Detecting a chromosome conformation as marker for fibrosis, e.g. scleroderma

The EpiSwitch technology allows for precise detection of scleroderma stages and presence by analyzing chromosome interactions, addressing the limitations of current methods and enabling early intervention and personalized treatment.

GB2611903BActive Publication Date: 2025-08-06OXFORD BIODYNAMICS PLC
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
GB2022019352
Authority / Receiving Office
GB · GB
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-06-02
Filing Date
2021-06-02
Publication Date
2025-08-06
Estimated Expiration
2041-06-02

AI Technical Summary

Technical Problem

Current methods for detecting and diagnosing scleroderma, particularly in its early stages, are inadequate, as fibrosis is a complex condition with regulatory and causative aspects that are not easily elucidated, leading to challenges in determining the stage and presence of the disease, which affects life expectancy and can result in severe complications.

Method used

A process is developed to detect the stage and presence of scleroderma by analyzing chromosome interactions using EpiSwitch technology, involving cross-linking, cleavage, and ligation of chromosomal DNA to generate ligated nucleic acids, which are then detected using PCR or probe-based methods to identify specific chromosome interactions represented by probes in predefined tables, allowing for early detection and personalized treatment.

Benefits of technology

This method enables accurate detection of scleroderma stages and presence, facilitating early intervention and personalized therapy, as chromosome interactions are stable and less variable among individuals within subgroups, providing a reliable means to assess disease status and progression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000004_0000
    Figure 00000004_0000
Patent Text Reader

Abstract

A process for analysing chromosome interactions, e.g. using EpiSwitch relating to fibrosis in particular systemic sclerosis and scleroderma.
Need to check novelty before this filing date? Find Prior Art

Description

5 Fibrosis, also known as fibrotic scarring, is a pathological wound healing in which connective tissue replaces normal parenchymal tissue to the extent that it goes unchecked, leading to considerable tissue remodelling and the formation of permanent scar tissue. Sclerosis is a type of fibrosis in which there is the stiffening of a tissue or anatomical feature, usually caused by a replacement of the normal organ-specific tissue with connective tissue. The structure may be said to have undergone sclerotic 10 changes or display sclerotic lesions, which refers to the process of sclerosis. Fibrosis is a complex condition where the regulatory and causative aspects cannot be easily elucidated. The outcome of scleroderma depends on the extent of disease. Those with localised disease generally have a normal life expectancy. In those with systemic disease typical life expectancy is about 11 years from onset. Death is often due to lung, gastrointestinal, or heart complications. 15 Summary of the Invention The invention provides a process for detecting the stage and / or presence of scleroderma; - wherein the stage of scleroderma is detected by determining the presence or absence of at least 10 chromosome interactions represented by any probe shown in: - Table l.a2 or Table l.b2, 20 - Table 3.a3 or Table 3.b3, or, - Table 4.a3 or Table 4.b3; and / or - wherein the presence of scleroderma is detected by determining the presence or absence of at least 10 chromosome interactions represented by any probe shown in: 25 -Table 2.a2 or Table 2.b2, - Table 5.a2 or Table 5.b2, or - Table 6.a3 or Table 6.b3. 05 03 25 Brief Description of the Drawings Figure 1 shows the genetic locations and pathways for the early phenotype chromosome conformations. The top 35 pathways are shown for the genetic locations associated to significant chromosome conformations for the early phenotype. 5 Figure 2 shows the genetic locations and pathways for the late phenotype chromosome conformations. The top 35 pathways are shown for the genetic locations associated to significant chromosome conformations for the late phenotype. Figure 3 shows an example of how the chromosome interaction typing may be carried out. The figure also shows how a probe (for example as described in the tables) corresponds to the ligated product 10 generated by the method. The method steps are those of the 3C method. Brief Description of the Tables Table 1 shows 100 markers relating to early or late scleroderma, with 50 markers corresponding to each. Table 2 shows 100 markers relating to presence of scleroderma, with 50 associated with disease and 50 associated with absence of disease. 15 Table 3 shows 100 markers associated with early scleroderma. Table 4 shows 100 markers associated with late scleroderma. Table 5 shows 100 markers associated with presence of scleroderma. Table 6 shows 100 markers associated with the absence of scleroderma. Table 7 shows SHAPLEY results for markers associated with early scleroderma. 20 Table 8 shows SHAPLEY results for markers associated with late scleroderma. Table 9 shows SHAPLEY results for markers associated with presence of scleroderma. Table 10 shows SHAPLEY results for markers associated with absence of scleroderma. Detailed Description of the Invention Terms Used Herein 25 The chromosome interactions which are typed may be referred to as 'markers', 'CCS', 'chromosome conformation signature', 'epigenetic interaction' or 'EpiSwitch markers' herein. Such interactions are recognised in the art as regions of the chromosome coming together in a stable manner and this represents a distinct mode of regulation. A chromosome interaction can also be referred to as a 05 03 25 'juxtaposition' of chromosomes, chromosome 'folding' or 'chromatin interaction'. Such interactions can be detected, for example, using the 3C (chromosome conformation capture) method. The word 'type' will be interpreted as per the context, but will usually refer to detection of whether a specific chromosome interaction is present or absent. 5 Different subgroups are mentioned herein, but essentially the invention allows identification of groups relating to scleroderma, and in particular to early or late scleroderma. The invention therefore provides a method of diagnosis (or detecting) the stage of scleroderma or the presence or scleroderma. The chromosome interactions which are typed in the method of the invention are defined in Tables 1 to 6. They are defined by means of the probe sequences which detect the ligated product made by an 10 EpiSwitch method (see Figure 3). They are also defined by the position numbers of the interaction which are included within the probe name and they are also defined by the primer sequences which allow detection of the ligated sequence. The chromosome interaction can be defined by the 'probe location' given in the tables with reference to the chromosome number and the 'Start' and 'End' positions given for the chromosome regions which come together to form the interaction. 15 The word 'method' is used herein to refer to the 'process' of the invention, unless the context requires otherwise. Aspects of the Invention The invention relates to determining different aspects of scleroderma, particularly in respect to the presence or stage of scleroderma. This determining is by typing any of the relevant markers disclosed 20 herein, for example in Table 1 or 2, or preferred combinations of markers, or markers in defined specific regions disclosed herein. The typing may be of any of the markers shown in Table 3, 4, 5 or 6 or selections (combinations) of markers from these tables. Specific number of markers may be chosen from any group of markers which is specifically disclosed herein. Preferred numbers of markers are at least 3, 5, 8, 10, 15 and at least 20. Preferred groups of 25 markers are those shown in each table, or each part of a table (for example Table l.al), or all the markers associated with a distinct characteristic of scleroderma. The invention includes a process of typing a patient to identify whether they have scleroderma and / or the stage of scleroderma. The invention includes diagnosis of an individual for any condition or stage of disease as defined herein (i.e. prognosis), which can be thought of as determining the subgroup they 30 belong to. The scleroderma may be a skin fibrotic condition, which may preferably be scleroderma. 05 03 25 The invention also concerns a panel of epigenetic markers which relates to scleroderma. The panel may have been optimised in some way, for example by GLMNET analysis. The invention therefore allows personalised therapy to be given to the patient which accurately reflects the patient's needs. 5 Any therapy, for example drug, which is mentioned herein may be administered to an individual based on the result of the process. Marker sets are disclosed in the Tables and Figures. In one embodiment at least 10 markers from any disclosed marker set are used in the invention. In another embodiment at least 20% of the markers from any disclosed marker set are used in the invention. 10 The Process of the Invention The process of the invention comprises a typing system for detecting chromosome interactions relevant to scleroderma. This typing may be performed using the EpiSwitch™ system mentioned herein which is based on cross-linking regions of chromosome which have come together in the chromosome interaction, subjecting the chromosomal DNA to cleavage and then ligating the nucleic acids present in 15 the cross-linked entity to derive a ligated nucleic acid with sequence from both the regions which formed the chromosomal interaction. Detection of this ligated nucleic acid allows determination of the presence or absence of a particular chromosome interaction. The ligated nucleic acid therefore acts as a marker for the presence of the chromosome interaction. Preferably the ligated nucleic acid is detected by PCR or a probe based method, including a qPCR method. 20 Any suitable typing method can be used for detecting the presence or absence of chromosome interactions, for example a method in which the proximity of the chromosomes in the interaction is detected and / or in which a marker that reflects chromosome interaction status is detected. The chromosomal interactions may be identified using the process described herein in which populations of first and second nucleic acids are used. These nucleic acids can also be generated using 25 EpiSwitch™ technology. The Epigenetic Interactions Relevant to the Invention As used herein, the term 'epigenetic' and 'chromosome' interactions typically refer to interactions between distal regions of a chromosome, said interactions being dynamic and altering, forming or breaking depending upon the state of the region of the chromosome. That state will typically reflect the 30 presence or stage of scleroderma. 05 03 25 In particular processes of the invention chromosome interactions are typically detected by first generating a ligated nucleic acid that comprises sequence from both regions of the chromosomes that are part of the interactions. In such processes the regions can be cross-linked by any suitable means. In a preferred aspect, the interactions are cross-linked using formaldehyde, but may also be cross-linked by 5 any aldehyde, or D-Biotinoyl-e- aminocaproic acid-N-hydroxysuccinimide ester or Digoxigenin-3-O-methylcarbonyl-e-aminocaproic acid-N-hydroxysuccinimide ester. Para-formaldehyde can cross link DNA chains which are 4 Angstroms apart. Preferably the chromosome interactions are on the same chromosome. Typically the chromosome interactions are 2 to 10 Angstroms apart. The chromosome interaction may reflect the status of the region of the chromosome, for example, if it 10 is being transcribed or repressed in response to change of the physiological conditions. Chromosome interactions which are specific to subgroups as defined herein have been found to be stable, thus providing a reliable means of measuring the differences between the two subgroups. In addition, chromosome interactions specific to a scleroderma characteristic will normally occur early in a biological process, for example compared to other epigenetic markers such as methylation or changes 15 to binding of histone proteins. Thus the process of the invention is able to detect early stages of a biological process. This allows early intervention (for example treatment) which may as a consequence be more effective. Chromosome interactions also reflect the current state of the individual and therefore can be used to assess changes to disease status. Furthermore there is little variation in the relevant chromosome interactions between individuals within the same subgroup. Detecting 20 chromosome interactions is highly informative with up to 50 different possible interactions per gene, and so processes of the invention can for example interrogate 500,000 different interactions. Preferred Marker Sets Herein the term 'marker' or 'biomarker' refers to a specific chromosome interaction which can be detected (typed) in the invention. Specific markers are disclosed herein, any of which may be used in the 25 invention. Further sets of markers may be used, for example in the combinations or numbers disclosed herein. The specific markers disclosed in the tables herein are preferred as well as markers presents in genes and regions mentioned in the tables herein are preferred. These may be typed by any suitable process, for example the PCR or probe based methods disclosed herein, including a qPCR method. The markers are defined herein by location or by probe and / or primer sequences. 30 Location and Causes of Epigenetic Interactions Epigenetic chromosomal interactions may overlap and include the regions of chromosomes shown to encode relevant or undescribed genes, but equally may be in intergenic regions. It should further be 05 03 25 noted that the inventors have discovered that epigenetic interactions in all regions are equally important in determining the status of the chromosomal locus. These interactions are not necessarily in the coding region of a particular gene located at the locus and may be in intergenic regions. The chromosome interactions which are detected in the invention could be caused by changes to the underlying DNA sequence, by environmental factors, DNA methylation, non-coding antisense RNA transcripts, non-mutagenic carcinogens, histone modifications, chromatin remodelling and specific local DNA interactions. The changes which lead to the chromosome interactions may be caused by changes to the underlying nucleic acid sequence, which themselves do not directly affect a gene product or the mode of gene expression. Such changes may be for example, SNPs within and / or outside of the genes, gene fusions and / or deletions of intergenic DNA, microRNA, and non-coding RNA. For example, it is known that roughly 20% of SNPs are in non-coding regions, and therefore the process as described is also informative in non-coding situation. In one aspect the regions of the chromosome which come together to form the interaction are less than 5 kb, 3 kb, 1 kb, 500 base pairs or 200 base pairs apart on the same chromosome. The chromosome interaction which is detected is preferably within any of the genes in the regions defined by Table 1 or 2. The chromosome interaction which is detected is preferably within any of the genes in the regions defined by Table 3, 4, 5 or 6. However it may also be upstream or downstream of the gene, for example up to 50,000, up to 30,000, up to 20,000, up to 10,000 or up to 5000 bases upstream or downstream from the gene or from the coding sequence. Subgroups, Time Points and Personalised Treatment Typing according to the process of the invention may be carried out at multiple time points, for example to monitor the progression of the disease. This may be at one or more defined time points, for example at at least 1, 2, 5, 8 or 10 different time points. The durations between at least 1, 2, 5 or 8 of the time points may be at least 5,10, 20, 50, 80 or 100 days. Typically there are 3 time points at least 50 days apart. As used herein, a "subgroup" preferably refers to a population subgroup (a subgroup in a population), more preferably a subgroup in the population of a particular animal such as a particular eukaryote, or mammal. Most preferably, a "subgroup" refers to a subgroup in the human population. Therefore the most preferred type of individuals for all aspects of the inventions are humans. The invention includes detecting and treating particular subgroups in a population. The inventors have discovered that chromosome interactions differ between subsets (for example at least two subsets) in the relevant population. Identifying these differences will allow physicians to categorize their patients as 6 05 03 25 a part of one subset of the population. The invention therefore provides physicians with a process of personalizing medicine for the patient based on their epigenetic chromosome interactions. Such testing may be used to select how to subsequently treat the patient, for example the type of drug and / or its dose and / or its frequency of administration. Generating Ligated Nucleic Acids Certain aspects of the invention utilise ligated nucleic acids, in particular ligated DNA. These comprise sequences from both of the regions that come together in a chromosome interaction and therefore provide information about the interaction. The EpiSwitch™ process described herein uses generation of such ligated nucleic acids to detect chromosome interactions. Thus a process of the invention may comprise a step of generating ligated nucleic acids (e.g. DNA) by the following steps (including a process comprising these steps): (i) cross-linking of epigenetic chromosomal interactions present at the chromosomal locus, preferably in vitro; (ii) optionally isolating the cross-linked DNA from said chromosomal locus; (iii) subjecting said cross-linked DNA to cutting, for example by restriction digestion with an enzyme that cuts it at least once (in particular an enzyme that cuts at least once within said chromosomal locus); (iv) ligating said cross-linked cleaved DNA ends (in particular to form DNA loops); and (v) optionally identifying the presence of said ligated DNA and / or said DNA loops, in particular using techniques such as PCR (polymerase chain reaction), to identify the presence of a specific chromosomal interaction. These steps may be carried out to detect the chromosome interactions for any aspect mentioned herein. The steps may also be carried out to generate the first and / or second set of nucleic acids mentioned herein. PCR (polymerase chain reaction) may be used to detect or identify the ligated nucleic acid, for example the size of the PCR product produced may be indicative of the specific chromosome interaction which is present, and may therefore be used to identify the status of the locus. In preferred aspects the primers shown in Table 1 or 2 are used. In other preferred aspects the primers shown in Table 3, 4, 5 or 6 are used. The skilled person will be aware of numerous restriction enzymes which can be used to cut the DNA within the chromosomal locus of interest. It will be apparent that the particular enzyme used will 05 03 25 depend upon the locus studied and the sequence of the DNA located therein. A non-limiting example of a restriction enzyme which can be used to cut the DNA as described in the present invention is TaqL EpiSwitch™ Technology The EpiSwitch™ Technology also relates to the use of microarray EpiSwitch™ marker data in the 5 detection of epigenetic chromosome conformation signatures specific for phenotypes. Aspects such as EpiSwitch™ which utilise ligated nucleic acids in the manner described herein have several advantages. They have a low level of stochastic noise, for example because the nucleic acid sequences from the first set of nucleic acids of the present invention either hybridise or fail to hybridise with the second set of nucleic acids. This provides a binary result permitting a relatively simple way to measure a complex 10 mechanism at the epigenetic level. EpiSwitch™ technology also has fast processing time and low cost. In one aspect the processing time is 3 hours to 6 hours. Samples and Sample Treatment The process of the invention will normally be carried out on a sample. The sample may be obtained at a defined time point, for example at any time point defined herein. The sample will normally contain DNA 15 from the individual. It will normally contain cells. In one aspect a sample is obtained by minimally invasive means, and may for example be a blood sample. DNA may be extracted and cut up with a standard restriction enzyme. This can pre-determine which chromosome conformations are retained and will be detected with the EpiSwitch™ platforms. Due to the synchronisation of chromosome interactions between tissues and blood, including horizontal transfer, a blood sample can be used to 20 detect the chromosome interactions in tissues, such as tissues relevant to disease. Properties of Nucleic Acids of the Invention The invention relates to certain nucleic acids, such as the ligated nucleic acids which are described herein as being used or generated in the process of the invention. These may be the same as, or have any of the properties of, the first and second nucleic acids mentioned herein with reference to a 25 screening method described below. The nucleic acids of the invention typically comprise two portions each comprising sequence from one of the two regions of the chromosome which come together in the chromosome interaction. Typically each portion is at least 8,10,15, 20, 30 or 40 nucleotides in length, for example 10 to 40 nucleotides in length. Preferred nucleic acids comprise sequence from any of the genes mentioned in any of the tables. Typically preferred nucleic acids comprise the specific probe 30 sequences mentioned in Table 1, 2, 3, 4, 5 or 6; or fragments and / or homologues of such sequences. 05 03 25 Preferably the nucleic acids are DNA. It is understood that where a specific sequence is provided the invention may use the complementary sequence as required in the particular aspect. Preferably the nucleic acids are DNA. It is understood that where a specific sequence is provided the invention may use the complementary sequence as required in the particular aspect. The primers shown in Table 1 and 2 may also be used in the invention as mentioned herein. In one aspect primers are used which comprise any of: the sequences shown in Table 1 or 2; or fragments and / or homologues of any sequence shown in Table 1 or 2. The primers shown in Table 3, 4, 5 or 6 may also be used in the invention as mentioned herein. In one aspect primers are used which comprise any of: the sequences shown in Table 3, 4, 5 or 6; or fragments and / or homologues of any sequence shown in Table 3, 4, 5 or 6. The Second Set of Nucleic Acids - the 'Index' Sequences The second set of nucleic acid sequences has the function of being a set of index sequences, and is essentially a set of nucleic acid sequences which are suitable for identifying subgroup specific sequence. They can represents the 'background' chromosomal interactions and might be selected in some way or be unselected. They are in general a subset of all possible chromosomal interactions. The second set of nucleic acids may be derived by any suitable process. They can be derived computationally or they may be based on chromosome interaction in individuals. They typically represent a larger population group than the first set of nucleic acids. In one particular aspect, the second set of nucleic acids represents all possible epigenetic chromosomal interactions in a specific set of genes. In another particular aspect, the second set of nucleic acids represents a large proportion of all possible epigenetic chromosomal interactions present in a population described herein. In one particular aspect, the second set of nucleic acids represents at least 50% or at least 80% of epigenetic chromosomal interactions in at least 20, 50,100 or 500 genes, for example in 20 to 100 or 50 to 500 genes. The second set of nucleic acids typically represents at least 100 possible epigenetic chromosome interactions which modify, regulate or in any way mediate a phenotype in population. The second set of nucleic acids may represent chromosome interactions that affect a disease state (typically relevant to diagnosis or prognosis) in a species. The second set of nucleic acids typically comprises sequences representing epigenetic interactions both relevant and not relevant to a prognosis subgroup. In one particular aspect the second set of nucleic acids derive at least partially from naturally occurring sequences in a population, and are typically obtained by in silico processes. Said nucleic acids may further comprise single or multiple mutations in comparison to a corresponding portion of nucleic acids 9 05 03 25 present in the naturally occurring nucleic acids. Mutations include deletions, substitutions and / or additions of one or more nucleotide base pairs. In one particular aspect, the second set of nucleic acids may comprise sequence representing a homologue and / or orthologue with at least 70% sequence identity to the corresponding portion of nucleic acids present in the naturally occurring species. In 5 another particular aspect, at least 80% sequence identity or at least 90% sequence identity to the corresponding portion of nucleic acids present in the naturally occurring species is provided. Properties of the Second Set of Nucleic Acids In one particular aspect, there are at least 100 different nucleic acid sequences in the second set of nucleic acids, preferably at least 1000, 2000 or 5000 different nucleic acids sequences, with up to 10 100,000,1,000,000 or 10,000,000 different nucleic acid sequences. A typical number would be 100 to 1,000,000, such as 1,000 to 100,000 different nucleic acids sequences. All or at least 90% or at least 50% or these would correspond to different chromosomal interactions. In one particular aspect, the second set of nucleic acids represent chromosome interactions in at least 20 different loci or genes, preferably at least 40 different loci or genes, and more preferably at least 100, 15 at least 500, at least 1000 or at least 5000 different loci or genes, such as 100 to 10,000 different loci or genes. The lengths of the second set of nucleic acids are suitable for them to specifically hybridise according to Watson Crick base pairing to the first set of nucleic acids to allow identification of chromosome interactions specific to subgroups. Typically the second set of nucleic acids will comprise two portions corresponding in sequence to the two chromosome regions which come together in the 20 chromosome interaction. The second set of nucleic acids typically comprise nucleic acid sequences which are at least 10, preferably 20, and preferably still 30 bases (nucleotides) in length. In another aspect, the nucleic acid sequences may be at the most 500, preferably at most 100, and preferably still at most 50 base pairs in length. In a preferred aspect, the second set of nucleic acids comprises nucleic acid sequences of between 17 and 25 base pairs. In one aspect at least 100, 80% or 50% of the second 25 set of nucleic acid sequences have lengths as described above. Preferably the different nucleic acids do not have any overlapping sequences, for example at least 100%, 90%, 80% or 50% of the nucleic acids do not have the same sequence over at least 5 contiguous nucleotides. Given that the second set of nucleic acids acts as an 'index' then the same set of second nucleic acids may be used with different sets of first nucleic acids which represent subgroups for different 30 characteristics, i.e. the second set of nucleic acids may represent a 'universal' collection of nucleic acids which can be used to identify chromosome interactions relevant to different characteristics. The First Set of Nucleic Acids 05 03 25 The first set of nucleic acids are typically from subgroups relevant to scleroderma. The first nucleic acids may have any of the characteristics and properties of the second set of nucleic acids mentioned herein. The first set of nucleic acids is normally derived from samples from the individuals which have undergone treatment and processing as described herein, particularly the EpiSwitch™ cross-linking and cleaving steps. Typically the first set of nucleic acids represents all or at least 80% or 50% of the chromosome interactions present in the samples taken from the individuals. Typically, the first set of nucleic acids represents a smaller population of chromosome interactions across the loci or genes represented by the second set of nucleic acids in comparison to the chromosome interactions represented by second set of nucleic acids, i.e. the second set of nucleic acids is representing a background or index set of interactions in a defined set of loci or genes. Library of Nucleic Acids Any of the types of nucleic acid populations mentioned herein may be present in the form of a library comprising at least 200, at least 500, at least 1000, at least 5000 or at least 10000 different nucleic acids of that type, such as 'first' or 'second' nucleic acids. Such a library may be in the form of being bound to an array. The library may comprise some or all of the probes or primer pairs shown in Table 1 or 2. The library may comprise some or all of the probes or primer pairs shown in Table 3, 4, 5 or 6. The library may comprise all of the probe sequence from any of the tables disclosed herein. Hybridisation The invention typically requires a means for allowing wholly or partially complementary nucleic acid sequences from the first set of nucleic acids and the second set of nucleic acids to hybridise. In one aspect all of the first set of nucleic acids is contacted with all of the second set of nucleic acids in a single assay, i.e. in a single hybridisation step. However any suitable assay can be used. Labelled Nucleic Acids and Pattern of Hybridisation The nucleic acids mentioned herein may be labelled, preferably using an independent label such as a fluorophore (fluorescent molecule) or radioactive label which assists detection of successful hybridisation. Certain labels can be detected under UV light. The pattern of hybridisation, for example on an array described herein, represents differences in epigenetic chromosome interactions between the two subgroups, and thus provides a process of comparing epigenetic chromosome interactions and determination of which epigenetic chromosome interactions are specific to a subgroup in the population of the present invention. 05 03 25 The term 'pattern of hybridisation' broadly covers the presence and absence of hybridisation between the first and second set of nucleic acids, i.e. which specific nucleic acids from the first set hybridise to which specific nucleic acids from the second set, and so it not limited to any particular assay or technique, or the need to have a surface or array on which a 'pattern' can be detected. The Chromosome Interactions Which are Typed The chromosome interactions which are typed are: (i) those which specifically defined in any of Tables 1, 2, 3, 4, 5 or 6, for example either by probe sequence or by position numbers on the chromosome, and / or (ii) those which are present in the genes or regions defined in any of Tables 1, 2, 3, 4 5 or 6, and / or (iii) those present in a 4,000 base region which comprises or which flanks any specific chromosome interaction defined in any of Tables 1, 2, 3,4, 5 or 6. The chromosome interactions which are typed can be those mentioned in the subset shown in Figure 1 or 2. Any preferred number of chromosome interactions can be typed as mentioned herein from (i), (ii) or (iii), but typically at least 5, 8, 10, 12,15, 20, 30 or 40 interactions will be typed. Selecting a Subgroup with Particular Characteristics This section provides examples of the number of interactions that can be typed from any one table. The invention includes a process in which a specific combination of chromosome interactions are typed comprising at least 3, 5, 8,10 or 20 of the chromosome interactions represented by the probes in Table 1. In one embodiment at least 10 chromosome interactions represented by the probes in Table 1 are typed. The invention also includes a process in which specific combination of chromosome interactions are typed comprising at least 3, 5, 8, 10 or 20 of the chromosome interactions represented by the probes in Table 2. In one embodiment at least 10 chromosome interactions represented by the probes in Table 2 are typed. The invention provides a process in which all of the chromosome interactions represented by the probes in Table 1 are typed. In certain embodiments at least 30, 40, 50, 60 or 80 of the chromosome interactions represented by the probes in Table 1 are typed. In particular embodiments at least 10, 20, 30, 50 or 80 chromosome interactions are typed which are present in a 4,000 base region which comprises or which flanks the chromosome interactions represented by the probes in Table 1. 05 03 25 The invention provides a process in which all of the chromosome interactions represented by the probes in Table 2 are typed. In certain embodiments at least 30, 40, 50, 60 or 80 of the chromosome interactions represented by the probes in Table 2 are typed. In particular embodiments at least 10, 20, 30, 50 or 80 chromosome interactions are typed which are present in a 4,000 base region which comprises or which flanks the chromosome interactions represented by the probes in Table 2. The invention includes a process in which a specific combination of chromosome interactions are typed comprising at least 3, 5, 8, 10 or 20 of the chromosome interactions represented by the probes in Table 3. In one embodiment at least 10 chromosome interactions represented by the probes in Table 3 are typed. The invention provides a process in which all of the chromosome interactions represented by the probes in Table 3 are typed. In certain embodiments at least 30, 40, 50, 60 or 80 of the chromosome interactions represented by the probes in Table 3 are typed. In particular embodiments at least 10, 20, 30, 50 or 80 chromosome interactions are typed which are present in a 4,000 base region which comprises or which flanks the chromosome interactions represented by the probes in Table 3. The invention includes a process in which a specific combination of chromosome interactions are typed comprising at least 3, 5, 8,10 or 20 of the chromosome interactions represented by the probes in Table 4. In one embodiment at least 10 chromosome interactions represented by the probes in Table 4 are typed. The invention provides a process in which all of the chromosome interactions represented by the probes in Table 4 are typed. In certain embodiments at least 30, 40, 50, 60 or 80 of the chromosome interactions represented by the probes in Table 5 are typed. In particular embodiments at least 10, 20, 30, 50 or 80 chromosome interactions are typed which are present in a 4,000 base region which comprises or which flanks the chromosome interactions represented by the probes in Table 4. The invention includes a process in which a specific combination of chromosome interactions are typed comprising at least 3, 5, 8, 10 or 20 of the chromosome interactions represented by the probes in Table 5. In one embodiment at least 10 chromosome interactions represented by the probes in Table 5 are typed. The invention provides a process in which all of the chromosome interactions represented by the probes in Table 5 are typed. In certain embodiments at least 30, 40, 50, 60 or 80 of the chromosome interactions represented by the probes in Table 5 are typed. In particular embodiments at least 10, 20, 30, 50 or 80 chromosome interactions are typed which are present in a 4,000 base region which comprises or which flanks the chromosome interactions represented by the probes in Table 5. 05 03 25 The invention includes a process in which a specific combination of chromosome interactions are typed comprising at least 3, 5, 8, 10 or 20 of the chromosome interactions represented by the probes in Table 6. In one embodiment at least 10 chromosome interactions represented by the probes in Table 6 are typed. 5 The invention provides a process in which all of the chromosome interactions represented by the probes in Table 6 are typed. In certain embodiments at least 30, 40, 50, 60 or 80 of the chromosome interactions represented by the probes in Table 6 are typed. In particular embodiments at least 10, 20, 30, 50 or 80 chromosome interactions are typed which are present in a 4,000 base region which comprises or which flanks the chromosome interactions represented by the probes in Table 6. 10 The invention provides a process which comprises detecting the presence or absence of chromosome interactions, typically 5 to 20 or 5 to 500 such interactions, preferably 20 to 300 or 50 to 100 interactions, in order to determine the presence or absence of a characteristic relating to a subgroup. Preferably the chromosome interactions are those in any of the genes mentioned herein or in which chromosome interactions of the invention are present within. 15 In one aspect all of the interactions of Table 1 are typed. In one aspect all of the interactions of Table 2 are typed. In one aspect all of the interactions of Table 3 are typed. In one aspect all of the interactions of Table 4 are typed. In one aspect all of the interactions of Table 5 are typed. In one aspect all of the interactions of Table 6 are typed. In one aspect all of the interactions of Tables 3 and 4 are typed. In one aspect all of the interactions of Tables 5 and 6 are typed. In one aspect all of the interactions of Tables 3, 20 4, 5 and 6 are typed. The detection of certain interactions shows presence of the relevant characteristic, whilst the presence of other interactions shows absence of the relevant characteristic as described in the tables. Selecting Markers from Different Tables The chromosome interactions which are typed can be selected from a single table or from more than 25 one of Tables 1, 2, 3, 4, 5 or 6. Typically at least 5, 8, 10, 12, 15, 20, 25, 30, 40, 50, 60, 70, 80 interactions are typed. This number of interactions can be selected from 1, 2, 3,4, 5 of or all of the Tables 1, 2, 3, 4, 5 or 6. In one aspect at least 5, 8,10,12,15, 20 interactions to be typed are selected from all of Tables 3, 4, 5 and 6. In one aspect at least 3, 5, 8 or 10 interactions are selected from each of Tables 3 and 4. In one aspect at least 3, 5, 8 or 10 interactions are selected from each of Tables 5 and 6. In one aspect at 30 least 10 interactions to be typed are selected from each of Tables 3 and 4. In one aspect at least 10 interactions to be typed are selected from each of Tables 5 and 6. 05 03 25 Combinations of Markers Selected by SHAPLEY analysis A SHAPLEY analysis provides one way of measuring the performance of an individual marker. Tables 7 to 10 show the results of such modelling. In one aspect the markers to be typed can be selected based on these results, example based on any of the parameters which are shown. In a preferred aspect the 5 chromosome interactions which are typed represent the top 10, 20, 30,40, 50 or 60 markers selected based on such a parameter. In a preferred aspect the 'SHAPLEY_diff' column is used to provide an indication of the power of a marker, and so for example the marker ORFl_chr6_31267448_31269252_31531115_31534994_RF_l in Table 7 could be seen as the most powerful marker, given that it has the highest value for 10 'SHAPLEY_diff'. Tables 7 to 10 list the markers in order of magnitude of 'SHAPLEY_diff', going from the most important to the less important as one goes down each table. In one aspect at least 3 markers may be typed from the 5, 8, 10 or 20 markers shown at the top of Table 7. In one aspect at least 5 markers are typed from the 10 markers shown at the top of Table 7. In one aspect at least 5 markers may be typed from 20, 30, 40 or 50 markers shown at the top of Table 7. In 15 one aspect at least 10 markers may be typed from the 30, 40 or 50 markers shown at the top of Table 7. In one aspect at least the 5, 8 or 10 markers shown at the top of Table 7 may be typed. In one aspect at least 3 markers may be typed from the 5, 8,10 or 20 markers shown at the top of Table 8. In one aspect at least 5 markers are typed from the 10 markers shown at the top of Table 8. In one aspect at least 5 markers may be typed from 20, 30, 40 or 50 markers shown at the top of Table 8. In 20 one aspect at least 10 markers may be typed from the 30, 40 or 50 markers shown at the top of Table 8. In one aspect at least the 5, 8 or 10 markers shown at the top of Table 8 may be typed. In one aspect at least 3 markers may be typed from the 5, 8,10 or 20 markers shown at the top of Table 9. In one aspect at least 5 markers are typed from the 10 markers shown at the top of Table 9. In one aspect at least 5 markers may be typed from 20, 30, 40 or 50 markers shown at the top of Table 9. In 25 one aspect at least 10 markers may be typed from the 30, 40 or 50 markers shown at the top of Table 9. In one aspect at least the 5, 8 or 10 markers shown at the top of Table 9 may be typed. In one aspect at least 3 markers may be typed from the 5, 8,10 or 20 markers shown at the top of Table 10. In one aspect at least 5 markers are typed from the 10 markers shown at the top of Table 10. In one aspect at least 5 markers may be typed from 20, 30, 40 or 50 markers shown at the top of Table 10. In 30 one aspect at least 10 markers may be typed from the 30, 40 or 50 markers shown at the top of Table 10. In one aspect at least the 5, 8 or 10 markers shown at the top of Table 10 may be typed. The Individual that is Tested 05 03 25 The individual that is tested in the process of the invention may have been selected in some way. The individual may be susceptible to any condition mentioned herein and / or may be in need of any therapy mentioned in. The individual may be receiving any therapy mentioned herein. In particular, the 5 individual may have, or be suspected of having, scleroderma. The individual may have, or be suspected of having, a scleroderma condition that results in changes to the skin, blood vessels, muscles, and internal organs. The individual may have any one of the following symptoms: areas of thickened skin, stiffness, feeling tired, and poor blood flow to the fingers or toes with cold exposure. The individual may have, or be suspected of having, CREST syndrome, which may 10 manifest as calcium deposits, Raynaud's syndrome, esophageal problems, thickening of the skin of the fingers and toes, and areas of small dilated blood vessels. Types of Chromosome Interaction In one aspect the locus (including the gene and / or place where the chromosome interaction is detected) may comprise a CTCF binding site. This is any sequence capable of binding transcription repressor CTCF. 15 That sequence may consist of or comprise the sequence CCCTC which may be present in 1, 2 or 3 copies at the locus. The CTCF binding site sequence may comprise the sequence CCGCGNGGNGGCAG (in IUPAC notation). The CTCF binding site may be within at least 100, 500,1000 or 4000 bases of the chromosome interaction or within any of the chromosome regions shown Table 1 or 2. The CTCF binding site may be within at least 100, 500,1000 or 4000 bases of the chromosome interaction or within any of the 20 chromosome regions shown Table 3, 4, 5 or 6. When detection is performed using a probe, typically sequence from both regions of the probe (i.e. from both sites of the chromosome interaction) could be detected. In preferred aspects probes are used in the process which comprise or consist of the same or complementary sequence to a probe shown in any table. In some aspects probes are used which comprise sequence which is homologous to any of the 25 probe sequences shown in the tables. Tables Provided Herein Tables 1 to 6 show specific markers represented by probes and relevant data. The probe sequences show sequence which can be used to detect a ligated product generated from both sites of gene regions that have come together in chromosome interactions, i.e. the probe will comprise sequence which is 30 complementary to sequence in the ligated product. The first two sets of Start-End positions show probe positions, and the second two sets of Start-End positions show the relevant 4kb region. 05 03 25 Table 1 shows 100 markers relating to early or late scleroderma, with 50 markers corresponding to each. Table 2 shows 100 markers relating to presence of scleroderma, with 50 associated with disease and 50 associated with absence of disease. Table 3 shows 100 markers associated with early scleroderma. Table 4 shows 100 markers associated with late scleroderma. Table 5 shows 100 markers associated with presence of scleroderma. Table 6 shows 100 markers associated with the absence of scleroderma. The following information is provided in the probe data table: RP - Rsum the Rank Product statistics evaluated per each chromosome interaction FC - Interaction frequency (positive or negative) Pfp - estimated percentage of false positive predictions (pfp), both considering positive and negative chromosome interactions Pval - estimated pvalues per each CCSs being positive and negative Adj.P.value(FDR) - False discovery rate adjusted p.value Loop Detected - which state the loop is found in Simple permutation-based estimation is used to determine how likely a given RP value or better is observed in a random experiment. This has the following steps: 1. Generate p permutations of k rank lists of length n. 2. Calculate the rank products of the n CCS in the p permutations. 3. Count (c) how many times the rank products of the CCS in the permutations are smaller or equal to the observed rank product. Set c to this value. 4. Calculate the average expected value for the rank product by: Erp(g)=c / p. 5. Calculate the percentage of false positives as: pfp (g)=Erp(g) / rank (g) where rank(g) is the rank of CCS g in a list of all n CCSs sorted by increasing RP. The rank product statistic ranks chromosome interactions according to intensities within each microarray and calculates the product of these ranks across multiple microarrays. This technique can identify chromosome interactions that are consistently detected among the most differential chromosome interactions in a number of replicated microarrays. Where the p-value is 0 this indicates that there is very little variation in the Rank Product of the CCS across the samples, this is a good example of the signal to noise and effect size of CCS. Where p value is 0 and pfp is 0 this means that permutated Rank Product doesn't differ from the actual observed Rank Product. These methods are 17 05 03 25 described Breitling R and Herzyk P (2005) Rank-based methods as a non-parametric alternative of the t-test for the analysis of biological microarray data. J Bioinf Comp Biol 3,1171-1189. The FC indicates prevalence of marker in each comparison, 2 means twice over average test, 1.5 means 1.5 over the average test, etc., and so FC indicates the weight of a marker to phenotype / group. The FC value can be used to give an indication of how many markers are needed for a highly effective test. The probes are designed to be 30bp away from the Taql site. In case of PCR, PCR primers are typically designed to detect ligated product but their locations from the Taql site vary. Probe locations: Start 1 - 30 bases upstream of Taql site on fragment 1 End 1 - Taql restriction site on fragment 1 Start 2 - Taql restriction site on fragment 2 End 2 - 30 bases downstream of Taql site on fragment 2 4kb Sequence Location: Start 1 - 4000 bases upstream of Taql site on fragment 1 End 1 - Taql restriction site on fragment 1 Start 2 - Taql restriction site on fragment 2 End 2 - 4000 bases downstream of Taql site on fragment 2 SHAPLEY analysis can show the importance of each marker. It related to the marginal contribution of the marker to the Random Forest Model. The Shapley value is a solution concept in cooperative game theory applied to Machine learning to explain the contribution of markers to models Table 7 shows SHAPLEY results for markers associated with early scleroderma. Table 8 shows SHAPLEY results for markers associated with late scleroderma. Table 9 shows SHAPLEY results for markers associated with presence of scleroderma. Table 10 shows SHAPLEY results for markers associated with absence of scleroderma. In these tables the following information is provided: HC_SHAPLEY - Health Control Class SHAPLEY value SSc_SHAPLEY - SSc Class SHAPLEY value E_SHAPLEY - Early Class SHAPLEY value L_SHAPLEY - Late Class SHAPLEY value SHAPLEY_diff - Difference between the two classes SHAPLEY Values RPs_classl_class2 - Rank Product Difference RPrank_classl_class2 - Rank Product Rank pfp_classl_class2 - percentage of false predictions pval_classl_class2 - Rank Product Pvalue LogFC - Log Abundance Difference FC - Linear Abundance Difference The Approach Taken to Identify Markers and Panels of Markers 05 03 25 The invention described herein relates to chromosome conformation profile and 3D architecture as a regulatory modality in its own right, closely linked to the phenotype. The discovery of biomarkers was based on annotations through pattern recognition and screening on representative cohorts of clinical samples representing the differences in phenotypes. We annotated and screened significant parts of the genome, across coding and non-coding parts and over large sways of non-coding 5' and 3' of known genes for identification of statistically disseminating consistent conditional disseminating chromosome conformations, which for example anchor in the non-coding sites within (intronic) or outside of open reading frames. In selection of the best markers we are driven by statistical data and p values for the marker leads. Selected and validated chromosome conformations within the signature are disseminating stratifying entities in their own right, irrespective of the expression profiles of the genes used in the reference. Further work may be done on relevant regulatory modalities, such as SNPs at the anchoring sites, changes in gene transcription profiles, changes at the level of H3K27ac. We are taking the question of clinical phenotype differences and their stratification from the basis of fundamental biology and epigenetics controls over phenotype - including for example from the framework of network of regulation. As such, to assist stratification, one can capture changes in the network and it is preferably done through signatures of several biomarkers, for example through following a machine learning algorithm for marker reduction which includes evaluating the optimal number of markers to stratify the testing cohort with minimal noise. This may end with 3-20 markers. Selection of markers for panels may be done by cross-validation statistical performance (and not for example by the functional relevance of the neighbouring genes, used for the reference name). A panel of markers (with names of adjacent genes) is a product of clustered selection from the screening across significant parts of the genome, in non-biased way analysing statistical disseminating powers over 14,000-60,000 annotated EpiSwitch sites across significant parts of the genome. It should not be perceived as a tailored capture of a chromosome conformation on the gene of know functional value for the question of stratification. The total number of sites for chromosome interaction are 1.2 million, and so the potential number of combinations is 1.2 million to the power 1.2 million. The approach that we have followed nevertheless allows the identifying of the relevant chromosome interactions. The specific markers that are provided by this application have passed selection, being statistically (significantly) associated with the condition. This is what the data in the relevant table demonstrates. Each marker can be seen as representing an event of biological epigenetic as part of network 05 03 25 deregulation that is manifested in the relevant condition. In practical terms it means that these markers are prevalent across groups of patients when compared to controls. On average, as an example, an individual marker may typically be present in 80% of patients tested and in 10% of controls tested. Simple addition of all markers would not represent the network interrelationships between some of the 5 deregulations. This is where the standard multivariate biomarker analysis GLMNET (R package) is brought in. GLMNET package helps to identify interdependence between some of the markers, that reflect their joint role in achieving deregulations leading to disease phenotype. Modelling and then testing markers with highest GLMNET scores offers not only identify the minimal number of markers that accurately identifies the patient cohort, but also the minimal number that offers the least false 10 positive results in the control group of patients, due to background statistical noise of low prevalence in the control group. Typically a group (combination) of selected markers (such as 3 to 10) offers the best balance between both sensitivity and specificity of detection, emerging in the context of multivariate analysis from individual properties of all the selected statistical significant markers for the condition. The tables herein show the reference names for the array probes (60-mer) for array analysis that 15 overlaps the juncture between the long range interaction sites, the chromosome number and the start and end of two chromosomal fragments that come into juxtaposition. Preferred Aspects for Sample Preparation and Chromosome Interaction Detection Methods of preparing samples and detecting chromosome conformations are described herein. Optimised (non-conventional) versions of these processes can be used, for example as described in this 20 section. Typically the sample will contain at least 2 xlO5 cells. The sample may contain up to 5 xlO5 cells. In one aspect, the sample will contain 2 xlO5 to 5.5 xlO5 cells Crosslinking of epigenetic chromosomal interactions present at the chromosomal locus is described herein. This may be performed before cell lysis takes place. Cell lysis may be performed for 3 to 7 25 minutes, such as 4 to 6 or about 5 minutes. In some aspects, cell lysis is performed for at least 5 minutes and for less than 10 minutes. Digesting DNA with a restriction enzyme is described herein. Typically, DNA restriction is performed at about 55°C to about 70°C, such as for about 65°C, for a period of about 10 to 30 minutes, such as about 20 minutes. 05 03 25 Preferably a frequent cutter restriction enzyme is used which results in fragments of ligated DNA with an average fragment size up to 4000 base pair. Optionally the restriction enzyme results in fragments of ligated DNA have an average fragment size of about 200 to 300 base pairs, such as about 256 base pairs. In one aspect, the typical fragment size is from 200 base pairs to 4,000 base pairs, such as 400 to 2,000 or 500 to 1,000 base pairs. In one aspect of the EpiSwitch process a DNA precipitation step is not performed between the DNA restriction digest step and the DNA ligation step. DNA ligation is described herein. Typically the DNA ligation is performed for 5 to 30 minutes, such as about 10 minutes. The protein in the sample may be digested enzymatically, for example using a proteinase, optionally Proteinase K. The protein may be enzymatically digested for a period of about 30 minutes to 1 hour, for example for about 45 minutes. In one aspect after digestion of the protein, for example Proteinase K digestion, there is no cross-link reversal or phenol DNA extraction step. In one aspect PCR detection is capable of detecting a single copy of the ligated nucleic acid, preferably with a binary read-out for presence / absence of the ligated nucleic acid. Figure 3 shows a preferred process of detecting chromosome interactions. Processes and Uses of the Invention The process of the invention can be described in different ways. It can be described as a process of making a ligated nucleic acid comprising (i) in vitro cross-linking of chromosome regions which have come together in a chromosome interaction; (ii) subjecting said cross-linked DNA to cutting or restriction digestion cleavage; and (iii) ligating said cross-linked cleaved DNA ends to form a ligated nucleic acid, wherein detection of the ligated nucleic acid may be used to determine the chromosome state at a locus, and wherein preferably: - the locus may be any of the loci or regions mentioned in Table 1, 2, 3, 4, 5 or 6, and / or - wherein the chromosomal interaction may be any of the chromosome interactions mentioned herein or corresponding to any of the probes disclosed in Table 1, 2, 3, 4, 5 or 6, and / or - wherein the ligated product may have or comprise (i) sequence which is the same as or homologous to any of the probe sequences disclosed in Table 1, 2, 3, 4, 5 or 6; or (ii) sequence which is complementary to (ii). 05 03 25 The process of the invention can be described as a process for detecting chromosome states which represent different subgroups in a population comprising determining whether a chromosome interaction is present or absent within a defined epigenetically active region of the genome, wherein preferably: 5 - the subgroup is defined by presence or stage of scleroderma, and / or the chromosome state may be at any locus or region mentioned in Table 1, 2, 3, 4, 5 or 6; and / or the chromosome interaction may be any of those mentioned in Table 1, 2, 3, 4, 5 or 6, or corresponding to any of the probes disclosed in those tables. 10 Use of the Process of the Invention to Identify New Treatments Knowledge of chromosome interactions can be used to identify new treatments for conditions. The invention provides processes and uses of chromosome interactions defined herein to identify or design new therapeutic agents, for example relating to therapy of scleroderma or related sub-conditions. Homologues 15 Homologues of polynucleotide / nucleic acid (e.g. DNA) sequences are referred to herein. Such homologues typically have at least 70% homology, preferably at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99% homology, for example over a region of at least 10, 15, 20, 30,100 or more contiguous nucleotides, or across the portion of the nucleic acid which is from the region of the chromosome involved in the chromosome interaction. The homology may be 20 calculated on the basis of nucleotide identity (sometimes referred to as "hard homology"). Therefore, in a particular aspect, homologues of polynucleotide / nucleic acid (e.g. DNA) sequences are referred to herein by reference to percentage sequence identity. Typically such homologues have at least 70% sequence identity, preferably at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99% sequence identity, for example over a region of at least 10,15, 20, 30, 25 100 or more contiguous nucleotides, or across the portion of the nucleic acid which is from the region of the chromosome involved in the chromosome interaction. For example the UWGCG Package provides the BESTFIT program which can be used to calculate homology and / or % sequence identity (for example used on its default settings) (Devereux et al (1984) Nucleic Acids Research 12, p387-395). The PILEUP and BLAST algorithms can be used to calculate 30 homology and / or % sequence identity and / or line up sequences (such as identifying equivalent or 05 03 25 corresponding sequences (typically on their default settings)), for example as described in Altschul S. F. (1993) J Mol Evol 36:290-300; Altschul, S, F et al (1990) J Mol Biol 215:403-10. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pair (HSPs) by 5 identifying short words of length W in the query sequence that either match or satisfy some positivevalued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al, supra). These initial neighbourhood word hits act as seeds for initiating searches to find HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be 10 increased. Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W5 T and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 15 scoring matrix (see Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. USA 89:10915-10919) alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands. The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the 20 probability by which a match between two polynucleotide sequences would occur by chance. For example, a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001. The homologous sequence typically differs by 1, 2, 3, 4 or more bases, such as less than 10,15 or 20 25 bases (which may be substitutions, deletions or insertions of nucleotides). These changes may be measured across any of the regions mentioned above in relation to calculating homology and / or % percentage sequence identity. Homology of a 'pair of primers' can be calculated, for example, by considering the two sequences as a single sequence (as if the two sequences are joined together) for the purpose of then comparing against 30 the another primer pair which again is considered as a single sequence. Arrays 05 03 25 The second set of nucleic acids may be bound to an array, and in one aspect there are at least 15,000, 45,000, 100,000 or 250,000 different second nucleic acids bound to the array, which preferably represent at least 300, 900, 2000 or 5000 loci. In one aspect one, or more, or all of the different populations of second nucleic acids are bound to more than one distinct region of the array, in effect 5 repeated on the array allowing for error detection. The array may be based on an Agilent SurePrint G3 Custom CGH microarray platform. Detection of binding of first nucleic acids to the array may be performed by a dual colour system. Therapeutic Agents This section is relevant both to: 10 - therapeutic agents which are given to individuals selected by the process of the invention, and - therapeutic agents which are selected based on the results of the process of the invention. The invention provides therapeutic agents for use in preventing or treating a disease condition in certain individuals, for example those identified by a process of the invention. This may comprise administering to an individual in need a therapeutically effective amount of the agent. The invention provides use of 15 the agent in the manufacture of a medicament to prevent or treat a condition in certain individuals. The disease or condition may be scleroderma or a stage of scleroderma. The formulation of the agent will depend upon the nature of the agent. The agent will be provided in the form of a pharmaceutical composition containing the agent and a pharmaceutically acceptable carrier or diluent. Suitable carriers and diluents include isotonic saline solutions, for example phosphate-20 buffered saline. Typical oral dosage compositions include tablets, capsules, liquid solutions and liquid suspensions. The agent may be formulated for parenteral, intravenous, intramuscular, subcutaneous, transdermal or oral administration. The dose of an agent may be determined according to various parameters, especially according to the substance used; the age, weight and condition of the individual to be treated; the route of 25 administration; and the required regimen. A physician will be able to determine the required route of administration and dosage for any particular agent. A suitable dose may however be from 0.1 to 100 mg / kg body weight such as 1 to 40 mg / kg body weight, for example, to be taken from 1 to 3 times daily. The therapeutic agent may be any such agent disclosed herein, or may target any 'target' disclosed herein, including any protein or gene disclosed herein in any table. It is understood that any agent that is 30 disclosed in a combination should be seen as also disclosed for administration individually. Therapeutic agents which can be used in the invention include: 05 03 25 - inflammation therapy, such as NSAIDs (e.g. ibuprofen) or corticosteroids (e.g. prednisone); - immunosuppressive therapy, such astocilizumab, methotrexate, cyclosporine, antithymocyte globulin, mycophenolate mofetil or cyclophosphamide; - vascular therapy, such as nifedipine, renin, endothelin, prostaglandins and nitric oxide, bosentan, epoprostenol (prostacyclin) or aspirin; - anti-fibrotic agents, such as colchicine, para-aminobenzoic acid (PABA), dimethyl sulfoxide or D-penicillamine. The therapeutic agent may be selected from the following: - lenabasum - IL 4 / IL13 combination - immunoglobin, preferably delivered intravenously - ROCK inhibitor - pirfenidone with MMF - oncostatin M - putotaxin inhibitor - brentuximab vedotin - teprotumumab - a TGF beta trap, preferably a TGF beta 1,3 trap. Astocilizumab is a preferred therapeutic agent. Forms of the Substance Mentioned Herein Any of the substances, such as nucleic acids or therapeutic agents, mentioned herein may be in purified or isolated form. They may be in a form which is different from that found in nature, for example they may be present in combination with other substance with which they do not occur in nature. The nucleic acids (including portions of sequences defined herein) may have sequences which are different to those found in nature, for example having at least 1, 2, 3, 4 or more nucleotide changes in the sequence as described in the section on homology. The nucleic acids may have heterologous sequence at the 5' or 3' end. The nucleic acids may be chemically different from those found in nature, for example they may be modified in some way, but preferably are still capable of Watson-Crick base pairing. Where appropriate the nucleic acids will be provided in double stranded or single stranded form. The invention provides all of the specific nucleic acid sequences mentioned herein in single or double stranded form, and thus includes the complementary strand to any sequence which is disclosed. 05 03 25 The invention provides a kit for carrying out any process of the invention, including detection of a chromosomal interaction relating to prognosis. Such a kit can include a specific binding agent capable of detecting the relevant chromosomal interaction, such as agents capable of detecting a ligated nucleic acid generated by processes of the invention. Preferred agents present in the kit include probes capable 5 of hybridising to the ligated nucleic acid or primer pairs, for example as described herein, capable of amplifying the ligated nucleic acid in a PCR reaction. A kit of the invention may comprise means to detect a panel of markers, such as any number of combination of markers disclosed herein. The invention provides use of a reagent for preparing kit for carrying out the process of the invention. Such a reagent may be any suitable substance mentioned herein, such as the agents which are capable 10 of detection of products of detection processes, including reagents which are any of the probes or primers mentioned herein. The invention provides use of the reagent in the process of the invention. The invention provides use of the reagent in the preparing of a means for carrying out the invention. The invention also provides a process for detecting a characteristic of scleroderma, including detecting the stage of scleroderma or the presence of scleroderma. 15 The invention provides a method of obtaining diagnostic information relating to scleroderma, such as the stage and / or presence of scleroderma. The invention provides a method of detecting a chromosome state defined by any number or combination of chromosome interactions disclosed herein. The invention provides a method of detecting a specific pattern of chromosome interactions, for example as defined by any number or combination of chromosome interactions disclosed herein. 20 The invention provides a device that is capable of detecting the relevant chromosome interactions. The device preferably comprises any specific binding agents, probe or primer pair capable of detecting the chromosome interaction, such as any such agent, probe or primer pair described herein. The invention provides use of detection of chromosome interactions as defined herein (for example by number or specific combination) to detect a characteristic of scleroderma, for example as defined 25 herein. The invention provides use of a reagent (for example a probe, primer, label, device or array) in any method of the invention. The Threshold of Detection The markers which are disclosed herein have been found to be 'disseminating markers' capable of determining the relevant subgroup and Tables 1 to 6 show which subgroup each marker is present in. 30 In practical terms it means that these markers are prevalent across the relevant subgroup when compared to controls (as is shown by the FC value, for example). On average, as an example, an 05 03 25 individual marker may typically be present in 80% of the relevant subgroup and in 10% of controls (for the subgroup). When testing an individual the result will be a combination of 'present' and 'absent' chromosome interactions for each of the markers shown in Tables 1 to 6 allowing determination of the subgroup for the individual. Typically presence / absence of at least 8 markers out of 10 compared to the 'ideal' result shown in the table can be used to assign the individual to a subgroup. Types of Method The invention relates to markers which are effective detecting a characteristic relating to scleroderma as described herein. Clearly different numbers of markers can be used as the basis of a test. In one aspect the invention provides a process for detecting a chromosome state which represents a subgroup in a population comprising determining whether a chromosome interaction relating to that chromosome state is present or absent within a defined region of the genome; wherein: (i) one or more chromosome interactions are typed which are associated with early stage scleroderma from Tables 1 and 3 and if at least 70% or 80% of these are present the individual is classed as have early stage scleroderma, and / or (ii) one or more chromosome interactions are typed which are associated with early stage scleroderma from Tables 1 and 3 and if at least 70% or 80% of these are absent the individual is classed as not having early stage scleroderma, and / or (iii) one or more chromosome interactions are typed which are associated with late stage scleroderma from Tables 1 and 4 and if at least 70% or 80% of these are present the individual is classed as have late stage scleroderma, and / or (iv) one or more chromosome interactions are typed which are associated with late stage scleroderma from Tables 1 and 4 and if at least 70% or 80% of these are absent the individual is classed as not having late stage scleroderma, and / or (v) one or more chromosome interactions are typed which are associated with presence of scleroderma from Tables 2 and 5 and if at least 70% or 80% of these are present the individual is classed as having scleroderma, and / or (vi) one or more chromosome interactions are typed which are associated with presence of scleroderma from Tables 2 and 5 and if at least 70% or 80% of these are absent the individual is classed as not having scleroderma, and / or 05 03 25 (vii) one or more chromosome interactions are typed which are associated with absence of scleroderma from Tables 2 and 6 and if at least 70% or 80% of these are present the individual is classed as having absence of scleroderma, and / or (viii) one or more chromosome interactions are typed which are associated with absence of scleroderma 5 from Tables 2 and 6 and if at least 70% or 80% of these are absent the individual is classed as having scleroderma. In this aspect any number and combination of markers may be typed, for example as disclosed herein. Detection Process In one aspect quantitative detection of the ligated sequence which is relevant to a chromosome 10 interaction is carried out using a probe which is detectable upon activation during a PCR reaction, wherein said ligated sequence comprises sequences from two chromosome regions that come together in an epigenetic chromosome interaction, wherein said process comprises contacting the ligated sequence with the probe during a PCR reaction, and detecting the extent of activation of the probe, and wherein said probe binds the ligation site. The process typically allows particular interactions to be 15 detected in a MIQE compliant manner using a dual labelled fluorescent hydrolysis probe. The probe is generally labelled with a detectable label which has an inactive and active state, so that it is only detected when activated. The extent of activation will be related to the extent of template (ligation product) present in the PCR reaction. Detection may be carried out during all or some of the PCR, for example for at least 50% or 80% of the cycles of the PCR. 20 The probe can comprise a fluorophore covalently attached to one end of the oligonucleotide, and a quencher attached to the other end of the nucleotide, so that the fluorescence of the fluorophore is quenched by the quencher. In one aspect the fluorophore is attached to the 5'end of the oligonucleotide, and the quencher is covalently attached to the 3' end of the oligonucleotide. Fluorophores that can be used in the process of the invention include FAM, TET, JOE, Yakima Yellow, 25 HEX, Cyanine3, ATTO 550, TAMRA, ROX, Texas Red, Cyanine 3.5, LC610, LC 640, ATTO 647N, Cyanine 5, Cyanine 5.5 and ATTO 680. Quenchers that can be used with the appropriate fluorophore include TAM, BHQ1, DAB, Eclip, BHQ2 and BBQ650, optionally wherein said fluorophore is selected from HEX, Texas Red and FAM. Preferred combinations of fluorophore and quencher include FAM with BHQ1 and Texas Red with BHQ2. 05 03 25 Use of the Probe in a qPCR Assay Hydrolysis probes of the invention are typically temperature gradient optimised with concentration matched negative controls. Preferably single-step PCR reactions are optimized. More preferably a standard curve is calculated. An advantage of using a specific probe that binds across the junction of the ligated sequence is that specificity for the ligated sequence can be achieved without using a nested PCR approach. The processes described herein allow accurate and precise quantification of low copy number targets. The target ligated sequence can be purified, for example gel-purified, prior to temperature gradient optimization. The target ligated sequence can be sequenced. Preferably PCR reactions are performed using about lOng, or 5 to 15 ng, or 10 to 20ng, or 10 to 50ng, or 10 to 200ng template DNA. Forward and reverse primers are designed such that one primer binds to the sequence of one of the chromosome regions represented in the ligated DNA sequence, and the other primer binds to other chromosome region represented in the ligated DNA sequence, for example, by being complementary to the sequence. Choice of Ligated DNA Target The invention includes selecting primers and a probe for use in a PCR process as defined herein comprising selecting primers based on their ability to bind and amplify the ligated sequence and selecting the probe sequence based properties of the target sequence to which it will bind, in particular the curvature of the target sequence. Probes are typically designed / chosen to bind to ligated sequences which are juxtaposed restriction fragments spanning the restriction site. In one aspect of the invention, the predicted curvature of possible ligated sequences relevant to a particular chromosome interaction is calculated, for example using a specific algorithm referenced herein. The curvature can be expressed as degrees per helical turn, e.g. 10.5° per helical turn. Ligated sequences are selected for targeting where the ligated sequence has a curvature propensity peak score of at least 5° per helical turn, typically at least 10°, 15° or 20° per helical turn, for example 5° to 20° per helical turn. Preferably the curvature propensity score per helical turn is calculated for at least 20, 50,100, 200 or 400 bases, such as for 20 to 400 bases upstream and / or downstream of the ligation site. Thus in one aspect the target sequence in the ligated product has any of these levels of curvature. Target sequences can also be chosen based on lowest thermodynamic structure free energy. Particular Aspects In one aspect only intrachromosomal interactions are typed / detected, and no extrachromosomal interactions (between different chromosomes) are typed / detected. 05 03 25 In particular aspects certain chromosome interactions are not typed, for example any specific interaction mentioned herein (for example as defined by any probe or primer pair mentioned herein). In some aspects chromosome interactions are not typed in any of the genes relevant to chromosome interactions mentioned herein. 5 The data provided herein shows that the markers are 'disseminating' ones able to differentiate cases and non-cases for the relevant disease situation. Therefore when carrying out the invention the skilled person will be able to determine by detection of the interactions which subgroup the individual is in. In one embodiment a threshold value of detection of at least 70% of the tested markers in the form they are associated with the relevant subgroup situation may be used to determine whether the individual is 10 in the relevant subgroup. In one aspect any single marker disclosed in any table might be typed together any other number or combination of markers disclosed herein (for example from the same table or one or more other tables). In one aspect 1, 2, 3, 4, or more groups of markers may be typed which are each a number or combination of markers disclosed herein. 15 In one aspect 200 or less markers are typed, for example 100 or less markers, 50 or less, 25 or less, or 20 or less markers are typed. In one aspect 200 or less of the specific markers shown in the tables are typed, for example 100 or less, 50 or less, 25 or less, or 20 or less such markers are typed. Screening process The invention provides a process of determining which chromosomal interactions are relevant to a 20 chromosome state corresponding to an prognosis subgroup of the population, comprising contacting a first set of nucleic acids from subgroups with different states of the chromosome with a second set of index nucleic acids, and allowing complementary sequences to hybridise, wherein the nucleic acids in the first and second sets of nucleic acids represent a ligated product comprising sequences from both the chromosome regions that have come together in chromosomal interactions, and wherein the 25 pattern of hybridisation between the first and second set of nucleic acids allows a determination of which chromosomal interactions are specific to an prognosis subgroup. The subgroup may be any of the specific subgroups defined herein, for example with reference to particular conditions or therapies. Publications The contents of all publications mentioned herein are incorporated by reference into the present 30 specification and may be used to further define the features relevant to the invention. The contents of 05 03 25 all priority applications are incorporated by reference into the present specification and may be used to define the features relevant to the invention. Use of a Classifier The method of the invention may include analysis of the chromosome interactions identified in the individual, for example using a classifier, which may increase performance, such as sensitivity or specificity. The classifier is typically one that has been 'trained' on samples from the population and such training may assist the classifier to detect any subgroup mentioned herein. Specific Aspects The EpiSwitch™ platform technology detects epigenetic regulatory signatures of regulatory changes between normal and abnormal conditions at loci. The EpiSwitch™ platform identifies and monitors the fundamental epigenetic level of gene regulation associated with regulatory high order structures of human chromosomes also known as chromosome conformation signatures. Chromosome signatures are a distinct primary step in a cascade of gene deregulation. They are high order biomarkers with a unique set of advantages against biomarker platforms that utilize late epigenetic and gene expression biomarkers, such as DNA methylation and RNA profiling. EpiSwitch ™ Array Assay The custom EpiSwitch™ array-screening platforms come in 4 densities of, 15K, 45K, 100K, and 250K unique chromosome conformations, each chimeric fragment is repeated on the arrays 4 times, making the effective densities 60K, 180K, 400K and 1 Million respectively. Custom Designed EpiSwitch ™ Arrays The 15K EpiSwitch™ array can screen the whole genome including around 300 loci interrogated with the EpiSwitch™ Biomarker discovery technology. The EpiSwitch™ array is built on the Agilent SurePrint G3 Custom CGH microarray platform; this technology offers 4 densities, 60K, 180K, 400K and 1 Million probes. The density per array is reduced to 15K, 45K, 100K and 250K as each EpiSwitch™ probe is presented as a quadruplicate, thus allowing for statistical evaluation of the reproducibility. The average number of potential EpiSwitch™ markers interrogated per genetic loci is 50, as such the numbers of loci that can be investigated are 300, 900, 2000, and 5000. EpiSwitch™ Custom Array Pipeline The EpiSwitch™ array is a dual colour system with one set of samples, after EpiSwitch™ library generation, labelled in Cy5 and the other of sample (controls) to be compared / analyzed labelled in Cy3. The arrays are scanned using the Agilent SureScan Scanner and the resultant features extracted using 05 03 25 the Agilent Feature Extraction software. The data is then processed using the EpiSwitch™ array processing scripts in R. The arrays are processed using standard dual colour packages in Bioconductor in R: Limma *. The normalisation of the arrays is done using the normalisedWithinArrays function in Limma * and this is done to the on chip Agilent positive controls and EpiSwitch™ positive controls. The data is 5 filtered based on the Agilent Flag calls, the Agilent control probes are removed and the technical replicate probes are averaged, in order for them to be analysed using Limma*. The probes are modelled based on their difference between the 2 scenarios being compared and then corrected by using False Discovery Rate. Probes with Coefficient of Variation (CV) <=30% that are <=-1.1 or =>1.1 and pass the p<=0.1 FDR p-value are used for further screening. To reduce the probe set further Multiple Factor 10 Analysis is performed using the FactorMineR package in R. * Note: LIMMA is Linear Models and Empirical Bayes Processes for Assessing Differential Expression in Microarray Experiments. Limma is an R package for the analysis of gene expression data arising from microarray or RNA-Seq. The pool of probes is initially selected based on adjusted p-value, FC and CV <30% (arbitrary cut off 15 point) parameters for final picking. Further analyses and the final list are drawn based only on the first two parameters (adj. p-value; FC). Statistical Pipeline EpiSwitch™ screening arrays are processed using the EpiSwitch™ Analytical Package in R in order to select high value EpiSwitch™ markers for translation on to the EpiSwitch™ PCR platform. 20 Step 1 Probes are selected based on their corrected p-value (False Discovery Rate, FDR), which is the product of a modified linear regression model. Probes below p-value <= 0.1 are selected and then further reduced by their Epigenetic ratio (ER), probes ER have to be <=-1.1 or =>1.1 in order to be selected for further analysis. The last filter is a coefficient of variation (CV), probes have to be below <=0.3. 25 Step 2 The top 40 markers from the statistical lists are selected based on their ER for selection as markers for PCR translation. The top 20 markers with the highest negative ER load and the top 20 markers with the highest positive ER load form the list. Step 3 30 The resultant markers from step 1, the statistically significant probes form the bases of enrichment analysis using hypergeometric enrichment (HE). This analysis enables marker reduction from the significant probe list, and along with the markers from step 2 forms the list of probes translated on to the EpiSwitch™ PCR platform. The statistical probes are processed by HE to determine which genetic locations have an enrichment of statistically significant probes, indicating which genetic locations are hubs of epigenetic difference. 5 The most significant enriched loci based on a corrected p-value are selected for probe list generation. Genetic locations below p-value of 0.3 or 0.2 are selected. The statistical probes mapping to these genetic locations, with the markers from step 2, form the high value markers for EpiSwitch™ PCR translation. Array design and processing 10 Arrgy Design 05 03 25 1. Genetic loci are processed using the Sil software (currently v3.2) to: a. Pull out the sequence of the genome at these specific genetic loci (gene sequence with 50kb upstream and 20kb downstream) b. Define the probability that a sequence within this region is involved in CCs Cut the sequence using a specific RE Determine which restriction fragments are likely to interact in a certain orientation Rank the likelihood of different CCs interacting together. Determine array size and therefore number of probe positions available (x) Pull out x / 4 interactions. For each interaction define sequence of 30bp to restriction site from part 1 and 30bp to restriction site of part 2. Check those regions that are not repeats, if so exclude and take next interaction down on the list. Join both 30bp to define probe. 5. Create list of x / 4 probes plus defined control probes and replicate 4 times to create list to be created on array Upload list of probes onto Agilent Sure design website for custom CGH array. Use probe group to design Agilent custom CGH array. Army Processing 05 03 25 1. Process samples using EpiSwitch™ Standard Operating Procedure (SOP) for template production. 2. Clean up with ethanol precipitation by array processing laboratory. 3. Process samples as per Agilent SureTag complete DNA labelling kit - Agilent Oligonucleotide 5 Array-based CGH for Genomic DNA Analysis Enzymatic labelling for Blood, Cells or Tissues 4. Scan using Agilent C Scanner using Agilent feature extraction software. EpiSwitch™ biomarker signatures demonstrate high robustness, sensitivity and specificity in the stratification of complex disease phenotypes. This technology takes advantage of the latest breakthroughs in the science of epigenetics, monitoring and evaluation of chromosome conformation 10 signatures as a highly informative class of epigenetic biomarkers. Current research methods deployed in academic environment require from 3 to 7 days for biochemical processing of cellular material in order to detect CCSs. Those procedures have limited sensitivity, and reproducibility; and furthermore, do not have the benefit of the targeted insight provided by the EpiSwitch™ Analytical Package at the design stage. 15 EpiSwitch ™ Array in silico marker identification CCS sites across the genome are directly evaluated by the EpiSwitch™ Array on clinical samples from testing cohorts for identification of all relevant stratifying lead biomarkers. The EpiSwitch™ Array platform is used for marker identification due to its high-throughput capacity, and its ability to screen large numbers of loci rapidly. The array used was the Agilent custom-CGH array, which allows markers 20 identified through the in silico software to be interrogated. EpiSwitch™ PCR Potential markers identified by EpiSwitch™ Array are then validated either by EpiSwitch™ PCR or DNA sequencers (i.e. Roche 454, Nanopore MinlON, etc.). The top PCR markers which are statistically significant and display the best reproducibility are selected for further reduction into the final 25 EpiSwitch™ Signature Set, and validated on an independent cohort of samples. EpiSwitch™ PCR can be performed by a trained technician following a standardised operating procedure protocol established. All protocols and manufacture of reagents are performed under ISO 13485 and 9001 accreditation to ensure the quality of the work and the ability to transfer the protocols. EpiSwitch™ PCR and EpiSwitch™ Array biomarker platforms are compatible with analysis of both whole blood and cell lines. The tests are 30 sensitive enough to detect abnormalities in very low copy numbers using small volumes of blood. Annotations Used in The Tables 05 03 25 The tables give names to particular sets of probes and primers to be used in aspects of the invention. Alternative primer names for the following PCR marker sets are shown below: For OBD168-669.671: OBD168-013.015 5 For OBD168-1729.1731: OBD168-265.267 For OBD168-1841.1843: OBD168-353.355 For OBD168-1361.1363: OBD168-97.99 For OBD168-1529.1531: OBD168-645.647 For OBD168-681.683: OBD168-661.663 10 For OBD168-921.923: OBD168-717.719 For OBD168-893.895: OBD168-705.707 For OBD168-1273.1275: OBD168-749.751 For OBD168-1629.1631: OBD168-737.739 For OBD168-885.887: OBD168-733.735 15 For OBD168-1741.1743: OBD168-781.783 The invention is illustrated by the following Examples: Chromatin Conformation Signature Analysis in Early vs Late Scleroderma / Scleroderma Phenotypes In this work systemic sclerosis is being used as a model disease to investigate the chromatin conformation signature relevant to scleroderma. 20 Systemic sclerosis (scleroderma, SSc) is a heterogeneous scleroderma disease in which clinical outcomes vary widely. Predicting outcomes on an individual basis remains challenging despite progress made through autoantibody analysis and gene expression profiling. Effective targeted therapies are evolving and accurately predicting outcomes is important to enable patient stratification for therapy. Scleroderma (systemic sclerosis, SSc) is a severe connective tissue disease in which an autoimmune 25 process at onset is associated with downstream scleroderma of the skin and internal organs, as well as vascular damage. In general, SSc is difficult to treat and patients continue to suffer a disabling, progressive and potentially lethal disease. Comprehensive genetic studies have indicated association of scleroderma susceptibility with genes involved in innate and adaptive immunity. Activated macrophages are seen to infiltrate into the perivascular tissue at an early stage of the disease, 30 expressing markers of the profibrotic M2 phenotype, such as CD206 and secreting growth factors such as TGFP which drive scleroderma. Macrophages derived from SSc patients display an activation signature characterised by high CD206 and elevated arginasel, highest in patients with severe disease. 05 03 25 Soluble CD206 is elevated in plasma and tissue fluid of patients as a biomarker of the M2 activation state. In co-culture, SSc macrophages secrete factors which stimulate fibroblasts to increase collagen I production. In the present work, through profiling of blood derived macrophages a mixed activation state of 5 macrophages has been identified in this disease. This includes identifying a macrophage activation signature which indicates a combined pro-inflammatory as well as M2-like pro-fibrotic state. Macrophages form patients release inflammatory proteins characteristic of this disease including IL-6, but are also pro-fibrotic, stimulating fibroblasts in co-culture. Using a signature across 3 markers (IFN¥, CD206 and Argl) an activation signature present in 50% of patients has been identified, which is not 10 seen in healthy control samples. These characteristics persist in tissue culturing implying that the signature results from an epigenetic change which fundamentally alters the macrophage state. Likely initiating factors including Th2 cytokines encountered in the disease microenvironment, tissue stiffness in the disease microenvironment, or stimulation by antibody / antigen complexes carried into the cells systemically. 15 Chromatin Conformation Signature (CCS) profiling of peripheral blood for systemic epigenetic deregulations was used in this work. The EpiSwitch platform offering high throughput and resolution chromosome conformation (3C) capture detects significant regulatory changes in 3D genome architecture and maps long range interaction between distant genomic locations. This, in turn, reveals the spatial disposition and physical properties of the chromosome, such as chromatin loops and inter- 20 chromosomal connections, which have a role in network organization and genetic epistasis controlling gene expression. This methodology was applied to patients with SSc to identify CCS associated with different phenotypes and can be used to stratify and identify patients into pathogenic subtypes. We aimed to determine significant chromatin conformation signatures associated with presence of 25 scleroderma and also detection of early and late phenotypes of scleroderma. The EpiSwitch - based chromosome conformation capture (3C) method was applied to blood samples from early phenotype, and late phenotype SSc patients. Intact nuclei were isolated from peripheral blood mononuclear cells and subjected to formaldehyde fixation resulting in crosslinking between physically touching segments of the genome via contacts between their DNA bound proteins. For 30 quantification of cross-linking frequencies, the cross-linked DNA was digested and then subjected to ligation. Cross-linking was then reversed and individual ligation products detected and quantified by EpiSwitch custom oligo array annotated across the whole genome to the anchoring sites of 3D genome architecture. The UK sample cohort consisted of 4 Healthy Controls and 6 Scleroderma patient samples. The 6 Scleroderma patients were split between Early and Late stage disease. EpiSwitch libraries were 5 generated from the received sample cohort (n=8) using the Robotic Delta9.1 with Qiagen column purification protocols. A pooled control was created from the 4 extracted Healthy control samples. These libraries were processed for using on the custom designed Agilent CGH array. Results 7 significant CCSs were found over the HLA-C, HLA-B and TNF regions on Chromosome 6 in the early 10 phenotype. The top 10 pathways for genetic locations associated to the CCSs are shown in the table below for the early phenotype. 05 03 25 GeneSet 1 Natural Killer cell mediated cytotoxicity 2 Immunoregulatory interactions between a lymphoid cell and a non-lymphoid cell 3 Antigen Processing &presentation 4 Phagosome 5 Graft versus host disease 6 Type 1 diabetes mellitus 7 Osteoclast differentiation 8 Class 1 MHC mediated antigen processing &presentation 9 Rheumatoid Arthritis 10 GnRH signalling pathway 2 significant CCSs were found centred around the IFNG region of chromosome 12 in the late phenotype. The top 10 pathways for genetic locations associated to significant CCSs are shown in the table below 15 for the late phenotype. GeneSet 1 Surfactant metabolism 2 IL12 signalling mediated by STAT4 3 Protein digestion and absorption 4 Calcineruin regulated NFAT dependent transcription in lymphocytes 5 Transcriptional mis-regulation in cancer 6 Kaposi's sarcoma associated herpes virus infection 7 IL2 mediated signalling events 8 Inflammatory bowel disease 9 Interleukin-20 Family signalling 10 AP-1 transcription factor network 05 03 25 Table 1 and Table 2 show the markers that were identified by this work. They represent part of the 3D genomic regulatory control. There were distinct CCSs in the early phenotype compared to the late showing the CCSs change as the disease progresses and varies between phenotypes. The CCSs can be 5 linked to each clinically defined subgroup to be used as a biomarker tool to predict outcome and progression in patients. The present work therefore provides both diagnostic and prognostic markers. Subsequent work done in the same way identified the markers shown in Tables 3 to 6. The data provided in Tables 1 to 6 show the efficacy of these markers in identifying the subgroups they are associated with. 10 It must be appreciated that identifying the markers shown in the tables required the testing of many potential markers. A total of 170229 markers were studied in an array. In the first analysis, they were shortlisted to 100 diagnostic (HC VS SSc) and prognostic (late SSc VS early SSc) markers, (170029 dropped out). In the second analysis, a shortlist of top 200 prognostic (unique markers present in early and late SSc) and 200 diagnostic (unique markers present in SSc and HC) markers prepared (169829 15 dropped out). For the second set of markers of Tables 3 to 6 additional modelling values has been provided based on a SHAPLEY analysis. The markers were used to build a Random Forest model and the markers contribution to the models was calculated using SHAPLEY. The results are shown in Tables 7 to 10, where the SHAPLEY difference column in each tab is the variable to rank importance, the larger the difference the 20 more important it is in the model. The top 100 markers for either early v late disease or SSc v pHC (healthy control), generate an average model accuracy of 94%, this is compared to a mean average of 45% when you randomly select 100 markers and do this 100 times. This difference in classifying accuracy clearly demonstrates the power of the statistically selected markers. In conclusion, the present work has led to the identification of markers which each have a powerful association with a distinct characteristic of scleroderma, and therefore individual markers or small numbers of these markers can be the basis of an effective test for the stage or presence of scleroderma. 05 03 25 05 03 25 probe gene.index RP / Rsum FC:(classl / class2) 1 ORFl_chr9_117652733_117662476_117782539_117784298_FF_l 27640 66.27 0.1915 2 ORFl_chr21_21135567_21136687_2119O498_21197349_RR_l 17045 79.99 0.3925 3 C)RFl_chrl2_108190915_108198003_108364371_108366987_FR_l 41612 75.78 0.3598 4 ORFl_chr8_138185388_138192430_138316302_138317782_FF_l 101290 88.9 0.3921 5 ORFl_chr6_104807984_104813896_104858263_104859297_FR_l 123015 60.98 0.3632 6 ORFl_chr7_73838719_73840112_73998797_74003463_FF_l 88433 52.65 0.3224 7 ORFl_chr6_149O191_1492799_1612178_1614243_FR_l 109136 40.25 0.2393 8 ORFl_chrl3_109624423_109630621_109869387_109876529_RF_l 116786 103.6 0.4592 9 ORFl_chr3_171788979_171791691_171971435_171976171_RF_l 38725 162 0.2839 10 ORFl_chrl3_102842718_102847079_102927740_102931657_FR_l 65746 168.2 0.4991 11 C)RFl_chrX_40971005_40973842_41006985_41010257_RF_l 93949 159.5 0.3908 12 C)RFl_chr4_26084879_26086604_26290850_26293788_FR_l 33330 173.8 0.476 13 C)RFl_chrl3_109869387_109876529_109901846_109907608_FF_l 60814 196.5 0.5216 14 ORFl_chrll_21505657_21511320_21625659_21628201_FR_l 69339 180.6 0.5138 15 ORFl_chrl3_102842718_102847079_102867709_102871733_FF_l 62134 157.6 0.4919 16 ORFl_chrl3_102842718_102847079_102952727_102953846_FF_l 57139 194.4 0.5129 17 ORFl_chr3_179490429_179499685_179696553_179701788_RF_l 32920 153.2 0.1938 18 ORFl_chrl3_109869387_109876529_109994965_109996722_FR_l 130780 191.1 0.5202 19 C)RFl_chrl3_42949707_42958335_43086110_43092272_RF_l 34008 188.2 0.1628 20 ORFl_chrl0_93375413_93378505_93410956_93413925_FR_l 97132 137.7 0.4814 21 ORFl_chrl_182254591_182258498_182271295_182272617_RR_l 106543 144.6 0.4902 22 ORFl_chr6_104807984_104813896_104859297_104866639_FF_l 135912 150.5 0.4555 23 ORFl_chr3_35637910_35639568_35705745_35720206_RF_l 28231 206.9 0.524 24 ORFl_chr8_81130626_81134961_81156168_81161109_RF_l 33879 135.9 0.3518 25 ORFl_chrll_61243450_61246026_61388261_61391790_FR_l 117098 242 0.5319 26 ORFl_chr4_107675768_107680919_107825397_107833109_FF_l 63807 246.5 0.5419 27 ORFl_chrl_193456875_193464580_193519461_193528788_RR_l 11362 262.4 0.501 28 ORFl_chrll_79134716_79152601_79219225_79225698_FR_l 33877 277.3 0.1144 29 ORFl_chr6_152821O3_15283199_15362212_15366665_RR_l 33469 294.6 0.2127 30 ORFl_chrll_35101113_35109487_35250591_35252942_RR_l 70719 292.6 0.5615 31 ORFl_chrll_111144097_111148048_111222819_111226135_FF_l 26876 289 0.5585 32 ORFl_chrl8_62522952_62526928_62633916_62637110_RR_l 73540 305.3 0.5596 33 ORFl_chrl8_63796182_63806119_63902371_63912126_RF_l 46660 312.7 0.5488 34 ORFl_chr4_59658576_59668116_59701046_59706041_RF_l 34142 320.9 0.4449 35 ORFl_chr2_68857299_68862999_68948O41_68951799_RF_l 26296 348.7 0.482 36 ORFl_chrl4_61751727_61758003_61810071_61812335_FR_l 139473 344.4 0.5737 37 ORFl_chr21_33072222_33074551_33276086_33283169_RF_l 38327 398.6 0.4507 38 ORFl_chrll_111222819_111226135_111261363_111265949_FR_l 43619 383.4 0.5574 39 ORFl_chr4_38671979_38673590_38888275_38891480_RF_l 36577 389.3 0.2779 40 ORFl_chr3_114010550_114016075_114047949_114051357_RF_l 33335 405.1 0.2532 41 C)RFl_chrl4_61490070_61495640_61751727_61758003_RF_l 53496 398.1 0.5138 42 ORFl_chrl5_67887204_67889122_68052888_68053975_FR_l 38981 434.3 0.2186 43 ORFl_chrl4_9674OO36_96741996_9682O569_96823739_RF_l 129511 447.6 0.5956 44 ORFl_chr8_116637960_116642220_116837668_116843681_FR_l 87182 461.1 0.3976 45 ORFl_chr7_43764O36_43765883_43792676_43795674_RR_l 37245 487.1 0.3162 46 ORFl_chrll_78798294_78806874_79036088_79041510_RF_l 40619 486.4 0.6055 47 C)RFl_chrl2_103575776_103578331_103663674_103664970_FR_l 32922 505.5 0.2152 48 ORFl_chr6_13375878_13378557_13523152_13526281_FF_l 33742 556.4 0.2342 49 C)RFl_chrll_21505657_21511320_21751405_21757053_FR_l 131989 552.9 0.4888 50 ORFl_chr5_54531220_54532270_54669234_54674643_FF_l 22667 574.6 0.4734 Table l.al 05 03 25 Probe sequence Pfp P.value CCSs ................................................................... mer 1 0.06903 0.000001957 Late ACAAAACTGATGATGCCTTGCAACAAACTCGATAGAAGAGAAAAACAAGCTCAGAGCAAC 2 0.0699 0.000002972 Late CCAACGGCATATAAAACTGAGAAGAGCTTCGACTCTGAGTCTTCTTCTTCAGTGTTCTGG 3 0.07439 0.000002635 Late TCCTTTCCTTCAAGTCTTTAATCAAACCTCGATGCAGAACCTGAATGGACAACTTCTGGA 4 0.0757 0.000003755 Late TGTAAGACTATCAAATTAGCCAAAATCTTCGAAAGCAGAAAATAAAAAGATAGATTTGGT 5 0.07646 0.000001625 Late ACAAAAATTAGAAAAGTAACTGATAACCTCGACTACGAAAAATAAGTAAGAGTAGCACTT 6 0.08262 0.000001171 Late ACTGAGGGCACCGACTATCAGCACCGCGTCGAAAATCATAATCTGGGGCCCTCTCTCCTC 7 0.09039 6.404E-07 Late ATATCCAATCAGAGTGGAAATATCAGAGTCGAAACTAAAAAAAAAAAATCCAATTAAAAA 8 0.09278 0.000005259 Late GGGTAGGGAAGTAAAAGAAAATGGTGCTTCGATTCCCATTGAAGCTAAGTCTGCAGTTTA 9 0.1239 0.00001404 Late TTCAGTTCAATGAGGAAAAGTCTCATAATCGAGGATGAATAAAACAGACATTGTCCTCAA 10 0.1267 0.00001526 Late GAGGTCAGTAAGGAGAGCAGAGTAGACTTCGATTCTCCTCTTATCACTCCCTTCCTTGAA 11 0.1278 0.00001358 Late ATGCGGTGCTGAGTTGTGCTATGGCAACTCGAACTCCTAACCTCAAATGGTCTTCCCGCC 12 0.1284 0.00001638 Late AGCCATCAAACAGAACCGGAAAAGTGGCTCGAGAAGAGAATCGTAAATGAAATACATAAA 13 0.1314 0.00002142 Late GGGTAGGGAAGTAAAAGAAAATGGTGCTTCGATCCTCTCCATCAAGTCTCCTCTCTCTAG 14 0.1323 0.00001781 Late CCTACAAC1 1 1C L1A1 1 1 GT AC Illi CCTCGATAAATTTATG 1 1 1ATTTAAAAAAATTTG 15 0.1333 0.00001322 Late GAGGTCAGTAAGGAGAGCAGAGTAGACTTCGAAGAATATTTAATAAAATGTAAATATGCC 16 0.1343 0.00002094 Late GAGGTCAGTAAGGAGAGCAGAGTAGACTTCGAAI 1 1C1 1 1ATTGACATGTTCTCACTCAT 17 0.135 0.00001243 Late CCTTCTCTTTTCTTCCTTTTCC1 1 ICI 1 ICGATAGATAGAGACATATATGAGAGGGGATT 18 0.1354 0.00002015 Late GGGTAGGGAAGTAAAAGAAAATGGTGCTTCGAGTTAAGACTGTTCTGAGTCCTGTAAAAA 19 0.1376 0.0000195 Late ACTGC1 1 1 1 1GCCATAAAGCCTACCTTATCGAGAAAATTCTTAAAAGAACAC1 1 1 1 1CC1 20 0.1389 0.00000984 Late ACATAAAATGATA1 1 1CAGAT1 1 1GCCGTCGAGCTATGTGAGTCTGAGTAAG1 1 1C1 1AA 21 0.1405 0.00001095 Late GCGGAGATCTTTCAAGAAATTTATTTAATCGATAGTATGTACCCTTGATATGATATGATG 22 0.1406 0.00001195 Late ACAAAAATTAGAAAAGTAACTGATAACCTCGAGTCATCTATTTGATATCTCCACTTCAGT 23 0.1409 0.00002397 Late CACTGAGTATTTTCATCTAATCTTTCACTCGAATAGTTGGAAAATAATTACCTACTCATC 24 0.1499 0.000009559 Late ATGGAAATCTGAGTAAAGAAATTCATGGTCGAGCCAAGAGGAAGGAAGAAACGGCGGTGG 25 0.1903 0.0000337 Late CCTGGCTCCTTCCTGTATTATGCTCCCTTCGAGAAGTAGAATATCTGAATGTTCTTATAT 26 0.1904 0.00003508 Late AAATACAAAGAAAAACATCAGAGCAGTATCGACCATGCACTCAGAAGCI 1 1 IACAGGGAA 27 0.2102 0.00004021 Late CACCTCATCAGCACTCAGAAGAGAACAGTCGACAGTTAAGAGATCCTGGTTAAGGGATGG 28 0.2284 0.00004531 Late TACAACAATTTA1 1 1 1 1GGTTTAAAAGCTCGAGCTCAGCTTTCCAGCATGTGTAAGCTGT 29 0.2352 0.00005166 Late TGGTCTCTACTTAAAATACAGAAATTGGTCGAAAATATATCAGTTTAAGTGTTATTGAGG 30 0.2395 0.00005091 Late ACATACCCCTAAGAATGCTCAGAAATACTCGAGAAATGATATGTTTGTATACTATCCTTT 31 0.2413 0.00004958 Late CTGTTCTAAGCCTAAAAAGAATATATATTCGACTACTGTGAATAGGGCTGCAATAAGCAT 32 0.2462 0.00005582 Late CCTCACCTCCGCCAATCAGCACCGCGAATCGATCCCTTTGGATTCTCAGGTCCCCATCTT 33 0.2515 0.00005881 Late ATATAGAAATGGTACTGATTTTTGTACGTCGAAATTAAAAGTTCAAAAATACATTTCTTA 34 0.2583 0.00006222 Late GGGGAAGATAAGTGATCATAI 1 1C1ACTTCGATCAAGCATACATAATAGACATCTACAGA 35 0.2919 0.00007446 Late AGTCTAAAATAGTGGTTTGAACAAGTAGTCGAGGAGGAAAGAAAAACCTCTCAGGTCCAT 36 0.2922 0.00007247 Late ATGCAAGAGAAATTACATAACAGAGGGCTCGATGTTTACCTTGAACTGAGTAAAATCAAA 37 0.3459 0.00009803 Late AGCCATGGACAACTTATTGTGTTCAAGTTCGATTTGTTACAGACGTTAACAAATTCCTTT 38 0.3469 0.00009095 Late ATGCTTATTGCAGCCCTATTCACAGTAGTCGAATTATTTTCAAATAACATCATAAAATTC 39 0.3479 0.00009367 Late TCCCTGTCTTCTAAATAATAAGAGAGAATCGACACTAGACTTGTTTAGAAGACCTCACTG 40 0.348 0.0001011 Late GATATGCAGCTACTATCTTACTGCATCCTCGATATTAAATCCCTACTAACTTCCAATGAT 41 0.3539 0.00009779 Late ATGCAAGAGAAATTACATAACAGAGGGCTCGACTCATGAGTCTGACTGCTTTGTGCCTTA 42 0.3878 0.0001154 Late AGCTGACTTATGTACCAGATACTTTGTTTCGATCAGGGTAGACTGAGAAGTGAATGTGAA 43 0.401 0.0001222 Late GCAGATCTCTAGAACTTAATTTGCAAATTCGATTAAATGCTTATTATGTGTTTATTTAGC 44 0.4147 0.0001293 Late TAACATTCTGATACCACTACACCTGAGTTCGACTAATTATGATGGTGAAGGAGCAGAAGA 45 0.44 0.0001434 Late TCTAGAGAGAACATC1 1 1C1 1CAGCAGATCGAAGTG 1 1C1 1 1CTCTGTATTTGTCTCGTT 46 0.4485 0.000143 Late CATTGGAGGCACTCAAAAAAAAAAAAAATCGATTGTGACCTAATTTGATAACAGGGCTTT 47 0.4617 0.0001537 Late AAATTATA1 1 1 1C1 1AGGTTAATCGTCCTCGATCATTATA1 1 1AAGGCCCACACTAATTC 48 0.5196 0.0001841 Late ACCTGCTGGGACAACTGAAAGATTATTATCGAGTCTAAACATCTACATGGGATTAGTAAT 49 0.524 0.0001819 Late CCTACAAC 1 1 1C L1A1 1 1G 1 AC 1 1 1 1CCTCGAGGAAATAATTCACTAGGTAAAGGGAGTA 50 0.5305 0.0001954 Late TACAGATATGCTTGTTGTATGTCACGTGTCGACATAAATATTTGTTGAACAAGTAAATGA 05 03 25 Probe Location 4 kb Sequence Location Chr Stam Endl Start2 End2 Chr Startl Endl Starts End2 1 chr9 117662445 117662474 117784267 117784296 chr9 117658475 117662474 117780297 117784296 2 chr21 21135569 21135598 21190500 21190529 chr21 21135569 21139568 21190500 21194499 3 chrl2 108197972 108198001 108364373 108364402 chrl2 108194002 108198001 108364373 108368372 4 chr8 138192399 138192428 138317751 138317780 chr8 138188429 138192428 138313781 138317780 5 chr6 104813865 104813894 104858265 104858294 chr6 104809895 104813894 104858265 104862264 6 chr7 73840081 73840110 74003432 74003461 chr7 73836111 73840110 73999462 74003461 7 chr6 1492768 1492797 1612180 1612209 chr6 1488798 1492797 1612180 1616179 8 chrl3 109624425 109624454 109876498 109876527 chrl3 109624425 109628424 109872528 109876527 9 chr3 171788981 171789010 171976140 171976169 chr3 171788981 171792980 171972170 171976169 10 chrl3 102847048 102847077 102927742 102927771 chrl3 102843078 102847077 102927742 102931741 11 chrX 40971007 40971036 41010226 41010255 chrX 40971007 40975006 41006256 41010255 12 chr4 26086573 26086602 26290852 26290881 chr4 26082603 26086602 26290852 26294851 13 chrl3 109876498 109876527 109907577 109907606 chrl3 109872528 109876527 109903607 109907606 14 chrll 21511289 21511318 21625661 21625690 chrll 21507319 21511318 21625661 21629660 15 chrl3 102847048 102847077 102871702 102871731 chrl3 102843078 102847077 102867732 102871731 16 chrl3 102847048 102847077 102953815 102953844 chrl3 102843078 102847077 102949845 102953844 17 chr3 179490431 179490460 179701757 179701786 chr3 179490431 179494430 179697787 179701786 18 chrl3 109876498 109876527 109994967 109994996 chrl3 109872528 109876527 109994967 109998966 19 chrl3 42949709 42949738 43092241 43092270 chrl3 42949709 42953708 43088271 43092270 20 chrlO 93378474 93378503 93410958 93410987 chrlO 93374504 93378503 93410958 93414957 21 chrl 182254593 182254622 182271297 182271326 chrl 182254593 182258592 182271297 182275296 22 chr6 104813865 104813894 104866608 104866637 chr6 104809895 104813894 104862638 104866637 23 chr3 35637912 35637941 35720175 35720204 chr3 35637912 35641911 35716205 35720204 24 chr8 81130628 81130657 81161078 81161107 chr8 81130628 81134627 81157108 81161107 25 chrll 61245995 61246024 61388263 61388292 chrll 61242025 61246024 61388263 61392262 26 chr4 107680888 107680917 107833078 107833107 chr4 107676918 107680917 107829108 107833107 27 chrl 193456877 193456906 193519463 193519492 chrl 193456877 193460876 193519463 193523462 28 chrll 79152570 79152599 79219227 79219256 chrll 79148600 79152599 79219227 79223226 29 chr6 15282105 15282134 15362214 15362243 chr6 15282105 15286104 15362214 15366213 30 chrll 35101115 35101144 35250593 35250622 chrll 35101115 35105114 35250593 35254592 31 chrll 111148017 111148046 111226104 111226133 chrll 111144047 111148046 111222134 111226133 32 chrl8 62522954 62522983 62633918 62633947 chrl8 62522954 62526953 62633918 62637917 33 chrl8 63796184 63796213 63912095 63912124 chrl8 63796184 63800183 63908125 63912124 34 chr4 59658578 59658607 59706010 59706039 chr4 59658578 59662577 59702040 59706039 35 chr2 68857301 68857330 68951768 68951797 chr2 68857301 68861300 68947798 68951797 36 chrl4 61757972 61758001 61810073 61810102 chrl4 61754002 61758001 61810073 61814072 37 chr21 33072224 33072253 33283138 33283167 chr21 33072224 33076223 33279168 33283167 38 chrll 111226104 111226133 111261365 111261394 chrll 111222134 111226133 111261365 111265364 39 chr4 38671981 38672010 38891449 38891478 chr4 38671981 38675980 38887479 38891478 40 chr3 114010552 114010581 114051326 114051355 chr3 114010552 114014551 114047356 114051355 41 chrl4 61490072 61490101 61757972 61758001 chrl4 61490072 61494071 61754002 61758001 42 chrl5 67889091 67889120 68052890 68052919 chrl5 67885121 67889120 68052890 68056889 43 chrl4 96740038 96740067 96823708 96823737 chrl4 96740038 96744037 96819738 96823737 44 chr8 116642189 116642218 116837670 116837699 chr8 116638219 116642218 116837670 116841669 45 chr7 43764038 43764067 43792678 43792707 chr7 43764038 43768037 43792678 43796677 46 chrll 78798296 78798325 79041479 79041508 chrll 78798296 78802295 79037509 79041508 47 chrl2 103578300 103578329 103663676 103663705 chrl2 103574330 103578329 103663676 103667675 48 chr6 13378526 13378555 13526250 13526279 chr6 13374556 13378555 13522280 13526279 49 chrll 21511289 21511318 21751407 21751436 chrll 21507319 21511318 21751407 21755406 50 chr5 54532239 54532268 54674612 54674641 chr5 54528269 54532268 54670642 54674641 05 03 25 probe Primer ID 1 ORF1_9_117652733_117662476_117782539_117784298_FF OBD168-001 2 ORF1_21_21135567_21136687_2119O498_21197349_RR OBD168-005 3 C)RFl_12_108190915_108198003_108364371_108366987_FR OBD168-009 4 ORF1_8_138185388_138192430_138316302_138317782_FF OBD168-013 5 C)RFl_6_104807984_104813896_104858263_104859297_FR OBD168-017 6 ORF1_7_73838719_73840112_73998797_74003463_FF OBD168-021 7 ORF1_6_149O191_1492799_1612178_1614243_FR OBD168-025 8 ORF1_13_109624423_109630621_109869387_109876529_RF OBD168-029 9 ORF1_3_171788979_171791691_171971435_171976171_RF OBD168-033 10 ORF1_13_102842718_102847079_102927740_102931657_FR OBD168-037 11 C)RFl_X_40971005_40973842_41006985_41010257_RF OBD168-041 12 C)RFl_4_26084879_26086604_26290850_26293788_FR OBD168-045 13 C)RFl_13_109869387_109876529_109901846_109907608_FF OBD168-049 14 ORF1_11_21505657_21511320_21625659_21628201_FR OBD168-053 15 C)RFl_13_102842718_102847079_102867709_102871733_FF OBD168-057 16 ORF1_13_102842718_102847079_102952727_102953846_FF OBD168-061 17 ORF1_3_179490429_179499685_179696553_179701788_RF OBD168-065 18 ORF1_13_109869387_109876529_109994965_109996722_FR OBD168-069 19 ORF1_13_42949707_42958335_43086110_43092272_RF OBD168-073 20 ORF1_10_93375413_93378505_93410956_93413925_FR OBD168-077 21 ORF1_1_182254591_182258498_182271295_182272617_RR OBD168-081 22 C)RFl_6_104807984_104813896_104859297_104866639_FF OBD168-085 23 C)RFl_3_35637910_35639568_35705745_35720206_RF OBD168-089 24 ORF1_8_81130626_81134961_81156168_81161109_RF OBD168-093 25 ORF1_11_61243450_61246026_61388261_61391790_FR OBD168-097 26 ORF1_4_107675768_107680919_107825397_107833109_FF OBD168-101 27 ORF1_1_193456875_193464580_193519461_193528788_RR OBD168-105 28 ORF1_11_79134716_79152601_79219225_79225698_FR OBD168-109 29 ORF1_6_152821O3_15283199_15362212_15366665_RR OBD168-113 30 ORF1_11_35101113_35109487_35250591_35252942_RR OBD168-117 31 ORF1_11_111144097_111148048_111222819_111226135_FF OBD168-121 32 ORF1_18_62522952_62526928_62633916_62637110_RR OBD168-125 33 ORF1_18_63796182_63806119_63902371_63912126_RF OBD168-129 34 ORF1_4_59658576_59668116_59701046_59706041_RF OBD168-133 35 ORF1_2_68857299_68862999_68948O41_68951799_RF OBD168-137 36 ORF1_14_61751727_61758003_61810071_61812335_FR OBD168-141 37 ORF1_21_33072222_33074551_33276086_33283169_RF OBD168-145 38 ORF1_11_111222819_111226135_111261363_111265949_FR OBD168-149 39 ORF1_4_38671979_38673590_38888275_38891480_RF OBD168-153 40 ORF1_3_114010550_114016075_114047949_114051357_RF OBD168-157 41 C)RFl_14_61490070_61495640_61751727_61758003_RF OBD168-161 42 ORF1_15_67887204_67889122_68052888_68053975_FR OBD168-165 43 ORF1_14_9674OO36_96741996_9682O569_96823739_RF OBD168-169 44 ORF1_8_116637960_116642220_116837668_116843681_FR OBD168-173 45 ORF1_7_43764O36_43765883_43792676_43795674_RR OBD168-177 46 C)RFl_ll_78798294_78806874_79036088_79041510_RF OBD168-181 47 C)RFl_12_103575776_103578331_103663674_103664970_FR OBD168-185 48 ORF1_6_13375878_13378557_13523152_13526281_FF OBD168-189 49 ORF1_11_21505657_21511320_21751405_21757053_FR OBD168-193 50 ORF1_5_54531220_54532270_54669234_54674643_FF OBD168-197 Table l.a4 05 03 25 Primer Sequence Primer ID Primer Sequence 1 CATCTGACCTCCTCCAGCCTCTG OBD168-003 CTCTG AAG CCACACCCACACTTG 2 CTTGGAGTCCCAGTGGAAAAGGTTGA OBD168-007 CCAAGTGTATTGTTAG CACCAG CGGT 3 ATGCTCTGCCCCACTGTCCTTGC OBD168-011 GTG ATTTCAGTG G GTCTCCAGG G 4 CCATACTACCTTTAGGAGGAACTTGC OBD168-015 TGGAGAAAACGCAAACGCCTACAGGG 5 CAGTAAAGGGAACCAAAGAAAACAAC OBD168-019 CAACTTCCACC1 1 1 GAA 1 CCA 1 1 1C1 6 G G CTG CTCCTCACCTG G CTTG GT OBD168-023 TCCCAACCCCTTCCAGAATCTTC 7 G CAATG CTAACAGCCTTGACAG C OBD168-027 TTTTCTTCGTG CTG GTG CTG GTG AGC 8 CCTGGAAGGATGTCAGATGAGTCT OBD168-031 AAGCAATGATAGTTGGCGATACAT 9 GGGTGAGGTAGAAGTATGAAGGAAAG OBD168-035 CCTTCCTCCCTTGTCTG CCTGTAG AT 10 CACAGGATTGGAATGAGGAATAAAGA OBD168-039 CCAATG AG G GTTCCAGG GTTCAA 11 TCCTTCCTACAACACCCTGCCAG OBD168-043 AGTGGCAG GTAACG GCTG G G CAT 12 TGTTGAATGAATGAGCAG GAG CCAG C OBD168-047 CACAGCCAGTAAACAGCATTCAAGGG 13 GGCTCTGCTGGGACTTGGGACTT OBD168-051 AGAGTGGCTTGACCAGAGTGTGG 14 GAAGAGTGCTTGGCAGAGTGTGTGCT OBD168-055 TTGTTCCTGGTTTACAGCCCCTACTA 15 CTACACACAGGATTGGAATGAGGAAT OBD168-059 GCACACAGCGAAATAATAGTTGTTAG 16 CACAGGATTGGAATGAGGAATAAAGA OBD168-063 CCACAGTGTTTCCATC AG CCTG G 17 CTCCACTGCTGAAACAATAGCGACGC OBD168-067 CATAAGCCAACTCCCCTAATGAATCC 18 AGATGAGTCTGCCCATTGCTCCTGAG OBD168-071 CTCAGAAGTCAGTTCATCCATTTCCT 19 CCTCCTACAGTGATTGTGGATTTGTC OBD168-075 GGGTAGGAATGTGAGTGAAGCAGGAC 20 CATCCTGTCCAG ATTAGG CAG CC OBD168-079 CCAGATACTGTGCTAAAGGCTTCGCC 21 CAGGGAGAAGGAGAAGGAGATTTC OBD168-083 TGACCTTGACAGTTTTGAGGAGTA 22 GCTTCCAGCCAACATTTGAGTGCCTC OBD168-087 CCAGGTATGGAAAAGGAGATTGTGTC 23 CCTG GTCATTGGTG AAGGTCTG G CAT OBD168-091 GACACCCAACCATAATGACAGAGATT 24 G G ATGTGTG AGAG AAAG GG CATTG G C OBD168-095 TTTACACTTTCGCCTTCTCTTCCAGC 25 TG G AG G CATCTCTG ACACCAATCA OBD168-099 GAAAGAATACACTGATGAAGCCAT 26 ACCTCCTGGG ATGTCTCAGTG G C OBD168-103 GAGGCAGATGTGGGAGGTTTGCT 27 GCTGGGTATGGCTGGTTTGTGTTTTA OBD168-107 CCTGCTTTCCATAAACCTCTG CTTCT 28 AGAG GTTCATCGTCTCCAG GTCATAG OBD168-111 TTGTTGGGTGTGATGTCCTCCACTTC 29 G ACCAG GAGTTCAAG ACCAG CCT OBD168-115 ATGTAACCCTGAGAGAAGACCTC 30 GGCAAGGGCTTATTTAGGAGCAT OBD168-119 GATTCACAGGAAGAAAACTGGAACTA 31 GCATAGATGGGTTAGTCAGAGACCAC OBD168-123 G GTCTCACAATCACACTG CTGG G AAT 32 TGGGTGAGGAGGTGGAGCAGCCG OBD168-127 AAATACGCCAG GACACAG G CAG C 33 GTAGTCTTGAGTTGGCTCCCTGTTTG OBD168-131 CAACTCGCTCCACTTTG G CATCGTAT 34 G CAGTAG ATTTCTGTTG AG GTG ATTA OBD168-135 CAGTTTTAGAATAAGTGCTATGTGGC 35 CTACTTCCCTTTCCATCCCACCC OBD168-139 CCCCAAACATTCTG CCAGG GTCC 36 GGGTCTAAGGAAGGTCAAGGCTGC OBD168-143 GCCCAAGCCCCTATTAGACCCAT 37 GCACCTGCTACCTGCTCCTTCCTATT OBD168-147 AACTGCGGAAAGGTCATAGCATAACC 38 G GTCTCACAATCACACTG CTG G G OBD168-151 CGACACTTCCCCATCTCCCCAAC 39 TTTTCAAATCCCTCTTGTG CCCTCAT OBD168-155 CCACAATCATCTCCCTTTCCCTCTGA 40 TCCTTCCTTTCCTACTCAGTGTGGAT OBD168-159 AGTCTACCTG AG G AG G CAACAG CCAT 41 CACTAAAGCACTCCAGTCAAGTCAGT OBD168-163 GGATGGCGAAATACCACGGGAAGCAT 42 GGGTAGGGAGAGGAAGGAAACGGATA OBD168-167 CAATAGTGCTTGTTCCTACCTCTCAC 43 GATTCTGTAGTCATCAG G AACACG OBD168-171 CAGGAGAGTGTGAGAGAGCCCGA 44 GTCTGCTTTGGAACATCAAGAGTGCT OBD168-175 G CTG ACCTCCTCATCTTCACCCACAA 45 TGA1 1 1C1GCCCAGCCGAGTGCTACA OBD168-179 ATACATTACCTTTCTG CTCAG CCAGC 46 GGACCATTGAGAGAATAACAGATA OBD168-183 GAAAGAGAATCACAAAGCATAAATA 47 GAGATG GATGGTGG CAATG GTTG OBD168-187 ATCTTGTTGGGAAATAAGGTCTTTGC 48 AACACAGTGGCTC1 1L1L1 11GAA OBD168-191 CCCTGTCTCAAAACAAAACAAATA 49 GAGTG CTTGGCAGAGTGTGTG CT OBD168-195 GGTAGGTGATGGTCTGCCCTTCC 50 CCTTGCCTTGGCTTCTCTCGTAAAGA OBD168-199 CAACAGCCGCACACTCATTCACTCAT Table l.a5 05 03 25 probe Marker 1 ORF1_9_117652733_117662476_117782539_117784298_FF OBD168-001.003 2 ORF1_21_21135567_21136687_21190498_21197349_RR OBD168-005.007 3 C)RFl_12_108190915_108198003_108364371_108366987_FR 0BD168-009.011 4 ORF1_8_138185388_138192430_138316302_138317782_FF OBD168-O13.O15 5 ORF1_6_104807984_104813896_104858263_104859297_FR 0BD168-017.019 6 ORF1_7_73838719_73840112_73998797_74003463_FF OBD168-O21.O23 7 ORF1_6_149O191_1492799_1612178_1614243_FR OBD168-O25.O27 8 ORF1_13_109624423_109630621_109869387_109876529_RF OBD168-O29.O31 9 ORF1_3_171788979_171791691_171971435_171976171_RF OBD168-O33.O35 10 ORF1_13_102842718_102847079_102927740_102931657_FR OBD168-O37.O39 11 C)RFl_X_40971005_40973842_41006985_41010257_RF 0BD168-041.043 12 C)RFl_4_26084879_26086604_26290850_26293788_FR 0BD168-045.047 13 C)RFl_13_109869387_109876529_109901846_109907608_FF 0BD168-049.051 14 ORF1_11_21505657_21511320_21625659_21628201_FR 0BD168-053.055 15 ORF1_13_102842718_102847079_102867709_102871733_FF 0BD168-057.059 16 ORF1_13_102842718_102847079_102952727_102953846_FF 0BD168-061.063 17 ORF1_3_17949O429_179499685_179696553_1797O1788_RF OBD168-O65.O67 18 C)RFl_13_109869387_109876529_109994965_109996722_FR 0BD168-069.071 19 C)RFl_13_42949707_42958335_43086110_43092272_RF 0BD168-073.075 20 ORF1_10_93375413_93378505_93410956_93413925_FR 0BD168-077.079 21 ORF1_1_182254591_182258498_182271295_182272617_RR 0BD168-081.083 22 ORF1_6_104807984_104813896_104859297_104866639_FF 0BD168-085.087 23 ORF1_3_35637910_35639568_35705745_35720206_RF 0BD168-089.091 24 ORF1_8_81130626_81134961_81156168_81161109_RF 0BD168-093.095 25 ORF1_11_61243450_61246026_61388261_61391790_FR 0BD168-097.099 26 ORF1_4_107675768_107680919_107825397_107833109_FF OBD168-101.103 27 ORF1_1_193456875_193464580_193519461_193528788_RR OBD168-105.107 28 ORF1_11_79134716_79152601_79219225_79225698_FR OBD168-1O9.111 29 ORF1_6_152821O3_15283199_15362212_15366665_RR OBD168-113.115 30 ORF1_11_35101113_35109487_35250591_35252942_RR OBD168-117.119 31 ORF1_11_111144097_111148048_111222819_111226135_FF OBD168-121.123 32 ORF1_18_62522952_62526928_62633916_62637110_RR OBD168-125.127 33 ORF1_18_63796182_63806119_63902371_63912126_RF OBD168-129.131 34 ORF1_4_59658576_59668116_59701046_59706041_RF OBD168-133.135 35 ORF1_2_68857299_68862999_68948041_68951799_RF OBD168-137.139 36 ORF1_14_61751727_61758003_61810071_61812335_FR OBD168-141.143 37 ORF1_21_33072222_33074551_33276086_33283169_RF OBD168-145.147 38 ORF1_11_111222819_111226135_111261363_111265949_FR OBD168-149.151 39 ORF1_4_38671979_38673590_38888275_38891480_RF OBD168-153.155 40 ORF1_3_114010550_114016075_114047949_114051357_RF OBD168-157.159 41 ORF1_14_61490070_61495640_61751727_61758003_RF OBD168-161.163 42 ORF1_15_67887204_67889122_68052888_68053975_FR OBD168-165.167 43 ORF1_14_96740036_96741996_96820569_96823739_RF OBD168-169.171 44 ORF1_8_116637960_116642220_116837668_116843681_FR OBD168-173.175 45 ORF1_7_43764O36_43765883_43792676_43795674_RR OBD168-177.179 46 C)RFl_ll_78798294_78806874_79036088_79041510_RF OBD168-181.183 47 C)RFl_12_103575776_103578331_103663674_103664970_FR OBD168-185.187 48 ORF1_6_13375878_13378557_13523152_13526281_FF OBD168-189.191 49 ORF1_11_21505657_21511320_21751405_21757053_FR OBD168-193.195 50 ORF1_5_54531220_54532270_54669234_54674643_FF OBD168-197.199 Table l.a6 05 03 25 51 ORFl_chrl_161526936_161530260_161592992_161600164_RF_l 54097 99.6 2.682 52 ORFl_chrl7_5961O792_59618647_59742829_59746633_FF_l 2321 88.77 3.732 53 ORFl_chrl_59019583_59021645_59133061_59141815_RR_l 5747 77.65 2.939 54 C)RFl_chrl_59019583_59021645_59122227_59127200_RR_l 14439 167.9 2.225 55 ORFl_chr8_2179427_2182848_2282002_2287140_RF_l 82548 140.9 2.302 56 ORFl_chrl2_31765908_31770394_31832455_31836936_RF_l 76089 135.3 3.146 57 ORFl_chr7_127571782_127576218_127652961_127655625_RF_l 196 167.8 2.332 58 ORFl_chr6_53297611_53301525_53330606_53336135_RF_l 4276 161.1 3.961 59 ORFl_chr8_6544838_6545849_669O336_6691879_RR_l 10831 75.34 2.967 60 ORFl_chrl5_74848287_74855121_74957951_74959166_FR_l 2428 305.6 2.602 61 ORFl_chrl7_27180736_27185386_27333521_27337305_RR_l 25171 296 2.03 62 ORFl_chrl6_72743677_72746653_72988436_72990339_FR_l 110054 304.9 2.847 63 ORFl_chrl7_36180872_36185095_36216401_36221747_RR_l 20739 347.5 4.862 64 ORFl_chr7_96316940_96320226_96464673_96468301_RR_l 1300 321 3.527 65 ORFl_chr6_31267448_31269252_31345648_31347228_RF_l 51004 291.8 1.889 66 ORFl_chrl0_133409387_133412825_133526816_133529614_RF_l 40699 284.9 1.887 67 ORFl_chrl_26201425_26205480_26333363_26336159_FR_l 121592 389.5 1.79 68 ORFl_chr5_782236_785121_920775_927647_RF_l 110906 338 1.81 69 ORFl_chr9_70567738_70570528_70702891_70712644_RF_l 4875 364.1 1.917 70 C)RFl_chrl5_64931692_64934068_65028347_65030549_RF_l 82247 332.5 1.829 71 ORFl_chr22_24772O75_24777926_24949355_24952491_RR_l 12733 399 1.858 72 C)RFl_chrll_10637008_10641060_10653098_10661130_FR_l 136402 347 1.803 73 C)RFl_chrl5_50065156_50069400_50125985_50128841_RR_l 2553 386.6 2.404 74 ORFl_chrl9_54789678_54792948_55035514_55037195_RF_l 99528 232.6 2.001 75 ORFl_chr6_1571374_1573462_1612178_1614243_RR_l 1633 243.1 2.249 76 ORFl_chrl2_8943814_8945391_9117O75_9121539_RR_l 77436 281.9 1.924 77 ORFl_chr20_62682975_62688983_62704898_62706446_FF_l 112187 363.7 2.386 78 ORFl_chrl7_13014484_13018600_13163660_13166024_RF_l 128130 378 1.782 79 ORFl_chr3_71509295_71510710_71611738_71613935_FF_l 130292 256.1 11.74 80 ORFl_chr2_144423688_144428542_144476252_144486305_RF_l 4532 386.3 2.799 81 ORFl_chrl_66194325_66201588_66444381_66456052_RR_l 130547 277.6 11.36 82 ORFl_chr2O_31723515_31724864_31865584_31867866_RR_l 1057 591.9 1.716 83 ORFl_chr2O_37222567_37225275_3749O771_37494248_RR_l 119165 590.8 1.67 84 C)RFl_chrl4_92536539_92540967_92697902_92700362_FR_l 29947 586.5 1.616 85 ORFl_chrl0_61891351_61894307_62056179_62058893_RR_l 104482 583.9 1.621 86 ORFl_chr3_171803475_171808332_171888052_171894907_RF_l 17545 274.5 1.916 87 ORFl_chr21_38766076_38770672_38858093_38859288_FR_l 25700 583.6 1.622 88 C)RFl_chrl7_43300561_43304860_43323475_43325945_FF_l 91767 579.6 1.642 89 ORFl_chrl5_74686122_74687597_74772372_74779791_FR_l 107590 565.5 1.632 90 ORFl_chrl6_87389518_87390661_87484414_87491902_RF_l 106302 576.8 1.69 91 C)RFl_chrl2_127036933_127040040_127282483_127288002_FR_l 90080 573.9 1.64 92 C)RFl_chrll_10637008_10641060_10723633_10730683_FF_l 115334 564.3 1.63 93 C)RFl_chr6_36408988_36410120_36693657_36702286_FF_l 104999 639.2 2.657 94 ORFl_chr4_186172696_186175767_18619O828_186192765_FF_l 132933 637.1 1.82 95 ORFl_chr22_35115503_35116970_35401039_35404538_RF_l 108441 563.1 2.82 96 ORFl_chrl6_56676662_56679108_56730378_56735303_FR_l 107625 628.4 2.81 97 C)RFl_chrll_73240092_73243799_73403994_73408090_RR_l 115685 548.5 2.096 98 C)RFl_chr2_203737190_203742853_203893081_203899008_RF_l 134375 636.7 1.6 99 C)RFl_chr2_203893081_203899008_203933311_203940057_FR_l 97021 560.3 1.641 100 ORFl_chrl7_27180736_27185386_27282892_27289008_RR_l 90989 627.7 1.71 Table l.bl 05 03 25 51 0.1703 0.000004825 Early AAAAAACAATTATGTAATTGAAAACCCATCGAAGTACAAAAGTACCCAAAGGCTTTCAGA 52 0.176 0.000003742 Early AAGAAAGTACCAGAAAGGTTATTATTAATCGATTTACAAAACTTGATGGTTAGTAATTTT 53 0.1963 0.000002782 Early CTGGTTGACAATAACTATACAAAGAGTGTCGAAATATGTTCCTAAAATATTCAAAGTATT 54 0.2382 0.00001519 Early CTGGTTGACAATAACTATACAAAGAGTGTCGACAGAGCTTAACAGCTGTTTCAAAGTCTT 55 0.2433 0.00001034 Early CCAGACACAGGTAGTTCCTAAAATCTTCTCGAAGGLI 1 1 1A1TTAATTTGAGAATCATCA 56 0.2671 0.000009462 Early G AACCCAGG AG ACG GAG CTTG CAGTG AGTCGAGTATTATTTAGTCATAAAAAGG AATG AA 57 0.2676 0.00001517 Early GTCTTCTATCAAATCAGA1 1 1 1 Al 1 1 1L1CGAATCAGTTCTTGATTCTAATCTCCAATGT 58 0.28 0.00001389 Early GTAGTATAATAATAAACTACCTGTTGATTCGATTTAATTATTAGTTATTGTTGTTAATCT 59 0.3672 0.000002602 Early AATGACATAATTGGCCTCAAAACATATTTCGAGAGTTGGCTAGATTCATACACATAATTA 60 0.3948 0.00005595 Early TCCTC1 1 1 1 1 1 1 ATA 1 1 1 1 1 1 1A1 1 1 1 1 1CGAAAAATGAATAAATTAATTAATTAAATAA 61 0.4093 0.0000522 Early GGATCTAGAAAAGAGTAT11ICAATGTGTCGAATGTGTTGCAAATAI 1 1 1 ILIAAGCTTA 62 0.4135 0.00005567 Early GAGGCGGGTGGATCATGAGGTCGGAAGATCGATATGCAGGCTGGAACCCGCCAAACATTT 63 0.4173 0.00007391 Early AATAAAGCACACAATAAATGTAATGGGCTCGACATTTTGAATATGTGGGATCCAAATCTG 64 0.4183 0.00006225 Early TAAAAAAGATCGGATAATTAGGAAATTATCGATGATAAAATATATGTACCCCACTTAGAG 65 0.4204 0.00005064 Early CCCTAAAGTCTGGGAAGGAAAGAGAGGCTCGATTCCTGTTTTCCCTTCTGCCTCCCTCGT 66 0.4238 0.00004804 Early CAGCGTACAI 1 1L1GAACATTGTGAACGTCGAGTCAGAAAAGATACTCAATAAGATTTTG 67 0.4269 0.00009376 Early GG GTTTCACCATGTTG GTCAG G CTG GTCTCG AGG CCAG CCTG ACCAACATG AAG AAACCC 68 0.427 0.00006958 Early GAGAATCTGCTCAGAGCTGATTTCGTTATCGAGCAGTAGGAACTAGGCGTGTGTAGATTC 69 0.4273 0.00008175 Early AGTTTGCCTATATTGGAATCATTAGCATTCGAATTGTGAAACAAAAACTGTTTGCTGGGC 70 0.4309 0.00006717 Early GTTACTTGTCTG CAGTTACTTTCTTG AATCGAGGCAG CAG ACAAG GTTCTG ATCTTG G CT 71 0.433 0.00009819 Early TGGTGCATTTATGATATACACTGTGTTATCGAAAAAAATTAAGTAATAATAATAATAGAG 72 0.4333 0.00007369 Early GGACATAACTGTATTCTCTCTCTCTCTCTCGATGAGCTTAAAGTGGTGTTCTAGGACCAG 73 0.4349 0.00009244 Early AATATGTATAAATTACAAAATG G CTAAATCG ATATCTG CCCTAACAAGAATCCTTCTAGT 74 0.4363 0.00003092 Early ATTCTGAAGAAATCAGGAAATAATGCATTCGATAGATAATAGATAGAAATATGCAGAAAG 75 0.4368 0.00003404 Early ATAGTATATTATCTAAAATGTCAAATTTTCGAAACTAAAAAAAAAAAATCCAATTAAAAA 76 0.4419 0.00004696 Early GTCGTGCAGTGGTGATGATCTCCTGCAATCGAAGAACAAAGAGATGAAAAGAGCI 1 1C1A 77 0.4427 0.00008155 Early GCTGGAAAATCAGGCTCATCACAAAAGCTCGAGACCCCCACAAAGAGGAAGTCCACAGCA 78 0.4463 0.00008854 Early CCTCAGTCTTTCI11GI11ICCAAGACCTCGAGGTA1 1 1 1 1CCTAATGAAAAACAAAGAA 79 0.4485 0.00003814 Early CTGCAATGTTCAACTAAGCTCTGTCCAATCGAGGTTGTTAGTTTTGAAGATTGAGGAAGG 80 0.4492 0.00009229 Early AAAAATGTGTA HILI ACA1 1 1 1 1 1 1GGTCGAATGAATAGAATGACAATAGG1 1 1 1 1A1 1 81 0.4579 0.00004543 Early AACATAGCATATTCAACTAAGCAATTCATCGAAGTATCCTTATATTTTAGATTAACATAT 82 0.4628 0.0002066 Early GGCTCGGCGGGTACCCGGCCTAGTGAGCTCGAGAAACTGTCTTAACAI 1 1 1 IATATTCAA 83 0.4687 0.0002059 Early AGCTCTGGCAG1 1 1 1L1GAAATACCATATCGAGCTGTGGTGATTAL1 1 1 LI LCCTGAAAC 84 0.4699 0.0002031 Early TCACTAGCAGATTCCTGCA1 1L1 1 1CAGTCGAAGAGTGAACCTTGATGTATGCAGATTTT 85 0.4738 0.0002014 Early ATGTCTTAATATTATTATAATCATTGTTTCGATATGCCAAGTTCCCTGTCTGCCTACAGT 86 0.4814 0.00004434 Early GGTCGTTGAGGACAATTTACAAATTGGCTCGATGGTGTAAATATTCCTGGAAGGCCAAGG 87 0.4814 0.0002012 Early CACI 1 1 1 IACACATGAGAGGTGAGGATATCGACCAAGAGATCGCGAGATGGGAGCAGAGA 88 0.4833 0.0001986 Early AACAACTGCTGCAAGAGGGGCCGTTTGTTCGATGCTALI 1 1 1AATCCCAGAACAAGTATT 89 0.4868 0.0001897 Early GGGTTTCACCATGTTGGCCAGACTGATCTCGAGACGATCCCGGCCAACATGGTGAAACCC 90 0.4874 0.0001969 Early CTGCAGCCCGTAGTTGTGGATGATGGAGTCGA1 1 1 1 1 1CCCTTCTTCTTGCATTTGGAAC 91 0.4915 0.000195 Early GAGAGAGAGAGAGAAAGAGACGAAGATTTCGACCACTCTTGAGCTGTGTGATGTTGATCT 92 0.4938 0.000189 Early GGACATAACTGTATTCTCTCTCTCTCTCTCGAGGAAGGTTCTGAGGAATTGAAGCCCACT 93 0.4948 0.0002384 Early GGCAGGTGGCTCACCTGAGGTCGGGAGTTCGAAGTCTGTTTCAGATGAAGTTTTAAGATC 94 0.499 0.0002369 Early ACGGAGTGGAAGGAGCTGCAACTTTCCATCGAGTTCGCCCTCCCTGACAGGGAGTTGTAA 95 0.5011 0.0001882 Early AAGTTAGATGCAAAGGCCTGACTGTGTTTCGAGCATAGATCCCAGCCCCAGATCCCACAG 96 0.5015 0.000231 Early TCCAGCTATCTG CTCAG GG AATTGTTATTCG AGCCG CCCCCG AG GCTTGG AGTCGG G CTG 97 0.5057 0.0001792 Early AGGAGTGGCCAGGCAGAGCCAAGTCCTATCGAGTGGCTCTGTCACTTATTAGCAAGTCAC 98 0.506 0.0002366 Early AATCTGTCTCTCTCTTACTCCCTCTCTCTCGAAAATACTGTAC1 1 1GGTTGA1 1 1 1 1 AAG 99 0.5062 0.0001865 Early AATCTGTCTCTCTCTTACTCCCTCTCTCTCGATGGGTATGGAAGCAAAGGCCTGAAGAAT 100 0.5082 0.0002305 Early GGATCTAGAAAAGAGTATTTTCAATGTGTCGACACAGATGATTAGGGCATCTTCTGCTCT Table l.b2 05 03 25 51 chrl 161526938 161526967 161600133 161600162 chrl 161526938 161530937 161596163 161600162 52 chrl7 59618616 59618645 59746602 59746631 chrl7 59614646 59618645 59742632 59746631 53 chrl 59019585 59019614 59133063 59133092 chrl 59019585 59023584 59133063 59137062 54 chrl 59019585 59019614 59122229 59122258 chrl 59019585 59023584 59122229 59126228 55 chr8 2179429 2179458 2287109 2287138 chr8 2179429 2183428 2283139 2287138 56 chrl2 31765910 31765939 31836905 31836934 chrl2 31765910 31769909 31832935 31836934 57 chr7 127571784 127571813 127655594 127655623 chr7 127571784 127575783 127651624 127655623 58 chr6 53297613 53297642 53336104 53336133 chr6 53297613 53301612 53332134 53336133 59 chr8 6544840 6544869 6690338 6690367 chr8 6544840 6548839 6690338 6694337 60 chrl5 74855090 74855119 74957953 74957982 chrl5 74851120 74855119 74957953 74961952 61 chrl7 27180738 27180767 27333523 27333552 chrl7 27180738 27184737 27333523 27337522 62 chrl6 72746622 72746651 72988438 72988467 chrl6 72742652 72746651 72988438 72992437 63 chrl7 36180874 36180903 36216403 36216432 chrl7 36180874 36184873 36216403 36220402 64 chr7 96316942 96316971 96464675 96464704 chr7 96316942 96320941 96464675 96468674 65 chr6 31267450 31267479 31347197 31347226 chr6 31267450 31271449 31343227 31347226 66 chrlO 133409389 133409418 133529583 133529612 chrlO 133409389 133413388 133525613 133529612 67 chrl 26205449 26205478 26333365 26333394 chrl 26201479 26205478 26333365 26337364 68 chr5 782238 782267 927616 927645 chr5 782238 786237 923646 927645 69 chr9 70567740 70567769 70712613 70712642 chr9 70567740 70571739 70708643 70712642 70 chrl5 64931694 64931723 65030518 65030547 chrl5 64931694 64935693 65026548 65030547 71 chr22 24772077 24772106 24949357 24949386 chr22 24772077 24776076 24949357 24953356 72 chrll 10641029 10641058 10653100 10653129 chrll 10637059 10641058 10653100 10657099 73 chrl5 50065158 50065187 50125987 50126016 chrl5 50065158 50069157 50125987 50129986 74 chrl9 54789680 54789709 55037164 55037193 chrl9 54789680 54793679 55033194 55037193 75 chr6 1571376 1571405 1612180 1612209 chr6 1571376 1575375 1612180 1616179 76 chrl2 8943816 8943845 9117077 9117106 chrl2 8943816 8947815 9117077 9121076 77 chr20 62688952 62688981 62706415 62706444 chr20 62684982 62688981 62702445 62706444 78 chrl7 13014486 13014515 13165993 13166022 chrl7 13014486 13018485 13162023 13166022 79 chr3 71510679 71510708 71613904 71613933 chr3 71506709 71510708 71609934 71613933 80 chr2 144423690 144423719 144486274 144486303 chr2 144423690 144427689 144482304 144486303 81 chrl 66194327 66194356 66444383 66444412 chrl 66194327 66198326 66444383 66448382 82 chr20 31723517 31723546 31865586 31865615 chr20 31723517 31727516 31865586 31869585 83 chr20 37222569 37222598 37490773 37490802 chr20 37222569 37226568 37490773 37494772 84 chrl4 92540936 92540965 92697904 92697933 chrl4 92536966 92540965 92697904 92701903 85 chrlO 61891353 61891382 62056181 62056210 chrlO 61891353 61895352 62056181 62060180 86 chr3 171803477 171803506 171894876 171894905 chr3 171803477 171807476 171890906 171894905 87 chr21 38770641 38770670 38858095 38858124 chr21 38766671 38770670 38858095 38862094 88 chrl7 43304829 43304858 43325914 43325943 chrl7 43300859 43304858 43321944 43325943 89 chrl5 74687566 74687595 74772374 74772403 chrl5 74683596 74687595 74772374 74776373 90 chrl6 87389520 87389549 87491871 87491900 chrl6 87389520 87393519 87487901 87491900 91 chrl2 127040009 127040038 127282485 127282514 chrl2 127036039 127040038 127282485 127286484 92 chrll 10641029 10641058 10730652 10730681 chrll 10637059 10641058 10726682 10730681 93 chr6 36410089 36410118 36702255 36702284 chr6 36406119 36410118 36698285 36702284 94 chr4 186175736 186175765 186192734 186192763 chr4 186171766 186175765 186188764 186192763 95 chr22 35115505 35115534 35404507 35404536 chr22 35115505 35119504 35400537 35404536 96 chrl6 56679077 56679106 56730380 56730409 chrl6 56675107 56679106 56730380 56734379 97 chrll 73240094 73240123 73403996 73404025 chrll 73240094 73244093 73403996 73407995 98 chr2 203737192 203737221 203898977 203899006 chr2 203737192 203741191 203895007 203899006 99 chr2 203898977 203899006 203933313 203933342 chr2 203895007 203899006 203933313 203937312 100 chrl7 27180738 27180767 27282894 27282923 chrl7 27180738 27184737 27282894 27286893 Table l.b3 05 03 25 51 ORF1_1_161526936_161530260_161592992_161600164_RF OBD168-201 52 ORF1_17_5961O792_59618647_59742829_59746633_FF OBD168-205 53 ORF1_1_59019583_59021645_59133061_59141815_RR OBD168-209 54 ORF1_1_59019583_59021645_59122227_59127200_RR OBD168-213 55 ORF1_8_2179427_2182848_2282002_2287140_RF OBD168-217 56 ORF1_12_31765908_31770394_31832455_31836936_RF OBD168-221 57 ORF1_7_127571782_127576218_127652961_127655625_RF OBD168-225 58 ORF1_6_53297611_53301525_53330606_53336135_RF OBD168-229 59 ORF1_8_6544838_6545849_6690336_6691879_RR OBD168-233 60 ORF1_15_74848287_74855121_74957951_74959166_FR OBD168-237 61 ORF1_17_27180736_27185386_27333521_27337305_RR OBD168-241 62 ORF1_16_72743677_72746653_72988436_72990339_FR OBD168-245 63 ORF1_17_36180872_36185095_36216401_36221747_RR OBD168-249 64 ORF1_7_96316940_96320226_96464673_96468301_RR OBD168-253 65 ORF1_6_31267448_31269252_31345648_31347228_RF OBD168-257 66 ORF1_10_133409387_133412825_133526816_133529614_RF OBD168-261 67 ORF1_1_26201425_26205480_26333363_26336159_FR OBD168-265 68 ORF1_5_782236_785121_920775_927647_RF OBD168-269 69 ORF1_9_70567738_70570528_70702891_70712644_RF OBD168-273 70 C)RFl_15_64931692_64934068_65028347_65030549_RF OBD168-277 71 ORF1_22_24772O75_24777926_24949355_24952491_RR OBD168-281 72 ORF1_11_10637008_10641060_10653098_10661130_FR OBD168-285 73 C)RFl_15_50065156_50069400_50125985_50128841_RR OBD168-289 74 ORF1_19_54789678_54792948_55035514_55037195_RF OBD168-293 75 ORF1_6_1571374_1573462_1612178_1614243_RR OBD168-297 76 ORF1_12_8943814_8945391_9117O75_9121539_RR OBD168-301 77 ORF1_20_62682975_62688983_62704898_62706446_FF OBD168-305 78 ORF1_17_13014484_13018600_13163660_13166024_RF OBD168-309 79 ORF1_3_71509295_71510710_71611738_71613935_FF OBD168-313 80 ORF1_2_144423688_144428542_144476252_144486305_RF OBD168-317 81 ORF1_1_66194325_66201588_66444381_66456052_RR OBD168-321 82 ORF1_2O_31723515_31724864_31865584_31867866_RR OBD168-325 83 ORF1_2O_37222567_37225275_3749O771_37494248_RR OBD168-329 84 C)RFl_14_92536539_92540967_92697902_92700362_FR OBD168-333 85 ORF1_10_61891351_61894307_62056179_62058893_RR OBD168-337 86 ORF1_3_171803475_171808332_171888052_171894907_RF OBD168-341 87 ORF1_21_38766076_38770672_38858093_38859288_FR OBD168-345 88 ORF1_17_43300561_43304860_43323475_43325945_FF OBD168-349 89 ORF1_15_74686122_74687597_74772372_74779791_FR OBD168-353 90 ORF1_16_87389518_87390661_87484414_87491902_RF OBD168-357 91 C)RFl_12_127036933_127040040_127282483_127288002_FR OBD168-361 92 C)RFl_ll_10637008_10641060_10723633_10730683_FF OBD168-365 93 ORF1_6_36408988_36410120_36693657_36702286_FF OBD168-369 94 ORF1_4_186172696_186175767_18619O828_186192765_FF OBD168-373 95 ORF1_22_35115503_35116970_35401039_35404538_RF OBD168-377 96 ORF1_16_56676662_56679108_56730378_56735303_FR OBD168-381 97 C)RFl_ll_73240092_73243799_73403994_73408090_RR OBD168-385 98 C)RFl_2_203737190_203742853_203893081_203899008_RF OBD168-389 99 C)RFl_2_203893081_203899008_203933311_203940057_FR OBD168-393 100 ORF1_17_27180736_27185386_27282892_27289008_RR OBD168-397 Table l.b4 05 03 25 51 CCAGCCAATCACAAG CAG CCTAC OBD168-203 CTCCTTCAG CACCCACCCCAACA 52 CTTTCATCCTTTATTGTATTGGTGCG OBD168-207 GGATTACAGGCGTGAGCCAACAT 53 TCCTCACTCTCCTG CCACTCCCT OBD168-211 CCAAGTAAGTG GAG GCTGG CTCT 54 CTCACTCTCCTGCCACTCCCTGC OBD168-215 CAAGAAAATCCAGATGCTCAAAACAC 55 TGTGGACAGATGCTGAGACCCTC OBD168-219 GAGACAGGGCTTCAGAGTCACAGG 56 TACTCGGGAGGCTGAGGCAGAAT OBD168-223 CTCTGTGGATTTACCTATTTTGGACA 57 GGAGGAAGTGGACAGTAAGTTGATAC OBD168-227 ATGGACAGGCAGAGGTGGTGACAATG 58 CCATCCACCCTGCCTTTCATAAGAGA OBD168-231 GGCAGGAAAGTGGCTTAGGACCAAAA 59 AGTGAGACTACTGACCAAAGAATC OBD168-235 GCTGAAACCCCAAGATAAAACTAT 60 GGGTGGTGAGGGTAGAGACTTAC OBD168-239 CCCAGGGCTTCAACTCCCCATCT 61 CAATGGGCTCTGAAATGTCACTTC OBD168-243 CATCAAAATGTCGTGTGGTGTATCAA 62 GGAGGTATGAGAAGGCTATTGTAGGA OBD168-247 TCAG AGG AAG G CTG G AGTG AATCCCT 63 CTGATTCTATGTTATGGTGAGTTGTG OBD168-251 CCATCATCGGTTGAATCCACAGAT 64 GCCTGGGTGACAGAGCAAGACTC OBD168-255 AACCTTAGCCCCACAATCAGAGC 65 AGGATTGGAACTGTTAGCCCCAT OBD168-259 CTCTG ATGG CTGTG CTG AG G ACA 66 GCCTGCCCTGCGGTTTCAAAGTAGAT OBD168-263 GCAAAACACACATTCTTCTCATCGGC 67 AGCCTTCCGAGTAGGTGGGAGTA OBD168-267 ACTCTCCTGCCTCAGCCTCTTGA 68 TTTTCTGGCAGCCTCTCCTTCCG OBD168-271 AACCCTCAGCCAGGAGCCAGGAT 69 GTGCCAGAACACGAGAGACACATAGG OBD168-275 AAACTCCCTAAGTCCGTAAATACCCC 70 AGGACAGAGCAGAGGTGGGACTC OBD168-279 TCACAGGGCTCAGCAGTGGAGAA 71 TGTCCTGTTGCTCATAGAAGTTGCTA OBD168-283 CACGGTAATGATACTAATGAAGGCTA 72 GGATAAAGCACAGGATGCCCCAG OBD168-287 CACACTCCACCACTCAGAGCAGG 73 CCAAATGGTCTGGTTCTGGGAATCTT OBD168-291 GAAGCCTGTTTGGACAAGGGACACCT 74 GATGCTGTCCCTTTAGTGGTCAA OBD168-295 CACTTTGTGTCCTGTTCATAACTTTC 75 GGGCTTCAGGGAAAATCAGTATTCTG OBD168-299 11 1 1C1 1CG1GCTGGTGCTGGTGAGC 76 CATTTTCCTTGTCCCTCCTCAG GTAA OBD168-303 TGCCGTGATTCTTCTCCCTCCTTTGC 77 CAGGCTGGTGGGAAGGAGACATT OBD168-307 TGGCAGAGGGACAGACTCCAGTG 78 TGTCTCTTTAGTCCCCTGTGGTCTGT OBD168-311 TGTTTCU 1 1 IGTCTCCTCCACTGGC 79 TAGTGTCCTCCCAGTGCTGTAGTGAG OBD168-315 TCAGGGAGAACGC1 1 1 1CC1TGATTC 80 TATTTGGCTGAAAAGCACTCTTGC OBD168-319 ACTACTTCTACTCAACTCATCCAT 81 GGCGATGGACACCCTTGTAACCTTTC OBD168-323 CCCCACACTTTCAGATGTCAGTAGTA 82 GCTGGGCTCGCTGATTGGCTGCG OBD168-327 GCCCCTGAAAAGAGCCATTTGAA 83 GGAATAGAGATAACGGGCTGGGC OBD168-331 GGGTGGGTGACAAAGGAGAGAGG 84 GCCAAGGGTCGGTTGAGTCACAG OBD168-335 GTAGTCTG CGTTCCACCTTG GG A 85 GAAACATAGTGAGAAGACAGGCATTG OBD168-339 CTCCAGATGTTCTTCCTTCCACACTG 86 CACCAGTTACCACCAACATACATTAT OBD168-343 GGTCAGG CTG GTCTTG AACTCCT 87 GACCGATTGCTCC ICHI AGCCC OBD168-347 TCCCCTCATCACTG CG GTCCCTA 88 GGGATTTGGACGAGAGACACAGGATG OBD168-351 CGGTTTGAACAGAGTTGTGGATAGCA 89 CCTCCCAGGTTCAATCAGGCAAT OBD168-355 CTCCTACCTCATCCTCCCGAGTA 90 CAGGAACTCATCGCCCGTGCGGC OBD168-359 TTCTCTTGCTGGACAACTGTTCC 91 GAGCGAGAGCAGGAGTGAGTGAG OBD168-363 AGACAGGCTGAGAGGTTTGGCTG 92 GGATAAAGCACAGGATGCCCCAG OBD168-367 CTCCACCTTCCCCACTCAAGCAG 93 TG CCTGTAATCCCAGCACTTTG G OBD168-371 CACCACTGCGGTTTTACATTTATGAT 94 AAGAAACAAAGCGAGGCAAGGTGACG OBD168-375 AGGCAGAC1 1C1 1 1GGAGGGTGTCAA 95 GTGGTTACAACATACCCCTTCCCC OBD168-379 CCTGCGGGACAAATCCAACCCAC 96 GCGAAGTGTCCAGCATCGTCCTG OBD168-383 AGTGGACGAATGAAAGGCACCCC 97 CAAGACAGAGGCAAGCCCAGGAA OBD168-387 TCCCAGAACCCTGCTGCCTCCAT 98 GCCTCCAAAAGTGTATGAGCCAA OBD168-391 CAACAGTTCTTCAG CACCCAAGTA 99 GCCTCCAAAAGTGTATGAGCCAA OBD168-395 TGCTTCCCCTCCTCACCACTCTA 100 CCGCATCGCAAAGGA1 1 1 1L1CAAAG OBD168-399 GAAAGTGGGATGGGAGAACAGAGCCA Table l.b5 05 03 25 51 ORF1_1_161526936_161530260_161592992_161600164_RF OBD168-201.203 52 ORF1_17_5961O792_59618647_59742829_59746633_FF OBD168-205.207 53 ORF1_1_59019583_59021645_59133061_59141815_RR 0BD168-209.211 54 C)RFl_l_59019583_59021645_59122227_59127200_RR OBD168-213.215 55 ORF1_8_2179427_2182848_2282002_2287140_RF OBD168-217.219 56 ORF1_12_31765908_31770394_31832455_31836936_RF OBD168-221.223 57 ORF1_7_127571782_127576218_127652961_127655625_RF OBD168-225.227 58 ORF1_6_53297611_53301525_53330606_53336135_RF OBD168-229.231 59 ORF1_8_6544838_6545849_6690336_6691879_RR OBD168-233.235 60 ORF1_15_74848287_74855121_74957951_74959166_FR OBD168-237.239 61 ORF1_17_27180736_27185386_27333521_27337305_RR OBD168-241.243 62 ORF1_16_72743677_72746653_72988436_7299O339_FR OBD168-245.247 63 ORF1_17_36180872_36185095_36216401_36221747_RR OBD168-249.251 64 ORF1_7_96316940_96320226_96464673_96468301_RR OBD168-253.255 65 ORF1_6_31267448_31269252_31345648_31347228_RF OBD168-257.259 66 ORF1_10_133409387_133412825_133526816_133529614_RF OBD168-261.263 67 ORF1_1_26201425_26205480_26333363_26336159_FR OBD168-265.267 68 ORF1_5_782236_785121_920775_927647_RF OBD168-269.271 69 ORF1_9_70567738_70570528_70702891_70712644_RF OBD168-273.275 70 ORF1_15_64931692_64934068_65028347_65030549_RF OBD168-277.279 71 ORF1_22_24772O75_24777926_24949355_24952491_RR OBD168-281.283 72 ORF1_11_10637008_10641060_10653098_10661130_FR OBD168-285.287 73 C)RFl_15_50065156_50069400_50125985_50128841_RR OBD168-289.291 74 ORF1_19_54789678_54792948_55035514_55037195_RF OBD168-293.295 75 ORF1_6_1571374_1573462_1612178_1614243_RR OBD168-297.299 76 ORF1_12_8943814_8945391_9117075_9121539_RR OBD168-301.303 77 ORF1_20_62682975_62688983_62704898_62706446_FF OBD168-305.307 78 ORF1_17_13014484_13018600_13163660_13166024_RF OBD168-3O9.311 79 ORF1_3_71509295_71510710_71611738_71613935_FF OBD168-313.315 80 ORF1_2_144423688_144428542_144476252_144486305_RF OBD168-317.319 81 ORF1_1_66194325_66201588_66444381_66456052_RR OBD168-321.323 82 ORF1_20_31723515_31724864_31865584_31867866_RR OBD168-325.327 83 ORF1_20_37222567_37225275_37490771_37494248_RR OBD168-329.331 84 ORF1_14_92536539_92540967_92697902_92700362_FR OBD168-333.335 85 ORF1_10_61891351_61894307_62056179_62058893_RR OBD168-337.339 86 ORF1_3_171803475_171808332_171888052_171894907_RF OBD168-341.343 87 ORF1_21_38766076_38770672_38858093_38859288_FR OBD168-345.347 88 ORF1_17_43300561_43304860_43323475_43325945_FF OBD168-349.351 89 ORF1_15_74686122_74687597_74772372_74779791_FR OBD168-353.355 90 ORF1_16_87389518_87390661_87484414_87491902_RF OBD168-357.359 91 C)RFl_12_127036933_127040040_127282483_127288002_FR OBD168-361.363 92 C)RFl_ll_10637008_10641060_10723633_10730683_FF OBD168-365.367 93 ORF1_6_36408988_36410120_36693657_36702286_FF OBD168-369.371 94 ORF1_4_186172696_186175767_18619O828_186192765_FF OBD168-373.375 95 ORF1_22_35115503_35116970_35401039_35404538_RF OBD168-377.379 96 ORF1_16_56676662_56679108_56730378_56735303_FR OBD168-381.383 97 ORF1_11_73240092_73243799_73403994_73408090_RR OBD168-385.387 98 C)RFl_2_203737190_203742853_203893081_203899008_RF OBD168-389.391 99 C)RFl_2_203893081_203899008_203933311_203940057_FR OBD168-393.395 100 ORF1_17_27180736_27185386_27282892_27289008_RR OBD168-397.399 Table l.b6 05 03 25 probe gene.index RP / Rsum FC:(classl / class2) 1 ORFl_chrl5_94287688_94292746_94340208_94346941_FR_l 92819 39.39 3.235 2 C)RFl_chr4_102312731_102315549_102386632_102391817_FR_l 109353 95.41 2.368 3 ORFl_chr8_38716162_38718294_38738341_38742581_RR_l 122864 89.18 2.377 4 ORFl_chr5_1324585O7_132464714_132517598_132521351_RF_l 83272 94.59 2.287 5 ORFl_chrl2_96463989_96466636_96618278_96624162_RR_l 108826 87.53 2.328 6 ORFl_chrll_79036088_79041510_79269569_79271288_FF_l 124955 81.79 2.53 7 ORFl_chrl_11226O37_11228251_11272812_11274518_RR_l 93778 112.6 2.208 8 ORFl_chr2_15928336O_159285194_159326592_159328925_FR_l 75100 149 2.024 9 ORFl_chr8_90002099_90011473_90148439_90150313_FR_l 104201 153.5 2.132 10 ORFl_chr3_113947O63_113952443_113975285_113978229_RR_l 137463 160.9 2.052 11 C)RFl_chr3_149818709_149821071_150005759_150009319_FR_l 87373 148.9 2.093 12 C)RFl_chr5_60597760_60604069_60738056_60741292_FR_l 107779 160.8 2.049 13 ORFl_chr6_53534187_53536920_53639583_53651122_RF_l 132284 183.6 2.105 14 ORFl_chr5_88269888_88274763_88365192_88376199_FR_l 114376 192.3 1.96 15 ORFl_chr9_76572O19_76577216_76769644_76771O52_RF_l 3234 181.2 1.994 16 ORFl_chrl8_68711389_68714330_68911644_68918950_RF_l 101101 203.8 1.951 17 ORFl_chr5_134464509_134469933_134674132_134676030_RR_l 65542 191.6 1.946 18 ORFl_chr8_92469388_92478361_92510934_92515600_RR_l 89074 203 1.92 19 ORFl_chrl0_54058576_54060371_54213283_54215754_FR_l 121042 200.8 2.123 20 C)RFl_chrl_109159473_109163477_109318126_109321152_RF_l 132421 199.6 1.915 21 ORFl_chrl2_9614159_9624874_9729793_9733228_FF_l 85149 211.9 1.939 22 ORFl_chrl4_89417652_89420597_89636182_89641783_RF_l 113983 214.7 1.908 23 ORFl_chrl_155206612_155209922_155288575_155290398_FR_l 6515 248.8 1.853 24 ORFl_chr5_17345O236_173452725_17347924O_173485435_RF_l 129576 244.7 1.907 25 ORFl_chr3_43246875_43252830_43297212_43303273_FR_l 2491 241.1 2.104 26 ORFl_chr2_118090940_118096647_118214615_118218048_RR_l 106991 247.9 1.981 27 ORFl_chr5_96799181_96801649_96813450_96815948_RF_l 85793 244.4 1.855 28 ORFl_chr3_43094298_43105527_43246875_43252830_RF_l 24515 257.1 2.065 29 ORFl_chr9_16574863_16577692_16721839_16729333_FF_l 91315 267.3 1.816 30 C)RFl_chr3_107414954_107426087_107525934_107527641_RF_l 59128 278.4 1.804 31 C)RFl_chrl2_13090807_13095110_13190440_13193042_FR_l 35176 283.4 1.815 32 ORFl_chr5_35271024_35276749_35319374_35321203_RR_l 93369 321.1 1.766 33 ORFl_chrl3_109649213_109651298_109745462_109746722_RR_l 73079 329.8 2.135 34 ORFl_chrl6_10044778_10047306_9907142_9911562_RF_l 94051 346.3 1.772 35 ORFl_chr9_71446407_71452706_71476978_71478030_FF_l 129153 352.3 1.737 36 ORFl_chr2_37666390_37670759_37879290_37884290_RF_l 101904 369.6 1.741 37 ORFl_chr5_50708409_50716050_50726245_50731870_FR_l 130047 382.9 1.775 38 ORFl_chr5_122311763_122314967_12235O193_122356927_FF_l 133785 385.8 1.812 39 ORFl_chr4_85761047_85763139_85952092_85960583_FR_l 73396 388.6 1.79 40 ORFl_chrl5_44713197_44715317_44756695_44758842_RR_l 91402 396.4 1.707 41 C)RFl_chr9_71446407_71452706_71550704_71559890_FR_l 78244 399.3 1.7 42 ORFl_chrX_45661991_45664592_45739643_45748O32_RF_l 120043 405.2 1.736 43 ORFl_chr4_73629979_73638181_73831449_73839428_FF_l 59006 404.4 1.749 44 ORFl_chrl8_68711389_68714330_68797123_68798463_RF_l 50615 422.1 1.705 45 ORFl_chrl4_65076556_65085228_65194791_65198794_FR_l 109799 441.4 1.674 46 ORFl_chrl4_53106017_53108105_53223270_53229326_RF_l 104855 437 1.713 47 C)RFl_chr9_127166323_127173810_127226000_127228604_RF_l 65446 434.9 1.734 48 C)RFl_chrl_98050628_98053768_98164665_98171570_RR_l 25472 439.8 1.728 49 ORFl_chr4_153219867_153224675_153242666_153249857_FR_l 55153 444.5 1.865 50 ORFl_chr2_233064861_233067168_233261787_233264668_RR_l 91626 433.6 1.828 Table 2.al 05 03 25 Probe sequence pfp P.value Type ............ 60 mer 1 5.687E-07 4.03E-12 SSc CAATCAAAATGTTGCAGTATC1 1 1 1 1AATCGAGATTTAACCACATCTGA1 1 ICATGGGTT 2 0.000004995 2.123E-10 SSc CCAAATACTTTCAAAATATAAGTATTATTCGAGTCTTCACAACAAAAGATAGAGGACCCA 3 0.00000558 1.582E-10 SSc TTCCACAAAG1 1 1A1 1 1 1 11G111CA111CGAGGCTACAGTGGAGCCTCGGCTTCCCAAA 4 0.000005773 2.045E-10 SSc TAAGACAGTGATTCCATTCGTAATAGTATCGAGTTGTTATTTATAATTCGGAACTATTCT 5 0.000006857 1.457E-10 SSc AGTTCAATGGACAAATAAATGAAATAAATCGACATACTCCAAAACATTGAAATATTGATG 6 0.000007637 1.082E-10 SSc CATTGGAGGCACTCAAAAAAAAAAAAAATCGATGATCTCTTCAAAGACATAACCCTTTGG 7 0.000008788 4.359E-10 SSc CACCTTGGTTATAATGTA11 1 1 1AAATTTCGAGTTCTTATGATGCTAAGAGAGGCTGATT 8 0.00002258 1.44E-09 SSc ATAAATATAAGTTGAATATTTATTTTGTTCGAAGGATATGAATTCCAGCTATGGCTCTGC 9 0.00002307 1.635E-09 SSc TTTTCAAAACAATTTTAGGATAAGCTTGTCGAGGTTATCCCTATTGGTTGAAGGTGGGAA 10 0.00002343 1.992E-09 SSc TTAGTCTTAATTTATAAAGCAACTTACTTCGATGTTATTGCAGCTTAAAGGTCAGGCTTA 11 0.00002535 1.437E-09 SSc TATATCAGTTTGTTTATCCA1 1 1A1CCATCGAATCAAAATATTG 1 1 1 CT AC 1 1C1 1 1GGA 12 0.00002554 1.99 E-09 SSc CCTAGTTAGCTTA1 1 1 1C1C1AGGA1 1 1 1CGATATGTTATTTAATCATCAACTAATTACA 13 0.00003265 3.47E-09 SSc AGAATTAAATCTTAAGTCTTTATGGAGATCGACTTTGAAACTAATTGTG1 1 1 1 1ACCAAA 14 0.00003301 4.211E-09 SSc TTCTTGAAGGACATACTTTAATATTTCTTCGACACTGTCTCCAACTTACTTTATCTGATT 15 0.00003313 3.286E-09 SSc AGCTAAAGTAGATATGCTTCTTGAGAAATCGACACAAGGGTTTGTTAAAAAAAAAAGAAA 16 0.00003443 5.367E-09 SSc ATAGCAAGTTGCA11IAG Illi IAGCTATCGAI HIGH 1AAACCTAAAAAACAAGAAAA 17 0.00003446 4.151E-09 SSc CAAAAAAAAAAAAAAAAAAAAAAGGTAGTCGAAAAATAAAATGATAAATAAAATAAAATA 18 0.00003545 5.275E-09 SSc GG11 1 1U 11 GT 1 1 1G FTTAAAATCA1 1 1CGAATCTTTAATTCACATTGAATATGTGTAC 19 0.00003559 5.043E-09 SSc GCAAATGCAAGAGTGCAACTACCGTAI 1 1CGAAATTAATTAGAAGAATATCTGCA1 Illi 20 0.0000365 4.914E-09 SSc AGCTGCTATCATGATTACTATATTATTATCGAACAGATTAGATATTTTAACACCAATTCT 21 0.00003869 6.306E-09 SSc TATTTATGACAGTTTAAAAAATTCCTTGTCGAGAAATCTGCTACCTTGATTAGTAAGACT 22 0.00003915 6.657E-09 SSc GCAGATAAAATAATACTCCAATAACTGATCGAAAGTAAAAATAAAAAGAATTACGATGCG 23 0.00005949 1.222E-08 SSc AAAGATGAATAAAATTTGGTTCCTCCCTTCGACCCTGTGCGGACATTCCGCATACTGCCA 24 0.00005968 1.142E-08 SSc GAG GTTTTCAAAAAG AATTATTTAAAAGTCGATTAACCATTTCTG CCATGTATG AAG GAT 25 0.00006062 1.074E-08 SSc TATCCACCTACCAAATTATCACCCATCCTCGAAAATCTTAGCTTTGTAAAGAACTGTTAA 26 0.00006065 1.203E-08 SSc GTTTAAAGGACAATATGTCAATAGATTCTCGAAACTATTTTGTTTGTAACTAATAAGTGA 27 0.00006162 1.135E-08 SSc GATGGATAGATAAATGGAAAGATAGAGATCGAGTTGTGTTAATTATTAGGAAAATAACCT 28 0.00006576 1.398E-08 SSc TATCCACCTACCAAATTATCACCCATCCTCGAAATGTTCCTGGATAATAAACACACAATT 29 0.00007459 1.638E-08 SSc AAAGTAATAATGTAAAACTATC Illi CCTCGATA1 1 1GTAGGTGGTTGAAGATTAATGTT 30 0.00008535 1.935E-08 SSc ACTTTAGATAATCTGTATATGTTTTGCATCGAAGAATATAATGGTATATGCCATGTTAAA 31 0.00008899 2.081E-08 SSc ACCTCATTCAAAAATCATCTTCTTGATATCGAACAGTAAAAGGACTTCCTCI 1 1 1 1 1 IGG 32 0.0001431 3.448E-08 SSc ATTTACTTATTTATTCATGGAATGTTTATCGAGGCTGATTTAGACAGGACTTTGTGTGCA 33 0.0001549 3.842E-08 SSc GCCAGATATTTGGTGCGCAGATATTTGGTCGATAAATGTTTATTGCCCTTTACTGTGTGA 34 0.0001833 4.676E-08 SSc TTTGTCATGAGTATAAAATGAGAATTCATCGAATCTGATTCCTCTTTTAGACTGTAAGTT 35 0.0001909 5.005E-08 SSc CAAGTTCTCCCAACTAATAATTGGAAGTTCGAAATTCCAAATATGGAAACACATACTGAA 36 0.0002251 6.062E-08 SSc ATTCCACTGTAACAAGTAAAG AAAATATTCG AG GTACACTTTAG G CGGTACCCTGTTACC 37 0.0002526 6.979E-08 SSc GCAAGAATCCAAAATTTACTGTGCTTTATCGACTATACAATAACAGTGAATTTATGGTGT 38 0.0002538 7.192E-08 SSc CCCATGGAAAATTAAATGATACTAAACATCGATTTAATAAGGTCAGACAGGAGCTAGGTA 39 0.0002549 7.405E-08 SSc ATATTTTATAGTTGCAGGAAGCTACTATTCGACACTCCAGAGAGC1C1 1 1C1ATACATAG 40 0.0002691 8.007E-08 SSc Al 1 1 IUCATGATCAAAACATTCTGCI1ICGATAGTTCAGTCACCAGGTGACTGTCGTGG 41 0.0002705 8.242E-08 SSc CAAGTTCTCCCAACTAATAATTGGAAGTTCGAATGGCTTTATTCTAAAATATATAAATTA 42 0.000274 8.735E-08 SSc AATGAAACAGTTAAGAGGAATGCTATTTTCGACCTTCTATAGTTCTCTCATTTTCAGTAT 43 0.0002782 8.673E-08 SSc AACAGTCAAAAAACAATAGATATTGGTATCGATGTTCTAGGAGAGCTCTTAATACAGTTA 44 0.0003151 1.027E-07 SSc TATACTAAGCAAAACTCAGGTAAGAATTTCGATTTTCTTTAAACCTAAAAAACAAGAAAA 45 0.0003391 1.225E-07 SSc ACCTGTTTAAC1 1 1 1 1AATTGGTTCTACTCGATAAAGAATCACAAATCTCCATCTTGCGA 46 0.0003392 1.178E-07 SSc TA 1 1 1CACTTAGCATAATATCTTCAAGGTCGAC1 1 1 1 1GCC1ACTTTACC Illi ATTATC 47 0.0003396 1.155E-07 SSc TTTATGAAATATAGATGCATACACTTTGTCGAGCATCAAACATGTACTAGATCCTTTTAT 48 0.0003408 1.207E-07 SSc TTACAAGTGGAATAGAATTTATTGGCTATCGAATTAAATTTATAATTA1 1 1 1C1 1 1 1 AGA 49 0.0003416 1.259E-07 SSc TGCCTTTATTTTCCTGGAAAATTCTATGTCGACAGAACTACTGAAATTGTAAAGAAACTC 50 0.000343 1.142E-07 SSc AATTAACAGTGTCTATTTTACTGAAGCTTCGAACTATAAATCCACAGTTCTAGTTGTCTT Table 2.a2 05 03 25 Probe Location 4 kb Sequence Location Chr Startl Endl Start2 End2 Chr Start 1 Endl Start2 End2 1 chrl5 94292715 94292744 94340210 94340239 chrl5 94288745 94292744 94340210 94344209 2 chr4 102315518 102315547 102386634 102386663 chr4 102311548 102315547 102386634 102390633 3 chr8 38716164 38716193 38738343 38738372 chr8 38716164 38720163 38738343 38742342 4 chr5 132458509 132458538 132521320 132521349 chr5 132458509 132462508 132517350 132521349 5 chrl2 96463991 96464020 96618280 96618309 chrl2 96463991 96467990 96618280 96622279 6 chrll 79041479 79041508 79271257 79271286 chrll 79037509 79041508 79267287 79271286 7 chrl 11226039 11226068 11272814 11272843 chrl 11226039 11230038 11272814 11276813 8 chr2 159285163 159285192 159326594 159326623 chr2 159281193 159285192 159326594 159330593 9 chr8 90011442 90011471 90148441 90148470 chr8 90007472 90011471 90148441 90152440 10 chr3 113947065 113947094 113975287 113975316 chr3 113947065 113951064 113975287 113979286 11 chr3 149821040 149821069 150005761 150005790 chr3 149817070 149821069 150005761 150009760 12 chr5 60604038 60604067 60738058 60738087 chr5 60600068 60604067 60738058 60742057 13 chr6 53534189 53534218 53651091 53651120 chr6 53534189 53538188 53647121 53651120 14 chr5 88274732 88274761 88365194 88365223 chr5 88270762 88274761 88365194 88369193 15 chr9 76572021 76572050 76771021 76771050 chr9 76572021 76576020 76767051 76771050 16 chrl8 68711391 68711420 68918919 68918948 chrl8 68711391 68715390 68914949 68918948 17 chr5 134464511 134464540 134674134 134674163 chr5 134464511 134468510 134674134 134678133 18 chr8 92469390 92469419 92510936 92510965 chr8 92469390 92473389 92510936 92514935 19 chrlO 54060340 54060369 54213285 54213314 chrlO 54056370 54060369 54213285 54217284 20 chrl 109159475 109159504 109321121 109321150 chrl 109159475 109163474 109317151 109321150 21 chrl2 9624843 9624872 9733197 9733226 chrl2 9620873 9624872 9729227 9733226 22 chrl4 89417654 89417683 89641752 89641781 chrl4 89417654 89421653 89637782 89641781 23 chrl 155209891 155209920 155288577 155288606 chrl 155205921 155209920 155288577 155292576 24 chr5 173450238 173450267 173485404 173485433 chr5 173450238 173454237 173481434 173485433 25 chr3 43252799 43252828 43297214 43297243 chr3 43248829 43252828 43297214 43301213 26 chr2 118090942 118090971 118214617 118214646 chr2 118090942 118094941 118214617 118218616 27 chr5 96799183 96799212 96815917 96815946 chr5 96799183 96803182 96811947 96815946 28 chr3 43094300 43094329 43252799 43252828 chr3 43094300 43098299 43248829 43252828 29 chr9 16577661 16577690 16729302 16729331 chr9 16573691 16577690 16725332 16729331 30 chr3 107414956 107414985 107527610 107527639 chr3 107414956 107418955 107523640 107527639 31 chrl2 13095079 13095108 13190442 13190471 chrl2 13091109 13095108 13190442 13194441 32 chr5 35271026 35271055 35319376 35319405 chr5 35271026 35275025 35319376 35323375 33 chrl3 109649215 109649244 109745464 109745493 chrl3 109649215 109653214 109745464 109749463 34 chrl6 10044780 10044809 9911531 9911560 chrl6 10044780 10048779 9907561 9911560 35 chr9 71452675 71452704 71477999 71478028 chr9 71448705 71452704 71474029 71478028 36 chr2 37666392 37666421 37884259 37884288 chr2 37666392 37670391 37880289 37884288 37 chr5 50716019 50716048 50726247 50726276 chr5 50712049 50716048 50726247 50730246 38 chr5 122314936 122314965 122356896 122356925 chr5 122310966 122314965 122352926 122356925 39 chr4 85763108 85763137 85952094 85952123 chr4 85759138 85763137 85952094 85956093 40 chrl5 44713199 44713228 44756697 44756726 chrl5 44713199 44717198 44756697 44760696 41 chr9 71452675 71452704 71550706 71550735 chr9 71448705 71452704 71550706 71554705 42 chrX 45661993 45662022 45748001 45748030 chrX 45661993 45665992 45744031 45748030 43 chr4 73638150 73638179 73839397 73839426 chr4 73634180 73638179 73835427 73839426 44 chrl8 68711391 68711420 68798432 68798461 chrl8 68711391 68715390 68794462 68798461 45 chrl4 65085197 65085226 65194793 65194822 chrl4 65081227 65085226 65194793 65198792 46 chrl4 53106019 53106048 53229295 53229324 chrl4 53106019 53110018 53225325 53229324 47 chr9 127166325 127166354 127228573 127228602 chr9 127166325 127170324 127224603 127228602 48 chrl 98050630 98050659 98164667 98164696 chrl 98050630 98054629 98164667 98168666 49 chr4 153224644 153224673 153242668 153242697 chr4 153220674 153224673 153242668 153246667 50 chr2 233064863 233064892 233261789 233261818 chr2 233064863 233068862 233261789 233265788 Table 2.a3 05 03 25 probe Primer ID 1 ORFl_chrl5_94287688_94292746_94340208_94346941_FR_l OBD168-401 2 C)RFl_chr4_102312731_102315549_102386632_102391817_FR_l OBD168-405 3 ORFl_chr8_38716162_38718294_38738341_38742581_RR_l OBD168-409 4 ORFl_chr5_1324585O7_132464714_132517598_132521351_RF_l OBD168-413 5 ORFl_chrl2_96463989_96466636_96618278_96624162_RR_l OBD168-417 6 C)RFl_chrll_79036088_79041510_79269569_79271288_FF_l OBD168-421 7 ORFl_chrl_11226O37_11228251_11272812_11274518_RR_l OBD168-425 8 ORFl_chr2_15928336O_159285194_159326592_159328925_FR_l OBD168-429 9 ORFl_chr8_90002099_90011473_90148439_90150313_FR_l OBD168-433 10 ORFl_chr3_113947O63_113952443_113975285_113978229_RR_l OBD168-437 11 C)RFl_chr3_149818709_149821071_150005759_150009319_FR_l OBD168-441 12 C)RFl_chr5_60597760_60604069_60738056_60741292_FR_l OBD168-445 13 ORFl_chr6_53534187_53536920_53639583_53651122_RF_l OBD168-449 14 ORFl_chr5_88269888_88274763_88365192_88376199_FR_l OBD168-453 15 ORFl_chr9_76572O19_76577216_76769644_76771O52_RF_l OBD168-457 16 ORFl_chrl8_68711389_68714330_68911644_68918950_RF_l OBD168-461 17 ORFl_chr5_134464509_134469933_134674132_134676030_RR_l OBD168-465 18 ORFl_chr8_92469388_92478361_92510934_92515600_RR_l OBD168-469 19 ORFl_chrl0_54058576_54060371_54213283_54215754_FR_l OBD168-473 20 C)RFl_chrl_109159473_109163477_109318126_109321152_RF_l OBD168-477 21 ORFl_chrl2_9614159_9624874_9729793_9733228_FF_l OBD168-481 22 ORFl_chrl4_89417652_89420597_89636182_89641783_RF_l OBD168-485 23 ORFl_chrl_155206612_155209922_155288575_155290398_FR_l OBD168-489 24 ORFl_chr5_17345O236_173452725_17347924O_173485435_RF_l OBD168-493 25 ORFl_chr3_43246875_43252830_43297212_43303273_FR_l OBD168-497 26 ORFl_chr2_118090940_118096647_118214615_118218048_RR_l OBD168-501 27 ORFl_chr5_96799181_96801649_96813450_96815948_RF_l OBD168-505 28 ORFl_chr3_43094298_43105527_43246875_43252830_RF_l OBD168-509 29 ORFl_chr9_16574863_16577692_16721839_16729333_FF_l OBD168-513 30 C)RFl_chr3_107414954_107426087_107525934_107527641_RF_l OBD168-517 31 C)RFl_chrl2_13090807_13095110_13190440_13193042_FR_l OBD168-521 32 ORFl_chr5_35271024_35276749_35319374_35321203_RR_l OBD168-525 33 ORFl_chrl3_109649213_109651298_109745462_109746722_RR_l OBD168-529 34 ORFl_chrl6_10044778_10047306_9907142_9911562_RF_l OBD168-533 35 ORFl_chr9_71446407_71452706_71476978_71478030_FF_l OBD168-537 36 ORFl_chr2_37666390_37670759_37879290_37884290_RF_l OBD168-541 37 ORFl_chr5_50708409_50716050_50726245_50731870_FR_l OBD168-545 38 ORFl_chr5_122311763_122314967_12235O193_122356927_FF_l OBD168-549 39 ORFl_chr4_85761047_85763139_85952092_85960583_FR_l OBD168-553 40 ORFl_chrl5_44713197_44715317_44756695_44758842_RR_l OBD168-557 41 C)RFl_chr9_71446407_71452706_71550704_71559890_FR_l OBD168-561 42 ORFl_chrX_45661991_45664592_45739643_45748O32_RF_l OBD168-565 43 ORFl_chr4_73629979_73638181_73831449_73839428_FF_l OBD168-569 44 ORFl_chrl8_68711389_68714330_68797123_68798463_RF_l OBD168-573 45 ORFl_chrl4_65076556_65085228_65194791_65198794_FR_l OBD168-577 46 ORFl_chrl4_53106017_53108105_53223270_53229326_RF_l OBD168-581 47 C)RFl_chr9_127166323_127173810_127226000_127228604_RF_l OBD168-585 48 C)RFl_chrl_98050628_98053768_98164665_98171570_RR_l OBD168-589 49 ORFl_chr4_153219867_153224675_153242666_153249857_FR_l OBD168-593 50 ORFl_chr2_233064861_233067168_233261787_233264668_RR_l OBD168-597 Table 2.a4 05 03 25 Primer Sequence Primer ID Primer Sequence 1 GCTTGTATTGGAGACTAAACATAG OBD168-403 CCTCTAAAACTCATCAATAACAAT 2 TCTCTTATCTCTTCATTGGTAACTGC OBD168-407 TAGTCCTCAGGTTTAGGCAAGTTG 3 ACTGTTCTGTTGATTGGTTGGTGATA OBD168-411 AGGGACACAGAAGCCAAATGAGAGAG 4 CATCAAGTTTTCAGAATAGTAAATC OBD168-415 C ACCTG G G AACATTATTTG G C ATA 5 CCTGGGCAACAGAGTGAGATTCT OBD168-419 CCTTTCCTGGTCCCTCCTCATCA 6 CAGGACCATTGAGAGAATAACAGATA OBD168-423 GTTCCTGAG CCGCCCGATAAAG C 7 CACCTTGGTTATAGGACATC OBD168-427 GAGTTCTTATGATGCTAAGA 8 TGCTCA1 1 1L1G1A1CCACACCAT OBD168-431 TATGTGGCTTGTCATCCTTATTTT 9 GGCTATGTCCCCTAAGGAAACACACA OBD168-435 CACCAG GTTGACATCTTTTCAGTGG G 10 GAAACTGCCCTGAGATGAGAGTCCTT OBD168-439 GCTGTGGATGAAAGGAAGGAGAGACA 11 TAAGCAGTCATTCCCTGATGCCCCTA OBD168-443 CACCTGAGCAATGCGGATAAAGCAGA 12 ATGCCTCAACCATTACATL1 1 1 1LLF OBD168-447 AGTAGACAGATGGGTGGGATTCTTCC 13 GAGGAAGAGGAATGTCCGCTAACACA OBD168-451 G CCAGCACCCAAG ATTTAG CCAAGTT 14 TTCTATTGTGTTTCGTGGTTCCTGGA OBD168-455 ATACCTGAGTAGGAGTTAGCGTCTA 15 TCAACTATCAATGCGAAAGTAAAT OBD168-459 CACATTTCCCATCTCATTATTATTA 16 TTGGATTCATAGCAGTTCTAAAAT OBD168-463 TATCAATGTATTATCTCTGCCTAT 17 GGCAACAGAGCGAGACTCCTTCT OBD168-467 AGGCTGGGATTACAGGCGTAGGC 18 TATCCTTCCAGTCTACL1 1L1 1 1 1 OBD168-471 GTTCTGTG GTCTCCTATCTACATA 19 CTGACTGACTATGATTGTTTGTAG OBD168-475 ATTTGGCATTTCAL Illi GGTTTA 20 TGGGCTCTGGAGTTGGGATGCCA OBD168-479 TGTTG GTTGTGTGCCAG CAG CCA 21 CAAGTCTGCTATTGAACCCCTCT OBD168-483 ATTTCCTTCTGCTCCCCAAGTGG 22 GCTGAGAGAGTCAAGGGAAAACCC OBD168-487 CGTGGAATCTCCTCTTCTCACCCC 23 GACCAAACGACTCACAG CCAG G C OBD168-491 CTTGGCAGTGGAGACATACAGCG 24 CCCAAG CAG GGCAACCATC AAG G OBD168-495 ACAATCAGTGGGCTGGATGTGGC 25 AAAATGTCTGTCCCCACCATCCCAG G OBD168-499 TGACTTCTCATCAGGTCCGAGTGTA 26 CAGAGGAGTGGGTTATTTTCAAGGGA OBD168-503 TTGATTTG CCCTCAGTAACCTCG CTG 27 ATGTATGTGTGGATAGACGGATGGAT OBD168-507 CCCTTTGGACGGGAATACCTCTCACT 28 CCCACCATCCCAGGCAATCCCAA OBD168-511 GGAAATCACTGGGTCTGTTGCCC 29 AAAATCAG GAGTTTGG AG AAAATA OBD168-515 TCATAAAAGTAGTCAGCAGGAAAA 30 GAGACCTCATCTGTGGTGTTTCCTGG OBD168-519 CTTGTTGAAGTGAGGGATTTTGTCCT 31 TCCACCAG G G AG AGACACAAG G A OBD168-523 TCCCCTGGATTGTGTGCTGGGCA 32 TAACCCCAG CCTAAGACAAAATAG OBD168-527 CCATTTTGTTTGGTTTTGCTTTGC 33 GGAAGGGAAGATACAGAGGG HILI OBD168-531 AAACAAGCGGCGGCAGGACCCCT 34 TAAAATG G GCATAATCATAGCAG CCA OBD168-535 GGTCATTGATTAGGGAATAGTAACAC 35 GAGAGGGAGGGTGAGAGAGAACCT OBD168-539 G G G CTTG GTGTTTCCTTG GTTCC 36 CCATCCAAAAGAGTCATACACAGGAA OBD168-543 GTTTG CTTAGTCCTTACTG CTTG CCT 37 GCTTCTGTCTCC11L11 1 1 LAG 1CTC OBD168-547 TAGATTACACATACATCCTCCATTGG 38 G CATTTACTTTGTGCTTATTTGTA OBD168-551 TTACTCTAAACAAGCCACTGAAGT 39 LI 1 1 1GGACTATTGA1 111CC1AT OBD168-555 AAAGCACAGGCAGATGTATGAATA 40 GAGGAGGAAAATAGACCTTCAGAGGC OBD168-559 AAGACCAGACACATTTCAACGCCACG 41 G AG G G AG GGTG AGAG AG AACCTATCT OBD168-563 GGAGTATGATTGTCCATCTTCTGCCT 42 TACTTCTGCGTGCTTTATTCCAGGCA OBD168-567 CCAGAGGATGACTTGATTTGGAGTGG 43 CAACATCACTAATCATCAGAGATA OBD168-571 TTG GTGTTCTCATAGCATCTTCTA 44 GCTGGGAAGCAGAAGGATTTGGAGTT OBD168-575 TCAGTCCTCTGCTTTTATCTTTGAGA 45 G GAG G CAG GTTTCTTTTCACATCCAC OBD168-579 TGTTATTTACGAAGAGTGTTGTGAGC 46 CGTCATTCTAL HILI GTCTCCAT OBD168-583 GTAATAAGTGAGAGTCATACAATA 47 1 1 1L1 1 1GTTTCATAGTGAGGTGA OBD168-587 GTAATACAGAAATAGTAACACCTA 48 TCAGTGTTCAAATGGATGACAAAA OBD168-591 AGAACTACATCTGAAAATCAAAGT 49 GTTTGTTTAGATGACTGTCTCTTATCAG OBD168-595 CTTTAC AG GCAGACCCAGGGAGC 50 G GG CACATACCCCTTCCTG GTCT OBD168-599 GTGCCTAAAGCCACAGGAGTGAG Table 2.a5 05 03 25 probe Marker 1 ORFl_chrl5_94287688_94292746_94340208_94346941_FR_l OBD168-401.403 2 C)RFl_chr4_102312731_102315549_102386632_102391817_FR_l OBD168-405.407 3 ORFl_chr8_38716162_38718294_38738341_38742581_RR_l OBD168-409.411 4 ORFl_chr5_1324585O7_132464714_132517598_132521351_RF_l OBD168-413.415 5 ORFl_chrl2_96463989_96466636_96618278_96624162_RR_l OBD168-417.419 6 C)RFl_chrll_79036088_79041510_79269569_79271288_FF_l OBD168-421.423 7 ORFl_chrl_11226O37_11228251_11272812_11274518_RR_l OBD168-425.427 8 ORFl_chr2_15928336O_159285194_159326592_159328925_FR_l OBD168-429.431 9 ORFl_chr8_90002099_90011473_90148439_90150313_FR_l OBD168-433.435 10 ORFl_chr3_113947O63_113952443_113975285_113978229_RR_l OBD168-437.439 11 C)RFl_chr3_149818709_149821071_150005759_150009319_FR_l OBD168-441.443 12 C)RFl_chr5_60597760_60604069_60738056_60741292_FR_l OBD168-445.447 13 ORFl_chr6_53534187_53536920_53639583_53651122_RF_l OBD168-449.451 14 ORFl_chr5_88269888_88274763_88365192_88376199_FR_l OBD168-453.455 15 ORFl_chr9_76572O19_76577216_76769644_76771O52_RF_l OBD168-457.459 16 ORFl_chrl8_68711389_68714330_68911644_68918950_RF_l OBD168-461.463 17 ORFl_chr5_134464509_134469933_134674132_134676030_RR_l OBD168-465.467 18 ORFl_chr8_92469388_92478361_92510934_92515600_RR_l OBD168-469.471 19 ORFl_chrl0_54058576_54060371_54213283_54215754_FR_l OBD168-473.475 20 C)RFl_chrl_109159473_109163477_109318126_109321152_RF_l OBD168-477.479 21 ORFl_chrl2_9614159_9624874_9729793_9733228_FF_l OBD168-481.483 22 ORFl_chrl4_89417652_89420597_89636182_89641783_RF_l OBD168-485.487 23 ORFl_chrl_155206612_155209922_155288575_155290398_FR_l OBD168-489.491 24 ORFl_chr5_17345O236_173452725_17347924O_173485435_RF_l OBD168-493.495 25 ORFl_chr3_43246875_43252830_43297212_43303273_FR_l OBD168-497.499 26 ORFl_chr2_118090940_118096647_118214615_118218048_RR_l OBD168-501.503 27 ORFl_chr5_96799181_96801649_96813450_96815948_RF_l OBD168-505.507 28 ORFl_chr3_43094298_43105527_43246875_43252830_RF_l OBD168-509.511 29 ORFl_chr9_16574863_16577692_16721839_16729333_FF_l OBD168-513.515 30 C)RFl_chr3_107414954_107426087_107525934_107527641_RF_l OBD168-517.519 31 C)RFl_chrl2_13090807_13095110_13190440_13193042_FR_l OBD168-521.523 32 ORFl_chr5_35271024_35276749_35319374_35321203_RR_l OBD168-525.527 33 ORFl_chrl3_109649213_109651298_109745462_109746722_RR_l OBD168-529.531 34 ORFl_chrl6_10044778_10047306_9907142_9911562_RF_l OBD168-533.535 35 ORFl_chr9_71446407_71452706_71476978_71478030_FF_l OBD168-537.539 36 ORFl_chr2_37666390_37670759_37879290_37884290_RF_l OBD168-541.543 37 ORFl_chr5_50708409_50716050_50726245_50731870_FR_l OBD168-545.547 38 ORFl_chr5_122311763_122314967_12235O193_122356927_FF_l OBD168-549.551 39 ORFl_chr4_85761047_85763139_85952092_85960583_FR_l OBD168-553.555 40 ORFl_chrl5_44713197_44715317_44756695_44758842_RR_l OBD168-557.559 41 C)RFl_chr9_71446407_71452706_71550704_71559890_FR_l OBD168-561.563 42 ORFl_chrX_45661991_45664592_45739643_45748O32_RF_l OBD168-565.567 43 ORFl_chr4_73629979_73638181_73831449_73839428_FF_l OBD168-569.571 44 ORFl_chrl8_68711389_68714330_68797123_68798463_RF_l OBD168-573.575 45 ORFl_chrl4_65076556_65085228_65194791_65198794_FR_l OBD168-577.579 46 ORFl_chrl4_53106017_53108105_53223270_53229326_RF_l OBD168-581.583 47 C)RFl_chr9_127166323_127173810_127226000_127228604_RF_l OBD168-585.587 48 C)RFl_chrl_98050628_98053768_98164665_98171570_RR_l OBD168-589.591 49 ORFl_chr4_153219867_153224675_153242666_153249857_FR_l OBD168-593.595 50 ORFl_chr2_233064861_233067168_233261787_233264668_RR_l OBD168-597.599 Table 2.a6 05 03 25 51 ORFl_chrl8_62330039_62332469_62410773_62412005_FR_l 65192 239.5 -1.875 52 ORFl_chrl_97723527_97730826_97845524_97850752_RF_l 50784 228.9 -1.885 53 ORFl_chr5_165127546_165128761_165171328_165175416_FR_l 19637 216.9 -2.379 54 ORFl_chr2_26077134_26081726_26188355_26191067_RF_l 69487 178.6 -1.995 55 ORFl_chr5_165127546_165128761_165223844_165225058_FF_l 64468 215.5 -2.376 56 ORFl_chrl8_62240628_62243651_62330039_62332469_RF_l 133666 346.6 -1.762 57 ORFl_chrl8_35525412_35527471_35609926_35611497_FF_l 82154 326.1 -1.904 58 ORFl_chrl0_93741396_93744278_93870079_93871714_FR_l 18832 373.7 -1.721 59 ORFl_chr2_186622411_186639782_186682119_186696186_RR_l 60297 398.7 -2.055 60 ORFl_chrl2_52217955_52219158_52307864_52312912_RR_l 94808 645.1 -1.637 61 ORFl_chr4_168499900_168503445_168627683_168631715_RR_l 19017 638.6 -1.749 62 ORFl_chrl9_56561558_56564720_56759775_56765600_RF_l 104682 688.2 -1.605 63 ORFl_chrl8_6233OO39_62332469_62555999_62562221_FR_l 50516 672 -1.631 64 ORFl_chr20_44492930_44498158_44629984_44632053_RF_l 124521 685.8 -1.717 65 ORFl_chr6_15591O3O_15592334_15658715_15661455_FR_l 337 714.7 -1.592 66 ORFl_chrl5_69599001_69607474_69822688_69824653_FF_l 62666 745.6 -1.585 67 ORFl_chr3_194783856_194786305_194878644_194884153_RR_l 17829 770.7 -1.677 68 ORFl_chr2_29059303_29063818_29079780_29082596_FR_l 40095 763.6 -1.742 69 ORFl_chrl_97845524_97850752_97969457_97975300_FR_l 50177 785.2 -1.6 70 ORFl_chrl0_93674996_93683570_93741396_93744278_RF_l 47914 862.8 -1.578 71 ORFl_chr8_125289724_125291437_1253O4189_125311876_RR_l 102207 885.4 -1.562 72 ORFl_chr5_77084813_77086498_77232748_77239462_RR_l 51608 913 -1.636 73 ORFl_chrl7_68654144_68657529_68785810_68796098_FR_l 41397 984.6 -1.724 74 ORFl_chrl_112396884_112399115_112478496_112485740_RR_l 98481 1020 -1.678 75 ORFl_chrl_207314651_207319651_207566031_207567951_RR_l 51534 1088 -1.97 76 ORFl_chr3_194783856_194786305_194980518_194987236_RR_l 16693 1145 -1.542 77 ORFl_chr4_24971631_24973362_25125726_25129421_RR_l 21906 1155 -1.541 78 ORFl_chrl_117925651_117930301_117977839_117981106_FF_l 60395 1120 -1.555 79 ORFl_chrl8_62330039_62332469_62459933_62463601_FF_l 79455 1142 -1.521 80 ORFl_chrl_16764579_16768424_17044824_17050263_RR_l 35783 1173 -1.58 81 ORFl_chr3_42701255_42712462_42763077_42767575_RR_l 96660 1137 -1.56 82 C)RFl_chr2_200711316_200714252_200861419_200863026_RR_l 37379 1120 -1.47 83 ORFl_chrl0_119537441_119541197_119587019_119594844_RR_l 102190 1191 -1.523 84 ORFl_chr8_57997832_57999789_5815656O_5816OO85_FF_l 97562 1274 -1.49 85 ORFl_chr5_54687073_54701690_54895820_54899919_RF_l 84406 1298 -1.495 86 ORFl_chr22_37276476_37281194_37296506_37298053_FF_l 89194 1268 -1.533 87 ORFl_chr9_27616981_27624076_27731177_27739077_RR_l 19905 1332 -1.487 88 ORFl_chrl3_57155089_57159703_57172839_57181375_RR_l 118355 1298 -1.539 89 ORFl_chr2_127388555_127395831_1275124O3_127514497_RR_l 125959 1266 -1.633 90 ORFl_chrl4_61568474_61572943_61720413_61722720_FR_l 105496 1233 -1.987 91 C)RFl_chrll_104153980_104160882_104179897_104181773_FF_l 18635 1291 -1.85 92 C)RFl_chr4_15897457_15905803_15999719_16002207_RR_l 19816 1244 -1.501 93 ORFl_chrl7_17631398_17633309_17824119_17825835_RR_l 73392 1264 -1.608 94 ORFl_chrl7_18194373_18201018_18300185_18301934_FF_l 43770 1320 -1.552 95 ORFl_chr5_169694390_169702047_169742878_169747823_FF_l 15015 1359 -1.527 96 ORFl_chrl_224094766_224099331_224328317_224334418_FF_l 46944 1354 -1.479 97 ORFl_chrl9_51484258_51487562_51764536_51772179_RR_l 27427 1262 -1.555 98 ORFl_chr9_92152672_92155419_92403506_92407832_FR_l 104212 1388 -1.947 99 ORFl_chrl_117925651_117930301_118024887_118028035_FR_l 17564 1467 -1.49 100 ORFl_chrl6_87246411_87247863_87484414_87491902_RF_l 65474 1403 -1.601 Table 2.bl 05 03 25 51 0.0002952 1.046E-08 pHC GAGAATCAATTCCATTTTTAAAGCTTAGTCGAGTCCCTTACAGAAAATGATGTAGTATTT 52 0.0003058 8.667E-09 pHC GTCACCTAI Illi ICCAACTTAAIIIGATCGATTCATTACAC111A1ATTAAGTAGTTTT 53 0.0003268 6.947E-09 pHC TTTGTAACAATAGCAAAAGTTCAGTTCTTCGAGCTAATAGAAGGATGGTGAAGTAAATTT 54 0.0004359 3.089E-09 pHC TACCTTCCAACAGGAAGTGCAAACTAATTCGAAATAATTCAGACATGATTGTGTTTTACT 55 0.0004767 6.755E-09 pHC TTTGTAACAATAGCAAAAGTTCAGTTCTTCGATAAACATTTATTCAAAGGCATGAATGAC 56 0.0008269 4.687E-08 pHC GAGAATCAATTCCA 1 1 1 1 1AAAGCTTAGTCGAATGCTAATCCTCTTCTATTAATGAATTC 57 0.0008633 3.67E-08 pHC GTCACAGAGATCATGGTAAAGAGAAAATTCGATTACATAAATATTTCTCTAAGGTTGCTG 58 0.0009938 6.338E-08 pHC AGAAATGAACAACACATTGTAATATACATCGAAAAGAACTAATAATGCTAAGGATTCTGA 59 0.001157 8.195E-08 pHC AGAAGACTCACCAAAATTTTATCCTGTTTCGAACCTTATAATGGTGATAAATCATTAATG 60 0.005398 5.355E-07 pHC AAATCAAGACGGAGGAACTATTTCAGATTCGAGGTAGTGGCAGCTAATAGCTCTTAAGGG 61 0.005591 0.000000515 pHC TTGAAGTCTGTTTGTGAAATACTTTGAGTCGAAAGACAAACGGCAAAATGAGAAAACAAT 62 0.005695 6.859E-07 pHC CGCGTGATGTGTTTGAAGGTGTGTTTGTTCGAAAAAGACTTGCATTTATGCAGAGTGAGG 63 0.005892 6.262E-07 pHC GAGAATCAATTCCA 1 1 1 1 1AAAGCTTAGTCGATTCTTGCAAATGAA1 1 1 1G1 rAAATGTT 64 0.00597 6.768E-07 pHC AAATTA1 1 1 TGC 1 1 1C1A1 1 1C1CCTCTTCGATC1 1 1CATATTTCATCCTGGTTTCACAA 65 0.006212 7.923E-07 pHC AG 1 1 1 1C1CAGTTATTGAAATGAATCTCTCGAAGTATGTAC1 1 1GGTATGTCCAAAAGTC 66 0.00691 9.303E-07 pHC AATGAAGTCCCAGGCTTTCGTCTCACGTTCGAATAACAACCAGTTTAAAAACATACTAAA 67 0.007091 0.000001055 pHC 1 1 1C1AAATTTCCAAGG 1 1C1 1 1CCAGTTCGACCAATG AAACTG ATTAAGACCATACAAG 68 0.007188 0.000001019 pHC GCATGAACAACTG1 1 1 1 1CACTTTGATTTCGAATTTCTTGACTTTTGACTGGTTGTTTAT 69 0.007265 0.000001132 pHC GTCACCTA1 1 1 1 1 1CCAACTTAA111GATCGA1 1 1C1GCATTTCCTTGAACTGAATCTTA 70 0.009917 0.000001616 pHC AGAAATGAACAACACATTGTAATATACATCGAAACTGTCACTACATTTTACCTAATTTAG 71 0.01048 0.000001781 pHC CTCAAGAAAGAAAACCTAAGCTTTAAATTCGACTCTAATCTATAAAACTAAGATACTTAA 72 0.01128 0.000001998 pHC CAACTGAGGAACTGGAACTTCATTAGAGTCGAAGTGCTCTGTGGTGATGCAGCAGGTTGA 73 0.01439 0.00000265 pHC AGAAGCTGTATGATTTGTAGTAATTCATTCGAATAGTCAGTAGCTGCCTTTGCAAAGATG 74 0.01577 0.000003017 pHC CCAAAACAGTCCCAAAACAGGAGAGCTCTCGATGGGACTATTGGAAGATTTCTCAGAAGA 75 0.01867 0.000003836 pHC TGGTGCATAATGAAGACTAAAGCGTTCCTCGATTTAAAAATAGTTTATTTTAATAATGTT 76 0.01927 0.000004641 pHC TTTCTAAAI1ICCAAGG 1 1C1 1 1CCAGTTCGAGGCAATTCTAAAGAACAATAAGAGATTA 77 0.01932 0.00000479 pHC GGTGAGTGGCAGATAGCTGGGAAAACATTCGAGCCAAGCTGAGTGACAGCTTTGTCACGG 78 0.01947 0.000004276 pHC GCAAGTTGTATGGGAGGTAGTTTAAATATCGAAGTATCTCAAATAACAI 1 1 1 IGAGAATG 79 0.01965 0.000004594 pHC GAGAATCAATTCCA 1 1 1 1 1AAAGCTTAGTCGATTAGGATGATGGCAATGGAAATAACAAG 80 0.01985 0.000005064 pHC AGCTCAGGCAATCCATGCTTGGAGAAAGTCGATAGATGGCAAATTTCTTGATACGGGGAG 81 0.01997 0.000004527 pHC TTGTGAGGAGCTAAGGGAGACTCACTGATCGAAAAAGATTTATGAACAGAAAAAGGAAAG 82 0.02009 0.00000427 pHC CAACAAGAACG AC 1 1 1C1 1 1 1 1 1C1 1CTTCGACTATGATAATCTTTCTCA1 1 1A I'AG ACC 83 0.02046 0.000005365 pHC ACTAGCTTGCAAGGATTGTTGCAAAGTTTCGATGAAAGCACAAATAAATAATTAAAGGCA 84 0.02204 0.000006872 pHC AG CG AATTTAAG G CAGTAATAAGTGCAGTCGAG GCAGTG GG AGTTG AATCCTCTCCCCTC 85 0.0221 0.000007358 pHC ATTAGGAGTGGGGGCCTTGAGAGGTAATTCGATCI 1 1 1CAAAGAACCACATTTTAGTTTT 86 0.02217 0.000006755 pHC GAGCTGCAAGGCCTTTTAAAGCTCAGCCTCGATTTGTATTCCACAGAGCTTATCATTCTC 87 0.02237 0.000008085 pHC AATACTACI1IGCATATATAATAAAG111CGAGAATGGACTAATAAACACATG1 1 1C1 GA 88 0.02256 0.000007354 pHC TCAGTCTAGAACATAACAGAAAATGTCTTCGAC1L1 1 1 1 1ACAAAAGGCCACTTGACATC 89 0.02258 0.000006718 pHC AATGTACACAACCAGTCATAACCAAGTATCGAAAAGA1 1 1 1 1ACAGAG Illi CCCCCTTC 90 0.0226 0.000006085 pHC GGCAGATGGATCACTTGAGGTCAAGAGTTCGAGATGCAGCCAGATCTCGGCGAAGTAAAG 91 0.02263 0.000007217 pHC CTTATAATGGGTAGAAGCAGACTATCATTCGATAAGAAAAAGAGAGATATCCAAATAAAA 92 0.02278 0.000006294 pHC TTGGTTAGAGATAAAAACCCTGTAAATGTCGACCAGTGAAATAACTAAAATACTGTGACA 93 0.02297 0.000006673 pHC AGGCTGATATTTG 1 1L1 1 1AGCTGTGTGTCGAATGGTAGAAGGGAGATAATATGGGTGCA 94 0.023 0.000007821 pHC GCTTACTTGGTCATTAGATCCACAGAGTTCGACTCTTTAACCACACGGCTTGCCTAGTTC 95 0.02313 0.000008685 pHC GAGGATGAAAATTAAATGACTTTTAATGTCGAGAATTAAACTCAGTTTAAGAGACTGCTA 96 0.02328 0.000008577 pHC GGCAGGTGGATTGCTTGAGCTCAGGAGTTCGAAAAAGAAAAGAAAAGAACATAACAGAAC 97 0.0234 0.000006633 pHC GTAGTCCAGGGGAAGAGAAAAATGTGAATCGATAATTGTGAAAGTCACTTCCGCTCTCTG 98 0.02457 0.0000094 pHC GTACAGTTCCAACGAGCGGAGTGGTGGGTCGAAGCAATATTTAAAAGCTTAGAGGATGTT 99 0.02494 0.00001149 pHC GCAAGTTGTATGGGAGGTAGTTTAAATATCGAAATCTTCTGATCTATTATTGATGACATG 100 0.02507 0.00000977 pHC CTGCAGCCCGTAGTTGTGGATGATGGAGTCGATCGTGCAGACAGGAGACAAACAGCAAGA Table 2.b2 05 03 25 51 chrl8 62332438 62332467 62410775 62410804 chrl8 62328468 62332467 62410775 62414774 52 chrl 97723529 97723558 97850721 97850750 chrl 97723529 97727528 97846751 97850750 53 chr5 165128730 165128759 165171330 165171359 chr5 165124760 165128759 165171330 165175329 54 chr2 26077136 26077165 26191036 26191065 chr2 26077136 26081135 26187066 26191065 55 chr5 165128730 165128759 165225027 165225056 chr5 165124760 165128759 165221057 165225056 56 chrl8 62240630 62240659 62332438 62332467 chrl8 62240630 62244629 62328468 62332467 57 chrl8 35527440 35527469 35611466 35611495 chrl8 35523470 35527469 35607496 35611495 58 chrlO 93744247 93744276 93870081 93870110 chrlO 93740277 93744276 93870081 93874080 59 chr2 186622413 186622442 186682121 186682150 chr2 186622413 186626412 186682121 186686120 60 chrl2 52217957 52217986 52307866 52307895 chrl2 52217957 52221956 52307866 52311865 61 chr4 168499902 168499931 168627685 168627714 chr4 168499902 168503901 168627685 168631684 62 chrl9 56561560 56561589 56765569 56765598 chrl9 56561560 56565559 56761599 56765598 63 chrl8 62332438 62332467 62556001 62556030 chrl8 62328468 62332467 62556001 62560000 64 chr20 44492932 44492961 44632022 44632051 chr20 44492932 44496931 44628052 44632051 65 chr6 15592303 15592332 15658717 15658746 chr6 15588333 15592332 15658717 15662716 66 chrl5 69607443 69607472 69824622 69824651 chrl5 69603473 69607472 69820652 69824651 67 chr3 194783858 194783887 194878646 194878675 chr3 194783858 194787857 194878646 194882645 68 chr2 29063787 29063816 29079782 29079811 chr2 29059817 29063816 29079782 29083781 69 chrl 97850721 97850750 97969459 97969488 chrl 97846751 97850750 97969459 97973458 70 chrlO 93674998 93675027 93744247 93744276 chrlO 93674998 93678997 93740277 93744276 71 chr8 125289726 125289755 125304191 125304220 chr8 125289726 125293725 125304191 125308190 72 chr5 77084815 77084844 77232750 77232779 chr5 77084815 77088814 77232750 77236749 73 chrl7 68657498 68657527 68785812 68785841 chrl7 68653528 68657527 68785812 68789811 74 chrl 112396886 112396915 112478498 112478527 chrl 112396886 112400885 112478498 112482497 75 chrl 207314653 207314682 207566033 207566062 chrl 207314653 207318652 207566033 207570032 76 chr3 194783858 194783887 194980520 194980549 chr3 194783858 194787857 194980520 194984519 77 chr4 24971633 24971662 25125728 25125757 chr4 24971633 24975632 25125728 25129727 78 chrl 117930270 117930299 117981075 117981104 chrl 117926300 117930299 117977105 117981104 79 chrl8 62332438 62332467 62463570 62463599 chrl8 62328468 62332467 62459600 62463599 80 chrl 16764581 16764610 17044826 17044855 chrl 16764581 16768580 17044826 17048825 81 chr3 42701257 42701286 42763079 42763108 chr3 42701257 42705256 42763079 42767078 82 chr2 200711318 200711347 200861421 200861450 chr2 200711318 200715317 200861421 200865420 83 chrlO 119537443 119537472 119587021 119587050 chrlO 119537443 119541442 119587021 119591020 84 chr8 57999758 57999787 58160054 58160083 chr8 57995788 57999787 58156084 58160083 85 chr5 54687075 54687104 54899888 54899917 chr5 54687075 54691074 54895918 54899917 86 chr22 37281163 37281192 37298022 37298051 chr22 37277193 37281192 37294052 37298051 87 chr9 27616983 27617012 27731179 27731208 chr9 27616983 27620982 27731179 27735178 88 chrl3 57155091 57155120 57172841 57172870 chrl3 57155091 57159090 57172841 57176840 89 chr2 127388557 127388586 127512405 127512434 chr2 127388557 127392556 127512405 127516404 90 chrl4 61572912 61572941 61720415 61720444 chrl4 61568942 61572941 61720415 61724414 91 chrll 104160851 104160880 104181742 104181771 chrll 104156881 104160880 104177772 104181771 92 chr4 15897459 15897488 15999721 15999750 chr4 15897459 15901458 15999721 16003720 93 chrl7 17631400 17631429 17824121 17824150 chrl7 17631400 17635399 17824121 17828120 94 chrl7 18200987 18201016 18301903 18301932 chrl7 18197017 18201016 18297933 18301932 95 chr5 169702016 169702045 169747792 169747821 chr5 169698046 169702045 169743822 169747821 96 chrl 224099300 224099329 224334387 224334416 chrl 224095330 224099329 224330417 224334416 97 chrl9 51484260 51484289 51764538 51764567 chrl9 51484260 51488259 51764538 51768537 98 chr9 92155388 92155417 92403508 92403537 chr9 92151418 92155417 92403508 92407507 99 chrl 117930270 117930299 118024889 118024918 chrl 117926300 117930299 118024889 118028888 100 chrl6 87246413 87246442 87491871 87491900 chrl6 87246413 87250412 87487901 87491900 Table 2.b3 05 03 25 51 ORFl_chrl8_62330039_62332469_62410773_62412005_FR_l OBD168-601 52 ORFl_chrl_97723527_97730826_97845524_97850752_RF_l OBD168-605 53 ORFl_chr5_165127546_165128761_165171328_165175416_FR_l OBD168-609 54 ORFl_chr2_26077134_26081726_26188355_26191067_RF_l OBD168-613 55 ORFl_chr5_165127546_165128761_165223844_165225058_FF_l OBD168-617 56 ORFl_chrl8_62240628_62243651_62330039_62332469_RF_l OBD168-621 57 ORFl_chrl8_35525412_35527471_35609926_35611497_FF_l OBD168-625 58 ORFl_chrl0_93741396_93744278_93870079_93871714_FR_l OBD168-629 59 ORFl_chr2_186622411_186639782_186682119_186696186_RR_l OBD168-633 60 ORFl_chrl2_52217955_52219158_52307864_52312912_RR_l OBD168-637 61 ORFl_chr4_168499900_168503445_168627683_168631715_RR_l OBD168-641 62 ORFl_chrl9_56561558_56564720_56759775_56765600_RF_l OBD168-645 63 ORFl_chrl8_6233OO39_62332469_62555999_62562221_FR_l OBD168-649 64 ORFl_chr20_44492930_44498158_44629984_44632053_RF_l OBD168-653 65 ORFl_chr6_15591O3O_15592334_15658715_15661455_FR_l OBD168-657 66 ORFl_chrl5_69599001_69607474_69822688_69824653_FF_l OBD168-661 67 ORFl_chr3_194783856_194786305_194878644_194884153_RR_l OBD168-665 68 ORFl_chr2_29059303_29063818_29079780_29082596_FR_l OBD168-669 69 ORFl_chrl_97845524_97850752_97969457_97975300_FR_l OBD168-673 70 ORFl_chrl0_93674996_93683570_93741396_93744278_RF_l OBD168-677 71 ORFl_chr8_125289724_125291437_1253O4189_125311876_RR_l OBD168-681 72 ORFl_chr5_77084813_77086498_77232748_77239462_RR_l OBD168-685 73 ORFl_chrl7_68654144_68657529_68785810_68796098_FR_l OBD168-689 74 ORFl_chrl_112396884_112399115_112478496_112485740_RR_l OBD168-693 75 ORFl_chrl_207314651_207319651_207566031_207567951_RR_l OBD168-697 76 ORFl_chr3_194783856_194786305_194980518_194987236_RR_l OBD168-701 77 ORFl_chr4_24971631_24973362_25125726_25129421_RR_l OBD168-705 78 ORFl_chrl_117925651_117930301_117977839_117981106_FF_l OBD168-709 79 ORFl_chrl8_62330039_62332469_62459933_62463601_FF_l OBD168-713 80 ORFl_chrl_16764579_16768424_17044824_17050263_RR_l OBD168-717 81 ORFl_chr3_42701255_42712462_42763077_42767575_RR_l OBD168-721 82 C)RFl_chr2_200711316_200714252_200861419_200863026_RR_l OBD168-725 83 ORFl_chrl0_119537441_119541197_119587019_119594844_RR_l OBD168-729 84 ORFl_chr8_57997832_57999789_5815656O_5816OO85_FF_l OBD168-733 85 ORFl_chr5_54687073_54701690_54895820_54899919_RF_l OBD168-737 86 ORFl_chr22_37276476_37281194_37296506_37298053_FF_l OBD168-741 87 ORFl_chr9_27616981_27624076_27731177_27739077_RR_l OBD168-745 88 ORFl_chrl3_57155089_57159703_57172839_57181375_RR_l OBD168-749 89 ORFl_chr2_127388555_127395831_1275124O3_127514497_RR_l OBD168-753 90 ORFl_chrl4_61568474_61572943_61720413_61722720_FR_l OBD168-757 91 C)RFl_chrll_104153980_104160882_104179897_104181773_FF_l OBD168-761 92 ORFl_chr4_15897457_15905803_15999719_16002207_RR_l OBD168-765 93 ORFl_chrl7_17631398_17633309_17824119_17825835_RR_l OBD168-769 94 ORFl_chrl7_18194373_18201018_18300185_18301934_FF_l OBD168-773 95 ORFl_chr5_169694390_169702047_169742878_169747823_FF_l OBD168-777 96 ORFl_chrl_224094766_224099331_224328317_224334418_FF_l OBD168-781 97 ORFl_chrl9_51484258_51487562_51764536_51772179_RR_l OBD168-785 98 ORFl_chr9_92152672_92155419_92403506_92407832_FR_l OBD168-789 99 ORFl_chrl_117925651_117930301_118024887_118028035_FR_l OBD168-793 100 ORFl_chrl6_87246411_87247863_87484414_87491902_RF_l OBD168-797 Table 2.b4 05 03 25 51 G CCCCTGTCTTCTCTCAACTTCATAG OBD168-603 CCGAATGGATGGTTGTGTCTGTGTTG 52 TCAGCCTCAGAATGCCAGAGTGACTG OBD168-607 CGAAGACTCTGACAAACACAGTGGTA 53 GCTGCTATGAGGCATTGTAGAGGAGA OBD168-611 GAACAGCAGACTTGTGGACCTTATCA 54 AACAGGCAGAGAGGTGGCTTCAGATG OBD168-615 GAGAAGCAACACCACAAAAGCAGGAA 55 GCTGCTATGAGGCATTGTAGAGGAGA OBD168-619 GCTCTCTGTCCATTCCTCAG111C1C 56 CCCTGTCTTCTCTCAACTTCATAGTC OBD168-623 TAG CAG GAACTATGTG CCACTGTG CC 57 CCCACTGCTTGGCTTTGGAGGAA OBD168-627 GCAGAGACTTTCCACCCTGTGCC 58 GCCCC1 1 1C1 bbbAACAACAACG OBD168-631 GGAGCAAGTAGGGAAGCAGTGGTC 59 ACCCTGTGCCCTTGAGCATACTGAAT OBD168-635 TGCCTTGTTTCCCCTTTG CCTTTAG C 60 ACCTCGGAGAAGCCTGGCAGACA OBD168-639 GTG CTTAGTGCCTGGCTCATAG C 61 AGAAAGTG GCAGACTCAGG GTG GAAG OBD168-643 CCCTTTGCGTTAGGAGTTTCAGATTG 62 G CG AATGTCCCTACAAGTGTG G G OBD168-647 ACTGGAAGCAAAGGTGCCTGGGC 63 G CCCCTGTCTTCTCTCAACTTCATAG OBD168-651 CTGATACTGTGTAGGGAGTCTGATGA 64 TACGGCTCCTCCATCTACCCAGC OBD168-655 CTCCTAAGATAAGTGACTCCTTGTG 65 CGGTAAATCTAAAGGACAATGCTGGT OBD168-659 GCCACAGACTGAAGAGGATTGGTTCT 66 CCGTTGCTCAAGAACCATCCAGAGTC OBD168-663 GCAAACTTCAGGCTGTATTGTTCTCG 67 GGTAGATTCCAACTCTGATTCCATTT OBD168-667 CTTTCCTTCTCTCTTCCTTATTGAGC 68 GCTCATTGGCAGAAGCAGGTTTT OBD168-671 TG G C A AAG CAACACCCTA AG G AT 69 TCAGCCTCAGAATGCCAGAGTGACTG OBD168-675 TGAGAAACCACAGCCACAGCAGAAAT 70 CTTTACCCTCAGTTTCCTTATCG G G A OBD168-679 GCAGAGAGGGAGATGTTGATGGAGGT 71 TAACAACTGCTAACTGGAGACACCA OBD168-683 ACTTGCTGTCTCGTTTCCTTGCCCC 72 G CAACACTACTCTCTCTCCTTCCTTG OBD168-687 GCAGTATTCCCTTTACAGTTATTGGT 73 GAGGCAGGCI 1 1 ICGTTCCAGCA OBD168-691 GAGACATCTTCCCCACTTGCTCGC 74 TACAAAGGGTGAAGGAGAGGAGGTCC OBD168-695 CCCTA1 1 1 1C1CC1GGTCAGCAAGTT 75 CACCTTCCATTGATACTCTCACTTTG OBD168-699 GCACAAGACCAAAGGATTTATCGCAC 76 CCACGCCTCAGCCAATCACTCCAAAA OBD168-703 GAAAGCCATTGTCCCAACACCAAGTA 77 CAGTAGTTCTAAAAGAGAGGATGGTA OBD168-707 GCCAGTAAACCAAGGCTTATTAGGAT 78 G GTTTG GTCGTGAACTGTCAG AAAG G OBD168-711 CTTTGTATTTCTTTCCTTCAGTCTG G 79 GGGTTCGCATCACATCCCACAGA OBD168-715 CCCACTCACAGTTTGCTGACCCC 80 TTATCCCCTGTCTGACTTGTTCCCCG OBD168-719 G CGTTACATCTGTTGTGCCAG CAAAA 81 GGAGTGGGAGTCAGAGAAAGGGTCTT OBD168-723 CCTCACTTGTGC1 1 1C1GTTCATCAC 82 CTGAAGCAGACTCTCACTGGAATACA OBD168-727 ACATAGCAGTGCCCAGGAGAACAAGC 83 G CTCATCCACTTCCTTGCTTG CTTCT OBD168-731 GATGGCAGGAGTTTATGGAAAGGGCT 84 AACATCAGTCAGGAAAGACAAGGTTC OBD168-735 TGGTGTGTCCTGGGTTTTGTGGAGCA 85 CTTGTTATG GACCAAATGTCTG G C OBD168-739 CAG CAG AAGG AAAG AAATAATAAAA 86 GTCCTCCGTCTTCCAACAGGCTA OBD168-743 AG GCACCATCCTAAGCCCTG G GT 87 GTGTTATTTGTATCTCCTCCTG G C OBD168-747 ATTATGTGCTTACCCAAAAGAAAT 88 TCAGACATCTCAAAAGCAGCAGTTC OBD168-751 Cl 1 1 IGAACTGCCAAGTGAGGATGT 89 GGAGATGAGGAGCGAAAGAAAGGGTT OBD168-755 TGTGGTAGGACAGATAGGGAAGAAGG 90 G CCTCAG G GAACGCTTCTTAG G G OBD168-759 GGAAGTGGCAACTGATGAGCAAGC 91 AGAATACCCTATGATGGAGAGTTCCG OBD168-763 CCACCTCCCCTACTTTCCCATAACAT 92 CAGATGAGGGCAGTCTTGGGAGA OBD168-767 CTCTCAGTCCAACTCCCACCGAC 93 GAGATAAAGGTGTGAGCCACTGT OBD168-771 CATCCCAGACCATCAGCCCCGCT 94 G G AGTG G AGGACTTGATACACCG OBD168-775 TGGGAGTGGTTTGGGAGGTGTGC 95 TCTATTCTGCTCCTACACAGTGAAAT OBD168-779 G CAAACTTGTATCCAGTG AAG GC 96 GTAATCCCAGCACTTTGGTAGGC OBD168-783 GAGGCTTCCTGCTTGCTGGGAGC 97 GCCTGGGCAACAGAGCGAGACTC OBD168-787 ATTACAATACCCTTGCTTTGGGACAA 98 GTATTCCAAGGCAGTCAATCCTGGGA OBD168-791 ATTAGTATGTCTGCTG AAG G CACTTA 99 TGAACTGTCAGAAAGGAGGCGAAAGC OBD168-795 GGAATGACACCTTCAAATGACAAATG 100 CAGG AACTCATCGCCCGTG CG G C OBD168-799 TGAGACCATTCCAAAGCAGAGGG Table 2.b5 05 03 25 51 ORFl_chrl8_62330039_62332469_62410773_62412005_FR_l OBD168-601.603 52 ORFl_chrl_97723527_97730826_97845524_97850752_RF_l OBD168-605.607 53 ORFl_chr5_165127546_165128761_165171328_165175416_FR_l OBD168-609.611 54 ORFl_chr2_26077134_26081726_26188355_26191067_RF_l OBD168-613.615 55 ORFl_chr5_165127546_165128761_165223844_165225058_FF_l OBD168-617.619 56 ORFl_chrl8_62240628_62243651_62330039_62332469_RF_l OBD168-621.623 57 ORFl_chrl8_35525412_35527471_35609926_35611497_FF_l OBD168-625.627 58 ORFl_chrl0_93741396_93744278_93870079_93871714_FR_l OBD168-629.631 59 ORFl_chr2_186622411_186639782_186682119_186696186_RR_l OBD168-633.635 60 ORFl_chrl2_52217955_52219158_52307864_52312912_RR_l OBD168-637.639 61 ORFl_chr4_168499900_168503445_168627683_168631715_RR_l OBD168-641.643 62 ORFl_chrl9_56561558_56564720_56759775_56765600_RF_l OBD168-645.647 63 ORFl_chrl8_6233OO39_62332469_62555999_62562221_FR_l OBD168-649.651 64 ORFl_chr20_44492930_44498158_44629984_44632053_RF_l OBD168-653.655 65 ORFl_chr6_15591O3O_15592334_15658715_15661455_FR_l OBD168-657.659 66 ORFl_chrl5_69599001_69607474_69822688_69824653_FF_l OBD168-661.663 67 ORFl_chr3_194783856_194786305_194878644_194884153_RR_l OBD168-665.667 68 ORFl_chr2_29059303_29063818_29079780_29082596_FR_l OBD168-669.671 69 ORFl_chrl_97845524_97850752_97969457_97975300_FR_l OBD168-673.675 70 ORFl_chrl0_93674996_93683570_93741396_93744278_RF_l OBD168-677.679 71 ORFl_chr8_125289724_125291437_1253O4189_125311876_RR_l OBD168-681.683 72 ORFl_chr5_77084813_77086498_77232748_77239462_RR_l OBD168-685.687 73 ORFl_chrl7_68654144_68657529_68785810_68796098_FR_l OBD168-689.691 74 ORFl_chrl_112396884_112399115_112478496_112485740_RR_l OBD168-693.695 75 ORFl_chrl_207314651_207319651_207566031_207567951_RR_l OBD168-697.699 76 ORFl_chr3_194783856_194786305_194980518_194987236_RR_l OBD168-701.703 77 ORFl_chr4_24971631_24973362_25125726_25129421_RR_l OBD168-705.707 78 ORFl_chrl_117925651_117930301_117977839_117981106_FF_l OBD168-709.711 79 ORFl_chrl8_62330039_62332469_62459933_62463601_FF_l OBD168-713.715 80 ORFl_chrl_16764579_16768424_17044824_17050263_RR_l OBD168-717.719 81 ORFl_chr3_42701255_42712462_42763077_42767575_RR_l OBD168-721.723 82 C)RFl_chr2_200711316_200714252_200861419_200863026_RR_l OBD168-725.727 83 ORFl_chrl0_119537441_119541197_119587019_119594844_RR_l OBD168-729.731 84 ORFl_chr8_57997832_57999789_5815656O_5816OO85_FF_l OBD168-733.735 85 ORFl_chr5_54687073_54701690_54895820_54899919_RF_l OBD168-737.739 86 ORFl_chr22_37276476_37281194_37296506_37298053_FF_l OBD168-741.743 87 ORFl_chr9_27616981_27624076_27731177_27739077_RR_l OBD168-745.747 88 ORFl_chrl3_57155089_57159703_57172839_57181375_RR_l OBD168-749.451 89 ORFl_chr2_127388555_127395831_1275124O3_127514497_RR_l OBD168-753.755 90 ORFl_chrl4_61568474_61572943_61720413_61722720_FR_l OBD168-757.759 91 ORFl_chrll_104153980_104160882_104179897_104181773_FF_l OBD168-761.763 92 ORFl_chr4_15897457_15905803_15999719_16002207_RR_l OBD168-765.767 93 ORFl_chrl7_17631398_17633309_17824119_17825835_RR_l OBD168-769.771 94 ORFl_chrl7_18194373_18201018_18300185_18301934_FF_l OBD168-773.775 95 ORFl_chr5_169694390_169702047_169742878_169747823_FF_l OBD168-777.779 96 ORFl_chrl_224094766_224099331_224328317_224334418_FF_l OBD168-781.783 97 ORFl_chrl9_51484258_51487562_51764536_51772179_RR_l OBD168-785.787 98 ORFl_chr9_92152672_92155419_92403506_92407832_FR_l OBD168-789.791 99 ORFl_chrl_117925651_117930301_118024887_118028035_FR_l OBD168-793.795 100 ORFl_chrl6_87246411_87247863_87484414_87491902_RF_l OBD168-797.799 Table 2,b6 05 03 25 Probe gene.index RP / Rsum 1 ORF1_8_143363265_143368758_143397073_143399812_RR 137 1022.182606 2 ORF1_X_48750795_48754365_48796124_48801821_FF 136 1020.280557 3 ORF1_4_186172696_186175767_186190828_186192765_FF 56 567.5154132 4 ORF1126201425262054802633336326336159FR 26 367.3594761 5 ORF1^70887659^70889000J70979229J?0981565JF 218 1455.232994 6 ORF12112539682112540702112816387112823836RR 414 2408.255424 7 ORFl_12_52037813_52040902_52237944_52243119_F R 269 1762.228575 8 ORF1_11_10562525_10569392_10617125_10621846_RR 40 489.4037173 9 ORF1_2_43086424_43092123_43178166_43179822_FF 43 493.6790445 10 ORFl_17_67419703_67421985_67604580_67609081_R R 47 520.8353844 11 ORF1_19_2777060_2780381_2901738_2905384_RF 45 519.5921477 12 ORFl_17_43300561_43304860_43444308_43448547_RR 436 2506.508269 13 ORF1J5J74686122J74687597J74772372J?4779791JR 58 576.6524083 14 ORF l_10_62056179_62058893_62096285_62100217 RR 63 590.6246291 15 ORF1_15_76885704_76887654_76983002_76985852_RF 533 2890.294194 16 ORF1_1l_10637008_10641060_10678778_10685244_FR 81 693.4429129 17 ORF1_3_122768838_122771609_122793452_122794847_FR 563 2999.066738 18 ORFl_5_140242642_140251155_140386390_140387430_F F 83 702.8036709 19 ORF1_2_143119651_143128757_143274179_143284059_FR 528 2861.529024 20 ORF1_7_1769382_1772142_1917082_1921849_RF 223 1465.773343 21 ORF 1^13^28585301^28589104 28625877 28627714 FR 112 886.7494008 22 ORF 1J1J0637008J0641060J0826892J0830503J R 110 877.5566621 23 ORF1_17_43300561_43304860_43353578_43358798_RR 133 1018.405989 24 ORFl_18_63921019_63923125_64068334_64074049_R R 474 2662.422604 25 ORF1 20 31989698_31994926 32038678 32045816 R F 554 2973.092177 26 ORF1_1l_35040602_35047084_35078579_35084103_FR 290 1888.328908 in ORF1_18_45762052_45766373_45829537_45837293_FF 477 2676.14117 28 ORF1^22^42713609^42716051428641^^R 127 993.9971762 29 ORF1_21_29039171_29043861_29092829_29094361_FF 119 954.7111896 30 ORF1JC101616906J01623004J01715574J01717864JF 622 3249.214339 31 ORF1_16_85533210_85536278_85655930_85660237_FR 259 1702.530556 32 ORFl_16_57546345_57549019_57808053_57811713_R F 138 1026.72489 33 ORF1_20_50192390_50194162_50280026_50281924_RF 326 2050.835647 34 ORF1225155910_25160743_25292182_25293890_FR 640 3317.320304 35 ORF1_7_151781262_151783710_151930364_151932111_RR 350 2142.221032 36 ORF 1^74503923^74507137 74519716 74521847 R F 164 1139.344398 37 ORF1^52573576^52576507^52715481^52719514JR 307 1975.310453 38 ORFl_10_104325690_104332059_104442837_104447074_RR 383 2255.373656 39 ORF1_11_10376885_1038251l_10637008_10641060_R F 154 1086.637744 40 ORF1_19_7270757_7273737_7367544_7370291_FR 160 1122.566671 41 ORF1_6_15165975_15168155_15248586_15249747_RF 266 1736.571207 42 ORF1_1_158181667_158187628_158243613_158252050_FF 162 1130.926813 43 ORF1_1l_65044650_65046952_65060361_65063993_FF 234 1538.948472 44 ORF1_6_31267448312692523153111531534994RF 157 1095.305893 45 ORF1_17_81104538_81109597_81345804_81351809_RR 602 3166.187603 46 ORF1_3_101887192_101889071_101943010_101950739_RF 388 2281.449083 47 ORFl_4_2639345_2642002_2800083_2804902_RR 233 1534.145351 48 ORF1_9_123259504_123263022_123339568_123345302_FR 181 1242.495673 49 ORF1_3_51243406_51244925_51388915_51391864_F F 355 2161.353049 50 ORF1_8_73772858_73775783_73991731_73996964_RF 172 1188.857634 51 ORFl_7_1901148_1902503_20331882038434RF 362 2193.315447 Table 3.al 05 03 25 FC:(classl / class2) pfp P. value Type 1 2.254198009 0.582954788 0.000565875 Early SSC 2 1.926442523 0.585246077 0.000563953 Early SSC 3 1.819576685 0.481315009 0.000190978 Early SSC 4 1.789862545 0.452448159 8.33504E-05 Early SSC 5 1.786660212 0.696259246 0.001075456 Early SSC 6 1.731351133 0.906180999 0.002658157 Early SSC 7 1.72782494 0.79699158 0.001519047 Early SSC 8 1.684693818 0.510408273 0.000144658 Early SSC 9 1.679467596 0.48264036 0.000147047 Early SSC 10 1.665042972 0.488329576 0.000162621 Early SSC 11 1.66364181 0.507750192 0.000161893 Early SSC 12 1.646347341 0.924029095 0.002854548 Early SSC 13 1.632056892 0.478789454 0.00019676 Early SSC 14 1.623263928 0.460927015 0.000205749 Early SSC 15 1.61294807 0.97372438 0.003677295 Early SSC 16 1.579010636 0.483049755 0.000277231 Early SSC 17 1.57167124 0.984233204 0.003926193 Early SSC 18 1.57069125 0.483257957 0.000284199 Early SSC 19 1.560692362 0.965656771 0.003612618 Early SSC 20 1.542279296 0.689591095 0.001089587 Early SSC 21 1.535126946 0.549667601 0.000436198 Early SSC 22 1.527885593 0.549057283 0.000427933 Early SSC 23 1.526693744 0.59643941 0.000562061 Early SSC 24 1.518323432 0.946326887 0.003178226 Early SSC 25 1.513503028 0.984923145 0.003866138 Early SSC 26 1.503017029 0.837079106 0.001720005 Early SSC 27 1.500622056 0.949008348 0.003207404 Early SSC 28 1.497953885 0.597522112 0.000537679 Early SSC 29 1.496480575 0.592329774 0.000499431 Early SSC 30 1.489761392 1.026554835 0.004524158 Early SSC 31 1.487826891 0.777966877 0.001427664 Early SSC 32 1.482472871 0.583437831 0.000570478 Early SSC 33 1.478605452 0.863503709 0.00199456 Early SSC 34 1.477688489 1.034924223 0.004693035 Early SSC 35 1.477264434 0.869597722 0.002156511 Early SSC 36 1.475249588 0.593584457 0.00068975 Early SSC 05 03 25 37 1.475130467 0.857292939 0.001864803 Early SSC 38 1.469690742 0.871292473 0.002364438 Early SSC 39 1.467937731 0.579847865 0.000632703 Early SSC 40 1.467830037 0.592200913 0.000671358 Early SSC 41 1.466878812 0.784983374 0.001479474 Early SSC 42 1.465675235 0.592850241 0.000680496 Early SSC 43 1.465342374 0.717660029 0.001189871 Early SSC 44 1.463447732 0.577069248 0.000641938 Early SSC 45 1.459551418 1.013212781 0.004321778 Early SSC 46 1.458144163 0.877911423 0.002413502 Early SSC 47 1.45177916 0.716682261 0.001183172 Early SSC 48 1.449946912 0.629677907 0.000807537 Early SSC 49 1.449756998 0.871099423 0.002191096 Early SSC 50 1.449681428 0.611542481 0.000745282 Early SSC 51 1.447185412 0.876984215 0.002249394 Early SSC Table 3.a2 60 mer 1 GGGTCTCCCCATATTGCCTAGGCTGGTCTCGAGGGAACTCCCTCCCCGCACCCCCAGCAT 2 CAGTCCAGTCTGAGTGACTCTAGCGATGTCGACTGCCCGCCCAGATCCCGCCTCCAGAGG 3 ACGGAGTGGAAGGAGCTGCAACTTTCCATCGAGTTCGCCCTCCCTGACAGGGAGTTGTAA 4 GGGTTTCACCATGTTGGTCAGGCTGGTCTCGAGGCCAGCCTGACCAACATGAAGAAACCC 5 CGCGGCCGTCAGAGGGCGCGGCCTACACTCGATCTTATCCTTTGACCTTGCCCACTCTTT 6 AATGCGCAGTCTTCTTTCCTTCCTTTTGTCGAACTCCTAACCTTGTGATCTACCCGCCTC 7 CTGGTCCTGCCCTCACTCTGGTGCGTAGTCGAGCCAGCATGAGCTCTCTGTTCCTGCAGA 8 ATACACAGGATAGATTTCAAGATCATTCTCGATGTACTTCTCTGCCTCAGCCTACGTGTC 9 GGATTTCTCCGTGTTGGCCAGGCTGGTCTCGAGACGACCCTGGCCAACAAGGAGAAACCC 10 GGGTTTCGCCATGTTGGCCAAGCTGGTCTCGAGACCAGCCTTGCCAACATGGTGAAACCC 11 GGGTTTCATCATGTTGGCCAGGCTGGTCTCGAGACCAGCCTGACCAACAGGTGAAACCCA 12 TCTCTTCCGGTTCTGTCTTTTCGCTGGCTCGAACAACAAATTGTTAAGTGAATGGAATGC 13 GGGTTTCACCATGTTGGCCAGACTGATCTCGAGACGATCCCGGCCAACATGGTGAAACCC 14 ACTGTAGGCAGACAGGGAACTTGGCATATCGAGGTGGTCCCACAAAAATATTTTATGTAG 15 TGGAGAAAACTGGTGGACACTACTTTAATCGAACTATTGGGCTCAAGCAATCCACCCACC 16 GGACATAACTGTATTCTCTCTCTCTCTCTCGAAGCTTTTTCCTGGGGCAGATTCTGCCTG 17 CATGATGCATAAACTCTAAACAGGTCTTTCGAGAAATGCCACGCTCACTAGAAAATATAG 18 GGGTTTCACCATGTTGGCCAGGCTGGTCTCGAGACCAGACTGGCCAACATAGTGAAACCC 19 CAGTCACAGCAAATGCCACAGGGTGTGTTCGAGGAAAAGTGGCAAATGTCTCTCTACTCC 20 TGATCTGGAAAAAAAATCAATTTAGATCTCGAAGCTGTCATCTGTGGGCGCGGGTTGAGC 21 GGATTTATCCGTGTTGGTCAGGCTGGTCTCGAGACAAGCCTGACTAACATGGTAAAACCC 22 GGACATAACTGTATTCTCTCTCTCTCTCTCGAGCAGGATGTGGAACAGACATCATGAGCC 23 TCTCTTCCGGTTCTGTCTTTTCGCTGGCTCGAGATAAGTGGACCCAGCTGTTTATTCCCA 24 CAGACTTTGGAACTAAGCTGACTTATATTCGAGATGGAGTTTTGCTCI 1 11IGCCCAGGC 25 GGCAGGTGGACCACCTGAGGTCAGGAGTTCGAACTCCTGGACTCAAGTGATCTTCCCACC 26 GTAACAGCAGCAATGGCAGTGGTGGTGATCGAAATGCCCATGAAGTGAGCCAAAACTTTG 27 ACAACAACAAAAAAGAACCAAATAGTGATCGACTTGGGAGTGCCTGCGTTCCCGCGGCTC 28 GGGTTTCTCCATGTTGGTCAGGCTGGTCTCGAGACCAGTCTGACCAACATGGTGAAACCC 05 03 25 29 TTTGTAGTAAGTTTAATTAACTTAATTTTCGATACTTCCCCTGGGTGACTCTGACAGATG 30 GAAACACAACTACAAGGTGATGAGATTATCGATGGGGAGAGTCCAAGGATTTTAGCTGTG 31 TAGGGAAGTGGGTGGTGCTCAGGAGGTGTCGAGCCGAGGAGCCCCTCTGCCCTCCCTGTC 32 GGCAGGTGGATCATTTGAGGTCAGGAGTTCGAATTCCTGAGCTCAAATGATCCTCCTGCC 33 CACACCACCGTTGGGATGAAAGATGGCCTCGAAGTTGATGCAATCGGTTTAAACATGGCT 34 TGTGCCTTCACCCAAACTATCTGATCCCTCGACCCTTAAAAAAAAAAATTAGCCAGGCAT 35 CCTACCAGGAGTCCCCGCCACGCTCCCCTCGACGATGACACCATAACCCTGGCAACAAAA 36 TCCCTTGCTCTCTCTCTGTCTCTCAGATTCGAGCTCTTCTTCGGCGTCTGCAGCCTCTTC 37 AAGCCATGGTGGCAGCGCGGCGGTTGGTTCGAGTATCAGATAAATGAAAATGCTGAGACT 38 TGGACTCGGGGTGCCCGGTTCCACCCACTCGAAGTGATGGAACTCATAGGACCAGCTCAA 39 G G ACATAACTGTATTCTCTCTCTCTCTCTCG AATTCCTG ACCTCG G CCTTCCAAAGTG CT 40 GGATTTCATCATGTTGGCCAGGCTGGTCTCGAGACCAGTCTGGCCAACATGGTAAAACCC 41 TAGCAAAGCAGAGTTGGGGGTGCGATTGTCGAGGCCTAACAATTTTCCAGGGTCCAAAGG 42 AGGTTTCACCATGTTGGCCAGGCTGGTCTCGAGACCAACCTGGCCAACATGGTGCAACCC 43 CAACGCTCACGCCAATGGTCTGAGTTAATCGAATGCATCCTGGCCATGGTTCTGCAGCTC 44 TGGTGAGCAGAAGGCTCCAGCTGTACGCTCGATTCCTGTTTTCCCTTCTGCCTCCCTCGT 45 TTGCGCTCCAGGCCGGCTGCCATGGAGCTCGACCGCCAGGGCCCGCGTCCTCTCCCCGGC 46 AACAAGGACTTAAGTGTGTCCACTTATGTCGAGCAATCCTTCTGCCTCAGCCTCCTGAGT 47 TTCAAACAGTTTAGATACATCAAGTCCCTCGAGGCTGCAGAAGGCTGGGTGGGAGTGGAG 48 CTCTCAATAAAG1 111C1AAAATTAGACTCGATGGTTCCCTATTACCCTCTGCCCGCAGC 49 GATGTCTTGGI 111 ILCATGAGAAACATTCGAGGTGCTCGGCGGGCAGCGCGGGGCTCAA 50 GGGTTTCACCATGTTGGTCAGGCTGGTCTCGAGACCAGCCTGAGCAACATGAAGAAACCC 51 TAGGGCTTTTACAGTTACAGAGGAGAAGTCGACGGAGTCGGTTCAGTTTGGGGCAGATCA Table 3.a3 Probe Location Start 1 Endl Start2 End2 1 8 143363267 143363296 143397075 143397104 2 X 48754334 48754363 48801790 48801819 3 4 186175736 186175765 186192734 186192763 4 1 26205449 26205478 26333365 26333394 5 2 70888969 70888998 70981534 70981563 6 2 112539684 112539713 112816389 112816418 7 12 52040871 52040900 52237946 52237975 8 11 10562527 10562556 10617127 10617156 9 2 43092092 43092121 43179791 43179820 10 17 67419705 67419734 67604582 67604611 11 19 2777062 2777091 2905353 2905382 12 17 43300563 43300592 43444310 43444339 13 15 74687566 74687595 74772374 74772403 14 10 62056181 62056210 62096287 62096316 15 15 76885706 76885735 76985821 76985850 16 11 10641029 10641058 10678780 10678809 17 3 122771578 122771607 122793454 122793483 18 5 140251124 140251153 140387399 140387428 19 2 143128726 143128755 143274181 143274210 05 03 25 20 7 1769384 1769413 1921818 1921847 21 13 28589073 28589102 28625879 28625908 22 11 10641029 10641058 10826894 10826923 23 17 43300563 43300592 43353580 43353609 24 18 63921021 63921050 64068336 64068365 25 20 31989700 31989729 32045785 32045814 26 11 35047053 35047082 35078581 35078610 27 18 45766342 45766371 45837262 45837291 28 22 42716020 42716049 42864114 42864143 29 21 29043830 29043859 29094330 29094359 30 X 101622973 101623002 101717833 101717862 31 16 85536247 85536276 85655932 85655961 32 16 57546347 57546376 57811682 57811711 33 20 50192392 50192421 50281893 50281922 34 2 25160712 25160741 25292184 25292213 35 7 151781264 151781293 151930366 151930395 36 2 74503925 74503954 74521816 74521845 37 6 52576476 52576505 52715483 52715512 38 10 104325692 104325721 104442839 104442868 39 11 10376887 10376916 10641029 10641058 40 19 7273706 7273735 7367546 7367575 41 6 15165977 15166006 15249716 15249745 42 1 158187597 158187626 158252019 158252048 43 11 65046921 65046950 65063962 65063991 44 6 31267450 31267479 31534963 31534992 45 17 81104540 81104569 81345806 81345835 46 3 101887194 101887223 101950708 101950737 47 4 2639347 2639376 2800085 2800114 48 9 123262991 123263020 123339570 123339599 49 3 51244894 51244923 51391833 51391862 50 8 73772860 73772889 73996933 73996962 51 7 1901150 1901179 2038403 2038432 Table 3.a4 4 kb Sequence Location Startl Endl Start 2 End2 1 8 143363267 143367266 143397075 143401074 2 X 48750364 48754363 48797820 48801819 3 4 186171766 186175765 186188764 186192763 4 1 26201479 26205478 26333365 26337364 5 2 70884999 70888998 70977564 70981563 6 2 112539684 112543683 112816389 112820388 7 12 52036901 52040900 52237946 52241945 8 11 10562527 10566526 10617127 10621126 9 2 43088122 43092121 43175821 43179820 10 17 67419705 67423704 67604582 67608581 05 03 25 11 19 2777062 2781061 2901383 2905382 12 17 43300563 43304562 43444310 43448309 13 15 74683596 74687595 74772374 74776373 14 10 62056181 62060180 62096287 62100286 15 15 76885706 76889705 76981851 76985850 16 11 10637059 10641058 10678780 10682779 17 3 122767608 122771607 122793454 122797453 18 5 140247154 140251153 140383429 140387428 19 2 143124756 143128755 143274181 143278180 20 7 1769384 1773383 1917848 1921847 21 13 28585103 28589102 28625879 28629878 22 11 10637059 10641058 10826894 10830893 23 17 43300563 43304562 43353580 43357579 24 18 63921021 63925020 64068336 64072335 25 20 31989700 31993699 32041815 32045814 26 11 35043083 35047082 35078581 35082580 27 18 45762372 45766371 45833292 45837291 28 22 42712050 42716049 42864114 42868113 29 21 29039860 29043859 29090360 29094359 30 X 101619003 101623002 101713863 101717862 31 16 85532277 85536276 85655932 85659931 32 16 57546347 57550346 57807712 57811711 33 20 50192392 50196391 50277923 50281922 34 2 25156742 25160741 25292184 25296183 35 7 151781264 151785263 151930366 151934365 36 2 74503925 74507924 74517846 74521845 37 6 52572506 52576505 52715483 52719482 38 10 104325692 104329691 104442839 104446838 39 11 10376887 10380886 10637059 10641058 40 19 7269736 7273735 7367546 7371545 41 6 15165977 15169976 15245746 15249745 42 1 158183627 158187626 158248049 158252048 43 11 65042951 65046950 65059992 65063991 44 6 31267450 31271449 31530993 31534992 45 17 81104540 81108539 81345806 81349805 46 3 101887194 101891193 101946738 101950737 47 4 2639347 2643346 2800085 2804084 48 9 123259021 123263020 123339570 123343569 49 3 51240924 51244923 51387863 51391862 50 8 73772860 73776859 73992963 73996962 51 7 1901150 1905149 2034433 2038432 Table 3.a5 Probe Primer ID 1 ORF1^143363265J43368758J43397073JL43399812^RR OBD168-989 2 ORF1JC48750795J18754365J18796124J18801821JF OBD168-2109 05 03 25 3 ORF1JL186172696JL86175767J86190828JL86192765JF OBD168-669 4 ORF1_1_26201425_26205480_26333363_26336159_FR OBD168-1729 5 ORF1_2_70887659_70889000_70979229_70981565_FF OBD168-701 6 ORF1_2_112539682_112540702_112816387_112823836_RR OBD168-889 7 ORF1 12 52037813 52040902 52237944 52243119_F R OBD168-1141 8 ORF1_11_10562525_10569392_10617125_10621846_RR OBD168-1221 9 ORF1_2_43086424_43092123_43178166_43179822_FF OBD168-1905 10 ORF1^17^67419703^67421985^67604580^6760908VR R OBD168-1465 11 0RF1_19_2777060_2780381_2901738_2905384_RF OBD168-1873 12 ORF1_17_43300561_43304860_43444308_43448547_RR OBD168-1437 13 ORF1_15_74686122_74687597_74772372_74779791_FR OBD168-1841 14 ORF1 10 62056179 62058893 62096285 62100217_R R OBD168-905 15 ORF1_15_76885704_76887654_76983002_76985852_RF OBD168-705 16 ORF1_1l_10637008_10641060_10678778_10685244_FR OBD168-865 17 ORF1_3 J22768838J22771609J22793452J22794847JR OBD168-1609 18 ORF1J J40242642J40251155J40386390J40387430J F OBD168-1641 19 0RF1J J43119651J43128757J43274179J43284059JR OBD168-1061 20 ORF1_7_1769382_1772142_1917082_1921849_RF OBD168-2053 21 ORFl_13_28585301_28589104_28625877_28627714_F R OBD168-1393 22 ORF1_1l_10637008_10641060_10826892_10830503JR OBD168-569 23 ORF1_17_43300561_43304860_43353578_43358798_RR OBD168-1433 24 ORFl_18_63921019_63923125_64068334_64074049_R R OBD168-1481 25 ORF 1 JO J1989698 31994926J2038678J2045816J F OBD168-1953 26 ORF1J1J5040602J5047084J5078579J5084103J R OBD168-1085 27 ORF1_18_45762052_45766373_45829537_45837293JF OBD168-757 28 ORF1 J2_42713609_42716051_42864112_42866876_F R OBD168-1965 29 ORF1J1J9039171J9043861J9092829J9094361JF OBD168-697 30 ORF1_X_101616906_101623004_101715574_101717864JF OBD168-977 31 ORF1_16_85533210_85536278_85655930_85660237JR OBD168-1117 32 ORFl_16_57546345_57549019_57808053_57811713_R F OBD168-1861 33 0RF1 JO J0192390J0194162J0280026J0281924JF OBD168-849 34 ORF1JJ5155910J5160743J5292182J5293890JR OBD168-557 35 ORF1_7_151781262_151783710_151930364_151932111_RR OBD168-765 36 ORF1J J4503923J4507137J4519716J4521847J F OBD168-1541 37 ORF1_6_52573576_52576507_52715481_52719514JR OBD168-773 38 ORFl_10_104325690_104332059_104442837_104447074_R R OBD168-1353 39 ORF1_11_10376885_1038251l_10637008_10641060_R F OBD168-573 40 ORF1_19J270757J273737J367544J370291_FR OBD168-1489 41 0RF1J J5165975J5168155J5248586J5249747JF OBD168-737 42 0RF1J J58181667J58187628J58243613J58252050JF OBD168-1325 43 ORF1_1l_65044650_65046952_65060361_65063993_FF OBD168-837 44 ORF1_6_31267448_31269252_31531115_31534994_RF OBD168-805 45 ORF1_17_81104538_81109597_81345804_81351809JR OBD168-1869 46 ORF1_3_101887192_101889071_101943010_101950739_RF OBD168-1981 47 ORF1_4J639345J642002J800083J804902JR OBD168-1997 48 0RF1J J23259504J23263022J23339568J23345302JR OBD168-529 49 ORF1_3_51243406512449255138891551391864FF OBD168-1605 50 ORF187377285873775783_7 OBD168-2089 51 ORFl_7_1901148_1902503_2033188_2038434_R F OBD168-1677 Table 3.a6 05 03 25 Sequence Primer ID Sequence 1 CAGGCTGTCTCATTCTGTTGCCC OBD168-991 GCCACATACAGTCAGGGTCCAGC 2 TTAG G AGTGTCCCAAACCCCC OBD168-2111 TTTACGTAGGCGCAGCACAGC 3 AAGAAACAAAGCGAGGCAAGGTGACG OBD168-671 AGGCAGACI ICI 1 1GGAGGGTGTCAA 4 ATCTTGGCTCACTGCAACCTCC OBD168-1731 GCTGGAGTGCAATGGCGCAATC 5 TCG CTCATTCCTCCCG ACCAAG G OBD168-703 CTGAAGACAGAGTGAGCCAGCCA 6 TCATCATACTTCTCCCTTTCCAATCT OBD168-891 TCTGCCAGCCCTAATCCCTCTGAATA 7 CCTCCTCCTCTTTGCCCCTCCTA OBD168-1143 GGTGAAGATGGTGTCTGAGCCTC 8 GACACCTGGAGGGCAGCACTGAT OBD168-1223 GGTAGTTGGCTATCTGGACCTGG 9 TGGCACAGTCTCAGCTCACTG OBD168-1907 TCTCGTTCTGTTG CCCAG GCT 10 CTGGGTCTCCAGCCTCACTCAGG OBD168-1467 CTGGAGTGCAGTGGCAAGTTCTC 11 GTCTTGCTTTGTTGCTCAGGTTGGAG OBD168-1875 GCGCCTGGTCI 1 1 III Illi IIICIG 12 CGGGTACGGGGCCGGTCTCCCCGCCC OBD168-1439 AAACGAAGACATGAGTCACTAGTAAG 13 CTCACTGCAACTTCTGCCTCCCAG OBD168-1843 ATCCIIIIIlli IIIIICIGAGAC 14 TTG CCACCCAAG AGTG ATG CG G G OBD168-907 GGCTGACCACCACCAAATGTGAC 15 CTCAAAGGATTTCCCCACAAGATACT OBD168-707 GCTTTTCTTTGTTTGGTAGGGTTATG 16 GGATAAAGCACAGGATGCCCCAGTTA OBD168-867 GAAGGTGACAGAAGACCCAGAAAAGG 17 CTGAGCTTGCTTTTAATTATTATAAA OBD168-1611 CCTGAGTACAAACCCAATGCCAGTTG 18 ATGATCTAGGCTCACTGCAAACT OBD168-1643 TGCCTCCTG GGTTCAAG CG ATTC 19 TGGACACATCCGTATGAGAGCCACAG OBD168-1063 AACAGCCAGGCACCATTGAACATTTC 20 TAAATGAAATTAAAAAAAACAAA OBD168-2055 CTCGGCTCCGCAAAGACATTCTG 21 GAGTTTCACTCTTGTTGCCCA OBD168-1395 CGCTCTGTCATGCAGGCTGAA 22 GGATAAAGCACAGGATGCCCCAGTTA OBD168-571 TACACTGTCTCACATTTCTCCCTGGC 23 CGTCCCCTCGTCCCCTCGGGT OBD168-1435 AGAGACTCTTGTTACAACCCA 24 TCATTAATATTCATTAATGAC OBD168-1483 ACTGGAGCATGCCTGTAATCC 25 AGCCAGACAGATCCTGTGAAAAGAT OBD168-1955 ATGCCTGGAATCCCAACATTTTGGG 26 GACTGGAGTGCTCTGCTCATCTC OBD168-1087 CACCCAAAGTCCCCACCTGCTCA 27 CCTACCATTGCCCACTTGAGAGGG OBD168-759 TCCACAGGGCAGGTTTTGATGGG 28 CCTGCGTTCAAGCGATTCTTCTG OBD168-1967 TGGGTTCAAGCGATTCTCCTGCC 29 GCTATTGAGTTTGTAGTCTGAATGAC OBD168-699 GCAGTGGGTTCTCAAATGTTAGCATC 30 CGTCCCTTTCTGGTAATCGGTGGAAG OBD168-979 CTTCATTTCCATTTCCTGACACACAG 31 GGTCACCAACAAGGCTTCTGTGG OBD168-1119 AGTCCAGTCAGGTTCCAGCCCAG 32 GGGTATGGAGTGCATACCTATGGTC OBD168-1863 AGACAAGAGCTGATTTTCCCATTAT 33 CTTGAAGGCGGATTCCTCCAGGT OBD168-851 GTGGGTTGCGTCAGTCCCGTGTA 34 TCAGTGGAGTGTGTGGAAAATACGGC OBD168-559 CCCTTCTTACCAAACCTGTCACCCTA 35 GCTCTCCCAAAACCGTGTTCCCG OBD168-767 CCCTGTTTCTGTCCTCCTCCACT 36 GCTCTCTCTCTCTCCCTCTCTTTCCC OBD168-1543 AGAGTGAGTACAGCGAAGGCGGCCTC 37 TGGACGCCAGAAAGGGAACCCCA OBD168-775 AGAATCACTCAGCCGAGCCCTTC 38 GCATCCCACTCAGTCAGTCTGGGC OBD168-1355 AACTATGCCCATCGTATTTTACCA 39 GGATAAAGCACAGGATGCCCCAGTTA OBD168-575 GTCACACAACAGAGACAGACTTGATA 40 GGTTCAAGCAATTCTCCTGCCTCAG OBD168-1491 TCCTGGGTTCAAGTGAGTCTCCTGC 41 CGGGATGCCTGCTGAGTTGCCAT OBD168-739 CCGCTGAGGTCTAAGGGTTTCCA 05 03 25 42 GGCGTGGTCTCGGCTCACTGCA OBD168-1327 CGGCTCACTG CAACCTCCG CCT 43 G CATCAAACAGG G AG GTG CCAG C OBD168-839 CCTCAGGACAGCCAGTGAAGGAT 44 TGTCCCTCTCTTGCTCTCCTGCC OBD168-807 CTCTGATGGCTGTGCTGAGGACA 45 CCCCCGAGAAACACTCACATCTTGG OBD168-1871 CCCCGGGGCTCCTGCCCGGACGGCG 46 TCTCAGTAACTTACATTTTCAGTTTG OBD168-1983 AATCCCAACACTTTGG G AG GCCG AGG 47 CTAAAATGGCAAGTTTAGAAGGGC OBD168-1999 GTCTGCCAGAAAAGCCAGCCAAGG 48 CACTTG GTCACCTCACTATTC AATG C OBD168-531 CGGTTCGCTTTCCCCTGGTTATGC 49 TTCTGATCTTAGAGGAAATGCTTTC OBD168-1607 GACGCGGCGGCAAGGCCTCGGGGGA 50 CCTCAGCCTTCTGAGTAGCAGGGATT OBD168-2091 TTCTTTTGACAGAATCTCACTCTTAC 51 ACCAATGAAGGTGGCCACACTAAAC OBD168-1679 CCAGAGGAACCCCGGGCTCTTGGCT Table 3.a7 qPCR Primer ID Sequence qPCR Primer ID 1 OBD168-q989 GGAGGAGGCTGGTGGAGACCCTGTTGGA OBD168-q991 2 OBD168-q2109 GTGTGATTTCAGGGGTGCCTGCC OBD168-q2111 3 OBD168-q669 TGAAGAAACAAAGCGAGGCAAGGTGACG OBD168-q671 4 OBD168-ql729 GATCTTGGCTCACTGCAACCT OBD168-ql731 5 OBD168-q701 TCGCCCCTCGCTCATTCCTCCCGACCAA OBD168-q703 6 OBD168-q889 TCATCATACTTCTCCCTTTCCAATCTGA OBD168-q891 7 OBD168-qll41 GGCAAAGGTCAGGTGGGTGAGGAAGCCC OBD168-qll43 8 OBD168-ql221 GGAGGGCAGCACTGATTTGTTCGTGGTC OBD168-ql223 9 OBD168-ql905 GGCCTCCCGAGTAGCTGGGATTACAA OBD168-ql907 10 OBD168-ql465 TGCCTCAGCCTCCCGAGTAGCT OBD168-ql467 11 OBD168-ql873 TTCAAGCGATTCTTCTGCCTCAGCCT OBD168-ql875 12 OBD168-ql437 GCGGGCGGCGAAGTAAAGGCCCA OBD168-ql439 13 OBD168-ql841 TCTCCTTCCTCAG CCTCCTGAG OBD168-ql843 14 OBD168-q905 GCTGTTTGCCACCCAAGAGTGATGCGGG OBD168-q907 15 OBD168-q705 ATAACAG AAG GG AACAGAAG CCACCC OBD168-q707 16 OBD168-q865 CACACGCATCCCTGCTCCCATTCTGAG OBD168-q867 17 OBD168-ql609 TATAAAAAGGGGTCCTAAAATAGTT OBD168-ql611 18 OBD168-ql641 CAATTCTCCCATCTCAGCCTCCCGAG OBD168-ql643 19 OBD168-ql061 CCAGAGTGGACACATCCGTATGAGAGCC OBD168-ql063 20 OBD168-q2053 AATACAGACCCGATTTTGCCT OBD168-q2055 21 OBD168-ql393 TCTTCTGCCTCGGCCTCTGGA OBD168-ql395 22 OBD168-q569 CACACGCATCCCTGCTCCCATTCTGAG OBD168-q571 23 OBD168-ql433 GTACGGGGCCGGTCTCCCCGCCCG OBD168-ql435 24 OBD168-ql481 AATTAATCTTCATTAAGTCATG OBD168-ql483 25 OBD168-ql953 AGATCCTGTGAAAAGATAAGCCAGTT OBD168-ql955 26 OBD168-ql085 CCCACCTCCTAACCATCACCTCCTCTCC OBD168-ql087 27 OBD168-q757 CTTTGCGTGTCTGTGGCTCTGTGGCTCC OBD168-q759 28 OBD168-ql965 TTTCGC1C1 1 1 1 1GCCCAGGCTGGA OBD168-ql967 29 OBD168-q697 GCTATTGAGTTTGTAGTCTGAATGACAT OBD168-q699 30 OBD168-q977 TGCCGTCCCTTTCTGGTAATCGGTGGAA OBD168-q979 31 OBD168-qlll7 CTGACGGGCATTCATTGGGCACCTGCTG OBD168-qlll9 32 OBD168-ql861 CTGGGTATGGAGTGCATACCTAT OBD168-ql863 33 OBD168-q849 GCTTGCTTGAAGGCGGATTCCTCCAGG OBD168-q851 34 OBD168-q557 GACAGTCCAGAGCACTCCCAGGCGTGG OBD168-q559 35 OBD168-q765 TACAGGGCAGGAGGCAGCGTGTCCAGAG OBD168-q767 36 OBD168-ql541 TCCCTCTCTTTCCCTCTCCCTCTCTC OBD168-ql543 37 OBD168-q773 ACTGCGGGTCTGGGAGTCTCTGGGCTT OBD168-q775 38 OBD168-ql353 ACAGGCCTTACTCTAATACCAAGCGC OBD168-ql355 39 OBD168-q573 GATTTCTGGATAAAGCACAGGATGCCCC OBD168-q575 40 OBD168-ql489 TCTGGGGTTCAAGCAATTCTCCTG OBD168-ql491 41 OBD168-q737 CGGGATGCCTGCTGAGTTGCCATTTAGT OBD168-q739 42 OBD168-ql325 CAACCTCCACCTCCTGGGTTCAAGT OBD168-ql327 43 OBD168-q837 GGCTTGGGATGGGAAGTGGGAGAAGGTG OBD168-q839 44 OBD168-q805 CG CTG CCG CCATCCACCGCTG G GT OBD168-q807 45 OBD168-ql869 TAATG AG GTCACCCTCCTTG AA OBD168-ql871 46 OBD168-ql981 GACCTTCTCAGTAACTTACATTT OBD168-ql983 47 OBD168-ql997 AGACAGGGTGACAGGTGTGCA OBD168-ql999 48 OBD168-q529 GTG G AG AGTCTGTTGTGAG GCAG GCAC OBD168-q531 49 OBD168-ql605 ATTTCTGATCTTAGAGGAAATGCT OBD168-ql607 50 OBD168-q2089 ATCTTGGCTCACAGCAGTCTCTG OBD168-q2091 51 OBD168-ql677 GTCCCCATCACATAAAAGTAC OBD168-ql679 Table 3.a8 05 03 25 Sequence qPCR Probe 1 AAGAGCAGGGCTGGAGGCAGGCG OBD168-p989 2 GAGCTCGCGGTGTGGCTCAGCCC OBD168-p2109 3 GCCGCCCTCCTCTCGCTGCCACT OBD168-p669 4 CTCTTGTTGCCTAGGCTGGAG OBD168-pl729 5 GGAACCTGAAGACAGAGTGAGCCAGCC OBD168-p701 6 TTCTGCCAGCCCTAATCCCTCTGAATAC OBD168-p889 7 CCAGCCCCGCTCCCAGAGATGGA OBD168-pll41 8 GGCTATCTGGACCTGGATTTTGAGGGAC OBD168-pl221 9 GCAGTGGGGCAATCTTGGCTTACTGC OBD168-pl905 10 CGCCTCCTGGGTTCAAGTGATT OBD168-pl465 11 CTCTTATTGCCCAGGCTGGAGTACAG OBD168-pl873 12 GAAGACATGAGTCACTAGTAAGG OBD168-pl437 13 ATATCAGCTCACTGCAACCTCT OBD168-pl841 14 CCAGATGCGACTTGGCTGACCACCACC OBD168-p905 15 GCTTTTCTTTGTTTGGTAGGGTTATGAT OBD168-p705 16 CAGAAGGTGACAGAAGACCCAGAAAAGG OBD168-p865 17 GGAGGAAGGTAGGTGCCAGGCTGAG OBD168-pl609 18 AGCTCACTGTAACCTCTGCCTCCTGG OBD168-pl641 19 GCTTGTGTGGAACAGCCAGGCACCATTG OBD168-pl061 20 CACAG ACACCGACCG GAACG G OBD168-p2053 21 GTGTGGTGGCGCCATCTCAGC OBD168-pl393 22 GTTACACTGTCTCACATTTCTCCCTGGC OBD168-p569 23 TGGAAACCAAAGACTCCCTTCCCC OBD168-pl433 24 GAGTTCAAGACCAGCCTGACCA OBD168-pl481 25 TGTGGCGGCTCATGCCTGGAATCCCA OBD168-pl953 05 03 25 26 GTCACCCAAAGTCCCCACCTGCTCATAC OBD168-pl085 27 ACG G AG AACTTGCTCAACACAG AG GTG C OBD168-p757 28 CCTGGGTTCAAGCGATTCTCCTGCC OBD168-pl965 29 CAG CAGTG GGTTCTCAAATGTTAG CATC OBD168-p697 30 GTCTTCATTTCCATTTCCTGACACACAG OBD168-p977 31 AGGAGTCCAGTCAGGTTCCAGCCCAGG OBD168-plll7 32 TTATGTAAAAGTTTCTAGAAATT OBD168-pl861 33 CGTGGGTTGCGTCAGTCCCGTGTA OBD168-p849 34 GGGCAGAGGGAGGACACCCATTAGAAAT OBD168-p557 35 GGCTTCTCCCTGTTTCTGTCCTCCTCC OBD168-p765 36 AACTCCAGACTTGCGGGAAAGGCCTG OBD168-pl541 37 GCAAGAATCACTCAGCCGAGCCCTTCCC OBD168-p773 38 GCAAACTATGCCCATCGTATTTTACC OBD168-pl353 39 GTCACACAACAGAGACAGACTTGATAAT OBD168-p573 40 G G GTTCAAGTG AGTCTCCTG CCTC OBD168-pl489 41 CCTTCCCTTCTGGCTCCCTCTTTACCCC OBD168-p737 42 CCTTTCCCCACCAGGTTAGGGCTTT OBD168-pl325 43 TCTGGGCTGGGCTGGGACTGCTTGGAT OBD168-p837 44 CAGGAGTGGTCAATGTGTGCCTTGTTGC OBD168-p805 45 CTGCCCGGACGGCGGCCGCCGC OBD168-pl869 46 AGGCCAGGAGTTCAAGACCCTAG OBD168-pl981 47 GGCCAATGCCACCCCAATCTC OBD168-pl997 48 GGAGAGAGCCAGTGGTGAGAAACGCAGC OBD168-p529 49 GCCCCGCGCGTCTCCTCTGCCGCC OBD168-pl605 50 1 1 1 1 1 1 1GTTTTCTTTTGACAGA OBD168-p2089 51 G G G CTCTTG G CTC ACTTG G G A OBD168-pl677 Table 3.a9 Sequence qPCR Probe 1 TAG G CTG GTCTCG AG G G AACTCCCTCCCC OBD168-p991 2 TGAGTGACTCTAGCGATGTCGACTGCCCGCCCAGATCCCG OBD168-p2111 3 AGGAGCTGCAACTTTCCATCGAGTTCGCCCTC OBD168-p671 4 ATGTTGGTCAGGCTGGTCTCGAGGCCAGCCTGACCAACAT OBD168-pl731 5 AGAGGGCGCGGCCTACACTCGATCTTATCCTT OBD168-p703 6 TCCTTTTGTCGAACTCCTAACCTTGTGATCTACCCGC OBD168-p891 7 TGCGTAGTCGAGCCAGCATGAGCTCTCTGTTC OBD168-pll43 8 TCATTCTCGATGTACTTCTCTGCCTCAGCCTACGTG OBD168-pl223 9 GTGTTGGCCAGGCTGGTCTCGAGACGACCCTGGCCAACAA OBD168-pl907 10 ATGTTGGCCAAGCTGGTCTCGAGACCAGCCTTGCCAACAT OBD168-pl467 11 ATGTTGGCCAGGCTGGTCTCGAGACCAGCCTGACCAACAG OBD168-pl875 12 TTCTGTCTTTTCGCTGGCTCGAACAACAAATTGTTAAGTG OBD168-pl439 13 ATGTTGGCCAGACTGATCTCGAGACGATCCCGGCCAACAT OBD168-pl843 14 AGGCAGACAGGGAACTTGGCATATCGAGGTGG OBD168-p907 15 TGGTGGACACTACTTTAATCGAACTATTGGGCTCAAGC OBD168-p707 16 TGGACATAACTGTATTCTCTCTCTCTCTCTCGAAGCT OBD168-p867 17 AAACTCTAAACAGGTCTTTCGAGAAATGCCACGCTCACTA OBD168-pl611 05 03 25 18 ATGTTGGCCAGGCTGGTCTCGAGACCAGACTGGCCAACAT OBD168-pl643 19 AGTCACAGCAAATGCCACAGGGTGTGTTCGAGGAA OBD168-pl063 20 AAAAAATCAATTTAGATCTCGAAGCTGTCATCTGTGGGCG OBD168-p2055 21 GTGTTGGTCAGGCTGGTCTCGAGACAAGCCTGACTAACAT OBD168-pl395 22 TCTCTCTCTCTCTCTCGAGCAGGATGTGGAACAG OBD168-p571 23 TTCTGTCTTTTCGCTGGCTCGAGATAAGTGGACCCAGCTG OBD168-pl435 24 AACTAAGCTGACTTATATTCGAGATGGAGTTTTGCTCTTT OBD168-pl483 25 CCACCTGAGGTCAGGAGTTCGAACTCCTGGACTCAAGTGA OBD168-pl955 26 AGCAGCAATGGCAGTGGTGGTGATCGAAATGCC OBD168-pl087 27 ATAGTGATCGACTTGGGAGTGCCTGCGTTCCC OBD168-p759 28 ATGTTGGTCAGGCTGGTCTCGAGACCAGTCTGACCAACAT OBD168-pl967 29 ACTTAATTTTCGATACTTCCCCTGGGTGACTCTGACAG OBD168-p699 30 ACACAACTACAAGGTGATGAGATTATCGATGGG OBD168-p979 31 TGGTGCTCAGGAGGTGTCGAGCCGAGGA OBD168-plll9 32 TCATTTGAGGTCAGGAGTTCGAATTCCTGAGCTCAAATGA OBD168-pl863 33 ACCACCGTTGGGATGAAAGATGGCCTCGAAGTTG OBD168-p851 34 TGCCTTCACCCAAACTATCTGATCCCTCGACCCT OBD168-p559 35 ACGCTCCCCTCGACGATGACACCATAACCCTG OBD168-p767 36 TCTCTCTGTCTCTCAGATTCGAGCTCTTCTTCGGCGTCTG OBD168-pl543 37 TGGCAGCGCGGCGGTTGGTTCGAGTATCA OBD168-p775 38 GTGCCCGGTTCCACCCACTCGAAGTGATGGAACTCATAGG OBD168-pl355 39 TCTCTCTCTCTCTCGAATTCCTGACCTCGGCC OBD168-p575 40 ATGTTGGCCAGGCTGGTCTCGAGACCAGTCTGGCCAACAT OBD168-pl491 41 TGCGATTGTCGAGGCCTAACAATTTTCCAGGGTCC OBD168-p739 42 ATGTTGGCCAGGCTGGTCTCGAGACCAACCTGGCCAACAT OBD168-pl327 43 ACGCCAATGGTCTGAGTTAATCGAATGCATCCTGGC OBD168-p839 44 AGCAGAAGGCTCCAGCTGTACGCTCGATTCCT OBD168-p807 45 GGCCGGCTGCCATGGAGCTCGACCGCCAGGGCCCGCGTCC OBD168-pl871 46 TAAGTGTGTCCACTTATGTCGAGCAATCCTTCTGCCTCAG OBD168-pl983 47 TTAGATACATCAAGTCCCTCGAGGCTGCAGAAGGCTGGGT OBD168-pl999 48 TTAGACTCGATGGTTCCCTATTACCCTCTGCCCG OBD168-p531 49 1 1 1 1 ICCATGAGAAACATTCGAGGTGCTCGGCGGGCAGCG OBD168-pl607 50 ATGTTGGTCAGGCTGGTCTCGAGACCAGCCTGAGCAACAT OBD168-p2091 51 ACAGTTACAGAGGAGAAGTCGACGGAGTCGGTTCAGTTTG OBD168-pl679 Table 3.al0 Sequence probe 1 AGG G AGTTCCCTCGAG ACCAG CCTAG G ORF1_8_143363265_143368758_143397O73_143399812_RR 2 CGGGATCTGGGCGGGCAGTCGACATCGCTAGAGTCACTCA ORF1_X_4875O795_48754365_48796124_488O1821_FF 3 AGGGAGGGCGAACTCGATGGAAAGTTGCAGCT ORF1_4_186172696_186175767_186190828_186192765_FF 4 ATGTTGGTCAGGCTGGCCTCGAGACCAGCCTGACCAACAT ORF1_1_26201425_26205480_26333363_26336159_FR 5 AAGGATAAGATCGAGTGTAGGCCGCGCCCTCT ORF1_2_70887659_70889000_70979229_70981565_FF 6 AGGCGGGTAGATCACAAGGTTAGGAGTTCGACAAAAG ORF1_2_112539682_112540702_112816387_112823836_RR 7 AACAGAGAGCTCATGCTGGCTCGACTACGCAC ORF1_12_52037813_52040902_52237944_52243119_FR 8 ACGTAGGCTGAGGCAGAGAAGTACATCGAGAATGATC ORF1_11_10562525_10569392_10617125_10621846_RR 9 TTGTTGGCCAGGGTCGTCTCGAGACCAGCCTGGCCAACAC ORF1_2_43086424_43092123_43178166_43179822_FF 10 ATGTTGGCAAGGCTGGTCTCGAGACCAGCTTGGCCAACAT ORF1_17_67419703_67421985_67604580_67609081_RR 05 03 25 11 CTGTTGGTCAGGCTGGTCTCGAGACCAGCCTGGCCAACAT ORF1_19_2777060_2780381_2901738_2905384_RF 12 CACTTAACAATTTGTTGTTCGAGCCAGCGAAAAGACAGAA ORF1_17_43300561_43304860_43444308_43448547_RR 13 ATGTTGGCCGGGATCGTCTCGAGATCAGTCTGGCCAACAT ORF1_15_74686122_74687597_74772372_74779791_FR 14 ACCACCTCGATATGCCAAGTTCCCTGTCTGCC C)RFl_10_62056179_62058893_62096285_62100217_RR 15 TGCTTGAGCCCAATAGTTCGATTAAAGTAGTGTCCACC ORF1_15_76885704_76887654_76983002_76985852_RF 16 AGCTTCGAGAGAGAGAGAGAGAATACAGTTATGTCC C)RFl_ll_10637008_10641060_10678778_10685244_FR 17 TAGTGAGCGTGGCATTTCTCGAAAGACCTGTTTAGAGTTT ORF1_3_122768838_122771609_122793452_122794847_FR 18 ATGTTGGCCAGTCTGGTCTCGAGACCAGCCTGGCCAACAT ORF1_5_140242642_140251155_140386390_140387430_FF 19 TTCCTCG AACACACCCTGTG G CATTTG CTGTG AC ORF1_2_143119651_143128757_143274179_143284059_FR 20 CGCCCACAGATGACAGCTTCGAGATCTAAATTGAI 1 Illi ORF1_7_1769382_1772142_1917082_1921849_RF 21 ATGTTAGTCAGGCTTGTCTCGAGACCAGCCTGACCAACAC ORF1_13_28585301_28589104_28625877_28627714_FR 22 TCTGTTCCACATCCTGCTCGAGAGAGAGAGAGAG C)RFl_ll_10637008_10641060_10826892_10830503_FR 23 CAGCTGGGTCCACTTATCTCGAGCCAGCGAAAAGACAGAA C)RFl_17_43300561_43304860_43353578_43358798_RR 24 AAAGAGCAAAACTCCATCTCGAATATAAGTCAGCTTAGTT C)RFl_18_63921019_63923125_64068334_64074049_RR 25 TCACTTGAGTCCAGGAGTTCGAACTCCTGACCTCAGGTGG ORF1_20_31989698_31994926_32038678_32045816_RF 26 TG GG CATTTCGATCACCACCACTGCCATTG CTG ORF1_11_35040602_35047084_35078579_35084103_FR 27 ACGCAGGCACTCCCAAGTCGATCACTATTTGGTTC ORF1_18_45762O52_45766373_45829537_45837293_FF 28 ATGTTGGTCAGACTGGTCTCGAGACCAGCCTGACCAACAT ORF1_22_42713609_42716051_42864112_42866876_FR 29 CTGTCAGAGTCACCCAGGGGAAGTATCGAAAATTAAGT ORF1_21_29039171_29043861_29092829_29094361_FF 30 TCCTTGGACTCTCCCCATCGATAATCTCATCACCTTG ORF1_X_101616906_101623004_101715574_101717864_FF 31 TCCTCG G CTCGACACCTCCTGAG CACCA ORF1_16_8553321O_85536278_8565593O_8566O237_FR 32 TCATTTGAGCTCAGGAATTCGAACTCCTGACCTCAAATGA ORF1_16_57546345_57549019_57808053_57811713_RF 33 AACTTCG AG GCCATCTTTCATCCCAACG GTG GTG ORF1_20_50192390_50194162_50280026_50281924_RF 34 AGGGTCGAGGGATCAGATAGTTTGGGTGAAGGC ORF1_2_25155910_25160743_25292182_25293890_FR 35 CAGGGTTATGGTGTCATCGTCGAGGGGAGCGT ORF1_7_151781262_151783710_151930364_151932111_RR 36 CAGACGCCGAAGAAGAGCTCGAATCTGAGAGACAGAGAGA ORF1_2_74503923_74507137_74519716_74521847_RF 37 TTATCTG ATACTCG AACCAACCG CCG CGCTG C ORF1_6_52573576_52576507_52715481_52719514_FR 38 CCTATGAGTTCCATCACTTCGAGTGGGTGGAACCGGGCAC ORF1_10_104325690_104332059_104442837_104447074_RR 39 AGGCCGAGGTCAGGAATTCGAGAGAGAGAGAG ORF1_11_10376885_10382511_10637008_10641060_RF 40 ATGTTGGCCAGACTGGTCTCGAGACCAGCCTGGCCAACAT ORF1_19_727O757_7273737_7367544_737O291_FR 41 ACCCTGGAAAATTGTTAGGCCTCGACAATCGCACC ORF1_6_15165975_15168155_15248586_15249747_RF 42 ATGTTGGCCAGGTTGGTCTCGAGACCAGCCTGGCCAACAT ORF1_1_158181667_158187628_158243613_158252050_FF 43 TGGCCAGGATGCATTCGATTAACTCAGACCATTGGC ORF1_11_65044650_65046952_65060361_65063993_FF 44 AGGAATCGAGCGTACAGCTGGAGCCTTCTGCT ORF1_6_31267448_31269252_31531115_31534994_RF 45 GGACGCGGGCCCTGGCGGTCGAGCTCCATGGCAGCCGGCC ORF1_17_81104538_81109597_81345804_81351809_RR 46 CTGAGGCAGAAGGATTGCTCGACATAAGTGGACACACTTA ORF1_3_101887192_101889071_101943010_101950739_RF 47 ACCCAGCCTTCTGCAGCCTCGAGGGACTTGATGTATCTAA ORF1_4_2639345_2642002_2800083_2804902_RR 48 TGCGGGCAGAGGGTAATAGGGAACCATCGAGTCTAA ORF1_9_123259504_123263022_123339568_123345302_FR 49 CGCTGCCCGCCGAGCACCTCGAATGTTTCTCATGGAAAAA ORF1_3_512434O6_51244925_51388915_51391864_FF 50 ATGTTGCTCAGGCTGGTCTCGAGACCAGCCTGACCAACAT ORF1_8_73772858_73775783_73991731_73996964_RF 51 CAAACTGAACCGACTCCGTCGACTTCTCCTCTGTAACTGT ORF1_7_1901148_1902503_2033188_2038434_RF Table 3.all PCR Marker Set qPCR Marker Set 1 OBD168-989.991 OBD168-q989.q991.p989 / p991 2 OBD168-2109.2111 OBD168-q2109.q2Ul.p2109 / p2111 05 03 25 3 OBD168-669.671 OBD168-q669.q671.p669 / p671 4 OBD168-1729.1731 OBD168-ql729.ql731.pl729 / pl731 5 OBD168-701.703 OBD168-q701.q703.p701 / p703 6 OBD168-889.891 OBD168-q889.q891.p889 / p891 7 OBD168-1141.1143 OBD168-qll41.qll43.pH41 / pll43 8 OBD168-1221.1223 OBD168-ql221.ql223.pl221 / pl223 9 OBD168-1905.1907 OBD168-ql905.ql907.pl905 / pl907 10 OBD168-1465.1467 OBD168-ql465.ql467.pl465 / pl467 11 OBD168-1873.1875 OBD168-ql873.ql875.pl873 / pl875 12 OBD168-1437.1439 OBD168-ql437.ql439.pl437 / pl439 13 OBD168-1841.1843 OBD168-ql841.ql843.pl841 / pl843 14 OBD168-905.907 OBD168-q905.q907.p905 / p907 15 OBD168-705.707 OBD168-q705.q707.p705 / p707 16 OBD168-865.867 OBD168-q865.q867.p865 / p867 17 OBD168-1609.1611 OBD168-ql609.ql611.pl609 / pl611 18 OBD168-1641.1643 OBD168-ql641.ql643.pl641 / pl643 19 OBD168-1061.1063 OBD168-ql061.ql063.pl061 / pl063 20 OBD168-2053.2055 OBD168-q2053.q2055.p2053 / p2055 21 OBD168-1393.1395 OBD168-ql393.ql395.pl393 / pl395 22 OBD168-569.571 OBD168-q569.q571.p569 / p571 23 OBD168-1433.1435 OBD168-ql433.ql435.pl433 / pl435 24 OBD168-1481.1483 OBD168-ql481.ql483.pl481 / pl483 25 OBD168-1953.1955 OBD168-ql953.ql955.pl953 / pl955 26 OBD168-1085.1087 OBD168-ql085.ql087.pl085 / pl087 27 OBD168-757.759 OBD168-q757.q759.p757 / p759 28 OBD168-1965.1967 OBD168-ql965.ql967.pl965 / pl967 29 OBD168-697.699 OBD168-q697.q699.p697 / p699 30 OBD168-977.979 OBD168-q977.q979.p977 / p979 31 OBD168-1117.1119 OBD168-qlll7.qlll9.plH7 / plll9 32 OBD168-1861.1863 OBD168-ql861.ql863.pl861 / pl863 33 OBD168-849.851 OBD168-q849.q851.p849 / p851 34 OBD168-557.559 OBD168-q557.q559.p557 / p559 35 OBD168-765.767 OBD168-q765.q767.p765 / p767 36 OBD168-1541.1543 OBD168-ql541.ql543.pl541 / pl543 37 OBD168-773.775 OBD168-q773.q775.p773 / p775 38 OBD168-1353.1355 OBD168-ql353.ql355.pl353 / pl355 39 OBD168-573.575 OBD168-q573.q575.p573 / p575 40 OBD168-1489.1491 OBD168-ql489.ql491.pl489 / pl491 41 OBD168-737.739 OBD168-q737.q739.p737 / p739 42 OBD168-1325.1327 OBD168-ql325.ql327.pl325 / pl327 43 OBD168-837.839 OBD168-q837.q839.p837 / p839 44 OBD168-805.807 OBD168-q805.q807.p805 / p807 45 OBD168-1869.1871 OBD168-ql869.ql871.pl869 / pl871 46 OBD168-1981.1983 OBD168-ql981.ql983.pl981 / pl983 47 OBD168-1997.1999 OBD168-ql997.ql999.pl997 / pl999 48 OBD168-529.531 OBD168-q529.q531.p529 / p531 49 OBD168-1605.1607 OBD168-ql605.ql607.pl605 / pl607 50 OBD168-2089.2091 OBD168-q2089.q2091.p2089 / p2091 51 OBD168-1677.1679 OBD168-ql677.ql679.pl677 / pl679 Table 3.al2 05 03 25 52 ORF1_22_41776313_41777375_42031915_42033846_R F 295 1915.600527 53 OR F 1_2 _10016688_10020163J0069588J0070662_R F 300 1950.081799 54 ORF1741457346_^^ 230 1511.98957 55 ORF1_7_135917157_135920025_136070982_136076106_FR 342 2112.969893 56 ORF1_6_134102628_134113539_134393136_134395072_RF 617 3237.196304 57 ORFl_17_27740779_27745632_27849258_27851150_F R 179 1226.644201 58 ORF1_X_39624253_39627672_39748652_39756826_RR 786 3811.777698 59 OR F1_2l_29066989_29073149_29092829_29094361_R F 341 2111.667632 60 ORF1_17_35363623_35366998_35578150_35580887_FF 427 2463.77808 61 ORF12129732845129738418129813191129815478RF 789 3819.174236 62 ORF V15^90688752^90691260 90881362OT F 529 2871.807678 63 ORF1_2_166059673_166070002_166163002_166177651_RF 228 1504.981553 64 ORF122236657842367382223711932_23713061_FR 184 1286.837245 65 ORF1_1_53182248_53184895_53364674_53371789_RF 635 3294.7368 66 ORF1_20_50280026_50281924_50437155_50439548_FF 373 2212.25714 67 ORFl_17_20844189_20846843_20895269_20898565_R F 832 3968.695995 68 ORF1_19_19361989_19364321_19458777_19462243_RF 768 3761.457058 69 ORF 1_14_67469788_6747349V67514914 67519335 FR 478 2676.769491 70 ORF1_21_29039171_29043861_29092829_29094361_RF 380 2252.095813 71 ORF1_19_4252394_4257822_4336234_4339292_FF 207 1414.449942 72 ORF1_8_41806799_41808430_41845432_41849175_RF 232 1525.067865 73 ORF1_11_47655428_47658417_47713810_47715533_RF 652 3360.825526 74 ORFl_l_3073908_3076056_3169997_3177404_F F 770 3771.044431 75 ORF1_19_41422837_41424323_41692451_41693876_RR 766 3759.146475 76 ORF1_9_134315578_134321630_134391769_134398405_RF 754 3730.532291 77 ORF1332625993326276993268332632685449F 459 2572.971635 78 ORF1194264058426581843418214 221 1462.635611 79 OR F12l_29092829_29094361_29164018_29174520_FF 398 2338.87323 80 ORF1_2_91859085_91863356_92122473_92125698_R F 310 1980.300976 81 ORF1_X_20268599_20270341_20456973_20459740_RR 811 3868.038973 82 ORF1_6_29844477_29850988_29921307_29925901_FF 283 1854.11491 83 ORF1_19_53278181_53279831_53467555_53470239_FR 560 2987.902851 84 ORF1_19_41422837_41424323_41672917_41678014_RR 249 1632.926185 85 ORFl_5_690177_692906_744214 749963 FR 400 2340.89338 86 ORF11743300561433048601982RF 846 4007.706758 87 ORF1_15_62681808_62691633_62730771_62732716_RR 551 2954.724442 88 ORF1_12_47686852_47690553_47817317_47827238_RF 433 2485.195218 89 ORF1_Y_18283408_18293202_18412555_18418411_RR 237 1545.88146 90 ORF1_2_218162078_218164150 218253352 218257050 F F 787 3812.00956 91 ORF1_19_41422837_41424323_41597548_41599628_RR 239 1554.462101 92 ORF1205028002650281924503094175 R 241 1558.884246 93 ORF 1^70371691 70373189 70454780^7 727 3635.071398 94 ORF 1^75205085J75210191J75236O91J75239565J R 337 2099.567055 95 ORF1_X_39735882_39738523_39748652_39756826_FR 778 3797.26634 96 ORF1_1l_10637008_10641060_10871146_10872290_FR 248 1629.314725 97 ORF1_20_63754820_63756674_63899802_63901328_FF 867 4053.634633 98 ORFl_4_102249197_102251493_102344820_102348626_F R 790 3820.755115 99 ORF1_1_161657362_161661864_161734762_161740896_RF 644 3341.384869 100 ORF11687705238772703^8 865 4048.304309 Table 3.bl 05 03 25 52 1.446445715 0.844353538 0.001764866 Early SSC 53 1.444313939 0.857296534 0.00182229 Early SSC 54 1.444202674 0.70719786 0.001152482 Early SSC 55 1.442909876 0.868305311 0.002104088 Early SSC 56 1.44164787 1.028118327 0.004494626 Early SSC 57 1.441256048 0.622029308 0.000788913 Early SSC 58 1.439937087 1.076426753 0.005994767 Early SSC 59 1.435176841 0.869890982 0.002101767 Early SSC 60 1.434551872 0.915034411 0.002768411 Early SSC 61 1.434549547 1.075994131 0.006015229 Early SSC 62 1.434212325 0.969982617 0.003635674 Early SSC 63 1.432836082 0.707437155 0.001142847 Early SSC 64 1.431899857 0.660136988 0.000860631 Early SSC 65 1.430019987 1.030563723 0.004636752 Early SSC 66 1.428940576 0.86431007 0.00228425 Early SSC 67 1.422169266 1.091590126 0.006434995 Early SSC 68 1.419967948 1.07621306 0.005856319 Early SSC 69 1.418668486 0.947418348 0.003208743 Early SSC 70 1.417447692 0.875891636 0.002358301 Early SSC 71 1.416297822 0.696494413 0.001021535 Early SSC 72 1.415515314 0.712096468 0.001170556 Early SSC 73 1.414697152 1.039518475 0.004802253 Early SSC 74 1.41377078 1.078233722 0.005882594 Early SSC 75 1.411375643 1.077857615 0.005849994 Early SSC 76 1.409033773 1.08039358 0.005771898 Early SSC 77 1.40830109 0.919601928 0.002990734 Early SSC 78 1.407406909 0.693140095 0.001085372 Early SSC 79 1.40724024 0.894701668 0.002523054 Early SSC 80 1.406168907 0.852847711 0.001873262 Early SSC 81 1.405642995 1.070456089 0.006151131 Early SSC 82 1.404695358 0.830066012 0.001664425 Early SSC 83 1.403682128 0.982988691 0.003900334 Early SSC 84 1.40273008 0.75057046 0.001324208 Early SSC 85 1.400704404 0.891601211 0.002526946 Early SSC 86 1.400672498 1.092114447 0.006546419 Early SSC 87 1.39987463 0.979467819 0.003823905 Early SSC 88 1.399263447 0.916381838 0.002811445 Early SSC 05 03 25 89 1.398979973 0.714351228 0.001199569 Early SSC 90 1.398583292 1.075173947 0.005995408 Early SSC 91 1.397442353 0.715489386 0.00121162 Early SSC 92 1.397341217 0.713200465 0.00121785 Early SSC 93 1.395652706 1.070547766 0.005514495 Early SSC 94 1.395237619 0.871205394 0.002080251 Early SSC 95 1.39513079 1.080227905 0.005954705 Early SSC 96 1.394698535 0.750594179 0.001318931 Early SSC 97 1.394072899 1.087179498 0.006678603 Early SSC 98 1.392557299 1.075414102 0.006019606 Early SSC 99 1.391243321 1.041707676 0.004753319 Early SSC 100 1.389721585 1.08718107 0.006663206 Early SSC Table 3.b2 52 ATGGGCCTCAGAGGGGAAGAAGTACATATCGAGAATGGGCATCTCTACCCTTGTTAGGTC 53 ACTGCGCCTGGCATATTTATTTATTTATTCGAGCCGCTTGAGCATAGAGCTTATGGAGAT 54 TAGTTTCCAAGTGTGTGATAGCTCCAGATCGAGTCTGAGGAGTGAGCGGGAAGCTGCACA 55 TTTCTCTTTCTCTCTCTCTTTTTTTTTTTCGAGATCCTTAGGGGACCTTGTAGTAAAATA 56 GACTCCACATTTCCACCAGCTCAAACAGTCGAACAATTCTTCTGCCTCAGCCTCCCAAGC 57 TGGCTTCTTCTTAACTTTCTCGGGTGAGTCGAAGAGCCCAAATAACTTGTTTTAGACCAG 58 TGGTTTCAGAAGAGGGGCCCAGGGAACCTCGAATCTTCTGAGGGAGCGTGGCCCAGGTGA 59 CATCTGTCAGAGTCACCCAGGGGAAGTATCGAAGG1 1 1 1 1 1GCAGAACAACATACCAAAT 60 GGCTGAGGTGAGAGAATCACCTGAGCCTTCGAGTTGCAAATTTCTGTTTTCI1 11 1 1 1 1 1 61 TGATAGCCAAGACAATGGGGAAAAGGCCTCGACCCTTGCACGGGCGCAGATCCAGGTGCA 62 AGGCTTCAGCTGGGGCAGGCTTGGCCTGTCGACACCAATGTCTTGGATGTTTAACCTCCA 63 CATCATGGCAGATGGGTTATCCAACTCCTCGAAAGCTTTCTTTTCTAAGCCTTAGGATGC 64 AGGTTTCACCATGTTGGCCAGGATGGTCTCGAGATCAGCCTGGTCAACATGGTGAAACCC 65 CCACCATGCCAGGCACGAACATGGTCACTCGAAATTACGTGAGCCTTAGTTCI1 1 1 IAI 1 66 CACACCACCGTTGGGATGAAAGATGGCCTCGATACATGCTTGTCAGTGAAAGAGCGATGC 67 TCATTGGTAGGACATCTCAAAATGGCACTCGAGCTCTACAGCCAGTACCTGGAGCGCCTG 68 TGTGCTGGGGGCACTAGTCCCGCTTGCTTCGATGCCTGGGCTCCTTCTGCCCCATCCCCA 69 GCTGGGCTCCCCGGGCTCAGCGTCCTTGTCGAAACCGAAAGCAAAGAGGAAGCGGGATCT 70 CATCTGTCAGAGTCACCCAGGGGAAGTATCGATTGTGCTTTCAGTGCCTCAGTGAGATGC 71 GGGTTTCACCATGTTGGCCAGGCTGGTCTCGAGACCAGCCTGGGCCAACATGGGGAAACC 72 GGGCTCACTTCATATCCTCTGCCCATCTTCGATGGTTTTCCATGACGATTGTCCAGTTTA 73 CTCATACATCACAGCCCCAGCCTCGGAATCGACCTCAGCTTCATTCTTCTTAAACAAGAG 74 ACCAGGAGCAGCCTCTGCTCTGCCCACCTCGAAGCTTCTCAAACGCCACTCTAACGACCC 75 TGATAAGGCCATGTTTTGGAGACAGTGATCGAGCATTTCTTAAATTCCCTCAGAATTTGC 76 CGGGGCCCTTTGCTGTGAGTAGAGGATGTCGAGGGCTGGGCGGCAGCCTCCCTGGGCTCC 77 GCTCTGACATACCACCCTGCCAAGTACCTCGACTCGGGTTCTTCCCTGCAGGTGGCGTGG 78 GGGTTTCACCATGTTGACCAGGCTGGTCTCGAGACCAGCCTGGCAAACATGGTGAAACCC 79 CATCTGTCAGAGTCACCCAGGGGAAGTATCGACTAGACACTTCCAAAATACTAACCATAC 80 GATATTTGTCTAGCTTTGAGGATTTCGTTCGAATTTTAAGCTCCACAAATGACCAAGAAC 81 CCCTAAATGGCCACGAGGTTCCCCGGCCTCGAGGTGTCAGATAI 1 1 1 1CTTCCTGTATAT 82 ACTCTTTCCATTATGTGCAATTGTAACTTCGATGCCAGAGAGGGAGCTCGCCCTGGGAAT 83 GAGGCAGGTGGAATGGGTGGAGTCCAAGTCGACTCCAAAACCCTAAAACAGGCGCTGGAG 84 TGATAAGGCCATGTTTTGGAGACAGTGATCGAAGTTTGTGCTCTTTGTGATTCAGACAGA 85 CCCCTAGGCCTGGGAATAGGGAAACGGTTCGATTTGGTTTCCCAAGGTCTTATCAGTGAT 86 TTGAGGGCATTTGGCTGCTCTTTTACACTCGAGCCAGCGAAAAGACAGAACCGGAAGAGA 87 AGACTGGGTGACAGAGTGAGATCGTGTCTCGATTTTCCAGCAGTGTGCCTGGAGGAGTTT 88 GAGTGGAGAAAACGGTTGGATGAGGGACTCGAGTATAGCATTCAATTGCTCTTTCATATT 89 TAGGGTCTTCTTCCAGAGAATCAAATTCTCGACCAGCTTGGCCCCATCTAAAGTATGATT 90 TTTCCTTCTGAGAAGAGATATTCCTTCATCGACTGGTCACGATGGGCTGCTTCATCTGTG 91 TGATAAGGCCATGTTTTGGAGACAGTGATCGACAGATCTCCATTAI 1 1 1ICAGCCGGCTC 92 CACACCACCGTTGGGATGAAAGATGGCCTCGAGCTGGTCATGACACGCTTTAAGACCCTG 93 GGGTTTCACCAGGTTGGCCATGCTGGGTTCGAGAGCAGCCTGGGCAACACAGTGAGACCT 94 TCTTGCTTTCTTGCTTTCTTTCTTGCTTTCGATAACCTGAAATACCGACI Illi IGGATT 95 TGATGTTATGGAAAACCATTTGGCCTTTTCGAATCTTCTGAGGGAGCGTGGCCCAGGTGA 96 GGACATAACTGTATTCTCTCTCTCTCTCTCGAACTCCTGACTTCGGCTGATCTGCCCACC 97 AAACAGGCACTGCGTGTTCCCAGCACCCTCGATTCCATCTTCCGACCTGCCAGCATCATG 98 CTCTTTTCTCTTGCAGAGGTGGCAAAACTCGAAAGAACAGCAGCTCGCGACCTGCGGGGC 99 GTTATTAI 1C1 ICCAITTATAI1 1 1 1G ITCGACCCTTCTGCTTTCTCTCCAGGGGATGGC 100 GTACTGAAGGTCTAGCATATGGGTAGAGTCGACCTCTCTGGGCTCAGGTGATCCTCCCAC Table 3.b3 05 03 25 Probe Location 52 22 41776315 41776344 42033815 42033844 53 2 10016690 10016719 10070631 10070660 54 7 41461324 41461353 41491372 41491401 55 7 135919994 135920023 136070984 136071013 56 6 134102630 134102659 134395041 134395070 57 17 27745601 27745630 27849260 27849289 58 X 39624255 39624284 39748654 39748683 59 21 29066991 29067020 29094330 29094359 60 17 35366967 35366996 35580856 35580885 61 2 129732847 129732876 129815447 129815476 62 15 90688754 90688783 90884704 90884733 63 2 166059675 166059704 166177620 166177649 64 22 23673791 23673820 23711934 23711963 65 1 53182250 53182279 53371758 53371787 66 20 50281893 50281922 50439517 50439546 67 17 20844191 20844220 20898534 20898563 68 19 19361991 19362020 19462212 19462241 69 14 67473460 67473489 67514916 67514945 70 21 29039173 29039202 29094330 29094359 71 19 4257791 4257820 4339261 4339290 72 8 41806801 41806830 41849144 41849173 73 11 47655430 47655459 47715502 47715531 74 1 3076025 3076054 3177373 3177402 75 19 41422839 41422868 41692453 41692482 76 9 134315580 134315609 134398374 134398403 77 3 32627668 32627697 32685418 32685447 05 03 25 78 19 4265787 4265816 4341823 4341852 79 21 29094330 29094359 29174489 29174518 80 2 91859087 91859116 92125667 92125696 81 X 20268601 20268630 20456975 20457004 82 6 29850957 29850986 29925870 29925899 83 19 53279800 53279829 53467557 53467586 84 19 41422839 41422868 41672919 41672948 85 5 692875 692904 744216 744245 86 17 43300563 43300592 43411951 43411980 87 15 62681810 62681839 62730773 62730802 88 12 47686854 47686883 47827207 47827236 89 Y 18283410 18283439 18412557 18412586 90 2 218164119 218164148 218257019 218257048 91 19 41422839 41422868 41597550 41597579 92 20 50281893 50281922 50309419 50309448 93 9 70371693 70371722 70454782 70454811 94 5 75210160 75210189 75236093 75236122 95 X 39738492 39738521 39748654 39748683 96 11 10641029 10641058 10871148 10871177 97 20 63756643 63756672 63901297 63901326 98 4 102251462 102251491 102344822 102344851 99 1 161657364 161657393 161740865 161740894 100 16 8770525 8770554 8943641 8943670 Table 3.b4 4 kb Sequence Location 52 22 41776315 41780314 42029845 42033844 53 2 10016690 10020689 10066661 10070660 54 7 41457354 41461353 41487402 41491401 55 7 135916024 135920023 136070984 136074983 56 6 134102630 134106629 134391071 134395070 57 17 27741631 27745630 27849260 27853259 58 X 39624255 39628254 39748654 39752653 59 21 29066991 29070990 29090360 29094359 60 17 35362997 35366996 35576886 35580885 61 2 129732847 129736846 129811477 129815476 62 15 90688754 90692753 90880734 90884733 63 2 166059675 166063674 166173650 166177649 64 22 23669821 23673820 23711934 23715933 65 1 53182250 53186249 53367788 53371787 66 20 50277923 50281922 50435547 50439546 67 17 20844191 20848190 20894564 20898563 68 19 19361991 19365990 19458242 19462241 69 14 67469490 67473489 67514916 67518915 05 03 25 70 21 29039173 29043172 29090360 29094359 71 19 4253821 4257820 4335291 4339290 72 8 41806801 41810800 41845174 41849173 73 11 47655430 47659429 47711532 47715531 74 1 3072055 3076054 3173403 3177402 75 19 41422839 41426838 41692453 41696452 76 9 134315580 134319579 134394404 134398403 77 3 32623698 32627697 32681448 32685447 78 19 4261817 4265816 4341823 4345822 79 21 29090360 29094359 29170519 29174518 80 2 91859087 91863086 92121697 92125696 81 X 20268601 20272600 20456975 20460974 82 6 29846987 29850986 29921900 29925899 83 19 53275830 53279829 53467557 53471556 84 19 41422839 41426838 41672919 41676918 85 5 688905 692904 744216 748215 86 17 43300563 43304562 43407981 43411980 87 15 62681810 62685809 62730773 62734772 88 12 47686854 47690853 47823237 47827236 89 Y 18283410 18287409 18412557 18416556 90 2 218160149 218164148 218253049 218257048 91 19 41422839 41426838 41597550 41601549 92 20 50277923 50281922 50309419 50313418 93 9 70371693 70375692 70454782 70458781 94 5 75206190 75210189 75236093 75240092 95 X 39734522 39738521 39748654 39752653 96 11 10637059 10641058 10871148 10875147 97 20 63752673 63756672 63897327 63901326 98 4 102247492 102251491 102344822 102348821 99 1 161657364 161661363 161736895 161740894 100 16 8770525 8774524 8939671 8943670 Table 3.b5 52 ORF1 22 41776313 41777375 42031915_42033846_R F OBD168-1265 53 ORFl_2_10016688_10020163_10069588_10070662_R F OBD168-1193 54 ORF1_7_41457346_41461355_41488360_41491403_FF OBD168-853 55 ORF1_7_135917157_135920025_136070982_136076106_FR OBD168-1689 56 ORFV6J34102628^134113539JL34393136J34395072^RF OBD168-1089 57 ORF1172774077921150FR OBD168-625 58 ORF1_X_39624253_39627672_39748652_39756826_RR OBD168-2101 59 OR F1_21_29066989_29073149_29092829_29094361_R F OBD168-821 60 ORF1_17_35363623_35366998_35578150_35580887_FF OBD168-1865 61 ORF1_2_129732845_129738418_129813191_129815478_RF OBD168-945 62 ORFl_15_90688752_90691260_90881362_90884735_R F OBD168-1845 63 ORF1_2_166059673_166070002_166163002_166177651_RF OBD168-1569 64 ORF 1_22_23665784_23673822_23711932 23713061_FR OBD168-1589 05 03 25 65 ORF W53182248_53184895_53364674_53371789_RF OBD168-1149 66 ORF1_20_50280026_50281924_50437155_50439548_FF OBD168-1169 67 ORFl_17_20844189_20846843_20895269_20898565_R F OBD168-473 68 ORF1_19_19361989_19364321_19458777_19462243_RF OBD168-833 69 ORF1_14_67469788_67473491_67514914_67519335_F R OBD168-1829 70 ORF1_21_29039171_29043861_29092829_29094361_RF OBD168-477 71 ORF1194^ OBD168-1877 72 ORF18418067994180843041845432418 OBD168-665 73 ORF1_11_47655428_47658417_47713810_47715533_RF OBD168-1765 74 ORF1 1 3073908 3076056 3169997_3177404_F F OBD168-1045 75 ORF1_19_41422837_41424323_41692451_41693876_RR OBD168-761 76 ORF1_9_134315578_134321630_134391769_134398405_RF OBD168-1197 77 ORF1_3_32625993_32627699_32683326_32685449_FF OBD168-1977 78 ORF1_19_4264058_4265818_4341821_4342968_FR OBD168-1881 79 OR F121^29092829^2909436V29164018 29174520 FF OBD168-613 80 ORF1_2_91859085J31863356_92122473J92125698_RF OBD168-1917 81 OR F1 JC20268599^2027034L20456973^20459740^R R OBD168-1713 82 ORF1_6_29844477_29850988_29921307_29925901_FF OBD168-1657 83 ORF1_19_53278181_53279831_53467555_53470239_FR OBD168-1897 84 ORF1_19_41422837_41424323_41672917_41678014_RR OBD168-1497 85 ORFl_5_690177_692906_744214_749963_FR OBD168-1109 86 ORFl_17_43300561_43304860_43406585_43411982_R F OBD168-1441 87 0RF1J5_62681808_62691633_62730771_62732716_RR OBD168-817 88 ORF1124768685247690553_4^ OBD168-1801 89 ORF1_Y_18283408_18293202_18412555_18418411_RR OBD168-461 90 ORF1_2_218162078_218164150 218253352 218257050 F F OBD168-1577 91 ORF1_19_41422837_41424323_41597548_41599628_RR OBD168-1205 92 ORFl_20_50280026_50281924_50309417_50313312_FR OBD168-1217 93 ORFl_9_7037169l_70373189_70454780_70468182_R R OBD168-2093 94 ORF15752050857521019l_75236091_75239565_FR OBD168-861 95 ORF1JC39735882^39738523^39748652^39756826JR OBD168-2105 96 ORF 1J1J0637008J0641060J0871146J0872290J R OBD168-709 97 ORF1_20_63754820_63756674_63899802_63901328_FF OBD168-1229 98 ORFl_4_102249197_102251493_102344820_102348626_F R OBD168-693 99 ORF1_1_161657362_161661864_161734762_161740896_RF OBD168-1053 100 ORFl_16_8770523_8772703_8938508_8943672_RF OBD168-1849 Table 3.b6 52 TGTGCTGATGTCTGCTGCTCTCAACA OBD168-1267 GATAAAACCCTGATTCTCTCTCCTGG 53 CCCGTGCTGAGATGGAGAACCTG OBD168-1195 GGTTTCACTCCTCCCACCTCATC 54 GGAGAGTTTCTGTTCAAAGGGTGTAG OBD168-855 CCCACAAAGGGTGTTCAATCATCCAC 55 AGGAAATAAGCCCTACGTGGCAGGAG OBD168-1691 CAGGTTTCTCACAAACAGACTGAAAA 56 GGGAGGGAGAGATTGGTTCTTTACC OBD168-1091 ACATAGGTGATGGTGGCTGACTTCCT 57 AGGAGGGCAAAGGTCACAGTGGC OBD168-627 CACCTTG CTG CTTG CCAACAGTG 58 ATTTAGCAAGACATTGGAAGAA OBD168-2103 TTGTGCCTCCGTATACTATAAT 59 CAGCAGTGGGTTCTCAAATGTTAGCA OBD168-823 CTGTCATCTAAGCCTCCATTCATAAC 05 03 25 60 CAGG CAG ATCACTTG AG CCTAG OBD168-1867 AAATACAAAAATTAGCTTGGAA 61 AGCCTGGTCAAGTGAAAAGCCCATTT OBD168-947 TGAGGATGACCCAGCAGATAGGGAGA 62 AGCGGTGGGAGCTGGGGGCGCG OBD168-1847 AAGGAGTACTAGTAGATACAAG 63 ACATACTTTCTAGATCAATTTCTTA OBD168-1571 TTTCAAAAACCAACTCCATTAGCAG 64 TGCAACATCTACCTCCCGGGTTC OBD168-1591 G AAACCTCCG CCTCCCAG GTTCA 65 CCCCAGCCCTCCTTCTCTTCTTT OBD168-1151 AATCCCAGCACTCACCACACGGC 66 GCTTGAAGGCGGATTCCTCCAGG OBD168-1171 GCTGCCTGACTACTCCTGGGAAA 67 GGCTGTGAGGTTGTCCTTTACTGC OBD168-475 TCCTGGGAGATGAAGCGACGCAG 68 TGGGTCTGTGCTTGCTGTGCGGT OBD168-835 CCTGCCTGTCTGTCTGGAGAAGA 69 TGGGGCAACCTCACCAGCTTGGT OBD168-1831 AGGCCTTTCCGCCGCCCAGAGAG 70 CAG CAGTGGGTTCTCAAATGTTAG C A OBD168-479 G CTGTCTTG CTG CTG ATAG CCTTTA 71 AGTGATCTGTCTGCCTCGGCCT OBD168-1879 GTAAAGTGGTATGATCTTGGCT 72 GGGACCTTTGAACCACATTTGGAGGG OBD168-667 CAGGGATTTCTGAGGACAAGACATCT 73 TCGGGCGCTTCCGGGGAGCTAGGCC OBD168-1767 GGGCACCAAAATGATTAAGGACATT 74 TGACCAAGAGTGAGCCAAGCCCC OBD168-1047 GCCCTTACTGACTGCCAGGAAAC 75 CTG AACTGTCGTCACTG GTG CTGTG OBD168-763 CCTACAAGCCAGAAGGGATTGAGAAT 76 CTGGAAGAGACAGAGCCCACACA OBD168-1199 CGCAGCCCTTCCAAGCCTCAGAA 77 AAACTAGGAAAAGAGAAATAGAACA OBD168-1979 GCTGTGGCGGTCCCTTGGTGGGGAA 78 CAGCCTGTAGCAATTGTCCTG OBD168-1883 AGGTTCAAGCGATTCTCCTGC 79 CAGCAGTGGGTTCTCAAATGTTAGCA OBD168-615 GTCCTCTCTACAAGACAATAGGCAGC 80 TAGATAGAAGCAATGTCAGAAAC OBD168-1919 ATATCGTTTTCCTGAGTAATAGT 81 AGTCCAAAGCTTCGGGAGAAG OBD168-1715 GTCAGGAAAAGAGAGGTAAAT 82 TAGAGAAGAGAGGACTCTCCCTA OBD168-1659 CCGATTAGATACCTGATCATTTA 83 TCCACAGGGAAAGAGAATCCCTCG OBD168-1899 CCTGACGAAGCAGGGGCGGGGCGA 84 GGAGGGAGGATGGGGGATGAA OBD168-1499 AAGTAG CATG CACAG GTTCCA 85 TTCATTCCAGCCCTCCACGCCCTAAT OBD168-1111 G CCAATAC ATTC AG G AAAC ACAG G CA 86 GAGTGCTGAAACTTCCTTTTCTTCT OBD168-1443 GGGCATGGGCCCCTCGTCCCCTCGT 87 GACTGAGCAACATAAGGAGACCCGTC OBD168-819 GAGAAAGGAAATGGGACAGAAGCAAT 88 GACTCTCAGGCACAGAGGCAAAAAA OBD168-1803 AACAGATTTTAAAACGTGTCTCATG 89 AGTGTGTGCCCAGGTGAGAGACCATT OBD168-463 GGCAGACGATACATTTCCAGATAGTT 90 AGGTTGGTGTGGCCCCTGAAGACA OBD168-1579 CTGTCCCAGAAAAAAGAAAAATCC 91 GGGAAGGAGGAGTGGAAACGGAA OBD168-1207 AAGCGGAGCCTGGAGCATCTCGT 92 CTTGAAGGCGGATTCCTCCAGGT OBD168-1219 AGCAGGCACGGAACACAGTGGTG 93 AGCTCACTGCAACCTCTGCCTCCCC OBD168-2095 GTTCTGCTGGGGGCAGGCCAGGGGA 94 GGTGCCACTGCCTTGGTTCCTGT OBD168-863 G GTCCCTG CCAAACTG G AAACG A 95 CACAG GTTGAAAGTGAAAATT OBD168-2107 GGTGCTGTACCAAAGTACCAC 96 GGATAAAGCACAGGATGCCCCAGTTA OBD168-711 CGGAAGTCCTACCCAAGCAATCAT 97 GCTTCCTGAGTCTTCATCACAAAACC OBD168-1231 GCCACTGTGCTCAATCTGCGTTCTGA 98 CCAGGTTCAGACACAGTGCCCAC OBD168-695 TCGGCTACGCTGCCACTTCAATG 99 CAGACTATGTGCCTCAAAGACAGTGC OBD168-1055 CAGAAGGGTGAGGACAAAGAGATAGC 100 GCCATGAGAAACACAAACGACT OBD168-1851 GGTGGCTCACACCTGTAATCCC Table 3.b7 52 OBD168-ql265 CTTCCTGTCATCTCTGTGGCTCTCAGCA OBD168-ql267 53 OBD168-qll93 CGGTCCCCGTG CTGAGATG G AG AACCTG OBD168-qll95 54 OBD168-q853 GGAGAGTTTCTGTTCAAAGGGTGTAGAG OBD168-q855 05 03 25 55 OBD168-ql689 CCCCTCTCCTACTAGGAAATAAG OBD168-ql691 56 OBD168-ql089 GTGATGATGGTTCTCCTGCTCCGTGTCC OBD168-ql091 57 OBD168-q625 GGCTGCCCCACGGCTACAGAAGGC OBD168-q627 58 OBD168-q2101 CCCAAAGGCATTTTGGAGAAT OBD168-q2103 59 OBD168-q821 GACAGCAGTGGGTTCTCAAATGTTAGCA OBD168-q823 60 OBD168-ql865 GAGCCTAGGAGTTTGAGACGAGT OBD168-ql867 61 OBD168-q945 GCAGCAAAGCATTCAAGAGTTACCTGGC OBD168-q947 62 OBD168-ql845 CAGGCGTTCCGAGGGCCAGAG OBD168-ql847 63 OBD168-ql569 TGTGAGGACATAGTAAGTATA OBD168-ql571 64 OBD168-ql589 CCCG G GTTCAG GTG ATTCTCC OBD168-ql591 65 OBD168-qll49 CCCCTGCCCTTCTGCCTGGTCTC OBD168-qll51 66 OBD168-qll69 GCTTGCTTGAAGGCGGATTCCTCCAGG OBD168-qll71 67 OBD168-q473 AGGCTGTGAGGTTGTCCTTTACTGC OBD168-q475 68 OBD168-q833 TCCTGGGTCTGTGCTTGCTGTGCGGTGG OBD168-q835 69 OBD168-ql829 ACCTCACCAG CTTGGTCTCTTTGT OBD168-ql831 70 OBD168-q477 GACAGCAGTGGGTTCTCAAATGTTAGCA OBD168-q479 71 OBD168-ql877 GACCTCAAGTGATCTGTCTGCCTCGG OBD168-ql879 72 OBD168-q665 CATTGCCCCTGGTGCGACCTGCCCC OBD168-q667 73 OBD168-ql765 GCTTCCGGGGAGCTAGGCCTC OBD168-ql767 74 OBD168-ql045 TGGGTGCGGCGACAGGCTCATCTGCGAT OBD168-ql047 75 OBD168-q761 CGTCACTG GTG CTGTGGTG CCCG OBD168-q763 76 OBD168-qll97 ACCTG G AAG AG ACAGAGCCCACACACG G OBD168-qll99 77 OBD168-ql977 AGTGTCTCACAAAACTCAAGGAAA OBD168-ql979 78 OBD168-ql881 GTCCTGCCTTAGCCTCCTGAGTAG OBD168-ql883 79 OBD168-q613 GACAGCAGTGGGTTCTCAAATGTTAGCA OBD168-q615 80 OBD168-ql917 AGGACTACGGTGAAAAAGGAA OBD168-ql919 81 OBD168-ql713 AGCGGTCCCCCTGAGTCCAAAGCTT OBD168-ql715 82 OBD168-ql657 GAAATGGTGCTTTGGTGCTTAGAT OBD168-ql659 83 OBD168-ql897 GTCTCATTTTCTACCCTCCACA OBD168-ql899 84 OBD168-ql497 GGGCCCCAGGTCAGTGTGGGCTC OBD168-ql499 85 OBD168-qll09 GCGGTCTGACAGCCCCACCTGCC OBD168-qllll 86 OBD168-ql441 GGGGCTGGGAGAGAGGAAGAGATTAT OBD168-ql443 87 OBD168-q817 GCCAGGGAGTTGGGAAGTGTGGGAAG OBD168-q819 88 OBD168-ql801 ATTTGTTGAGCATCTACTCTTTG OBD168-ql803 89 OBD168-q461 AGTGTGTGCCCAGGTGAGAGACCATT OBD168-q463 90 OBD168-ql577 GGAGGTACCTCAACAGCTCCTCAG OBD168-ql579 91 OBD168-ql205 CGTCACTG GTG CTGTGGTG CCCG OBD168-ql207 92 OBD168-ql217 GCTTGCTTGAAGGCGGATTCCTCCAGG OBD168-ql219 93 OBD168-q2093 G ATG G AGTCTCACTCTGTCAC OBD168-q2095 94 OBD168-q861 CTTTGGTGCCACTGCCTTGGTTCCTGTT OBD168-q863 95 OBD168-q2105 AAAAAACACTTCCAAAGCTTTTCACC OBD168-q2107 96 OBD168-q709 CACACGCATCCCTGCTCCCATTCTGAG OBD168-q711 97 OBD168-ql229 GCAGTTGGCTTCAGACGGGCAGACAGGG OBD168-ql231 98 OBD168-q693 TGTCCAGGAACAGGAAGTTTCAGAGGGC OBD168-q695 99 OBD168-ql053 CTCAGACTATGTGCCTCAAAGACAGTGC OBD168-ql055 100 OBD168-ql849 CAAGAGCCAAAGGATCAACACC OBD168-ql851 Table 3.b8 05 03 25 52 CTGCTGCTGCCTCCATCCTCCTCC OBD168-pl265 53 CGGGCAGAGAGCCAGGGTGAAGC OBD168-pll93 54 GCCCCTTCTCCTTCCCACCATTCCC OBD168-p853 55 CTCACAAACAGACTGAAAAAATA OBD168-pl689 56 CTGCTCCTCTGCCTGCCTTGTAGTCTC OBD168-pl089 57 GTTACACCTTGCTGCTTGCCAACAGTG OBD168-p625 58 ATTAGTTTTCCAGGGGTGCTG OBD168-p2101 59 GCTGTCATCTAAGCCTCCATTCATAACT OBD168-p823 60 taaaaatacaaaaattag cttg g OBD168-pl865 61 ACTTGGTGAGGCTGGAGGAGGAGGGC OBD168-p945 62 GGAGTACTAGTAGATACAAGA OBD168-pl845 63 GCAGGTAGGGGTGTGGGAGGG OBD168-pl569 64 TGAGACAGAGTCTTGTGCTGT OBD168-pl589 65 GCCCAAATCCCAGCACTCACCACACGGC OBD168-pll49 66 GCTCCTGCTCATCATCTCCCCAGTGG OBD168-pll69 67 ATCGTCCACAGCCCCTGG GTCG G OBD168-p473 68 GCTGCCTGGTGCTGAACTGGTGGG OBD168-p833 69 GGCTCTGCCCAGCCCCTACCCACG OBD168-pl829 70 GCTCCTGGCTGTCTTGCTGCTGATAGC OBD168-p479 71 ACTCTGTTGCCCAGGCTGGAGTAAAG OBD168-pl877 72 GCAGGCATAACCAGGGATTTCTGAGGAC OBD168-p665 73 CAAAATGATTAAGGACATTAA OBD168-pl765 74 CTCCCACCCATACCTCTTCTGCTGGAC OBD168-pl045 75 GCAAGAAGGACCTCACCGCAACTAT OBD168-p761 76 GCCTCG CAGCCCTTCCAAG CCTCAG AA OBD168-pll97 77 CCCGCCGTCTGCCCACTCCTCTAG OBD168-pl977 78 AAGATCTTGGCTCGCTACAACCTC OBD168-pl881 79 CCTCTCTACAAG ACAATAG G CAG CATCT OBD168-p615 80 GTTTTCCTGAGTAATAGTTAC OBD168-pl917 81 GTATTGATGTGTGATGAATAAATTG OBD168-pl713 82 TTTACCGATTAGATACCTGATCAT OBD168-pl657 83 GAAGCAGGGGCGGGGCGAGAGG OBD168-pl897 84 TAGCATGCACAGGTTCCAGGGAT OBD168-pl497 85 TGCCACTATCAACCTGACACCAAAGCCA OBD168-pll09 86 GCGCTCCTGCCCTGGGGCCTCGTCTT OBD168-pl441 87 CCGCTAAAGAGAGGAAAAGTGAACTGGA OBD168-p817 88 TTAACAATATTCTTTCTTGAAAT OBD168-pl801 89 CGATACATTTCCAGATAGTTTTGTGGCA OBD168-p461 90 GAGTGAGACCCTGTCCCAGAAAAA OBD168-pl577 91 CAAGCGGAGCCTGGAGCATCTCGTGAGG OBD168-pl205 92 CCCAGGCTCTCTCCATCGCACCTTCTGC OBD168-pl217 93 GGGGGCAGGCCAGGGGACAGG OBD168-p2093 94 GAAACTGGTCCCTGCCAAACTGGAAACG OBD168-p861 95 CTGGATATTTATACAAGAGACTGGAT OBD168-p2105 96 GGCACAGGAGGAACATACCAAAACATAC OBD168-p709 97 TCGTGTCTCACTGCCGCTTCCACCTC OBD168-pl229 98 CGCTCCCCTCGGCTACGCTGCCAC OBD168-p693 99 GGGTGCCCAGTCTGCCACAACCTGTC OBD168-pl053 100 GTGGCTCACACCTGTAATCCCA OBD168-pl849 Table 3.b9 05 03 25 52 AGTACATATCGAGAATGGGCATCTCTACCCTTGTTAGG OBD168-pl267 53 ATTTATTCGAGCCGCTTGAGCATAGAGCTTATGGAGATG OBD168-pll95 54 ATAGCTCCAGATCGAGTCTGAGGAGTGAGCGG OBD168-p855 55 TCTCTCTC1 1 1 1 1 1 1 1 1 1 1 CGAGATCCTTAGGGGACCTTG OBD168-pl691 56 TCAAACAGTCGAACAATTCTTCTGCCTCAGCCTCCC OBD168-pl091 57 TGGCTTCTTCTTAACTTTCTCGGGTGAGTCGAAGAGC OBD168-p627 58 AGAGGGGCCCAGGGAACCTCGAATCTTCTGAGGGAGCGTG OBD168-p2103 59 ACCTTCGATACTTCCCCTGGGTGACTCTGACAG OBD168-p821 60 AGAGAATCACCTGAGCCTTCGAGTTGCAAAI1 1C1G1111 OBD168-pl867 61 AAAAGGCCTCGACCCTTGCACGGGCGCA OBD168-p947 62 TGGGGCAGGCTTGGCCTGTCGACACCAATGTCTTGGATGT OBD168-pl847 63 GATGGGTTATCCAACTCCTCGAAAGCTTTCTTTTCTAAGC OBD168-pl571 64 ATGTTGGCCAGGATGGTCTCGAGATCAGCCTGGTCAACAT OBD168-pl591 65 TGCCAGGCACGAACATGGTCACTCGAAATTACGTG OBD168-pll51 66 ACACCACCGTTGGGATGAAAGATGGCCTCGATACA OBD168-pll71 67 AATGGCACTCGAGCTCTACAGCCAGTACCTGG OBD168-p475 68 ACTAGTCCCGCTTGCTTCGATGCCTGGGCT OBD168-p835 69 CCGGGCTCAGCGTCCTTGTCGAAACCGAAAGCAAAGAGGA OBD168-pl831 70 AGCACAATCGATACTTCCCCTGGGTGACTCTGAC OBD168-p477 71 ATGTTGGCCAGGCTGGTCTCGAGACCAGCCTGGGCCAACA OBD168-pl879 72 TCCTCTG CCCATCTTCG ATG GTTTTCCATG ACG ATTG OBD168-p667 73 ACAGCCCCAGCCTCGGAATCGACCTCAGCTTCATTCTTCT OBD168-pl767 74 AGCAGCCTCTGCTCTGCCCACCTCGAAGCTT OBD168-pl047 75 AGGCCATGTTTTGGAGACAGTGATCGAGCATTTC OBD168-p763 76 TTTGCTGTGAGTAGAGGATGTCGAGGGCTGGG OBD168-pll99 77 ACCACCCTGCCAAGTACCTCGACTCGGGTTCTTCCCTGCA OBD168-pl979 78 ATGTTGACCAGGCTGGTCTCGAGACCAGCCTGGCAAACAT OBD168-pl883 79 TCTAGTCGATACTTCCCCTGGGTGACTCTGACAG OBD168-p613 80 TAGCTTTGAGGATTTCGTTCGAATTTTAAGCTCCACAAAT OBD168-pl919 81 CCACGAGGTTCCCCGGCCTCGAGGTGTCAGATATTTTTCT OBD168-pl715 82 TTATGTGCAATTGTAACTTCGATGCCAGAGAGGGAGCTCG OBD168-pl659 83 GAATGGGTGGAGTCCAAGTCGACTCCAAAACCCTAAAACA OBD168-pl899 84 ATGTTTTGGAGACAGTGATCGAAGTTTGTGCTCTTTGTGA OBD168-pl499 85 AGGCCTGGGAATAGGGAAACGGTTCGATTTGG OBD168-pllll 86 TTGGCTGCTCTTTTACACTCGAGCCAGCGAAAAGACAGAA OBD168-pl443 87 TCGTGTCTCGATTTTCCAGCAGTGTGCCTGGAG OBD168-p819 88 AACGGTTGGATGAGGGACTCGAGTATAGCATTCAATTGCT OBD168-pl803 89 AGAATCAAATTCTCGACCAGCTTGGCCCCATCTAAAG OBD168-p463 90 AG AAG AG ATATTCCTTCATCG ACTG GTCACGATGGG CTG C OBD168-pl579 91 AGGCCATGTTTTGGAGACAGTGATCGACAGATCTCC OBD168-pl207 05 03 25 92 ACCGTTGGGATGAAAGATGGCCTCGAGCTGGT OBD168-pl219 93 AGGTTGGCCATGCTGGGTTCGAGAGCAGCCTGGGCAACAC OBD168-p2095 94 TTCTTGCTTTCTTGCTTTCTTTCTTGCTTTCGATAACCTG OBD168-p863 95 GAAAACCATTTGGCCTTTTCGAATCTTCTGAGGGAGCGTG OBD168-p2107 96 TCTCTCTCTCTCTCTCGAACTCCTGACTTCGGC OBD168-p711 97 ACTGCGTGTTCCCAGCACCCTCGATTCCATCT OBD168-pl231 98 AGGTGGCAAAACTCGAAAGAACAGCAGCTCGCG OBD168-p695 99 TTTTGTTCGACCCTTCTGCTTTCTCTCCAGGG OBD168-pl055 100 TCTAGCATATGGGTAGAGTCGACCTCTCTGGGCTCAGGTG OBD168-pl851 Table 3.bl0 52 TGCCCATTCTCGATATGTACTTCTTCCCCTCTGAGG ORF1_22_41776313_41777375_42031915_42033846_RF 53 AGCGGCTCGAATAAATAAATAAATATGCCAGGCGCAGTG ORF1_2_10016688_10020163_10069588_10070662_RF 54 TTCCCGCTCACTCCTCAGACTCGATCTGGAG ORF1_7_41457346_41461355_41488360_41491403_FF 55 CAAGGTCCCCTAAGGATCTCGAAAAAAAAAAAGAGAGAGA ORF1_7_135917157_135920025_136070982_136076106_FR 56 TGGGAGGCTGAGGCAGAAGAATTGTTCGACTGTTTG ORF1_6_134102628_134113539_134393136_134395072_RF 57 TGGGCTCTTCGACTCACCCGAGAAAGTTAAGAAGAAG ORF1_17_27740779_27745632_27849258_27851150_FR 58 CACG CTCCCTCAG AAG ATTCG AG GTTCCCTG GGCCCCTCT ORF1_X_39624253_39627672_39748652_39756826_RR 59 CTGTCAGAGTCACCCAGGGGAAGTATCGAAGGT C)RFl_21_29066989_29073149_29092829_29094361_RF 60 AAAACAGAAATTTGCAACTCGAAGGCTCAGGTGATTCTCT ORF1_17_35363623_35366998_3557815O_3558O887_FF 61 AGGGTCGAGGCCTTTTCCCCATTGTCTTGGCT ORF1_2_129732845_129738418_129813191_129815478_RF 62 ACATCCAAGACATTGGTGTCGACAGGCCAAGCCTGCCCCA ORF1_15_90688752_90691260_90881362_90884735_RF 63 GCTTAGAAAAGAAAGCTTTCGAGGAGTTGGATAACCCATC ORF1_2_166059673_166070002_166163002_166177651_RF 64 ATGTTGACCAGGCTGATCTCGAGACCATCCTGGCCAACAT ORF1_22_23665784_23673822_23711932_23713O61_FR 65 TCACGTAATTTCGAGTGACCATGTTCGTGCCTGGC ORF1_1_53182248_53184895_53364674_53371789_RF 66 TGTATCG AG GCCATCTTTCATCCCAACG GTG GTG ORF1_20_50280026_50281924_50437155_50439548_FF 67 TCCAGGTACTGGCTGTAGAGCTCGAGTGCCAT ORF1_17_20844189_20846843_20895269_20898565_RF 68 AGCCCAG GCATCG AAGCAAG CG G G ACTAGT ORF1_19_19361989_19364321_19458777_19462243_RF 69 TCCTCTTTGCTTTCGGTTTCGACAAGGACGCTGAGCCCGG ORF1_14_67469788_67473491_67514914_67519335_FR 70 GTCAGAGTCACCCAGGGGAAGTATCGATTGTGCT ORF1_21_29039171_29043861_29092829_29094361_RF 71 TGTTGGCCCAGGCTGGTCTCGAGACCAGCCTGGCCAACAT ORF1_19_4252394_4257822_4335234_4339292_FF 72 ACCATCGAAGATGGGCAGAGGATATGAAGTGAGCC ORF1_8_41806799_41808430_41845432_41849175_RF 73 AGAAGAATGAAGCTGAGGTCGATTCCGAGGCTGGGGCTGT ORF1_11_47655428_47658417_4771381O_47715533_RF 74 AAGCTTCGAGGTGGGCAGAGCAGAGGCTG ORF1_1_3073908_3076056_3169997_3177404_FF 75 ATGCTCGATCACTGTCTCCAAAACATGGCCTTATCACC ORF1_19_41422837_41424323_41692451_41693876_RR 76 AGCCCTCG ACATCCTCTACTCACAG CAAAG G G ORF1_9_134315578_134321630_134391769_134398405_RF 77 TG CAG G G AAGAACCCG AGTCG AG GTACTTG GCAGGGTG GT ORF1_3_32625993_32627699_32683326_32685449_FF 78 ATGTTTGCCAGGCTGGTCTCGAGACCAGCCTGGTCAACAT 0RFl_19_4264058_4265818_4341821_4342968_FR 79 CTGTCAGAGTCACCCAGGGGAAGTATCGACTAGA ORF1_21_29092829_29094361_29164018_29174520_FF 80 ATTTGTGGAGCTTAAAATTCGAACGAAATCCTCAAAGCTA ORF1_2_91859O85_91863356_92122473_92125698_RF 81 AG AAAAATATCTG ACACCTCG AG GCCG G G G AACCTCGTGG ORF1_X_20268599_20270341_20456973_20459740_RR 82 CGAGCTCCCTCTCTGGCATCGAAGTTACAATTGCACATAA ORF1_6_29844477_29850988_29921307_29925901_FF 83 TGTTTTAGGGTTTTGGAGTCGACTTGGACTCCACCCATTC ORF1_19_53278181_53279831_53467555_5347O239_FR 84 TCACAAAGAGCACAAACTTCGATCACTGTCTCCAAAACAT ORF1_19_41422837_41424323_41672917_41678O14_RR 85 ACCAAATCG AACCGTTTCCCTATTCCCAG G CCTAG ORF1_5_690177_692906_744214_749963_FR 86 TTCTGTCTTTTCGCTGGCTCGAGTGTAAAAGAGCAGCCAA ORF1_17_43300561_43304860_43406585_43411982_RF 87 TCCAGGCACACTGCTGGAAAATCGAGACACGATC ORF1_15_62681808_62691633_62730771_62732716_RR 88 AGCAATTGAATGCTATACTCGAGTCCCTCATCCAACCGTT ORF1_12_47686852_47690553_47817317_47827238_RF 89 CTTTAGATGGGGCCAAGCTGGTCGAGAATTTGATTCT ORF1_Y_18283408_18293202_18412555_18418411_RR 90 GCAGCCCATCGTGACCAGTCGATGAAGGAATATCTCTTCT ORF1_2_218162078_218164150_218253352_218257050_FF 91 TCTGTCGATCACTGTCTCCAAAACATGGCCTTATCACC ORF1_19_41422837_41424323_41597548_41599628_RR 92 ACCAGCTCGAGGCCATCTTTCATCCCAACGGT C)RFl_20_50280026_50281924_50309417_50313312_FR 93 GTGTTGCCCAGGCTGCTCTCGAACCCAGCATGGCCAACCT ORF1_9_70371691_70373189_70454780_70468182_RR 94 AGGTTATCGAAAGCAAGAAAGAAAGCAAGAAAGCAAGAAG ORF1_5_75205085_75210191_75236091_75239565_FR 95 CACGCTCCCTCAGAAGATTCGAAAAGGCCAAATGGTTTTC ORF1_X_39735882_39738523_39748652_39756826_FR 96 AGCCGAAGTCAGGAGTTCGAGAGAGAGAGAGAG ORF1_11_10637008_10641060_10871146_10872290_FR 97 AGATGGAATCGAGGGTGCTGGGAACACGCAGT ORF1_20_63754820_63756674_63899802_63901328_FF 98 TCG CG AG CTGCTGTTCTTTCG AGTTTTG CCACC C)RFl_4_102249197_102251493_102344820_102348626_FR 99 TCCCCTGGAGAGAAAGCAGAAGGGTCGAACAAAA ORF1_1_161657362_161661864_161734762_161740896_RF 100 CACCTGAGCCCAGAGAGGTCGACTCTACCCATATGCTAGA ORF1_16_8770523_8772703_8938508_8943672_RF Table 3.bll 05 03 25 52 OBD168-1265.1267 OBD168-ql265.ql267.pl265 / pl267 53 OBD168-1193.1195 OBD168-qll93.qll95.pH93 / pll95 54 OBD168-853.855 OBD168-q853.q855.p853 / p855 55 OBD168-1689.1691 OBD168-ql689.ql691.pl689 / pl691 56 OBD168-1089.1091 OBD168-ql089.ql091.pl089 / pl091 57 OBD168-625.627 OBD168-q625.q627.p625 / p627 58 OBD168-2101.2103 OBD168-q2101.q2103.p2101 / p2103 59 OBD168-821.823 OBD168-q821.q823.p823 / p821 60 OBD168-1865.1867 OBD168-ql865.ql867.pl865 / pl867 61 OBD168-945.947 OBD168-q945.q947.p945 / p947 62 OBD168-1845.1847 OB D 168-q1845.q 1847. p 1845 / p 1847 63 OBD168-1569.1571 OBD168-ql569.ql571.pl569 / pl571 64 OBD168-1589.1591 OBD168-ql589.ql591.pl589 / pl591 65 OBD168-1149.1151 OBD168-qll49.qll51.pH49 / pll51 66 OBD168-1169.1171 OBD168-qll69.qll71.pH69 / pll71 67 OBD168-473.475 OBD168-q473.q475.p473 / p475 68 OBD168-833.835 OBD168-q833.q835.p833 / p835 69 OBD168-1829.1831 OBD168-ql829.ql831.pl829 / pl831 70 OBD168-477.479 OBD168-q477.q479.p479 / p477 71 OBD168-1877.1879 OBD168-ql877.ql879.pl877 / pl879 72 OBD168-665.667 OBD168-q665.q667.p665 / p667 73 OBD168-1765.1767 OBD168-ql765.ql767.pl765 / pl767 74 OBD168-1045.1047 OB D 168-q 1045.q 1047. p 1045 / p 1047 75 OBD168-761.763 OBD168-q761.q763.p761 / p763 76 OBD168-1197.1199 OBD168-qll97.qll99.pH97 / pll99 77 OBD168-1977.1979 OBD168-ql977.ql979.pl977 / pl979 78 OBD168-1881.1883 OBD168-ql881.ql883.pl881 / pl883 79 OBD168-613.615 OBD168-q613.q615.p615 / p613 80 OBD168-1917.1919 OBD168-ql917.ql919.pl917 / pl919 81 OBD168-1713.1715 OBD168-ql713.ql715.pl713 / pl715 82 OBD168-1657.1659 OBD168-ql657.ql659.pl657 / pl659 83 OBD168-1897.1899 OBD168-ql897.ql899.pl897 / pl899 84 OBD168-1497.1499 OBD168-ql497.ql499.pl497 / pl499 85 OBD168-1109.1111 OBD168-qll09.qllll.pll09 / pllll 86 OBD168-1441.1443 OB D 168-q 1441.q1443. p 1441 / p 1443 87 OBD168-817.819 OBD168-q817.q819.p817 / p819 88 OBD168-1801.1803 OBD168-ql801.ql803.pl801 / pl803 89 OBD168-461.463 OBD168-q461.q463.p461 / p463 90 OBD168-1577.1579 OBD168-ql577.ql579.pl577 / pl579 91 OBD168-1205.1207 OBD168-ql205.ql207.pl205 / pl207 92 OBD168-1217.1219 OBD168-ql217.ql219.pl217 / pl219 93 OBD168-2093.2095 OBD168-q2093.q2095.p2093 / p2095 94 OBD168-861.863 OBD168-q861.q863.p861 / p863 95 OBD168-2105.2107 OBD168-q2105.q2107.p2105 / p2107 96 OBD168-709.711 OBD168-q709.q711.p709 / p711 97 OBD168-1229.1231 OBD168-ql229.ql231.pl229 / pl231 98 OBD168-693.695 OBD168-q693.q695.p693 / p695 99 OBD168-1053.1055 OBD168-ql053.ql055.pl053 / pl055 100 OBD168-1849.1851 OBD168-ql849.ql851.pl849 / pl851 Table 3.bl2 05 03 25 Probe gene.index RP / Rsum 1 ORF VI16124345061246026^61790 FR 65 683.7987722 2 ORFl_3_18693806_18695229_18731498_18743005_FR 121 1311.207619 3 ORF1_2_118112112_118113416_118185366_118187110_FR 42 424.4713289 4 ORF1 17 27395089 27399400 27471513_27474666_R R 123 1345.935183 5 ORF1_12_131862265_131863764_132122269_132123632_RF 192 1895.333542 6 ORFl_12_121447890_121451709_121468997_121471919_F F 64 676.3740979 7 ORF1_14_81120330_81122262_81268937_81270783_RF 225 2139.947545 8 ORFV13_45338339_45340076_45393094_45398989_FR 247 2241.882572 9 ORFV12_5915876_5919160_6152139_6154132_FF 95 973.1243446 10 ORF1_16_9911562_9916434_9954809_9955829_RF 204 2003.48294 11 ORF1_22_16907330_16914217_17087415_17089015_RR 189 1885.344261 12 ORF1_9_131999122_132006607_132139741_132142158_FR 216 2077.891178 13 ORF1_12_5915876_5919160_6059110_6067436_F F 112 1190.76143 14 ORF1_19_52960383_52965476_52976109_52979684_FR 105 1105.727185 15 ORFW229299065^229300173^22950687V229512794^FR 224 2125.739433 16 ORF1J6J8252588J8255195J8400348J8402976^RR 274 2399.456066 17 ORFV2_111366352_111370512_111529947_111533147_FF 282 2454.310373 18 ORFl_5_55186470_55190634_55308382_55310405_FR 119 1277.819011 19 ORF1_7_2130888_2136507_2376124_2377913_F F 308 2576.79482 20 ORF1_12_109959287_109961500_109999941_110004320_FF 292 2522.263056 21 ORFl_5_148804534_148807399_148901266_148906110_R F 315 2610.322544 22 ORF1_2_174610120_174616390_174648154_174652062_RR 205 2020.977518 23 ORFV17_43832124_43833485_43905109_43906650_FF 273 2395.722643 24 ORFV4J74078231J74079386J741179UJ7412514VFR 284 2461.265909 05 03 25 25 ORF TV165949 36303183 36304407 R F 260 2319.480175 26 ORF1_5_124631740_124634000_124857558_124858678_FR 269 2362.930803 27 ORF1 6 86970655 86977787 87154540_87156275_R R 335 2708.303887 28 ORF1_4_38133158_38135017_38161792_38166364_RF 158 1684.416661 29 ORFl_l_42817616_42818863_42949613_42952408_FF 156 1670.587608 30 ORF1_10_44948033_44949598_44963508_44966433_RR 215 2075.653386 31 ORFV1V75155500 75159840 7^ 319 2622.075007 32 ORFW151547581^151552501J51755108J51762446^RF 317 2616.065515 33 ORF VV49053496_49056424_49286142_49288605_RF 214 2072.613711 34 ORF1_1l_61243450_61246026_61472770_61474691_FR 173 1776.408098 35 ORF1_14_81530269_81532452_81602546_81604597_FF 313 2604.836014 36 ORF1_14_74588744_74593680_74780483_74782393_FF 374 2923.537449 37 ORFl_2_27481760_27484387_27626184_27635183_R F 281 2452.218225 38 ORFl_18_10287457_10291556_10505933_10507774_FF 382 2969.774836 39 ORFVV109681178J09683602^109788010J09790308JF 352 2769.148458 40 ORF VI19504057595045594^91653 FF 145 1598.706819 41 ORF1667458946 18926983650^6^ R 324 2654.348688 42 ORF1_6_113632952_113639716_113727754_113732296_RF 345 2749.196717 43 ORF1_11_61224624_61227200_61388261_61391790_FR 193 1898.912573 44 ORFl_10_91056658_91062643_91164372_91168358_R F 174 1780.548073 45 ORFl_2_102100064_102105009 102374574 102377537 F R 207 2033.960539 46 ORF1_11_17097711_17100441_17188135_17191681_RR 322 2640.403311 47 ORFW199677018^19968384V199811400^199820398^RR 395 3048.106352 48 ORFVV100090606J00091968J00119089J00121546^RR 410 3137.941194 49 ORFl_12_7868599_7870934_7932397_7933511_F F 201 1979.138215 50 ORF1_7_87727621_87737484_87868535_87872727_FF 339 2722.114145 Table 4.al FC:(classl / class2) Pfp P.value Type 1 -1.880110497 0.586539786 0.000270132 Late SSc 2 -1.799608311 1.03860777 0.000890435 Late SSc 3 -1.780583699 0.371293764 0.000110492 Late SSc 4 -1.667670091 1.071320657 0.000933662 Late SSc 5 -1.602310181 1.272773307 0.00173148 Late SSc 6 -1.594316169 0.583773394 0.000264722 Late SSc 7 -1.585703511 1.35013943 0.002152417 Late SSc 8 -1.56216833 1.336623574 0.002339221 Late SSc 9 -1.556271307 0.768375125 0.000517204 Late SSc 10 -1.555096184 1.323326956 0.001912769 Late SSc 11 -1.540705079 1.280763297 0.001715126 Late SSc 12 -1.538681271 1.334213022 0.002041946 Late SSc 13 -1.536705015 0.941892109 0.000747454 Late SSc 14 -1.536449321 0.877882311 0.000653117 Late SSc 15 -1.527220454 1.340092929 0.002126906 Late SSc 16 -1.52149253 1.360282508 0.002640857 Late SSc 17 -1.519473048 1.376054571 0.002749477 Late SSc 05 03 25 18 -1.503923716 1.007768197 0.000849714 Late SSc 19 -1.502514474 1.374072688 0.002998649 Late SSc 20 -1.502130011 1.39520081 0.002886588 Late SSc 21 -1.50156792 1.374806784 0.003068439 Late SSc 22 -1.500042403 1.337558365 0.001942817 Late SSc 23 -1.496149497 1.361478188 0.002633532 Late SSc 24 -1.494024976 1.373274177 0.002763382 Late SSc 25 -1.492254542 1.349373491 0.002485826 Late SSc 26 -1.482938536 1.348160178 0.002569562 Late SSc 27 -1.48249355 1.380279235 0.00327625 Late SSc 28 -1.482383403 1.250937648 0.001400419 Late SSc 29 -1.47881757 1.248294422 0.001379771 Late SSc 30 -1.477514304 1.337834051 0.002038008 Late SSc 31 -1.475489797 1.368461872 0.003093062 Late SSc 32 -1.473695833 1.371485397 0.003080461 Late SSc 33 -1.473125886 1.34056185 0.002032665 Late SSc 34 -1.47310541 1.257251246 0.001541109 Late SSc 35 -1.472213708 1.378421017 0.003056972 Late SSc 36 -1.467917288 1.416119903 0.00375264 Late SSc 37 -1.467652572 1.378853794 0.0027453 Late SSc 38 -1.467315677 1.425572936 0.003858496 Late SSc 39 -1.4669037 1.36651033 0.003408167 Late SSc 40 -1.464113123 1.240602908 0.001274577 Late SSc 41 -1.462599528 1.37698371 0.003161106 Late SSc 42 -1.457734612 1.37644207 0.003364669 Late SSc 43 -1.456367968 1.270475422 0.001737356 Late SSc 44 -1.451682509 1.255271302 0.001547576 Late SSc 45 -1.446541214 1.339926641 0.001965245 Late SSc 46 -1.443313466 1.372615939 0.003131628 Late SSc 47 -1.442937935 1.443731983 0.004040629 Late SSc 48 -1.442059337 1.464295228 0.004253807 Late SSc 49 -1.441214801 1.313952351 0.001871289 Late SSc 50 -1.439270427 1.376378475 0.003306 Late SSc Table 4.a2 Probe sequence ..............".......'....... "*.................'oOmer g ,**'^*-—......................................................... 1 CCTGGCTCCTTCCTGTATTATGCTCCCTTCGAGAAGTAGAATATCTGAATGTTCTTATAT 2 TGGACTGGGCTAATGTGGAAAGTGAGGATCGAGAATGAAGAAGGAACAGTCACGAAGGGA 3 TATTTAI 1 11IAI11 1IATTTAI Illi 1 1CGATTGTGTTCACCAGGACGGCAGGCTATTA 4 CACATGGCTAAAAGGAAGACTGACAATTTCGAGCTTGGTGTGGTCAAGGGCCAGGAGGAG 5 TAATATTGGCTTTGGCTAATCAGAGATTTCGACAGGAGGATGGTGGGGAGGGGAGGCCAG 6 GGTGGGTAGATCACTTGAGGTCAGGAGTTCGAACTCCTGACCTCAAGTGATCCACGCCCA 7 GGAGGCAGAAGTTGTGGGCATGCTGAACTCGAGGAAATCCATTGACATGAAAAACGTCAA 8 TTCCTGCAGGTGATGGTTCATGACAATATCGACTGAGCTGCCAAGTATTTCATACATGGG 9 GAGTGTGATGAAGAAAAGTAAGGCAGGATCGATGAATTCTAGGGCATGTAAATGCTCAAG 05 03 25 10 GCGAATGAGCTCCCTGTGTCACACAGCATCGAGAGTCCTGAGCACCATCCCAATCCCTGT 11 TCTAGGCTTCAAGAGAGAGAATCCAATGTCGATTTAGCCTTCCATAACTATCCTCAGACA 12 AATGGTGTCTATAGCCAGG1 1 1 1 1G rAATCGAAGGACCCCTTGCTGGGGGCGCCTAAAGA 13 GAGTGTGATGAAGAAAAGTAAGGCAGGATCGAATATTTGCACATTTCTCGTTGACCCTTC 14 CTATAI 1 1 1ILALICACATCCCTAGTTATCGAGAACATCCTGGCTAATGTGATGAAACCC 15 ACGCTGAACTAATTGGGCTGAAGTATGGTCGAACAGGTTACGAGCATCAGCTGTTACATG 16 CATTGGTCACAATGGGTCACGTGCCTATTCGAGACCACCCAGCAAAGCCCCAAGGACACA 17 TGCACCTCTCTTTTGAATCCCTCCCCCATCGAGGTTAATCCCTCTCCACAGGGCGGCACC 18 AGAGAGAGTAACAAATACGAGGAGGGTTTCGATGTTACTGATTCTGTCCCCATCTTCGCG 19 ACTCTCTTACCCAAGTTTCCTAACAGGATCGACACCCAGGGTCATTCACACAACACGGCT 20 CTG AAG CC A ACACACG C AAAG G C AAAC GTCG AAACTG ATC ATTTAG G TTTTCCTTTTAAG 21 GTTTACAGACCTTGGATGCAGGCTCTTCTCGAGGGGAAAAAGGAGCAAGTTGGGAGGTGA 22 CCTGTGGCCTGATAAGGTATTGACCCCATCGAGATTTTATTAATTAGTGGCAGTCATAAT 23 AGGGGTGGACACCTGCTCAACAGAGAATTCGACCCCATCCTCTGGCCCTCAGTTCTGTCC 24 AGCCTCTTCCAACACTGAGGATCACAACTCGATGATATAATACTCTGCTGACTACATTTT 25 GGAGCTAAGATGACTAATTTGATGATTTTCGAACTCCTGACCTCGTGATCTTCCCACCTT 26 TCAAATGAGCATCCCCATTCTGTTTACATCGAGACCAGCCTGGCCAAAATGGTGAAAACC 27 TGCCAGCTTTTCTTGCCATTCTGGCCATTCGACAATATTGTTTTATTTTAGCATCAATTT 28 TGACTCACGAGGGAAGTGGTTGTTGACCTCGATTCCTCTCCTCTCAGTGACAACCAAAGA 29 Illi 1AAAAACCCTATACAAATGCTGATTCGACTGCATCAGCCTCTACGGGAATCTCCTC 30 ACATTCCACTTAACTGCAACTTGGCTTCTCGAATGTGGTAGCCACAGACTGCAGTCAGGA 31 AACTTGACAACCTGTAAGGGATTCTGAATCGACAGGGGAGAAAGTGCCGGCCCAGAGAAA 32 CATATACAGCCAGTCCCTGAGGAAGGAGTCGATGAAGGAAGAAAAGAGACGTGG1 1 1 1C1 33 GCACGATAI 1111GCAAGAGTAGACAAATCGAAGACCCGAGCCGGCGCTTGCGCACTTAG 34 CCTGGCTCCTTCCTGTATTATGCTCCCTTCGAGTATTCTTCTGGGTGTTTCTATGAGGAT 35 CAAATATTAAATAACTG CTAAAAGTGCTTCG AACTCCTG AG CTCAG GTGATCCACCCACC 36 TCAGTCTCACAAGCCATATTTCAAGTGCTCGAGAACCAAATAGCCTAAGTCAATAAAATA 37 AACAGTTGTCATCTATGTAATGGACACATCGAACTCCTGACCTTGTGATCAGCCCGTCTC 38 CACCAGGCCCAGGTTCTCGCAGAAAGGCTCGAACTTGCTAGACAAAGACTTTGAATCAGT 39 TTCATAGTGCCTGGAATGTAGTAGGATCTCGATTTGTATAATTTCAATTAAAACCATCCA 40 CTGCCTATCTTTGGCTCTAACCCACAGATCGAGAGATCAGGAAATATTTAGCTCAATCTT 41 AGCCAGAGGTCGTAAAACGATGATAGAATCGAACTCCTGGTCTCAAGTGATCCACCAGCC 42 CACGGAGGTCTTTTAAGCTTAGTTGGAATCGACCTTTCAGGCTCAAGCAATCCTCCCACC 43 CCTGGCTCCTTCCTGTATTATGCTCCCTTCGAGAAGTAGAATATCTGAATGTTCTTATAT 44 TGGGCAAAGAAAGATAAGGAAGGAGATTTCGATTTCTGGGCTTGGCCATTATCACCCTGG 45 CTGATAAAAGGTAACGTTATATTGTTTGTCGAGACCATGCTGGCTAATATGATGAAACCC 46 GGGTTTTGCCATGTTGGCCAGGCTGGTCTCGAGACCAGCCTGGCCAACATGGCGAAACCC 47 GGTGCTAGGAAGCAAGGATACTGCATTGTCGACTGCATTTCTGCCTTCGGGGGCTTGACC 48 AGGGTTCAACTTCAGAAAGAGGGGGCTCTCGAAGATCCCCGGGCAGCGCGAAAGGAGGTT 49 GGGGCCACATCCAATGTCTTCGTGATGTTCGAAGCACAAAGCTCACTTACTCCCGGAACG 50 AGTTTGCATAAGAGAAGAAATTAAI 1 1 1 ICGACCTCCCAAAGTGCTAGGATTACAAGCGT Table 4.a3 05 03 25 Probe Location liiStartl Endl IllllOiiii End2 1 11 61245995 61246024 61388263 61388292 2 3 18695198 18695227 18731500 18731529 3 2 118113385 118113414 118185368 118185397 4 17 27395091 27395120 27471515 27471544 5 12 131862267 131862296 132123601 132123630 6 12 121451678 121451707 121471888 121471917 7 14 81120332 81120361 81270752 81270781 8 13 45340045 45340074 45393096 45393125 9 12 5919129 5919158 6154101 6154130 10 16 9911564 9911593 9955798 9955827 11 22 16907332 16907361 17087417 17087446 12 9 132006576 132006605 132139743 132139772 13 12 5919129 5919158 6067405 6067434 14 19 52965445 52965474 52976111 52976140 15 1 229300142 229300171 229506873 229506902 16 16 18252590 18252619 18400350 18400379 17 2 111370481 111370510 111533116 111533145 18 5 55190603 55190632 55308384 55308413 19 7 2136476 2136505 2377882 2377911 20 12 109961469 109961498 110004289 110004318 21 5 148804536 148804565 148906079 148906108 22 2 174610122 174610151 174648156 174648185 23 17 43833454 43833483 43906619 43906648 24 4 74079355 74079384 74117913 74117942 25 1 36159279 36159308 36304376 36304405 26 5 124633969 124633998 124857560 124857589 27 6 86970657 86970686 87154542 87154571 28 4 38133160 38133189 38166333 38166362 29 1 42818832 42818861 42952377 42952406 30 10 44948035 44948064 44963510 44963539 31 18 75155502 75155531 75217309 75217338 32 1 151547583 151547612 151762415 151762444 33 X 49053498 49053527 49288574 49288603 34 11 61245995 61246024 61472772 61472801 35 14 81532421 81532450 81604566 81604595 36 14 74593649 74593678 74782362 74782391 37 2 27481762 27481791 27635152 27635181 38 18 10291525 10291554 10507743 10507772 39 1 109683571 109683600 109790277 109790306 40 11 95045563 95045592 95231622 95231651 41 6 6751861 6751890 6983652 6983681 42 6 113632954 113632983 113732265 113732294 43 11 61227169 61227198 61388263 61388292 44 10 91056660 91056689 91168327 91168356 45 2 102104978 102105007 102374576 102374605 46 11 17097713 17097742 17188137 17188166 47 1 199677020 199677049 199811402 199811431 48 7 100090608 100090637 100119091 100119120 49 12 7870903 7870932 7933480 7933509 50 7 87737453 87737482 87872696 87872725 Table 4.a4 05 03 25 4 kb Sequence Location Start 1 Endl Start2 End2 probe 1 11 61242025 61246024 61388263 61392262 ORF1_11_61243450_61246026_61388261_61391790_FR 2 3 18691228 18695227 18731500 18735499 ORF1_3_18693806_18695229_18731498_18743005_FR 3 2 118109415 118113414 118185368 118189367 ORF1_2_118112112_118113416_118185366_118187110_FR 4 17 27395091 27399090 27471515 27475514 ORF1_17_27395089_27399400_27471513_27474666_RR 5 12 131862267 131866266 132119631 132123630 ORF1_12_131862265_131863764_132122269_132123632_RF 6 12 121447708 121451707 121467918 121471917 ORF1_12_121447890_121451709_121468997_121471919_FF 7 14 81120332 81124331 81266782 81270781 ORF1_14_8112O33O_81122262_81268937_8127O783_RF 8 13 45336075 45340074 45393096 45397095 ORF1_13_45338339_45340076_45393094_45398989_FR 9 12 5915159 5919158 6150131 6154130 ORF1_12_5915876_5919160_6152139_6154132_FF 10 16 9911564 9915563 9951828 9955827 ORF1_16_9911562_9916434_9954809_9955829_RF 11 22 16907332 16911331 17087417 17091416 ORF1_22_16907330_16914217_17087415_17089015_RR 12 9 132002606 132006605 132139743 132143742 ORF1_9_131999122_132006607_132139741_132142158_FR 13 12 5915159 5919158 6063435 6067434 ORF1_12_5915876_5919160_6059110_6067436_FF 14 19 52961475 52965474 52976111 52980110 ORF1_19_5296O383_52965476_529761O9_52979684_FR 15 1 229296172 229300171 229506873 229510872 ORF1_1_229299065_229300173_229506871_229512794_FR 16 16 18252590 18256589 18400350 18404349 ORF1_16_18252588_18255195_18400348_18402976_RR 17 2 111366511 111370510 111529146 111533145 ORF1_2_111366352_111370512_111529947_111533147_FF 18 5 55186633 55190632 55308384 55312383 C)RFl_5_55186470_55190634_55308382_55310405_FR 19 7 2132506 2136505 2373912 2377911 ORF1_7_2130888_2136507_2376124_2377913_FF 20 12 109957499 109961498 110000319 110004318 ORF1_12_109959287_109961500_109999941_110004320_FF 21 5 148804536 148808535 148902109 148906108 ORF1_5_148804534_148807399_148901266_148906110_RF 22 2 174610122 174614121 174648156 174652155 ORF1_2_174610120_174616390_174648154_174652062_RR 23 17 43829484 43833483 43902649 43906648 ORF1_17_43832124_43833485_43905109_43906650_FF 24 4 74075385 74079384 74117913 74121912 ORF1_4_74078231_74079386_74117911_74125141_FR 25 1 36159279 36163278 36300406 36304405 ORF1_1_36159277_36165949_36303183_36304407_RF 26 5 124629999 124633998 124857560 124861559 C)RFl_5_124631740_124634000_124857558_124858678_FR 27 6 86970657 86974656 87154542 87158541 ORF1_6_8697O655_86977787_8715454O_87156275_RR 28 4 38133160 38137159 38162363 38166362 ORF1_4_38133158_38135017_38161792_38166364_RF 29 1 42814862 42818861 42948407 42952406 ORF1_1_42817616_42818863_42949613_42952408_FF 30 10 44948035 44952034 44963510 44967509 ORF1_10_44948033_44949598_44963508_44966433_RR 31 18 75155502 75159501 75213339 75217338 C)RFl_18_75155500_75159840_75214354_75217340_RF 32 1 151547583 151551582 151758445 151762444 ORF1_1_151547581_151552501_151755108_151762446_RF 33 X 49053498 49057497 49284604 49288603 ORF1_X_49053496_49056424_49286142_49288605_RF 34 11 61242025 61246024 61472772 61476771 ORF1_11_61243450_61246026_61472770_61474691_FR 35 14 81528451 81532450 81600596 81604595 ORF1_14_81530269_81532452_81602546_81604597_FF 36 14 74589679 74593678 74778392 74782391 ORF1_14_74588744_74593680_74780483_74782393_FF 37 2 27481762 27485761 27631182 27635181 ORF1_2_2748176O_27484387_27626184_27635183_RF 05 03 25 38 18 10287555 10291554 10503773 10507772 ORF1_18_10287457_10291556_10505933_10507774_FF 39 1 109679601 109683600 109786307 109790306 C)RFl_l_109681178_109683602_109788010_109790308_FF 40 11 95041593 95045592 95227652 95231651 C)RFl_ll_95040575_95045594_95230445_95231653_FF 41 6 6747891 6751890 6983652 6987651 ORF1_6_6745894_6751892_6983650_6986668_FR 42 6 113632954 113636953 113728295 113732294 ORF1_6_113632952_113639716_113727754_113732296_RF 43 11 61223199 61227198 61388263 61392262 ORF1_11_61224624_61227200_61388261_61391790_FR 44 10 91056660 91060659 91164357 91168356 ORF1_10_91056658_91062643_91164372_91168358_RF 45 2 102101008 102105007 102374576 102378575 ORF1_2_102100064_102105009_102374574_102377537_FR 46 11 17097713 17101712 17188137 17192136 ORF1_11_17097711_17100441_17188135_17191681_RR 47 1 199677020 199681019 199811402 199815401 C)RFl_l_199677018_199683841_199811400_199820398_RR 48 7 100090608 100094607 100119091 100123090 ORF1_7_100090606_100091968_100119089_100121546_RR 49 12 7866933 7870932 7929510 7933509 ORF1_12_7868599_7870934_7932397_7933511_FF 50 7 87733483 87737482 87868726 87872725 ORF1_7_87727621_87737484_87868535_87872727_FF Table 4.a5 Primer ID Sequence Primer ID Sequence 1 OBD168-1361 TGCATGAGATGAACCAGGGTGG OBD168-1363 AG GTATTTCTTCTTTTTCTATT 2 OBD168-913 CTCCTTGTTCAGACTCAGGGAATAAG OBD168-915 G G CTCCAG GTCTCTTCTGTCTCTTG A 3 OBD168-1925 GTGGGAAGGAAGGGTGTCATCTATAC OBD168-1927 CATAAAGCCTCTCTCCAATCGCTTTC 4 OBD168-1093 AGCAGATTAGAACCACAGTGAGTTGC OBD168-1095 GGAGGACACCTGTTTGCTGAGTTGGT 5 OBD168-1389 ACAGATACAAATAAGCTTGACC OBD168-1391 TGTACAGTCCCAGCTACTCAGG 6 OBD168-1385 ACTGCAGCACTATTCACAACA OBD168-1387 ATCCTTTTAATGTTGAGACCA 7 OBD168-581 GATG CTTCCCAAGG CTACCTGGT OBD168-583 CAGAAAATCAGAAAGCCTCCACCAAA 8 OBD168-513 CTGCGAAAGAACCTCAAAAGTTAGCC OBD168-515 TGGGATAATCTTACTCATTGCCTGGC 9 OBD168-533 TTGTTATTCCAGGTGGCAATGCTGAG OBD168-535 GGCAGGACTTACCCAACATCAGGACT 10 OBD168-485 GCTTGTTTTGAATGAGGTTAGGCAGC OBD168-487 GCCATCACAGGTTAGGAGACAGACC 11 OBD168-1585 CACCCCTTCCCCTTGCATTGGTTTCC OBD168-1587 G CTG ACCGTTCTTTCCTTCATTCATG 12 OBD168-813 CCAG G AACAAAACAAACCCCAG GTAA OBD168-815 AAGAAGCCAGGCAAGAAGACACGAGC 13 OBD168-1793 ACACTTATTAAGCACCTATATGTG OBD168-1795 TTCAGAAATTATCATCATTCTACA 14 OBD168-1509 CCAGCCTGGGCAACAGAGTGAGACTG OBD168-1511 CTGTCACTCGGGCTACAGTGCAGTGG 15 OBD168-925 GAGCCAGCCAGTCCTCATCAAGG OBD168-927 G CCCTTAG CCCTTCTGTATGTG C 16 OBD168-1185 GGTGCCACAGTGCCTTACATCAC OBD168-1187 TTTCTGGGTCACTCCCGCCTGTG 17 OBD168-1561 GCCTGGTGAACTCTGTCGTGTGGG OBD168-1563 GTGATTCATAAAGCAGCTCTTTTC 18 OBD168-1173 CGGGCTGTCTCCTGAATGGTGTG OBD168-1175 TGTG CCAG GTGTTGTGCTGATGC 19 OBD168-2057 GCAGGATCAGTGCCAGGGCAGGGGG OBD168-2059 GGAGGAAGGAGCAGGCGCGAGCGCT 20 OBD168-1805 CCAGGGCGCTGTGGTTTTGCGTGGC OBD168-1807 AAGAAAAGTGGATGAGCTGAAATGA 21 OBD168-673 GAGGGCTTCTGTGAGATTGGGCAC OBD168-675 GGCAGAGAGGCAATGTCAGGAAG 22 OBD168-661 GAAAAGAGTCAACACGGAGCAGAAAG OBD168-663 G CACCACCCAG AGCACCAACCTTATT 23 OBD168-1445 ACCGCCGCACCCTCCGGGCCG OBD168-1447 TCCCACCCATCCCTCCATCCA 24 OBD168-621 AAGTGGGAGAGTGAAGGGAGAAGGGA OBD168-623 CAAGCACGGTTGTAGGAGTTGTAAGT 25 OBD168-1049 GGCGGGAGAGCGATGCTTGGATT OBD168-1051 CTCTCCGCTGCCTTCTTGTCCTA 26 OBD168-2025 TAAAAGAACTACTAATTATTATGTT OBD168-2027 CATCCAGGCTGGAGTACACTGGCGC in OBD168-2037 TTGAGCTTCACAAAGGTTCCACTGAA OBD168-2039 TTTCACCGTGATTTAGACTCTACTAC 28 OBD168-1013 GGTAAGCGTAGGAGCAGAGCAAC OBD168-1015 GGGTGGGAAAGGTCCTCTGGTCA 29 OBD168-1313 GGGCTCAAGTGATCCTCCTGCC OBD168-1315 GACCATGCAGTGAAAATGAGGA 30 OBD168-985 CCTTGTCATAATGGGAAACTCAGGGC OBD168-987 CCTGGGAAGCAAAAGAAAGGAGGACA 31 OBD168-481 GAGTTTTGGCTGCTGAAGGGAAGGCA OBD168-483 ATGGTCATTCACTCAAATCCTGGGC 32 OBD168-901 CCCCAAGTCTCTCTGTCCTTCCT OBD168-903 CATCAAAGGGAGTGGCTCTGCCC 33 OBD168-1721 GATCATGACACATTAATTCTTAAATT OBD168-1723 GTAGGAGGGGAGCGCCGGCCCGGCCG 34 OBD168-797 CCCAGGTTGGAGGCATCTCTGAC OBD168-799 CCAGGCGAATCTGAAGGCAGGAT 35 OBD168-897 GCTGTTCCAGACCTAAAACCCAATGT OBD168-899 AAGATGACTTCCTTCCTTAGCCCAGC 36 OBD168-645 GAGTCTCACACTGTAGCCACGAACTG OBD168-647 GCTCTGCCATACAGTTCATTCTCATC 37 OBD168-1901 GCTCTGCACACCCTGCCTAAAGTGG OBD168-1903 GCTCTTTGTGGGCCCAGACGGTGTT 38 OBD168-1477 CATAAATTCCTAGTTTCCTGTGCAA OBD168-1479 TTTCTAATTCTACTTGG111C1 1 1 1 39 OBD168-857 CTCTCCCCTGAAGTTCCCACCTG OBD168-859 GCAGAAGTTGGAGCCTCTACCTC 40 OBD168-1781 GATAAAG CTTCACCATCTCTGC OBD168-1783 AGGGAACAGTTTGCTCTCCTCT 41 OBD168-1645 GAGACACGCAAGTCTTGCATCTG OBD168-1647 ACTCTTGTG CTCAAGTG ATTAG C 42 OBD168-1669 CTGATCTAACCCCCAAAATCCT OBD168-1671 AGTGCTAGCTATTTGGTCTTGA 43 OBD168-1777 AGCTCAGTGAACATGACCCGATGGTG OBD168-1779 ATAGTGTAAG CTAGGTAATATTTCTT 44 OBD168-949 GAGGAGGTAGACAGGATGCTGAG OBD168-951 AG CCCAG GACAAGTGTGACCAG G 45 OBD168-1269 ACCCCGACATTCTCCACCTCCTG OBD168-1271 ATTCTCCTTCCTCAGCCTCCCGA 46 OBD168-1357 TCCAGCACCCAGTGTGGAGTGCA OBD168-1359 Cl 11 1 ICI 11 1 1 1 11IGAGACAG 47 OBD168-909 GTGTG AG CCATCTGTTTATGCCTTTT OBD168-911 GGGTTTGACCACAGACCTGAGAGATG 48 OBD168-2069 AGTGTCACACAGTAAAAGGTATAG OBD168-2071 GGAGGAGACCCTTTGAAGGTCCCT 49 OBD168-1177 CACCAAGAAGCGACCACAGCACA OBD168-1179 GAAGAACAGCACCGCCCAGCGTT 50 OBD168-2065 GTTCCAAI 1 1 1 1CAATGAGGTAA OBD168-2067 GGCTTGAGCAAGCCTTTCAATCC Table 4.a6 05 03 25 qPCR Primer ID Sequence qPCR Primer ID 1 OBD168-ql361 CCTGCATGAGATGAACCAGGG OBD168-ql363 2 OBD168-q913 GACTCCTTGTTCAGACTCAGGGAATAAG OBD168-q915 3 OBD168-ql925 TTTTGACCATTTGAGCAGGTAC OBD168-ql927 4 OBD168-ql093 AAAGCAGATTAGAACCACAGTGAGTTGC OBD168-ql095 5 OBD168-ql389 TTGACAAGTCTTTTAAGAAAAAGTAC OBD168-ql391 6 OBD168-ql385 CAAAACATGATCTCAAAGAGATAT OBD168-ql387 7 OBD168-q581 GCCAGATGCTTCCCAAGGCTACCTG OBD168-q583 8 OBD168-q513 CACTGCGAAAGAACCTCAAAAGTTAGCC OBD168-q515 9 OBD168-q533 GATGAAAATGGCACCTCAAGCCTCAGCA OBD168-q535 10 OBD168-q485 TGGCTTGTTTTGAATGAGGTTAGGCAGC OBD168-q487 11 OBD168-ql585 TGCTGCTGTAACAAATTACCAC OBD168-ql587 12 OBD168-q813 GGAAAAGGAGACTGAGGAAACGCTCTGC OBD168-q815 13 OBD168-ql793 GCGAGCCAAACAAGATCTCTGCC OBD168-ql795 14 OBD168-ql509 AAATTATAAACTTTTACATCACCGCA OBD168-ql511 15 OBD168-q925 CCTG CCCCAGCCAG AGGATAG AG G AG G OBD168-q927 16 OBD168-qll85 GGGTGCCACAGTGCCTTACATCACATCC OBD168-qll87 17 OBD168-ql561 CAATGGGAAGGTGGACAGAGGA OBD168-ql563 18 OBD168-qll73 GGACGGGCTGTCTCCTGAATGGTGTG OBD168-qll75 19 OBD168-q2057 GCAGGCAGGATCAGTGCCAGGGCAG OBD168-q2059 20 OBD168-ql805 GCTGTGGTTTTGCGTGGCAAGCCAGA OBD168-ql807 21 OBD168-q673 GTCAGGTCAGCACATCCCATTAGGTGGA OBD168-q675 22 OBD168-q661 GGGAAAAGAGTCAACACGGAGCAGAAAG OBD168-q663 23 OBD168-ql445 CTGCCTGTGTCCCCCCGCACCCT OBD168-ql447 05 03 25 24 OBD168-q621 GGAGAGTGAAGGGAGAAGGGACACACCC OBD168-q623 25 OBD168-ql049 GGGTAGGGCGGGAGAGCGATGCTTGGAT OBD168-ql051 26 OBD168-q2025 TAATTATTATGTTAAAATCTGGG OBD168-q2027 27 OBD168-q2037 ACCTTTCAGAACACCTTTGTGTGC OBD168-q2039 28 OBD168-ql013 GGTGAAAGGGTAAGCGTAGGAGCAGAGC OBD168-ql015 29 OBD168-ql313 GGAAATCCTGGGCTCAAGTGATC OBD168-ql315 30 OBD168-q985 GCTGGGCATCCCTGAGGCTTGGAGC OBD168-q987 31 OBD168-q481 CAAGAGTTTTGGCTGCTGAAGGGAAGGC OBD168-q483 32 OBD168-q901 CTCACCGCCTCACCTGCCTTGGTCTGG OBD168-q903 33 OBD168-ql721 GTTTTG CCTGTGTGTAG ATCATG AC OBD168-ql723 34 OBD168-q797 CCCACCCAGGTTGGAGGCATCTCTGAC OBD168-q799 35 OBD168-q897 GG ATACACACCGTG CTCTTTCATTACTG OBD168-q899 36 OBD168-q645 GGCAGGAGGATTGGTTTGGTTTGACCCC OBD168-q647 37 OBD168-ql901 AAGAGTTTGAGGACAGATCGTGAG OBD168-ql903 38 OBD168-ql477 CCTGTGCAATCTCAGTATTTT OBD168-ql479 39 OBD168-q857 ACCCCTCTCCCACTCCACTGCCTCTCAG OBD168-q859 40 OBD168-ql781 ATCCCATGACTTCCCGGTAGTG OBD168-ql783 41 OBD168-ql645 CTTTCCCCTCCCCCTCCCCCTCCCC OBD168-ql647 42 OBD168-ql669 ACTTGTATGAATGATATGTTACTG OBD168-ql671 43 OBD168-ql777 AGGGTGGCTCTGGGCCTGAGGCT OBD168-ql779 44 OBD168-q949 GGGAGATAGGAGGAGGTAGACAGGATGC OBD168-q951 45 OBD168-ql269 GATTACCCCGACATTCTCCACCTCCTGG OBD168-ql271 46 OBD168-ql357 CCTCTTTCCTCCTGGGTTCAAGC OBD168-ql359 47 OBD168-q909 TAGTGTGAGCCATCTGTTTATGCCTTTT OBD168-q911 48 OBD168-q2069 AAGTGGCATCTGGCATTCCCCAAT OBD168-q2071 49 OBD168-qll77 CTCTG CTACCTTCCCCACCCTG CG OBD168-qll79 50 OBD168-q2065 A1 1 1 1 1CAATGAGGTAAAATGAAA OBD168-q2067 Table 4.a7 Sequence qPCR Probe Sequence 1 CAATAAAG CGAAAGGTATTTC OBD168-pl361 TCCTGTATTATGCTCCCTTCGAGAAGTAGAATATCTGAAT 2 CCTG CCAAG CCTGCCGCCACTGT OBD168-p913 TGGACTGGGCTAATGTGGAAAGTGAGGATCGAGAATG 3 TAAAGCCTCTCTCCAATCGCTT OBD168-pl925 1A1 1 1 1 1A1 1 1A1 1 1 1 1 1 1 CG A1 1G 1G 1 1 CACCAGGACGG 4 GTAGGAGGACACCTGTTTGCTGAGTTGG OBD168-pl093 ACAATTTCG AGCTTG GTGTG GTCAAGG G CCAGG 5 CAGGTG CAGTGGCACAG G CCTGTACA OBD168-pl389 TTTGGCTAATCAGAGATTTCGACAGGAGGATGGTGGGGAG 6 TTTTCCAGAGGCTCAGGGCAGAGA OBD168-pl385 TCACTTGAGGTCAGGAGTTCGAACTCCTGACCTCAAGTGA 7 CTGTTTCTGAGTGCGGATGACATTATCT OBD168-p581 AGGCAGAAGTTGTGGGCATGCTGAACTCGAGGAA 8 G CTG G G ATAATCTTACTC ATTG CCTG G C OBD168-p513 TGCAGGTGATGGTTCATGACAATATCGACTGAGCTGC 9 G GCAG G ACTTACCCAACATCAG G ACTTC OBD168-p533 AG G CAG G ATCGATG AATTCTAGG G CATGTAAATGCTC 10 GCCATCACAGGTTAGGAGACAGACC OBD168-p485 ATGAGCTCCCTGTGTCACACAGCATCGAGAGTC 11 TTTGTTCAGTCAACACATATGT OBD168-pl585 AAGAGAGAGAATCCAATGTCGATTTAGCCTTCCATAACTA 12 GCAAGAAGCCAGGCAAGAAGACACGAGC OBD168-p813 TTTTGTAATCGAAGGACCCCTTGCTGGG 13 GGAAI ICIICCCCCIGCCI1 Id OBD168-pl793 AAGAAAAGTAAGGCAGGATCGAATATTTGCACATTTCTCG 14 TCTGTCACTCGGGCTACAGTGCAGTG OBD168-pl509 CACTCACATCCCTAGTTATCGAGAACATCCTGGCTAATGT 15 CTCTGTCAG GAAACAAAG CCCTTAG CCC OBD168-p925 TGG G CTGAAGTATG GTCGAACAG GTTACGAGCATC 16 TATTTCCCAGGCTCCAGGCTCCTCGCCG OBD168-pll85 ACAATG GGTCACGTG CCTATTCG AG ACCACCC 05 03 25 17 TGTGATTCATAAAGCAGCTCTT OBD168-pl561 TTTTGAATCCCTCCCCCATCGAGGTTAATCCCTCTCCACA 18 GACTATGTGCCAGGTGTTGTGCTGATGC OBD168-pll73 ACGAGGAGGGTTTCGATGTTACTGATTCTGTCCCC 19 AATGACCCTGGGTGTCATGGAGGAA OBD168-p2057 CCAAGTTTCCTAACAGGATCGACACCCAGGGTCATTCACA 20 CAAGAAAAGTGGATGAGCTGAAATGA OBD168-pl805 CACACGCAAAGGCAAACGTCGAAACTGATCATTTAGGTTT 21 AAAGGCAGAGAGGCAATGTCAGGAAGAC OBD168-p675 TTCCCCTCGAGAAGAGCCTGCATCCAAGGTCT 22 CTTTAGGCACCACCCAGAGCACCAACC OBD168-p661 TCCTGTGGCCTGATAAGGTATTGACCCCATCGAGATT 23 CATCACCCATAGTGTCCGCAG G C OBD168-pl445 ACCTGCTCAACAGAGAATTCGACCCCATCCTCTGGCCCTC 24 GTGTG AATCAGG AGAG G ACAAAAG AG G G OBD168-p621 AG CCTCTTCCAACACTG AG G ATCACAACTCG ATGAT 25 CCCCTCTCCGCTGCCTTCTTGTCC OBD168-pl049 TGATTTTCGAACTCCTGACCTCGTGATCTTCCCACC 26 CTCCCG G GTTCAAATGATCCTTC OBD168-p2025 ATCCCCATTCTGTTTACATCGAGACCAGCCTGGCCAAAAT 27 GTTTCACCGTGATTTAGACTCTAC OBD168-p2037 TCTTGCCATTCTGGCCATTCGACAATATTGTTTTATTTTA 28 GCTCTGGGACTGCCTGACCTTAGCAAAG OBD168-pl013 ACTCACGAGGGAAGTGGTTGTTGACCTCGATTCC 29 TTCTGTGGCTGGTGGGCTCAAAG OBD168-pl313 CCCTATACAAATGCTGATTCGACTGCATCAGCCTCTACGG 30 GCCACGCTGACGGCATTCCTGGG OBD168-p985 TGGCTTCTCGAATGTGGTAGCCACAGACTGCAG 31 CCCCAACCCCAGCACAACCAGCCCTG OBD168-p481 ACTTGACAACCTGTAAGGGATTCTGAATCGACAGGG 32 CACCCACTTGCTAAGCCAGTCTCACTCT OBD168-p901 ACAGCCAGTCCCTGAGGAAGGAGTCGATGAAG 33 GTCTGTCCG CTTCCAGCG GCACG G C OBD168-pl721 TTTGCAAGAGTAGACAAATCGAAGACCCGAGCCGGCGCTT 34 GCCAGTGTTCCCAGGCGAATCTGAAGGC OBD168-p797 ACCTG G CTCCTTCCTGTATTATGCTCCCTTCG AGTAT 35 CCAAGATGACTTCCTTCCTTAGCCCAGC OBD168-p897 AAATAACTGCTAAAAGTGCTTCGAACTCCTGAGCTC 36 GCCCCACCGACAACTTACCATCCTCCG OBD168-p645 TCAGTCTCACAAGCCATATTTCAAGTGCTCGAGAACC 37 TGACCCTCCTTAAAAAAAGAAGCC OBD168-pl901 ATCTATGTAATGGACACATCGAACTCCTGACCTTGTGATC 38 CAGCTCCAGGATTTCTAATTC OBD168-pl477 AG GTTCTCGCAG AAAG G CTCG AACTTG CTAG ACAAAG ACT 39 GTGGGAACGGGTCAGCGTCCTGG OBD168-p857 TTTATTCATAGTGCCTGGAATGTAGTAGGATCTCGATTTG 40 CCAATAAG AGG ACG AG G GTGTG OBD168-pl781 TTGGCTCTAACCCACAGATCGAGAGATCAGGAAATATTTA 41 CCCAGCCTGATCTCAGACTCTTGTG OBD168-pl645 CGTAAAACGATGATAGAATCGAACTCCTGGTCTCAAGTGA 42 G GCTTCAAG CAATCCTCCCACCTC OBD168-pl669 TTTTAAGCTTAGTTGGAATCGACCTTTCAGGCTCAAGCAA 43 ATTCTCCGGAAGAGATAGTGTAA OBD168-pl777 TCCTGTATTATGCTCCCTTCGAGAAGTAGAATATCTGAAT 44 GCCCAGCAGTCAAGGTTGGAAGCCCAGG OBD168-p949 AGGAGA1 1 1CGA1 1 1 L1GGGC1 1GGCCA1 1A1CACCC 45 TGATTCTCCTTCCTCAGCCTCCCGA OBD168-pl269 TGTTTGTCG AGACCATG CTG GCTAATATG ATG AAACCC 46 CACCCAG GTTGGAGTGTAGTG GT OBD168-pl357 ATGTTGGCCAGGCTGGTCTCGAGACCAGCCTGGCCAACAT 47 AGGGTTTGACCACAGACCTGAGAGATGA OBD168-p909 AGGATACTGCATTGTCGACTGCAI 1 ICIGCCTTCGG 48 CCCCGGAGGAGACCCTTTGAAGGT OBD168-p2069 TTCAGAAAGAGGGGGCTCTCGAAGATCCCCGGGCAGCGCG 49 GGGAGGAAGAACAGCACCGCCCAGCGTT OBD168-pll77 TCGTG ATGTTCG AAG CACAAAG CTCACTTACTCCCG 50 AICCI 1 I ICAAIGAAAGGGAAAI 1 OBD168-p2065 AG AGAAGAAAI 1AA1 1 1 1 1GG AGG 1CCCAAAG 1GC1 AGG A Table 4.a8 qPCR Probe Sequence 1 OBD168-pl363 ATTCAGATATTCTACTTCTCGAAGGGAGCATAATACAGGA 2 OBD168-p915 TCATTCTCGATCCTCACTTTCCACATTAGCCCAGTCC 3 OBD168-pl927 CCGTCCTGGTGAACACAATCGAAAAAAATAAATAAAAATA 4 OBD168-pl095 TGGCCCTTGACCACACCAAGCTCGAAATTGTCAG 5 OBD168-pl391 CTCCCCACCATCCTCCTGTCGAAATCTCTGATTAGCCAAA 6 OBD168-pl387 TCACTTGAGGTCAGGAGTTCGAACTCCTGACCTCAAGTGA 7 OBD168-p583 TTCCTCGAGTTCAGCATGCCCACAACTTCTGCC 8 OBD168-p515 TGGCAGCTCAGTCGATATTGTCATGAACCATCACCTG 9 OBD168-p535 TGAGCATTTACATGCCCTAGAATTCATCGATCCTGCC 05 03 25 10 OBD168-p487 AGGACTCTCGATGCTGTGTGACACAGGGAGCT 11 OBD168-pl587 TAGTTATG G AAGG CTAAATCG ACATTG G ATTCTCTCTCTT 12 OBD168-p815 CCCAGCAAGGGGTCCTTCGATTACAAAA 13 OBD168-pl795 CGAGAAATGTGCAAATATTCGATCCTGCCTTACTTTTCTT 14 OBD168-pl511 ACATTAGCCAGGATGTTCTCGATAACTAGGGATGTGAGTG 15 OBD168-p927 TGATGCTCGTAACCTGTTCGACCATACTTCAGCCC 16 OBD168-pll87 TGGGTGGTCTCGAATAGGCACGTGACCCATTG 17 OBD168-pl563 TGTGGAGAGGGATTAACCTCGATGGGGGAGGGATTCAAAA 18 OBD168-pll75 AACATCGAAACCCTCCTCGTATTTGTTACTCTCTCTAC 19 OBD168-p2059 TGTGAATGACCCTGGGTGTCGATCCTGTTAGGAAACTTGG 20 OBD168-pl807 AAACCTAAATGATCAGTTTCGACGTTTGCCTTTGCGTGTG 21 OBD168-p673 AGACCTTGGATGCAGGCTCTTCTCGAGGGGAA 22 OBD168-p663 AATCTCGATGGGGTCAATACCTTATCAGGCCACAGGA 23 OBD168-pl447 GAGGGCCAGAGGATGGGGTCGAATTCTCTGTTGAGCAGGT 24 OBD168-p623 ATCATCGAGTTGTGATCCTCAGTGTTGGAAGAGGCTC 25 OBD168-pl051 AGGTGGGAAGATCACGAGGTCAGGAGTTCGAAAATCA 26 OBD168-p2027 ATTTTGGCCAGGCTGGTCTCGATGTAAACAGAATGGGGAT 27 OBD168-p2039 TAAAATAAAACAATATTGTCGAATGGCCAGAATGGCAAGA 28 OBD168-pl015 AGGAATCGAGGTCAACAACCACTTCCCTCGTGAG 29 OBD168-pl315 CCGTAGAGGCTGATGCAGTCGAATCAGCATTTGTATAGGG 30 OBD168-p987 TGCAGTCTGTGGCTACCACATTCGAGAAGCCAAG 31 OBD168-p483 TCTCCCCTGTCGATTCAGAATCCCTTACAGGTTGTC 32 OBD168-p903 TCCTTCATCGACTCCTTCCTCAGGGACTGGCT 33 OBD168-pl723 AAGCGCCGGCTCGGGTCTTCGATTTGTCTACTCTTGCAAA 34 OBD168-p799 ATACTCGAAGGGAGCATAATACAGGAAGGAGCCAGG 35 OBD168-p899 AG CTCAG G AGTTCG AAGCACTTTTAG CAGTTATTTA 36 OBD168-p647 TGGTTCTCGAGCACTTGAAATATGGCTTGTGAGACTG 37 OBD168-pl903 GATCACAAGGTCAGGAGTTCGATGTGTCCATTACATAGAT 38 OBD168-pl479 AGTCTTTGTCTAGCAAGTTCGAGCCTTTCTGCGAGAACCT 39 OBD168-p859 ACAAATCGAGATCCTACTACATTCCAGGCACTATGAATAA 40 OBD168-pl783 TAAATATTTCCTGATCTCTCGATCTGTGGGTTAGAGCCAA 41 OBD168-pl647 TCACTTGAGACCAGGAGTTCGATTCTATCATCGTTTTACG 42 OBD168-pl671 TTGCTTGAGCCTGAAAGGTCGATTCCAACTAAGCTTAAAA 43 OBD168-pl779 ATTCAGATATTCTACTTCTCGAAGGGAGCATAATACAGGA 44 OBD168-p951 AGGGTGATAATGGCCAAGCCCAGAAATCGAAATCTCC 45 OBD168-pl271 TCATATTAGCCAGCATGGTCTCGACAAACAATATAACGT 46 OBD168-pl359 ATGTTGGCCAGGCTGGTCTCGAGACCAGCCTGGCCAACAT 47 OBD168-p911 TGCAGTCGACAATGCAGTATCCTTGCTTCCTAGCAC 48 OBD168-p2071 CGCGCTGCCCGGGGATCTTCGAGAGCCCCCTCTTTCTGAA 49 OBD168-pll79 TGCTTCGAACATCACGAAGACATTGGATGTGGCCC 50 OBD168-p2067 TCCTAGCACTTTGGGAGGTCGAAAAATTAATTTCTTCTCT Table 4.a9 probe PCR Marker Set qPCR Marker Set 1 ORF1_11_61243450_61246026_61388261_61391790_FR OBD168-1361.1363 OBD168-ql361.ql363 .pl361 / pl363 2 ORF1_3_186938O6_18695229_18731498_18743OO5_FR OBD168-913.915 OBD168-q913.q915 ,p913 / p915 05 03 25 3 ORF1_2_118112112_118113416_118185366_118187110_FR OBD168-1925.1927 OBD168-ql925.ql927 ,pl925 / pl927 4 ORF1_17_27395089_27399400_27471513_27474666_RR OBD168-1093.1095 OBD168-ql093.ql095 ,pl093 / pl095 5 ORF1_12_131862265_131863764_132122269_132123632_RF OBD168-1389.1391 OBD168-ql389.ql391 ,pl389 / pl391 6 ORF1_12_121447890_121451709_121468997_121471919_FF OBD168-1385.1387 OBD168-ql385.ql387 ,pl385 / pl387 7 ORF1_14_8112O33O_81122262_81268937_8127O783_RF OBD168-581.583 OBD168-q581.q583 ,p581 / p583 8 ORF1_13_45338339_45340076_45393094_45398989_FR OBD168-513.515 OBD168-q513.q515 ,p513 / p515 9 ORF1_12_5915876_5919160_6152139_6154132_FF OBD168-533.535 OBD168-q533.q535 ,p533 / p535 10 ORF1_16_9911562_9916434_9954809_9955829_RF OBD168-485.487 OBD168-q485.q487 ,p485 / p487 11 ORF1_22_16907330_16914217_17087415_17089015_RR OBD168-1585.1587 OBD168-ql585.ql587 ,pl585 / pl587 12 ORF1_9_131999122_132006607_132139741_132142158_FR OBD168-813.815 OBD168-q813.q815 ,p813 / p815 13 ORF1_12_5915876_5919160_6059110_6067436_FF OBD168-1793.1795 OBD168-ql793.ql795 ,pl793 / pl795 14 ORF1_19_52960383_52965476_52976109_52979684_FR 0BD168-1509.1511 OBD168-ql509.ql511 ,pl509 / pl511 15 ORF1_1_229299065_229300173_229506871_229512794_FR OBD168-925.927 OBD168-q925.q927 ,p925 / p927 16 ORF1_16_18252588_18255195_18400348_18402976_RR OBD168-1185.1187 OBD168-qll85.qll87 ,pll85 / pll87 17 ORF1_2_111366352_111370512_111529947_111533147_FF OBD168-1561.1563 OBD168-ql561.ql563 ,pl561 / pl563 18 ORF1_5_55186470_55190634_55308382_55310405_FR OBD168-1173.1175 OBD168-qll73.qll75 .pll73 / pU75 19 ORF1_7_2130888_2136507_2376124_2377913_FF OBD168-2O57.2O59 OBD168-q2057.q2059 ,p2057 / p2059 20 C)RFl_12_109959287_109961500_109999941_110004320_FF OBD168-1805.1807 OBD168-ql805.ql807 ,pl805 / pl807 21 C)RFl_5_148804534_148807399_148901266_148906110_RF OBD168-673.675 OBD168-q673.q675 ,p675 / p673 22 C)RFl_2_174610120_174616390_174648154_174652062_RR OBD168-661.663 OBD168-q661.q663 ,p661 / p663 23 ORF1_17_43832124_43833485_43905109_43906650_FF OBD168-1445.1447 OBD168-ql445.ql447 ,pl445 / pl447 24 ORF1_4_74078231_74079386_74117911_74125141_FR OBD168-621.623 OBD168-q621.q623 ,p621 / p623 25 ORF1_1_36159277_36165949_36303183_36304407_RF OBD168-1049.1051 OBD168-ql049.ql051 ,pl049 / pl051 26 ORF1_5_124631740_124634000_124857558_124858678_FR OBD168-2O25.2O27 OBD168-q2025.q2027 ,p2025 / p2027 27 ORF1_6_86970655_86977787_87154540_87156275_RR OBD168-2O37.2O39 OBD168-q2037.q2039 ,p2037 / p2039 28 ORF1_4_38133158_38135017_38161792_38166364_RF OBD168-1013.1015 OBD168-ql013.ql015 ,pl013 / pl015 29 ORF1_1_42817616_42818863_42949613_429524O8_FF OBD168-1313.1315 OBD168-ql313.ql315 ,pl313 / pl315 30 ORF1_10_44948033_44949598_44963508_44966433_RR OBD168-985.987 OBD168-q985.q987 ,p985 / p987 31 C)RFl_18_75155500_75159840_75214354_75217340_RF OBD168-481.483 OBD168-q481.q483 ,p481 / p483 32 ORF1_1_151547581_151552501_151755108_151762446_RF 0BD168-901.903 OBD168-q901.q903 ,p901 / p903 33 ORF1_X_49053496_49056424_49286142_49288605_RF OBD168-1721.1723 OBD168-ql721.ql723 ,pl721 / pl723 34 ORF1_11_61243450_61246026_61472770_61474691_FR OBD168-797.799 OBD168-q797.q799 ,p797 / p799 35 ORF1_14_81530269_81532452_81602546_81604597_FF OBD168-897.899 OBD168-q897.q899 ,p897 / p899 36 ORF1_14_74588744_74593680_74780483_74782393_FF OBD168-645.647 OBD168-q645.q647 ,p645 / p647 37 ORF1_2_2748176O_27484387_27626184_27635183_RF OBD168-1901.1903 OBD168-ql901.ql903 ,pl901 / pl903 38 C)RFl_18_10287457_10291556_10505933_10507774_FF OBD168-1477.1479 OBD168-ql477.ql479 ,pl477 / pl479 39 C)RFl_l_109681178_109683602_109788010_109790308_FF OBD168-857.859 OBD168-q857.q859 ,p857 / p859 40 ORF1_11_95040575_95045594_95230445_95231653_FF OBD168-1781.1783 OBD168-ql781.ql783 ,pl781 / pl783 41 ORF1_6_6745894_6751892_6983650_6986668_FR OBD168-1645.1647 OBD168-ql645.ql647 ,pl645 / pl647 42 ORF1_6_113632952_113639716_113727754_113732296_RF OBD168-1669.1671 OBD168-ql669.ql671 ,pl669 / pl671 43 ORF1_11_61224624_61227200_61388261_61391790_FR OBD168-1777.1779 OBD168-ql777.ql779 ,pl777 / pl779 44 ORF1_10_91056658_91062643_91164372_91168358_RF OBD168-949.951 OBD168-q949.q951 ,p949 / p951 45 C)RFl_2_102100064_102105009_102374574_102377537_FR OBD168-1269.1271 OBD168-ql269.ql271 ,pl269 / pl271 46 ORF1_11_17097711_17100441_17188135_17191681_RR OBD168-1357.1359 OBD168-ql357.ql359 ,pl357 / pl359 47 C)RFl_l_199677018_199683841_199811400_199820398_RR 0BD168-909.911 OBD168-q909.q911 ,p909 / p911 48 ORF1_7_100090606_100091968_100119089_100121546_RR 0BD168-2069.2071 OBD168-q2069.q2071 ,p2069 / p2071 49 ORF1_12_7868599_7870934_7932397_7933511_FF OBD168-1177.1179 OBD168-qll77.qll79 ,pll77 / pll79 | 50 | ORF1_7_87727621_87737484_87868535_87872727_FF Table 4.al0 | OBD168-2O65.2O67 | OBD168-q2Q65.q2O67 .p2065 / p2067 | 05 03 25 51 ORF1_12_51666821_51670814_51862305_51869704_FR 401 3075.288832 52 ORF1_7_137931629_137933966_137981878_137983291_FR 323 2644.935118 53 ORF1Jl_61042263_61044402_61243450_61246026_FF 245 2203.942492 54 ORF 1^28881912891631 3046105 3049187 R F 220 2093.173181 55 ORF1_11_115616166_115618345_115711125_115715158_FF 359 2842.705641 56 ORF1_X_77646855_77652042_77915112_77916580_RF 430 3219.053584 57 ORF1_20_62658422_62663845_62934812_62935956_RF 419 3172.19168 58 ORF1_22_17921708_17928023_17999187_18001605_FF 398 3062.496857 59 ORF1_19_47777294_47778517 47957709_47959307_RF 364 2875.54375 60 ORFl_8_7882531_7883805_7954782_7966362_FF 266 2337.981624 61 ORF11112091217120943581215367112160688F 298 2559.990469 62 ORF1J7^31222339^3122413L31324781^31330350^RR 288 2501.124218 63 ORF1_7_4620261_4621735_4724415_4726417_FR 416 3166.931042 64 ORF1_10_45820548_45823847_45898343_45903899_RF 311 2598.185801 65 ORF1_16_81474879_81476453_81607034_81611259_RR 463 3398.382345 66 ORF1_1l_10776569_10779775_10900691_10903608_FF 332 2691.77054 67 ORF1_8_97253466_97261198_97345458_97357412_RF 411 3139.677711 68 ORF1_1_109681178_109683602_109741801_109745521_FR 340 2722.247784 69 ORF1_1_7774817_7777030_7966809_7968736_FF 294 2534.406731 70 ORF1J2J7858281J7862390J7932397J793351LRF 304 2568.815685 71 ORFl_13_3040829l_30410407_30585632_30589891_RR 310 2592.51634 72 ORF1_15_30288521_30290733_30544055_30547496_FR 375 2927.700157 73 ORF1_11_61152527_61154904_61243450_61246026_R F 316 2615.722841 74 ORF1_17_64322183_64329531_64384310_64385587_R F 483 3472.308017 75 ORF1 6 26459325 26460705 26493174_26499033_R R 449 3319.91788 76 ORFl_2_74503923_745071377451971674521847FF 514 3577.121944 77 ORFL2J59230477J59238639J59250572J59255062JF 498 3520.298247 78 ORFlJ6^46899253^46904082^47060044^47061469JF 459 3384.670678 79 ORF1_5_40609009_40613245_40692971_40695207_FR 341 2735.33663 80 ORF1_4_47908113_47912137_48013964_48015665_FF 354 2796.807098 81 ORF1_4_38161792_38166364_38180538_38182770_FR 357 2829.764831 82 ORF1_7_22482163_22488443_22587350_22592472_RR 504 3548.464077 83 ORF1_17_27477797_27480875_27629083_27630392_RR 373 2916.46944 84 ORF1_10_13707193_13712319_13854651_13857653_FR 365 2875.544458 85 0RFO5J79006295J79007772J79123113J?912734OF 541 3719.882512 86 ORF 09^9777468^977979 0828343^9833999J F 383 2978.506253 87 ORFl_17_48576277_48578280_48760984_48766661_FF 500 3523.786793 88 ORFl_3_124942088_124944537_125145442_125149201_R R 406 3118.518158 89 ORF1_2_230319552_230322976_230433766_230436650_RR 403 3095.482353 90 ORF1_5_179455074_179456297_179632102_179634386_RF 525 3614.075373 91 ORF1_13_94395452_94397500_94478315_94481582_FR 421 3181.350595 92 0RF1O185482953JL85486658J8556990O85571399JF 426 3194.213302 93 ORF 0^105801948^10580999 1105902395^W 423 3184.944399 94 0RFO7J75411072J75413612J75649583^75651419^RF 434 3237.927886 95 ORF1_11_61224624_61227200_61378098_61379415_FF 415 3162.182868 96 ORF1_5_94419239_94427299_94505842_94514405_FR 551 3764.075451 97 ORFl_17_82434207_82440644_82511425_82512972_F R 567 3825.12433 98 ORF1_17_59893718_59895987_59916319_59918152_FR 568 3830.891167 99 ORF1_2_102051982_102057593_102268036_102274328_RR 543 3724.636088 100 ORF LM1154 203473865 203477190 F R 577 3888.735935 Table 4.bl 05 03 25 51 -1.437023753 1.444662839 0.00410465 Late SSc 52 -1.436812218 1.372546527 0.003141195 Late SSc 53 -1.435876536 1.307037927 0.002268922 Late SSc 54 -1.433613438 1.327259391 0.00206892 Late SSc 55 -1.432745201 1.403705162 0.003570554 Late SSc 56 -1.429058783 1.46064713 0.004450195 Late SSc 57 -1.426850922 1.460623768 0.004336283 Late SSc 58 -1.426020051 1.444849909 0.00407447 Late SSc 59 -1.422034199 1.41292781 0.003644069 Late SSc 60 -1.420867576 1.337778105 0.002521338 Late SSc 61 -1.417944096 1.403736871 0.002963925 Late SSc 62 -1.416627122 1.393528599 0.002843634 Late SSc 63 -1.416315236 1.466844799 0.004323573 Late SSc 64 -1.414963784 1.380989039 0.003043098 Late SSc 65 -1.413911362 1.49285337 0.004897376 Late SSc 66 -1.411966593 1.37767433 0.003240783 Late SSc 67 -1.41025199 1.462162948 0.004257973 Late SSc 68 -1.409458393 1.372450033 0.003306288 Late SSc 69 -1.408443165 1.397614445 0.002911387 Late SSc 70 -1.407950766 1.384488035 0.00298214 Late SSc 71 -1.404913131 1.380068244 0.00303129 Late SSc 72 -1.403981089 1.415911341 0.00376212 Late SSc 73 -1.403771448 1.375504908 0.003079743 Late SSc 74 -1.403471491 1.486407014 0.005086864 Late SSc 75 -1.401945125 1.477210974 0.004699527 Late SSc 76 -1.400464213 1.471925259 0.005360609 Late SSc 77 -1.400250828 1.476947968 0.005211465 Late SSc 78 -1.399306124 1.495157038 0.004862558 Late SSc 79 -1.39807413 1.380138694 0.00333459 Late SSc 80 -1.396796568 1.382985423 0.003468855 Late SSc 81 -1.393419416 1.400184107 0.003541756 Late SSc 82 -1.392802437 1.480005974 0.005285174 Late SSc 83 -1.391786866 1.413834843 0.003736567 Late SSc 84 -1.391343564 1.409057391 0.003644071 Late SSc 85 -1.389469621 1.498207138 0.005742942 Late SSc 86 -1.388905146 1.429267903 0.003878624 Late SSc 87 -1.387700446 1.473610575 0.005220571 Late SSc 05 03 25 88 -1.382271601 1.462565011 0.004207329 Late SSc 89 -1.382083594 1.454244682 0.004152482 Late SSc 90 -1.381646553 1.467409322 0.005458532 Late SSc 91 -1.381291697 1.461116048 0.00435845 Late SSc 92 -1.380681871 1.45430681 0.00438966 Late SSc 93 -1.380346255 1.457114043 0.004367161 Late SSc 94 -1.380100261 1.462217536 0.004496421 Late SSc 95 -1.379802039 1.466482296 0.004312114 Late SSc 96 -1.379749126 1.501894245 0.00586349 Late SSc 97 -1.379483586 1.501385344 0.006031711 Late SSc 98 -1.379324736 1.50271561 0.006047702 Late SSc 99 -1.378671665 1.496046282 0.005755859 Late SSc 100 -1.378053209 1.518746877 0.006209069 Late SSc Table 4.b2 51 GATAGATTATGGAGGGTTAAGGAAGGAATCGATAACGCCAAGCACTCGGGCATGGGTGAC 52 AAAACCAGAGAAAGGAGCAAAGTGAGCCTCGAGTACAGAGGCACAGGGCAGCTTTTGGGG 53 ACTATTACTCAAATGTTAAAGCTCTTG GTCG AAGG G AGCATAATACAGGAAGGAG CCAG G 54 TTTCTACATTTTAGGGAGACATGAGATATCGAGACCAACCTGACAACATGGCAAAACCCC 55 AGTGGTATGACAATGGCTCACTGCAGCCTCGAACTCCACACCCCTGCTAGGAAGGGCACA 56 TAATTAGTGAGCCACAGACTCTAGGCCATCGAGGCTACAGTGAGCTATGATCACGTCACT 57 AGTTTCTAGAGAGGATTAAGGAGGGGGCTCGAGGGCCTTTGCCCTTTCGTAAGGGAAAGA 58 TTGGCTTCTGACTGTATACTCTGAGCACTCGAGGTGTACTGAGATATCTCGCCCCCGAGG 59 AAAAACCTTAGACTAGACGGATTCACAGTCGAGACAGTGTCTTACTCTGTTGTCCAGGCT 60 AGTGCAACAGACCAATGAAGTGAGACTTTCGATATAATAGTGGCAAACAAAATCCAGCAA 61 GGCAGAAAAATGAGTGAAGTCAGAGCGATCGAGTCTGCACCTATTTAATAATAACTCTCC 62 AAGCAGGTGTCCATTATTAATTCATTCATCGAACTCCTGGCCTTATGTAACCCACCTGCC 63 TCACTTAGTAGCCATCACGGTTATCAGATCGAACTCCTGTTCTCAAGTGATCTGCGTGCC 64 ATCTAGTTTCCATGCAAACTCAGAAGCATCGATTTGGGTGTGTCTGATGTATTTCCATGA 65 CCAGCAGTTCTGCAAAGACAAGCACTGGTCGATTGTGGATGGGAGTGTGGATTTTGTGGC 66 TTATGGGTAACTTCGTGTCI Illi 1 IG ITCGAAI11 1 1ACACCCGGCCCTTGCTTCCAGG 67 TTCAATTACCTCCCACTAG GTCCCTCCCTCGATAGCAG AATCTCCCAGTCTGGAG CACAG 68 TTCATAGTGCCTGGAATGTAGTAGGATCTCGAATCACTTCCTACCTGCAGGAGGCAGAGA 69 GGGTTTCCCCATGTTGGCCAGGTTGGTCTCGAGACCAGCCTGGCCAACATGGCAAAACCC 70 CGTTCCGGGAGTAAGTGAGCTTTGTGCTTCGAGCCTTCTTACTCAACCACTCAACATCTG 71 TTCCAAGGACACAACATGATCTCATCTTTCGAACTCCAGCCTGGGTAACAGAGACTCCAT 72 CTTCTATACGCCAGAACATGGATGAACCTCGAGATAATTTTGTATGTTTCCI11111CTT 73 CCTGGCTCCTTCCTGTATTATGCTCCCTTCGAGAGAACACTATCAGAGCTCCCATGGCCC 74 TTCAAGTTCCCATCCAATGAGACATGTGTCGAGATCAGCCTGGCCAACGTGGTGAAACCC 75 AAATCTGGGGACCAGTAGCTGTGGCTAGTCGAGCCACTGCACTCCAGCCTGCAGGACAGA 76 TGTGTTCATTCAAGTCTTTGATCTTCACTCGAATCTGAGAGACAGAGAGAGAGCAAGGGA 77 AATCACTAAATTTCCAAATGTACATGGATCGACCTCCCAGGCTCAAGTGGTCTTCCTGTC 78 GAATGAAGGGGCCCTAGGGCAGTGGTGTTCGAGAGGCGGAAGTAAAAGGATTCAGATCCC 79 TTTGACTCTAGCCCAGTGATTCCCAAACTCGAGTCAAAGTTGAAAATTCATAGTAAGATT 80 AAAACAAATTGAGTATTTCAAGTAAACCTCGAACCACTGCACTCTAGTCCAGGCAACAGA 81 TGACTCACGAGGGAAGTGGTTGTTGACCTCGAGGAGACTGGACCAGAAGAGTTTCCCACC 82 GAGGTGGTGGGCAGGAAAGGAAGACAGTTCGAATGGTCTGTTCAAGACTATTTTATAGTG 83 GGCAGGAGGATTGCTTGAGCCTAGGAAATCGAACTCCTGGGCTCAAGCAATCCTCCCGCC 84 GGTTGGGGGATCACTTGAGGTCAGGAGCTCGAACTCCTGACCTCAAGTGATCCACTCTCC 85 CAGACTTTCATATTTTCAATCTCTCTCTTCGATGCTCAGGAAGCGCAGGTCCGTCAGCCT 86 AGGTTTCACCATGTTGGCCAGGCTGGTCTCGAGACCAGCCTGGCCAACATGGTGAAACCC 87 ATATTCCTCGCATGGAGGGAACTTGGGGTCGAAATCCTGGCCTCAAGCAATTCACCCACC 88 TAAGAAGTGGAAGTCGCCATGAGAGTGCTCGATACAATGGAATGTTATTCCACCATAAAA 89 GGTGGCTACATCATTATATGGCCAAGACTCGACTTTTAAATTCCTAAGTTTCCTAGTTGG 90 CGCGCACTGGATCAAAATAATACACGCCTCGAACTAACTTTCCAAGCTTGACTCTTAGGA 91 TTTACTGAACATTGGTAAATCTACCTAATCGAAATACAAAAATTAGCCAGGCATGATGGC 92 GTGATTGGTGAACAGTGGCTTCCTTTAGTCGACTAAATGGA...

Claims

05 03 251. A process for detecting the stage and / or presence of scleroderma;- wherein the stage of scleroderma is detected by determining the presence or absence of at least 10 chromosome interactions represented by any probe shown in:5 -Table l.a2 or Table l.b2,- Table 3.a3 or Table 3.b3, or,- Table 4.a3 or Table 4.b3;and / or- wherein the presence of scleroderma is detected by determining the presence or absence of at least 10 10 chromosome interactions represented by any probe shown in:- Table 2.a2 or Table 2.b2,- Table 5.a2 or Table 5.b2, or- Table 6.a3 or Table 6.b3.

2. A process according to claim 1 in which the presence or absence of the chromosome interactions is15 determined:- in a sample from an individual, and / or- by detecting the presence or absence of a DNA loop at the site of the chromosome interactions, and / or- detecting the presence or absence of distal regions of a chromosome being brought together in a chromosome conformation.20 3. A process according to claim 1 or 2 in which the presence or absence of the chromosome interactionsis determined by detecting the presence of a ligated nucleic acid which is generated during said typing and whose sequence comprises two regions each corresponding to the regions of the chromosome which come together in the chromosome interaction.

4. A process according to claim 3 in which detection of the ligated nucleic acid is by a probe that has at 25 least 70% identity to any of the specific probe sequences shown in:- Table l.a2 or Table l.b2,- Table 2.a2 or Table 2.b2,- Table 3.a3 or Table 3.b3,05 03 25- Table 4.a3 or Table 4.b3,- Table 5.a2 or Table 5.b2, or- Table 6.a3 or Table 6.b3.

5. A process according to any one of the preceding claims, wherein said determining of whether the5 chromosome interactions are present or absent is by a process comprising the steps of: -(i) cross-linking of chromosome regions which have come together in a chromosome interaction;(ii) subjecting said cross-linked regions to cleavage, optionally by restriction digestion cleavage with an enzyme;(iii) ligating said cross-linked cleaved DNA ends to form ligated DNA; and10 (iv) detecting the presence or absence of the ligated nucleic acid to thereby determine presence or absence of the chromosome interaction.

6. A process according to any one of the preceding claims wherein:- the result of the process is used to select a treatment schedule; and / or- the result of the process is used to select a specific therapy for the individual; and / or15 - the process is carried out to select an individual for a medical treatment.

7. A process according to any one of the preceding claims which is carried out to identify or design a therapeutic agent for scleroderma;- wherein said process is used to detect whether a candidate agent is able to cause a change to at least10 chromosomal interactions represented by the probes in:20 -Table l.a2 or Table l.b2,- Table 2.a2 or Table 2.b2,- Table 3.a3 or Table 3.b3,- Table 4.a3 or Table 4.b3,- Table 5.a2 or Table 5.b2, or25 - Table 6.a3 or Table 6.b3.

8. A process according to any one of the preceding claims, wherein detecting the presence of absence of chromosome interactions comprises specific detection of ligated nucleic acid by quantitative PCR (qPCR) which uses primers capable of amplifying the ligated nucleic acid and a probe which binds the ligation site during the PCR reaction, wherein said probe comprises sequence which is complementary to5 sequence from each of the chromosome regions that have come together in the chromosome interaction.

9. A process according to claim 8 in which said probe comprises:- a fluorophore covalently attached to the 5' end of the probe, and / or- a quencher covalently attached to the 3' end of the probe10 10. A process according to claim 9 in which said fluorophore is selected from HEX, Texas Red and FAM.

11. A process according to claim 8 or 9 in which said probe comprises a nucleic acid sequence of length 10 to 40 nucleotide bases, preferably a length of 20 to 30 nucleotide bases.

12. A therapeutic agent for scleroderma for use in a method of treating scleroderma in an individual, wherein said method comprises identifying the individual as being in need of the therapeutic agent by a 15 process according to any one of claims 1 to 5 and administering the agent to the individual.05 03 25

Citation Information

Patent Citations

  • Detection processes using sites of chromosome interaction

    US20180274015A1

  • Methods for genome assembly and haplotype phasing

    WO2014121091A1

  • Genetic regulation

    WO2019086898A2

  • Novel druggable targets for the treatment of inflammatory diseases such as systemic lupus erythematosus (SLE) and methods for diagnosis and treatment using the same

    WO2021127589A1