCR amplification of total cDNA from HEK 293T transfected with mCherry-CD9 plasmid (addition of PCR + / - control). [Fig. 16] [Fig. 16] represents the Sanger sequencing result of the positive amplified band (Gel [Fig. 15]) for the Tn5 DREAMT mix. The obtained sequence and the corresponding chromatogram are shown. [Fig. 17] [Fig. 17] represents the assay of the "new design" UVRD-mSA / Tn5 / DREAMT complex on the mcherry-CD9 plasmid. Injection (transfection) of the plasmid mCherry-CD9 to HEK 293T cells then DREAMT technology, searching for a visible color change (Red->green as mentioned in the figure) [Fig.18] [Fig.18] represents the transfection of the technology according to the invention in the HEK 293T cell line stably expressing mCherry-CD9, then searching for a visible color change (Red->green as mentioned in the figure). [Fig.19] [Fig.19] represents the Sanger sequencing results of the amplified GFP fragment from the cDNA library from the mCherry-CD9+ HEK 293T cell line transfected with the DREAMT "new design" technology (Cells used on day 18). Examples Example 1 - Implementation of the invention in vitro. The purpose of this example is to show that the assembly according to the invention makes it easy and specific to replace a sequence of a single-stranded nucleic acid molecule (RNA or cDNA) with a sequence of interest. In this example, the goal is to replace the mCherry-CD9 sequence with the GFP sequence. - Preparation of the recombination set targeting mCherry-CD9. Preparation of two separate tubes containing: - for Tube 1 (10juL): + 1OuM the loop oligonucleotide A (first molecule) including in the A region a recognition sequence of the mCherry sequence; + 10M oligonucleotide A (third molecule) comprising at 3° a half restriction site + the reverse oligo BSPEi Frag (10uM) -for Tube 2 (10uL), + 1OUM the loop B oligonucleotide (second molecule) comprising in the B region a recognition sequence of the CD9 sequence; + 10M oligonucleotide A (third molecule) comprising a 3” half-restriction site + the trace element Nde I Frag (10uM). The two tubes are then heated to 95°C for 5 minutes and then left at room temperature for 1 hour. Once at room temperature, the contents of the tubes are exposed to either the Ndel enzyme or the BSPEi enzyme to allow digestion of the restriction sites. The digestion products are then purified with a PCR purification kit (20uL elution). In parallel, a GFP-encoding sequence is amplified to provide the NdeI and BSPEi restriction sites at positions 5 and 3. The PCR product is then digested with the two restriction enzymes, and the digest is purified using a PCR purification kit (20µL elution). The contents of Tubes 1 and 2 are then combined with the GFP fragment (amplified and digested) in the presence of T4 phage ligase (4uL, i.e. 100U) with 5uL of T4 Buffer (10X) and 1uL ddH20, for a total reaction volume of SOUL. The solution is then left for 1 hour at room temperature, then a gel purification is carried out to isolate the largest GFP fragment, greater than 1 kilo bases (kb), and containing the two single-stranded molecules (first and second molecules of the set) at its 5° and 3' ends, to form a recombination complex. The recombination complex is then ready to be incubated with transposase dimers. In control, MeA and MeB oligonucleotides at 1OUM each were prepared with the MERev fragment (previously described by S. Picelli et al Genome Res 2014): Tn5MErev, S'-[phos] CTGTCTCTTATACACATCT-3' (SEQ ID NO: 11) Tn5SME-AA (Illumina FC-121-1030), 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3”; (SEQ ID NO: 12) and Tn5SME-B (Illumina FC-121-1031), 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3" (SEQ ID NO: 13) by pairing at 95°C for 5 min then left for 1 hour at room temperature. These oligos serve as a positive control for the tagmentation reaction. Regarding the production of the Tn5 transposase, it is produced via the recommendations of the following publication: S. Picelli et al Genome res 2014. The two previous preparations, the recombination complex and the positive control oligos, were then mixed with the Tn5 transposase production via the following protocol: 0.125 Vol of the 10 / M recombination complex solution or control oligos (or just Dialysis buffer (cf S. Picelli et al Genome res 2014) for wild Tn5, also known as WT) + 0.4 Vol of 100% glycerol solution + 0.24 Vol of Dialysis buffer (cf S. Picelli et al Genome res 2014) + 0.36 Vol of Tn5 solution. The reaction is then placed in a thermocycler for 30 minutes at 45°C to 37°C, decreasing by 1°C every 4 minutes. At the same time, several targets were produced to test the technology according to the invention. An mCherry-CD9 plasmid was used as a negative control, along with production of an mRNA and cDNA library from pre-HEK293T cells. lable transfected by lipofectamine 3000 with the mCherry-CD9 vector. Forty-eight hours after transfection and visual control (red membrane due to mCherry expression) of HEK cells, the total mRNA population is then extracted and reverse transcribed into cDNA. These mRNA or cDNA libraries are then used for our "in-tube" DREAMT technology test. In order to characterize and test the technology according to the invention, different mRNA / cDNA and plasmid targets were contacted with - Tn5 WT dimers: without oligo, - Tn5 Me: with oligo Me (positive control) and - Tn5 Complex: with the assembly according to the invention. Three types of targets were tested: the mCherry-CD9 plasmid and the mRNA or cDNA library with or without transfection of mCherry-CD9. The double-stranded or single-stranded DNA / RNA solutions were brought into contact with the different activated Tn5 solutions via the following reaction: - concentration X or 10X of Tn5 WT, Tn5 Me, Tn5 Complex solution or even volume of ddH2O + 500ng of mCherry-CD9 plasmid or 2uL of cDNA or mRNA + 5X tagmentation buffer (100mM HEPES, 50mM MgCL, 40% PEG 3500) + ddH20 QSP 20uL. Each tagmentation reaction is carried out in a thermocycler at 55°C for 7 min, then 0.5uL of proteinase k solution (20ug / uL) is added before a second incubation time at 55°C for 7 min in order to inactivate the transposase. Thus, as shown in [Fig.11], sedimentation (ligation) of the 3' end of the GFP was carried out towards the target sequence mCherry. On the agarose gel [Fig.11], the mCherry-CD9 plasmid (Davidson Lab) was in contact with two concentrations (X and 10X) of Tn5 solution. As expected, at high concentration (10X), the WT Tn5 mix and the Me Tn5 positive control underwent tagmation, illustrated by plasmid degradation (smear or degradation trail, disappearance of the plasmid band). Furthermore, as expected, the complex alone could not perform tagmentation (plasmid degradation), as illustrated by the preservation of the DNA band on the agarose gel ([Fig. 11]) [because it lacks a molecule to open the double strand of plasmid DNA (Helicases) in order to bind to the mCherry-CD9 target, which would release the Tn5 molecules and allow tagmentation]. This finding leads to the conclusion that the Tn5S Complex dimers are trapped and can only perform their tagmentation activity by binding the strand to be recombined with the single strand of the target, in this case the mCherry-CD9 mRNA fragment. The same concentration of Tn5(X) solution was used with 2 yL of the bank mRNA (from normal HEK293T cells or cells transfected with mCherry CDS9) was then used. PCR with the Forward mCherry and Forward GFP primers was then performed (see Table 1). Table | : Oligos utilisés pour les réactions de PCR et les contructions plasmidiques |Noms [séquences S'to 3' GFP For CTGGTCGAGCTGGACGGCGACG (SEQ ID NO : 14) GFP Rev CACGAACTCCAGCAGGACCATG (SEQ ID NO : 15) mCherry For CD9 Rev GFP Ndel For |GFP Ndel Rev GFP bspei For |GrP bspei Rev CMV Ndel For |UVRD For |UVRD Rev |msA For |mSA Rev |Tns For |Tns Rev As expected, no signal was detected for the mRNA library obtained from cells without transfection of the mCherry-CD9 vector. Similarly, no amplification was detected for the negative controls (mRNA fragments alone, mRNA + TnS WT, mRNA + Tn5 Me) and the mRNA library samples transfected with mCherry-CD9. However, in the same batch of samples, a distinct band was detected at the correct molecular weight = 1 kb ([Fig. 11]) for the sample corresponding to mCherry-CD9 replacement with the GFP (Tn5 Complex) sequence. This band indicates a cleavage of the 3' mCherry end (antisense mRNA) with insertion of the 3' GFP end (sense strand), or in other words, a ligation of the antisense mCherry mRNA strand to the GFP sense strand in a 3° to 5° direction. The amplification product was sequenced, and the resulting sequence is shown in [Fig. 12]. As expected, we detected mCherry amplification toward the 3” GFP side, with both sequences linked by ligation being detected. The chromatogram of this sequencing clearly shows the sedimentation (tagmentation) zone 10 bp from the target sequence ([Fig. 12]). The same analysis was repeated, but this time changing the design to ligate the DNAc sense strand at the 3°:CD9 position ([Fig. 12]). The same results were obtained with an amplification gel showing an expected band around 1 kb ([Fig. 13]) for the cDNA library with mCherry-CD9 transfection and contacted with the assembly according to the invention (Tn5 Complex), and sequencing of the resulting fragment was performed ([Fig. 14]). As expected, this sequencing allowed us to identify the CD9 sense strand sequence of sedimented cDNA with multiple sequences of the 5' GFP sense strand (ligation at the 3° position of the GFP sense sequence; [Fig. 14]), 5 bp from the target sequence. Example 2 — Implementation of the invention in cellulo Building on these encouraging results, the design was modified to obtain a version compatible with direct transfection of the entire assembly, including the Tn5 plasmid and the strand-opening protein, the UVRD bacterial helicase plasmid which fuses with monomeric streptavidin (UVRD-mSA plasmid) so that the latter attaches in situ to one of the assembly molecules via pre-biotinylated oligos. To achieve this, a new version of the assembly was developed for easier implementation and allowing near 100% design control (reducing the number of Tn5 dimers not trapped by the Beacon sarcophagus system and thus the potential for associated off-target effects). Therefore, for this "New Design Assembly," the same type of protocol as the previous one was used, with some major changes.In terms of design itself, the Loop nDREAMT oligos A, B, C and D (one per Tn5 dimer and per target for a tagmation of the four target areas — complete double strand replacement-) are longer with three attachment sequences to the . transposase. This allows for rapid and controlled pairing with just the addition of the last transposase attachment sequence linked to the GFP fragments replacing the target fragment mCherry-CD9 (nDREAMT Oligos A, B, C, D). In addition, other nDREAMT Bio Oligos A and B (biotinylated oligos) are added to allow in-cell assembly of the whole with the UVRD-mSA fusion protein. The following oligos were mixed in two separate tubes, 1 and 2: for tube 1 (10 µL), loop nDREAMT A and C (10 µM) + oligos nDREAMT A and C (10 µM) + oligos nDREAMT Bio A (10 µM); for tube 2 (10 µL), loop NDREAMT B and D (10 pM) + oligos nDREAMT B and D (10 µM) + oligos nDREAMT Bio B (10 µM). Both tubes were then heated to 95°C for 5 min and left at room temperature for 1 h. Each tube was then digested with the corresponding restriction enzymes and purified using a PCR purification kit (20 µL elution). At the same time, an amplified GFP sequence including as flanking ends the Nde I restriction enzyme sequences in 5' and BSPEi in 3° (oligos with restriction site architecture digested after PCR) was amplified and then digested with the corresponding restriction enzymes and purified by PCR purification kit eluted to a volume of 20uL. The contents of Tubes 1 and 2 are then mixed with the newly amplified and digested GFP fragment, a T4 ligase solution (4 µL, i.e., 100 U), Su of T4 Buffer (10X), and 1 L ddH2O, for a total reaction volume of SOuL. The solution is left for 1 h at room temperature, then a gel purification is performed to isolate the largest GFP fragment, greater than 1 kb, containing the four sarcophages A, B, C, and D at its 5' and 3' ends. The replacement GFP fragment with its four sarcophages positioned at the 5' and 3' ends is then ready to receive the transposase dimers ([Fig. 15]). Before testing this system at the cellular level, the new design was tested using the same series of experiments as before, with ligation of the 3′ GFP (sense strand) to the CD9 side of the mCherry-CD9 target cDNA (sense strand). The same type of result as before was obtained (all remaining negative controls were undetectable), with an expected band around 0.5 kb after amplification using Forward GFP and Reverse CDS PCR primers ([Fig. 15]). After Sanger sequencing of this band, as expected, detection of the CD9 fragment in the 5° to 3° direction was achieved with multiple GFP sequence ligation at its 3° end ([Fig. 16]), within two bases of the original target sequence ([Fig. 16]). Following this positive validation of the new design, an in situ test was performed in HEK293T cells expressing mCherry-CD9. For this purpose, two intracellular protein expression plasmids for the transposase proteins Tn5 and UVRD- mSAs were created. For the Tn5 plasmid, the Tn5 sequence was amplified by PCR using the PTXB1-Tn5 plasmid (S. Picelli et al., Genome Res 2014). It should be noted that the intein tail tag, which allows for the purification of the Tn5 transposase via chitin bead binding and self-cleavage leaving no tag element on the Tn5 protein (S. Picelli et al., Genome Res 2014), was replaced by a stop codon. This was then cloned in place of the mCherry-CD9 fragment of the mCherry-CD9 plasmid (Davidson Lab) using the restriction enzymes BMT1 and EcoRl, ultimately yielding a CMV-Tn5 promoter plasmid. PCR amplification of the mSA fragment was performed (Table 1) via the pRSET-mSA plasmid (Sheldon Park Lab) with the addition of the BMT1 restriction sites in 5' and EcoR1 in 3' (Table 1).A first cloning step was performed in the mCherry-CD9 plasmid using the BMT1 and EcoR1 enzymes, replacing the mCherry-CD9 fragment with the mSA fragment, resulting in a CMV-mSA promoter plasmid. For the UVRD fragment, an E. coli cDNA library (DHSa) was generated. UVRD cDNA was amplified by PCR using specific oligonucleotides (Table 1). The 5' end contains the usual elements such as the BMT1 sequence for cloning and the Kozac sequence, as well as the NLS nuclear import sequence to allow for the importation of a complete Complex + Tn5 + UVRD-mSA into the cell nucleus. In the third step, a flexible portion (a GGGSx3 polyglycine tail) was added, along with a segment of the 5' mSA sequence leading to a specific restriction enzyme contained within the 5' mSA sequence, PMI1.A second cloning step was then performed using the restriction enzymes BMTI1 and PMil, allowing the addition of the UVRD sequence at the 5' end and obtaining a final CMV-UVRD-mSA promoter-type plasmid. HEK 293T cells were transfected with lipofectamine 3000 using the mCherry-CD9 plasmid. After a 24-hour standstill and confirmation of the red signal on the cytoplasmic membrane by confocal microscopy, the cells were transfected with three compounds: the CMV-Tn5 and CMV-UVRD-mSA plasmids and the New Design complex. This complete complex allows for double-strand replacement of the sequence located between the four targets (quadruple of targets; two mCherry ends and two CD9 ends) with a CMV-GFP sequence. Thus, this experiment expected a decrease or even a replacement of the red membrane signal with a green cytoplasmic signal. As expected and shown in [Fig.17], 5 days after the second transfection with the technology according to the invention, green cells were detected. These cells were isolated by cell sorting flow cytometry, and knowing that the CMV-GFP fragment replaced the mCherry-CD9 portion of the CMV-mCherry-CD9 plasmid, this new CMV-GFP plasmid should contain an antibiotic selection sequence for NeoR / KanR cell line creation. After more than 6 days of transfection, these Still green cells were placed in a medium containing 2mg / ml of G418, changed daily for 14 days and then maintained at a concentration of 0.5mg / ml for 3 months. As expected, after 19 days post transfection, a new green GFP+ cell line was obtained, very stable despite repeated freezing and thawing (see [Fig.17]). To reconfirm this result in situ with greater certainty, a stable HEK293T red membrane cell line was created by transfection with the CMV-mCherry-CD9 plasmid and treatment with G418 2 mg / ml as previously performed. After two weeks of treatment, a HEK293T red membrane cell line was obtained. This cell line was transfected as before using the aforementioned technology. After three days of transfection, the first green cells began to appear (see [Fig. 18]). Fourteen days post-transfection, certain groups of green cells were identified and isolated for further analysis (see [Fig. 18]). After isolation of these cells, reverse transcription was performed from these cells 18 days post-transfection, in order to obtain a cDNA library. An amplification of the GFP sequence was then performed by PCR and the amplified fragment was then sequenced according to the Sanger method. As expected, after analysis by comparison with sequence databases (NCBI blast), a very close similarity was found with the theoretical GFP fragment replacing the mCherry-CD9 sequence [Fig. 19]. Furthermore, after almost a month, the green cells obtained remained stable with a strong green signal [Fig. 18]. These results confirm the in-cell efficacy of the technology according to the invention, enabling the replacement of the target mCherry-CD9 sequence by the GFP replacement sequence, as illustrated by the color change from membrane red to cytoplasmic green.This color change allows validation of the nuclear import of the new design + Tn5 + UVRD-mSA complex (with the NLS on the N-Term sequence of the UVRD), the opening of the DNA strands carried out by the two helicases on the 5' and 3° side, the pairing at the four desired target sites (two on the mCherry side and two on the CD9 side) and the replacement of the mCherry-CD9 sequence by the CMV-GFP fragment by the technology according to the invention.

Claims

Demands

1. Complex comprising - a first single-stranded nucleic acid molecule comprising or consisting essentially of a sequence A allowing insertion of a complementary sequence of a nucleic acid of interest, said sequence A being linked in 5' to a first sequence rich in A / T, particularly rich in T, 40 to 60 nucleotides long and in 3' to a second sequence rich in A / T, particularly rich in T, from 40 to 60 long nucleotides, the said first and second sequences rich in A / T, particularly rich in T, comprising respectively a first and a second domain of 6 to 12 nucleotides rich in GC, the sequence the first domain being complementary to the sequence of the second domain, said first and second domains being positioned from 15 to 52 nucleotides of said sequence A, said first molecule including at its extremity 5' a first sequence oriented 5'-3° of recognition of a transposase and at its 3' end at least one second recognition sequence of said transposase; and - a second single-stranded nucleic acid molecule comprising or consisting essentially at its extremity 5° of at least one complementary sequence to the said second recon- sequence birth of said transposase, said complex being such that the first and second molecules single-stranded nucleic acids are paired according to complementarity databases defined by Watson and Crick to define two sites double linking strand of said transposase.

2. Complex according to claim 1, wherein said sequence A comprises a complementary sequence of a nucleic acid of interest.

3. Complex according to any one of claims 1 to 2, where said the first molecule includes at its 5' end a first sequence oriented 5'-3' for transposase recognition and at its end 3' a second oriented sequence 5'-3° of recognition of said transposase and where the second molecule includes at its 5' end a first complementary sequence to the said first recon- sequence birth of said transposase followed by a second sequence complementary to the said second recognition sequence of said transposase.

4. Complex according to any one of claims 1 to 3, where said the first molecule includes at its 5' end a first sequence oriented 5'-3' for transposase recognition and at its end 3' a second recognition sequence of said transposase, followed by a first complementary sequence of said first recognition sequence of said transposase and where the second molecule includes at its 5' end a sequence com- supplementary to the said second recognition sequence of the said transposase.

5. Complex according to any one of claims 1 to 4, where said transposase is a bacterial transposase, specifically a transposase chosen from Tn5, Tn9, Tn10 or Tc1 / mariner.

6. Set comprising - a first single-stranded nucleic acid molecule comprising or consisting essentially of a sequence A allowing insertion of a complementary sequence of a nucleic acid of interest, or including a complementary sequence of a nucleic acid of interest, the said supplementary sequence being linked in 5 minutes to a first sequences rich in T, 40 to 60 nucleotides long, and in 3° to a second T-rich sequences of 40 to 60 nucleotides in length, the so-called first and second T-rich sequences comprising respectively a first and a second domain of 6 to 12 G-- rich nucleotides C, the sequence of the first domain being complementary to the sequence of the second domain, the said first and second domains being po- positioned from 15 to 52 nucleotides of said sequence A, said first molecule comprising at its 5' end at least a first sequence oriented 5'-3' of recognition of a transposase and in its end 3' a second recognition sequence of said transposase - a second single-stranded nucleic acid molecule comprising or consisting essentially of a B sequence allowing insertion of a complementary sequence of a nucleic acid of interest, or including a complementary sequence of a nucleic acid of interest, said complementary sequence B being linked in 5' to a third sequence rich in T, 40 to 60 nucleotides long and in 3° to a fourth T-rich sequence of 40 to 60 nucleotides in length, called third and fourth T-rich sequences comprising respectively a third and fourth domain of 6 to 12 G-- nucleotides C, the sequence of the third domain being complementary to the sequence of the fourth domain, the said third and fourth domain being positioned from 15 to 52 nucleotides of said sequence B, said second molecule comprising at its 5' end at least the first sequence oriented 5'-3° of recognition of said transposase and at its 3' end the second recon- sequence birth of said transposase, said sequence B being a complementary sequence of said acid nucleic acid of interest, the A sequence being positioned at 5' of a region of interest of said nucleic acid of interest and the sequence B positioned in 3° of the region of interest of said nucleic acid of interest, and - a third single-stranded molecule comprising in its part 5', at least one additional sequence of said second recognition sequence of said transposase (of the first molecule), in its part 3' at least a supplementary sequence of the said first recognition sequence of said transposase (of the second molecule), and - a region located between complementary sequence of said second recognition sequence of said transposase (of the first molecule) and the complementary sequence of said first sequence of recognition of said transposase (of the second molecule) allowing the insertion of a rem- nucleic acid molecule placement (single strand), the first and third single-stranded nucleic acid molecules being matched according to the complementarity of the bases defined by Watson and Crick so as to define two double-stranded bonding sites of said transposase and the second and third nucleic acid molecules single strands being paired according to the complementarity of the bases defined by Watson and Crick so as to define two double-strand bonding sites of said transposase.

7. Kit comprising at least one vector enabling the expression of a re- combinase and - of a first single-stranded nucleic acid molecule comprising or consisting essentially of a sequence A allowing insertion of a complementary sequence of a nucleic acid of interest, or including a complementary sequence of a nucleic acid of interest, the said supplementary sequence being linked in 5 minutes to a first T-rich sequences 40 to 60 nucleotides long and 3' to second T-rich sequences of 40 to 60 nucleotides in length, the so-called first and second T-rich sequences comprising respectively a first and a second domain of 6 to 12 G-- rich nucleotides C, the sequence of the first domain being complementary to the sequence of the second domain, the said first and second domains being po- positioned from 15 to 52 nucleotides of said sequence A, said first molecule comprising at its 5' end at least a first sequence oriented 5'-3° of recognition of a transposase and in its end 3' a second recognition sequence of said transposase - a second single-stranded nucleic acid molecule comprising or consisting essentially of a B sequence allowing insertion of a complementary sequence of a nucleic acid of interest, or including a complementary sequence of a nucleic acid of interest, said complementary sequence B being linked in 5' to a third sequence rich in T, 40 to 60 nucleotides long and in 3° to a fourth T-rich sequence of 40 to 60 nucleotides in length, called third and fourth T-rich sequences comprising respectively a third and fourth domain of 6 to 12 G-- nucleotides C, the sequence of the third domain being complementary to the sequence of the fourth domain, the said third and fourth domain being positioned from 15 to 52 nucleotides of said sequence B, said second molecule comprising at its 5' end at least the first sequence oriented 5'-3' of recognition of said transposase and at its 3' end the second recon- sequence birth of said transposase, said sequence B being a complementary sequence of said acid nucleic acid of interest, the A sequence being positioned at 5' of a region of interest of said nucleic acid of interest and the sequence B positioned in 3° of the region of interest of said nucleic acid of interest, and - of a third single-stranded molecule comprising in its 5' part, at less a complementary sequence of said second sequence of re- knowledge of said transposase (of the first molecule), in its part 3' at least one additional sequence to the said first recognition sequence of said transposase (of the second molecule).

8. Use of the assembly as defined in claim 6, for nucleic acid engineering, particularly for the substitution of a target sequence by a sequence of interest, provided that the use does not include a method for changing identity germline genetics of human beings and that said use is not a method for treating the human or animal body by a surgery or therapy.

9. Method for in vitro replacement of a target region of a molecule of nucleic acid by a region of interest of another acid molecule nucleic acid, so as to obtain a hybrid nucleic acid molecule, said method comprising: - bringing into contact a set as defined in the claim 6, with the nucleic acid comprising the target region, said set being such that the A sequence of said first molecule comprises a sequence complementary to the region immediately in 5° of the target region, the B sequence of said first molecule comprises a com- sequence complementary to the region immediately in 3° of the target region, and the third molecule includes said region of interest in the region located between complementary sequence of said second sequence of recognition of said transposase from the first molecule and the complementary sequence to the said first recon- sequence birth of said transposase from the second molecule, in order to obtain a replacement complex, - the introduction of the replacement complex with a transposase recognizing the double-strand binding sites of said transposase contained in said set, to obtain a complex of recombination, and - the recombination of the combination complex to obtain the hybrid nucleic acid molecule including the region of interest at the location of the target region.

10. In vitro or ex vivo method for editing the genome of a cell, allowing the replacement of a specific fragment of double-stranded DNA said genome of said cell by another (double-stranded DNA fragment) of interest, to obtain a recombinant hybrid genome comprising the other double-stranded DNA fragment of interest in place of the specific fragment of double-stranded DNA, said method comprising: - the preparation of a first set as defined in the claim- instruction 6, where sequence A of the first molecule comprises a sequence complementary to the 5' adjacent region of the specific fragment; where sequence B of the second molecule comprises a sequence complementary to the 3° adjacent region of the specific fragment; and where the third molecule comprises, between the region located between the complementary sequence of said second recognition sequence of said transposase of the first molecule and the complementary sequence of said first recognition sequence of said transposase of the second molecule, a sequence of one of the strands of said specific fragment; - and possibly the preparation of a second set as defined in claim 6, where sequence A of said complementary region of the first molecule of the second set comprises a sequence complementary to the 5' adjacent region of the specific fragment; where sequence B of said complementary region of the second molecule of the second set comprises a sequence complementary to the 3' adjacent region of the specific fragment; and where the third molecule of the second set comprises, between the region located between the complementary sequence of said second recognition sequence of said transposase of the first molecule of the second set and the complementary sequence of said first recognition sequence of said transposase of the second molecule of the second set, the sequence of the complementary strand of said specific fragment contained in the third sequence of the first set; where the complementary sequence of the 5' adjacent region of the specific fragment contained in region A of the first molecule of the first set is at most 95% complementary to the complementary sequence of the 5' adjacent region of the fragment specific contained in region A of the first molecule of the second set; and where the complementary sequence of the adjacent region at 3° of the specific fragment contained in region B of the first molecule of the first set is at most 95% complementary to the complementary sequence of the adjacent region at 3° of the fragment specific contained in region B of the first molecule of the second set; to obtain a recombination complex; - bringing said cell into contact with said recombination complex, to obtain a cell ready to be edited, - the expression in said cell ready to be edited of said transposase, to obtain an edited cell, -the selection of the edited cell, where the genome of said edited cell includes, instead of the specific fragment of double-stranded DNA, the other double-stranded DNA fragment of interest, provided that said method is not a process for modifying the germline genetic identity of human beings and that said method is not a method for treating the human or animal body by surgery or therapy.