Methods and compositions

CANs in RT-qPCR simplify decentralized cancer prognosis testing by integrating algorithmic interpretation into molecular design, using fluorescent encoding and competing oligonucleotides to derive a Recurrence Score efficiently and accurately.

GB2635318BActive Publication Date: 2026-02-11SIGNATUR BIOSCIENCES INC
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
GB2023016106
Authority / Receiving Office
GB · GB
Patent Type
Patents
Current Assignee / Owner
Filing Date
2023-10-20
Publication Date
2026-02-11
Estimated Expiration
2043-10-20

AI Technical Summary

Technical Problem

Current cancer prognosis tests, such as the Oncotype DX test, require centralized facilities and complex protocols, making them inconvenient for patients and prone to sample variability.

Method used

The use of Competitive Amplification Networks (CANs) for RT-qPCR, which integrate algorithmic interpretation into the molecular design, allowing decentralized testing by encoding relative gene concentrations using fluorescent colors and competing oligonucleotides to derive a Recurrence Score (RS) in a single reaction.

Benefits of technology

Enables rapid, low-variability, and clinically interpretable RS scoring in near-patient settings, reducing the need for sample splitting and improving test performance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000001_0000
    Figure 00000001_0000
  • Figure 00000001_0001
    Figure 00000001_0001
  • Figure 00000001_0002
    Figure 00000001_0002
Patent Text Reader

Abstract

Methods and compositions for PCR based means for generating gene-signature based risk scores for the prognosis of breast cancer recurrence and predicting therapy efficacy. The invention uses competitive amplification of 21 genes to encode the gene signature into the design of the oligonucleotides, making downstream amplification and subsequent analysis straight forward and suitable to be performed on-site. The 21 genes comprise the housekeeping module: ACTB, GAPDH, GUSB, RPLP0, and TFRC; the invasion module: CD68, CTSV, MMP11; the proliferation module: AURKA, BIRC5, CCNB1, MKI67, MYBL2; the HER2 module: ERBB2, and GRB7; and the Estrogen module; BAG1, BCL2, ESR1, GSTM1, PGR, and SCUBE2.
Need to check novelty before this filing date? Find Prior Art

Description

Field The invention is in the field of in vitro diagnostics. Background Various tests have been developed to determine different parameters about an individual's particular tumours. For example specific biomarkers such as over or underexpression of particular genes in a tumour sample can be used to diagnose the presence of cancer, or give an indication as to like metastasis. A particular well known test, the Oncotype DX test from Exact Sciences, has been developed to determine the likelihood of recurrence of breast cancer in patients with particular types of cancers (i.e. is prognostic), and the likely benefit of chemotherapy treatment (i.e. is predictive). Such tests are valuable since they aid in directing therapies to the patients most likely to benefit, and away from those unlikely to benefit, saving them from the unnecessary side effects of an ineffective treatment. For these latter patients, a different therapeutic may be chosen instead. In instances where cancer recurrence is more likely, specific screening programmes can be put in place. The Oncotype DX test is a well-known 21 gene test, involving the real time reversetranscriptase PCR (real time rt-PCR), involving sets of primers and probes which can be used to first quantify the concentration of 21 genes in a patient sample (each in a separate reaction). See for example Kalinsky K et al 2021 et al. New England Journal of Medicine. 2021;385(25):2336-2347. doi:10.1056 / NEJMoa2108873; Paik S et al 2004 New England Journal of Medicine 351(27):2817-2826. doi: 10.1056 / NEJMoa 041588; Sparano JA et al 2018 New England Journal of Medicine . 2018;379(2): 111-121. doi:10.1056 / NEJMoa 1804710; and Cronin M et al 2007 Clinical Chemistry. 53(6): 1084-1091. doi: 10.1373 / clinchem.2006.076497. The raw CT values of each of the genes is converted into a risk score via an algebraic "algorithm" to determine patient relapse risk. The outcome of the test is a "Recurrence Score", a single value which is used in combination with other features such patient age, node positive / node negative status, HER2 status etc to provide the prognosis and predictive outcome. This test is run in a single centralized facility with bespoke, high-throughput protocols. There is a need to provide a simple means of attaining the RS score, which can be interpreted in the same way as the Oncotype DX RS score, fitting with current clinical pathways, and which can be done in a decentralised manner. For example so that the test can be performed in the same hospital as the patient is being treated resulting in a quicker and less stressful process for the patient. The present invention aims to solve this problem. Summary of the invention The present invention provides a simplified means to generate the RS score, by leveraging Competitive Amplification Networks (CANs), which are described in WO 2022 / 074392 Al (which is incorporated by reference in its entirety) and Goertz et al, 2023, "Competitive Amplification Networks enable molecular pattern recognition with PCR", biorxiv, doi: 10.1101 / 2023.06.29.546934, available at https: / / www.biorxiv.org / content / 10.1101 / 2023.06.29.546934vl.full.pdf (which is herein incorporated by reference in its entirety). CANs allow interpretation of the expression levels of multiple genes in aggregate in a single reaction. Rather than quantify each RNA transcript individually, then enter either the quantities or the raw CTs into an algorithm for interpretation, which is how the current Oncotype DX test works, CANs embed algorithmic interpretation into the molecular design of the components. Rather than using different fluorescent channels to indicate the absolute quantity of different components, CANs use fluorescent colours to encode the relative concentration of each target compared to an a priori decision boundary. A different boundary concentration is used for each gene of interest, determined by the empirical value which best separates "disease-negative" (low-risk) patients from "diseasepositive" (high-risk) patients. Numerous RNA transcripts are analysed in a single reaction, (or in multiple modules of individual reactions) each contributing to the same two fluorescent channels. The relative intensity of the two channels at the end of the reaction can be interpreted as an indication of whether, on the whole, the genes of interest indicate the patient has a greater likelihood of being low or high risk. An exemplary representation of a CAN may be found in Figure 2. The test of the invention, referred to in some instances as the OncoSignatur Breast Test, is a molecular pathology assay for determining post-operative risk of breast cancer recurrence in women. The test analyses the expression of certain genes in the patient's resected tumour (the same genes as used in the Oncotype DX test) translating the concentration of each gene transcript into a score representing the likelihood of recurrence - the RS score. CANs modify the design of the RT-qPCR system through the inclusion of long synthetic oligonucleotides termed competitors, as well as through a novel method of selecting the primer and probe sequences and deciding on their concentration in the kit. One or more competitor oligos are included, each corresponding to one of the natural RNA targets. The concentration of a given competitor is related to the a priori decision boundary of the respective RNA target. A distinct probe may be designed specific to each competitor, to each target sequence, or there may be two probes, one designed to be specific to the competitor and one to the target. During enzymatic RT-qPCR amplification, these competitors compete for primers with the natural targets or with other competitors. The rate of amplification of a given amplicon (and thus the growth of the respective fluorescent signal) slows as its corresponding primers are consumed and stops completely once primers are exhausted. This competition for primers ensures that the final fluorescence intensity of the signal deriving from the natural RNA and / or the synthetic competitor is indicative of the relative concentration of the two at the start of the reaction. The final fluorescence intensities can be correlated with empirical patient data through any of several means known in the art. The present invention allows this assessment to take place in a near-patient setting, such as a molecular pathology lab in same hospital that performed the surgery. This is in contrast to existing tests such as Oncotype DX, which require the patient sample to be sent to the Exact Sciences facility in California. The present invention is easier to use than related tools in the prior art. Running the test requires only 1-6 aliquots of the purified RNA from the processed patient tumour sample, significantly fewer than other kits which require 12-63 or more. This allows the test to be run quickly while reducing variability that comes from splitting the sample across many reactions, which in turn improves performance. In some embodiments, the methods and kits of the invention, for example methods and kits herein referred to as OncoSignatur Breast Test methods and kits may be a kit, which can be easily run by a technician skilled in molecular pathology on readily available polymerase chain reaction (PCR) instrumentation (i.e., a real-time thermocycler). The data from the instrument can be correlated to the empirical risk through any of several means known in the art. In some embodiments the interpretation of the RS score derived by the present methods and kits is interpreted in the same way as the RS score derived from the Oncotype DX test. In some embodiments, the kit comprises a mixture of many synthetic oligonucleotides (oligos) along with a mixture of enzymes and other reagents. The synthetic oligonucleotides are the subject of the present invention; any of several reagent mixtures familiar to those skilled in the art could be used. The present invention uses similar concepts to reverse-transcriptase quantitative PCR mixture (RT-qPCR), which works as follows. The mixture of reagents first converts specific natural gene expression products (RNA transcripts) in the patient sample to complementary DNA (cDNA) then through the help of primer oligos generates copies of the cDNA sequences; this process is known as amplification and these copies are known as amplicons. Amplification occurs through extension of the primer oligos, which are consumed in the process. Additionally, probe oligos specific to each natural target are degraded by enzymes in the reagent mixture. These probes are synthesized with a fluorescent molecule attached to one end and a fluorescence-quenching molecule attached the other; degrading the probe separates these two labels, removing the quenching of the fluorophore and producing a fluorescent signal. Typically, this fluorescent signal is monitored until it exceeds a certain threshold known as a CT; the number of thermal cycles needed to exceed this threshold is quantitatively related to the starting concentration of the relevant RNA sequence. If there are multiple genes of interest, their respective RNA transcripts are quantified individually; either in the same reaction by using a probe with a fluorescent molecule attached or by using physically separate reactions to measure each transcript. The Oncotype DX test uses the CT values to arrive at the RS. The present invention uses the end-point fluorescence intensity achieved after a specified number of cycles to derive the RS value. Amplification of the 21 genes and subsequent fluorescent detection as performed by the Oncotype DX test requires 42 primers and 21 probes. One cannot simply combine these 42 primer and 21 probes into a single reaction and expect equivalent (or even acceptable) performance, nor can one simply take the existing high-throughput protocols and downsize them for a clinical lab. Furthermore, when using CANs in accordance with the present invention, the algorithm must be "embedded" into the design of the reaction components. Whereas in Oncotype DX, raw CTs of each target are fed into an algebraic equation to determine patient relapse risk, in the present invention the competitive amplification behaviour must be carefully tuned to produce an appropriate signal directly indicative of relapse risk. This similarly requires a combination of skilled knowledge, custom computer modeling, careful experimental design, and trial and error. Although CANs are known, in addition to the above mentioned difficulties in designing any new set of primers, which compound as the size of the primer set grows, the design of the competitors and component concentrations must be specific to each new application and gene set. The invention provides specific reaction components (probes and primers and competitor oligonucleotides) and conditions that have been specifically designed for multiplex amplification, and to convey the appropriate algorithm information into the end-point fluorescence. Detailed description of the invention The invention is as set out in the claims. The Oncotype DX test analyses the expression level of 21 genes - 5 housekeeping genes and 16 informative genes. These genes are grouped together into five different modules as described below. The prior art test requires the analysis of the expression level of each gene, and determination of the CT value using RT-PCR. The test of the current invention does not determine the expression level of each individual gene. Instead the present invention provides a read out of the end-point fluorescence, after a specified number of amplification cycles, of the genes within a given module. Furthermore, the endpoint fluorescence of a module does not simply provide a readout of the amount of starting material (i.e. the expression level of a particular gene in the sample) - instead the read out incorporates information of the relevance of each particular marker in the gene signature that is predictive of, for example, recurrence of breast cancer. This information is coded into the amplification reaction by the specific design of competitor oligonucleotides that correspond to each gene in the panel. The output of the amplification reaction is an end-point fluorescence level for each module which can be converted to an RS score, the same RS score as obtained via the Oncotype DX test, via a simple algorithm. Data in the Examples shows that the RS score obtained by the present invention correlates with the Oncotype DX RS score that is obtained by performing the Oncotype DX algorithm on synthetic samples. Accordingly, the invention provides methods of amplification of target polynucleotides. These methods can be used to give an output that can be used in an algorithm to generate a risk score, or an RS score comparable to the RS score of the Oncotype DX test. The invention provides various methods and compositions for amplifying the target nucleic acids; for obtaining a score that is can be used to predict breast cancer recurrences and determination of the likelihood of therapy being effective; and also methods of prognosis and determination of the likelihood of therapy being effective. Accordingly, in one aspect the invention provides a method of amplifying a plurality of of target polynucleotides in a sample, wherein the method comprises: a) providing a sample potentially comprising the at least two or a plurality of target polynucleotides; b) providing at least two or a plurality of sets of competitive target amplification oligonucleotides, wherein each set of competitive target amplification oligonucleotides is designed to amplify a particular target polynucleotide, and where each target to be amplified has a corresponding set of competitive target amplification oligonucleotides, and where within each set there comprises: i) a competitor polynucleotide; ii) a first primer and a second primer that are capable of hybridising to the particular target polynucleotide and to the first competitor polynucleotide of the set, wherein said first primer and second primer are arranged so that: hybridisation of the first and second primers to the particular target polynucleotide allows amplification of a portion of the particular target polynucleotide producing a target amplicon; and hybridisation of the first and second primers to the first competitor polynucleotide allows amplification of the first competitor polynucleotide, or of portion of the first competitor polynucleotide producing a competitor amplicon; and iii) a probe oligonucleotide which comprises a fluorescent label and which is capable of hybridising to the first competitor amplicon or the first target amplicon wherein the first competitor polynucleotide of each set is designed to have different amplification kinetics to that of the first target polynucleotide of each set; c) initiating a primer extension reaction such that: amplification of a portion of each of the at least two or plurality of target polynucleotides occurs resulting in the production of at least two, or a plurality of different target amplicons corresponding to each particular target; and amplification of each competitor polynucleotide, or a portion of each competitor polynucleotide of each set of competitive target amplification oligonucleotides occurs, resulting in the production of at least two or a plurality of different competitor amplicons wherein the plurality of target polynucleotides are cDNA molecules derived from a first and a second or a plurality of different mRNA polynucleotides present in a sample obtained from a subject and wherein the plurality of mRNA polynucleotides are expressed from the group comprising or consisting of the following genes: CD68, CTSV, MMP11, AURKA, BIRC5, CCNB1, MKI67, MYBL2, ERBB2, GRB7, BAG1, BCL2, ESRI, GSTM1, PGR, SCUBE2, ACTB, GAPDH, GUSB, RPLPO, TFRC. In some embodiments: a) where one of the at least two of or plurality of mRNA polynucleotides is expressed from CD68, then the corresponding set of competitive target amplification oligonucleotides comprises: a CD68 competitor polynucleotide; a CD68 first primer; a CD68 second primer; and a CD68 probe oligonucleotide; b) where one of the at least two of or plurality of mRNA polynucleotides is expressed from CTSV, then the corresponding set of competitive target amplification oligonucleotides comprises: a CTSV competitor polynucleotide; a CTSV first primer; a CTSV second primer; and a CTSV probe oligonucleotide; c) where one of the at least two of or plurality of mRNA polynucleotides is expressed from MMP11, then the corresponding set of competitive target amplification oligonucleotides comprises: a MMP11 competitor polynucleotide; a MMP11 first primer; a MMP11 second primer; and a MMP11 probe oligonucleotide; d) where one of the at least two of or plurality of mRNA polynucleotides is expressed from AURKA, then the corresponding set of competitive target amplification oligonucleotides comprises: a AURKA competitor polynucleotide; a AURKA first primer; a AURKA second primer; and a AURKA probe oligonucleotide; e) where one of the at least two of or plurality of mRNA polynucleotides is expressed from BIRC5, then the corresponding set of competitive target amplification oligonucleotides comprises: a BIRC5 competitor polynucleotide; a BIRC5 first primer; a BIRC5 second primer; and a BIRC5 probe oligonucleotide; f) where one of the at least two of or plurality of mRNA polynucleotides is expressed from CCNB1, then the corresponding set of competitive target amplification oligonucleotides comprises: a CCNB1 competitor polynucleotide; a CCNB1 first primer; a CCNB1 second primer; and a CCNB1 probe oligonucleotide; g) where one of the at least two of or plurality of mRNA polynucleotides is expressed from MKI67, then the corresponding set of competitive target amplification oligonucleotides comprises: a MKI67 competitor polynucleotide; a MKI67 first primer; a MKI67 second primer; and a MKI67 probe oligonucleotide; h) where one of the at least two of or plurality of mRNA polynucleotides is expressed from MYBL2, then the corresponding set of competitive target amplification oligonucleotides comprises: a MYBL2 competitor polynucleotide; a MYBL2 first primer; a MYBL2 second primer; and a MYBL2 probe oligonucleotide; i) where one of the at least two of or plurality of mRNA polynucleotides is expressed from ERBB2, then the corresponding set of competitive target amplification oligonucleotides comprises: a ERBB2 competitor polynucleotide; a ERBB2 first primer; a ERBB2 second primer; and a ERBB2 probe oligonucleotide; j) where one of the at least two of or plurality of mRNA polynucleotides is expressed from GRB7, then the corresponding set of competitive target amplification oligonucleotides comprises: a GRB7 competitor polynucleotide; a GRB7 first primer; a GRB7 second primer; and a GRB7 probe oligonucleotide; k) where one of the at least two of or plurality of mRNA polynucleotides is expressed from BAG1 then the corresponding set of competitive target amplification oligonucleotides comprises: a BAG1 competitor polynucleotide; a BAG1 first primer; a BAG1 second primer; and a BAG1 probe oligonucleotide; I) where one of the at least two of or plurality of mRNA polynucleotides is expressed from BCL2, then the corresponding set of competitive target amplification oligonucleotides comprises: a BCL2 competitor polynucleotide; a BCL2 first primer; a BCL2 second primer; and a BCL2 probe oligonucleotide; m) where one of the at least two of or plurality of mRNA polynucleotides is expressed from ESRI, then the corresponding set of competitive target amplification oligonucleotides comprises: a ESRI competitor polynucleotide; a ESRI first primer; a ESRI second primer; and a ESR.1 probe oligonucleotide; n) where one of the at least two of or plurality of mRNA polynucleotides is expressed from GSTM1, then the corresponding set of competitive target amplification oligonucleotides comprises: a GSTM1 competitor polynucleotide; a GSTM1 first primer; a GSTM1 second primer; and a GSTM1 probe oligonucleotide; o) where one of the at least two of or plurality of mRNA polynucleotides is expressed from PGR, then the corresponding set of competitive target amplification oligonucleotides comprises: a PGR competitor polynucleotide; a PGR first primer; a PGR second primer; and a PGR probe oligonucleotide; p) where one of the at least two of or plurality of mRNA polynucleotides is expressed from SCUBE2, then the corresponding set of competitive target amplification oligonucleotides comprises: a SCUBE2 competitor polynucleotide; a SCUBE2 first primer; a SCUBE2 second primer; and a SCUBE2 probe oligonucleotide; q) where one of the at least two of or plurality of mRNA polynucleotides is expressed from ACTB, then the corresponding set of competitive target amplification oligonucleotides comprises: a ACTB competitor polynucleotide; a ACTB first primer; a ACTB second primer; and a ACTB probe oligonucleotide; r) where one of the at least two of or plurality of mRNA polynucleotides is expressed from GAPDH, then the corresponding set of competitive target amplification oligonucleotides comprises: a GAPDH competitor polynucleotide; a GAPDH first primer; a GAPDH second primer; and a GAPDH probe oligonucleotide; s) where one of the at least two of or plurality of mRNA polynucleotides is expressed from GUSB, then the corresponding set of competitive target amplification oligonucleotides comprises: a GUSB competitor polynucleotide; a GUSB first primer; a GUSB second primer; and a GUBS probe oligonucleotide; t) where one of the at least two of or plurality of mRNA polynucleotides is expressed from RPLPO, then the corresponding set of competitive target amplification oligonucleotides comprises: a RPLPO competitor polynucleotide; a RPLPO first primer; a RPLPO second primer; and a RPLPO probe oligonucleotide; and / or w) where one of the at least two of or plurality of mRNA polynucleotides is expressed from TFRC, then the corresponding set of competitive target amplification oligonucleotides comprises: a TFRC competitor polynucleotide; a TFRC first primer; a TFRC second primer; and a TFRC probe oligonucleotide. In some embodiments, one probe may be used to detect multiple target polynucleotides. Accordingly, in one embodiment, the sequence of a probe oligonucleotide of a given set of competitive oligonucleotides may be the same sequence of a probe oligonucleotide of a different set of competitive oligonucleotides. In some embodiments, the fluorescent label of the probe oligonucleotide of a given set of competitive oligonucleotides may be the same as the fluorescent label of a probe oligonucleotide of a second different set of competitive oligonucleotides. In some embodiments, the plurality of target polynucleotides are grouped into a House Keeping (HK) Module, an Invasion Module; a Proliferation Module; a HER2 Module; and an Estrogen Module, wherein: a) the House Keeping Module comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: ACTB, GAPDH, GUSB, RPLPO and TFRC; b) the Invasion Module comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: CD68, CTSV and MMP11; c) the Proliferation Module comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: AURKA, BIRC5, CCNB1, MKI67 and MYBL2; d) the HER2 Module comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: ERBB2 and GRB7; and / or e) the Estrogen Module comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: BAG1, BLC2, ESRI, GSTM1, PGR and SCUBE2. Any number of target polynucleotides may be amplified within a given module; however, preferably each target polynucleotide is amplified. Accordingly, in one embodiment, the method comprises amplifying each target within a module. The target polynucleotides of any number of modules may be amplified. In some embodiments, the method comprises amplifying target polynucleotides of the House Keeping Module, Invasion Module, Proliferation Module, HER2 Module and / or the Estrogen Module. The House Keeping Module, Invasion Module, Proliferation Module, HER2 Module and / or the Estrogen Module are amplified in separate reactions, for example in separate wells of a reaction plate, or the same reaction i.e. within the same well of a reaction plate. In some embodiments, each probe within a module is labelled with the same fluorescent label which is a Module fluorescent label. In some configurations of this embodiment: The Module fluorescent label of each probe associated with a target in the House Keeping Module is labelled with a House Keeping Module fluorescent label; The Module fluorescent label of each probe associated with a target in the Invasion Module is labelled with a Invasion Module fluorescent label; The Module fluorescent label of each probe associated with a target in the Proliferation Module is labelled with a Proliferation Module fluorescent label; The Module fluorescent label of each probe associated with a target in the HER2 Module is labelled with a HER.2 Module fluorescent label; The Module fluorescent label of each probe associated with a target in the Estrogen Module is labelled with a Estrogen Module fluorescent label; As will be understood, the target polynucleotides of multiple modules may be amplified in one (or the same) amplification reaction - i.e., the modules may be amplified in a multiplexed reaction. Accordingly, in some embodiments, the method comprises amplifying target polynucleotides from two, three, four or five modules in the same amplification reaction. By House Keeping Module fluorescent label, Proliferation Module fluorescent label, Invasion Module fluorescent label, HER2 Module fluorescent label, and Estrogen Module fluorescent label we include the meaning of any fluorescent label. As described elsewhere herein, within a given module, the same fluorescent label is used, hence reference to a House Keeping Module fluorescent label is intended to refer to a fluorescent label that is present on the probe or probes that are associated with the House Keeping module. In some embodiments, each Module fluorescent label has a different compatible fluorescent label. For example, where the House Keeping Module is amplified in the same amplification reaction as the HER2 Module and the Estrogen Module, the House Keeping Module fluorescent label, the HER2 Module fluorescent label and the Estrogen Module fluorescent label must be capable of being discriminated from another - i.e., must be compatible with one another. The skilled person is well aware of the concept of multiplexing, and the requirement to choose appropriate probe labels that do not interfere with one another and give output signals that can be read and discriminated from the output signal of other probes. A key part of the invention requires that each group of target polynucleotides in a module be amplified together using a probe or probes that have the same fluorophore. Multiplexing probes for PCR amplification is well known and the skilled person will be aware that suitable fluorescent labels can be chosen so that multiple modules can be analysed together in the same amplification reaction, using probes with compatible fluorophores. Exemplary compatible fluorophores may be selected, for example, from Figure 1. In some embodiments then one or more of the modules are ran together in the same amplification reaction, each module using a probe or probes with different but compatible fluorescent labels. In other embodiments, each of the modules are analysed separately meaning that although different fluorescent labels may be used, it is also possible to use the same fluorescent label. Figure 5 shows a number of different variations of this. The different types of shading indicate different fluorescent labels. For example Figure 5A indicates five separate amplification reactions, each using probes that are labelled with the same fluorescent label. Since the amplification reactions are independent, there is no need to consider the compatibility of the fluorescent labels. Figure 5B again demonstrates five independent amplification reactions, but in this case the probes are labelled with different fluorescent labels. Figure 5 C shows two different amplification reactions. One reaction amplifies and analyses four of the modules - within this reaction the probe(s) associated with each module are labelled with different, compatible fluorescent labels (indicated by the different shading). The second reaction amplifies a single module. The probe(s) associated with this module may be labelled with a fluorescent label that is different to the labels used in the first reaction, or may be the same as one of the labels used in the first reaction. Since this second reaction is performed independently of the first reaction the choice of fluorescent label is largely irrelevant (depending on whether there are any non-specific fluorophores present in the reaction). Figure 5 D shows the case where just four of the modules are amplified, again each using a probe(s) with different fluorescent labels, specific to each module. Figure 5E shows the same set up as that of Figure 5A but in the presence of the non-specific marker EvaGreen. Figure 5F shows the same configuration as Figure 5B but with some modules amplified in the presence of EvaGreen and some in the presence of EvaRuby. Figure 5G and 5H again show the same configurations as Figures 5 C and D, in the presence of different nonspecific fluorescent markers. It will be clear to the skilled person that there are many different configurations in which the methods of the invention can be performed. The key feature being that the end-point fluorescence from each module must be able to be determined - whether that is by performing 5 separate individual amplification reactions (one for each module), or one reaction with 5 different compatible fluorescent markers, and all combinations in between. The skilled person knows how to choose fluorophores and labels that are compatible with one another, for example as set out below. Fluorescent labels The use of multiplex PCR with different fluorescently labelled probes is routine in the art, and the skilled person is well able to select appropriate fluorescent labels to labelling each probe oliogonucleotide within a set of competitive amplification oligonucleotides. For example the skilled person will appreciate that when selecting appropriate fluorescent labels for multiplex PCR. or multiplex qPCR assays, several considerations should be taken into account to ensure accurate and reliable results: Unique Reporter Dyes: Each different fluorescent label used in the amplification reaction of the invention set must have a unique reporter dye with distinct spectra. This allows for the differentiation of amplifications based on fluorescent signals. Crosstalk Mitigation: Crosstalk, which is the interference of the fluorescent signal from one reporter into adjacent channels, must be avoided. Select dye-sets with emission spectra that are sufficiently distant from each other to be easily resolved. The choice of optical specifications should align with the thermal-cycler used, considering the excitation source (LASER, lamp, or LED) and detection filters. Compatibility: The selected fluorescent labels should be compatible with your instrument. This means that there should not be a significant overlap between the excitation and emission spectra of the fluorophores and the instrument's detection channels. Crosstalk can lead to false positive amplifications and hinder quantification. Calibration: Real-time qPCR instruments must be calibrated for the specific set of dyes chosen for the experiment. The calibration ensures that the instrument can accurately detect the emission spectrum for each dye, minimizing background and signal overlap. Dye Selection: The skilled person will be able to choose dyes that are compatible with a specific instrument model. Tools like the PrimeTime Multiplex Dye Selection Tool can help identify compatible dyes for various instrument models. The instrument will need calibration since some dyes may be compatible with an instrument but require instrument calibration. An alternative set of dyes may be available for such cases. Fluorescent labels should be selected with appropriate excitation wavelengths and minimal to no overlap in their emission spectra. The skilled person can take into account the total fluorescence intensity. In some instances, any of the amplification reactions of the invention may comprise additional dyes or labels that are used as passive references labels. For example in some instances the amplification reaction comprises a fluorescent dye that intercalates or otherwise binds non- specifically to the DNA of polynucleotides in the amplification reaction. There are many non-specific dyes that may be used for this purpose, for example Sybr Green, EvaGreen or EvaRuby. In addition other references dyes such as ROX may be included in the amplification reaction. The choice of fluorescent label for use with the probe oligonucleotides of the present invention should also take into account the spectra of these non-specific non-probe fluorescent labels and dyes. Minimize Cross-Talk: To reduce cross-talk in multiplex reactions, the skilled person will know to select probes with low background fluorescence. Quenchers can also be used. Accordingly in any of the methods and compositions of the invention, any probe oligonucleotide may also comprise a quencher, in addition to the fluorescent label. Efficient dark quenchers, especially when used in combination with secondary internal quenchers, can significantly reduce background fluorescence. Double-quenched probes offer advantages, such as clear endpoint signals and earlier quantification cycle (Cq) values. Consistency in the type of quencher used (all dark quenchers or all fluorescent quenchers) is recommended for multiplexed assays to minimize background fluorescence. The skilled person is therefore well able to select appropriate fluorescent labels for use with any of the probe oligonucleotides of the invention. In some embodiments, the sequence of a probe oligonucleotide of a given set of competitive oligonucleotides may be the same sequence of a probe oligonucleotide of a different set of competitive oligonucleotides. In some embodiments, one or more Modules comprises a single probe oligonucleotide, optionally probe oligonucleotide is capable of hybridising to the competitor amplicon or the target amplicon. The probes described here hybridise to the competitor amplicon, but could be designed to hybridise to the target amplicon. In some embodiments, multiple probes ( / .e., at least two or more probes) are used to give a fluorescent readout for each target polynucleotide of a given Module. This may be termed the "multi-probe" method. In the multi-probe method, one or more sets of competitive amplification oligonucleotides that are used to amplify the target polynucleotides of a given module comprise one or more probe oligonucleotides with a different sequence to one or more other probe oligonucleotides in the same sets of competitive amplification oligonucleotides used for the given Module, i.e., the targets of the Module are amplified using sets of competitive amplification oligonucleotides that have a different probe oligonucleotide with a different nucleic acid sequence to one or more other probes of the sets of competitive amplification oligonucleotides the same universal module probe that has been designed so as to hybridise to the competitor amplicon and / or target amplicon of each target of the Module. Suitable competitor and probe sequences for the Multi-Probe method are set out in Table 1. In other embodiments, a single fluorescently labelled probe is used to give a fluorescent readout for each target polynucleotide of a given Module, i.e., a single probe can hybridise to each of the competitor amplicons generated for targets produced for example from the BAG1, BCL2, ESRI, GSTM1, PGR. and SCUBE2 genes -i.e., the genes comprised the Estrogen Module. This may be termed the "single-probe" method. In these embodiments each set of competitive amplification oligonucleotides that are used to amplify the target polynucleotides of a given module all comprise the same probe oligonucleotide sequence, i.e., the targets of the Module are amplified using sets of competitive amplification oligonucleotides that each comprises the same universal module probe that has been designed so as to hybridise to the competitor amplicon and / or target amplicon of each target of the Module. Suitable competitor and probe sequences for the single-Probe method are set out in Table 2. In some embodiments, the target polynucleotides of a single module are amplified in an amplification reaction in the absence of amplification of target polynucleotides of another module. In some embodiments, the module probe is any fluorescent label and is independent of the choice of fluorescent labels used in the amplification of target polynucleotides of other modules in other amplification reactions. In some embodiments, the amplification comprises five different amplification reactions, comprising: a first amplification reaction for the amplification of the Invasion Module; a second amplification reaction for the amplification of the Proliferation Module; a third amplification reaction for the amplification of the HER2 Module; a fourth amplification reaction for the amplification of the Estrogen Module; a first amplification reaction for the amplification of the House Keeping Module; and wherein the choice of Module fluorescent label for each module is independent. As will be understood, where each module is amplified in a separate amplification reaction, there is no need to discriminate between amplification of the different modules. Accordingly, where each module is amplified in a separate amplification reaction, the fluorophores may be incompatible between different reactions, and / or may be the same between different reactions. In some embodiments, the Invasion Module fluorescent label, the Proliferation Module fluorescent label, the HER.2 Module fluorescent label, the Estrogen Module fluorescent label, and the House Keeping Module fluorescent label are all the same label. By following the disclosure provided herein the skilled person is able to determine sequences of the competitor polynucleotides, first primers, second primers, and probe oligonucleotides that may be used in the methods provided herein. In preferred embodiments, the methods provided herein are practiced using the following polynucleotides: The CD68 competitor polynucleotide has a sequence of [SEQ ID NO: 20] or [SEQ ID NO: 81]; The CD68 first primer has a sequence of [SEQ ID NO: 17]; The CD68 second primer has a sequence of [SEQ ID NO: 18 ]; The CD68 probe oligonucleotide has a sequence of [SEQ ID NO: 19] or [SEQ ID NO: 84]; The CTSV competitor polynucleotide has a sequence of [SEQ ID NO: 24 ] or [SEQ ID NO: 82]; The CTSV first primer has a sequence of [SEQ ID NO: 21]; The CTSV second primer has a sequence of [SEQ ID NO: 22 ]; The CTSV probe oligonucleotide has a sequence of [SEQ ID NO: 23] or [SEQ ID NO: 84]; The MMP11 competitor polynucleotide has a sequence of [SEQ ID NO: 28] or [SEQ ID NO: 83]; The MMP11 first primer has a sequence of [SEQ ID NO: 25]; The MMP11 second primer has a sequence of [SEQ ID NO: 26]; The MMP11 probe oligonucleotide has a sequence of [SEQ ID NO: 27] or [SEQ ID NO: 84]; The AURKA competitor polynucleotide has a sequence of [SEQ ID NO: 32]; The AURKA first primer has a sequence of [SEQ ID NO: 29]; The AURKA second primer has a sequence of [SEQ ID NO: 30]; The AURKA probe oligonucleotide has a sequence of [SEQ ID NO: 31] or [SEQ ID NO: 85]; The BIRC5 competitor polynucleotide has a sequence of [SEQ ID NO: 36]; The BIRC5 first primer has a sequence of [SEQ ID NO: 33]; The BIRC5 second primer has a sequence of [SEQ ID NO: 34]; The BIRC5 probe oligonucleotide has a sequence of [SEQ ID NO: 35] or [SEQ ID NO: 85]; The CCNB1 competitor polynucleotide has a sequence of [SEQ ID NO: 40]; The CCNB1 first primer has a sequence of [SEQ ID NO: 37]; The CCNB1 second primer has a sequence of [SEQ ID NO: 38]; The CCNB1 probe oligonucleotide has a sequence of [SEQ ID NO: 39] or [SEQ ID NO: 85]; The MKI67 competitor polynucleotide has a sequence of [SEQ ID NO: 44]; The MKI67 first primer has a sequence of [SEQ ID NO: 41]; The MKI67 second primer has a sequence of [SEQ ID NO: 42]; The MKI67 probe oligonucleotide has a sequence of [SEQ ID NO: 43] or [SEQ ID NO: 85]; The MYBL2 competitor polynucleotide has a sequence of [SEQ ID NO: 48]; The MYBL2 first primer has a sequence of [SEQ ID NO: 45]; The MYBL2 second primer has a sequence of [SEQ ID NO: 46]; The MYBL2 probe oligonucleotide has a sequence of [SEQ ID NO: 47] or [SEQ ID NO: 85]; The ERBB2 competitor polynucleotide has a sequence of [SEQ ID NO: 52]; The ERBB2 first primer has a sequence of [SEQ ID NO: 49]; The ERBB2 second primer has a sequence of [SEQ ID NO: 50]; The ERBB2 probe oligonucleotide has a sequence of [SEQ ID NO: 51] or [SEQ ID NO: 86]; The GRB7 competitor polynucleotide has a sequence of [SEQ ID NO: 56]; The GRB7 first primer has a sequence of [SEQ ID NO: 53]; The GRB7 second primer has a sequence of [SEQ ID NO: 54]; The GRB7 probe oligonucleotide has a sequence of [SEQ ID NO: 55] or [SEQ ID NO: 86]; The BAG1 competitor polynucleotide has a sequence of [SEQ ID NO: 60] or [SEQ ID NO: 87]; The BAG1 first primer has a sequence of [SEQ ID NO: 57]; The BAG1 second primer has a sequence of [SEQ ID NO: 58]; The BAG1 probe oligonucleotide has a sequence of [SEQ ID NO: 59] or [SEQ ID NO: 93]; The BCL2 competitor polynucleotide has a sequence of [SEQ ID NO: 64] or [SEQ ID NO: 88]; The BCL2 first primer has a sequence of [SEQ ID NO: 61]; The BCL2 second primer has a sequence of [SEQ ID NO: 62]; The BCL2 probe oligonucleotide has a sequence of [SEQ ID NO: 63] or [SEQ ID NO: 93]; The ESRI competitor polynucleotide has a sequence of [SEQ ID NO: 68] or [SEQ ID NO: 89]; The ESRI first primer has a sequence of [SEQ ID NO: 65]; The ESRI second primer has a sequence of [SEQ ID NO: 66]; The ESRI probe oligonucleotide has a sequence of [SEQ ID NO: 67] or [SEQ ID NO: 93]; The GSTM1 competitor polynucleotide has a sequence of [SEQ ID NO: 72] or [SEQ ID NO: 90]; The GSTM1 first primer has a sequence of [SEQ ID NO: 69]; The GSTM1 second primer has a sequence of [SEQ ID NO: 70]; The GSTM1 probe oligonucleotide has a sequence of [SEQ ID NO: 71] or [SEQ ID NO: 93]; The PGR competitor polynucleotide has a sequence of [SEQ ID NO: 76] or [SEQ ID NO: 91]; The PGR first primer has a sequence of [SEQ ID NO: 73]; The PGR second primer has a sequence of [SEQ ID NO: 74]; The PGR probe oligonucleotide has a sequence of [SEQ ID NO: 75] or [SEQ ID NO: 93]; The SCUBE2 competitor polynucleotide has a sequence of [SEQ ID NO: 80] or [SEQ ID NO: 92]; The SCUBE2 first primer has a sequence of [SEQ ID NO: 77]; The SCUBE2 second primer has a sequence of [SEQ ID NO: 78]; The SCUBE2 probe oligonucleotide has a sequence of [SEQ ID NO: 79] or [SEQ ID NO: 93]; The ACTB competitor polynucleotide has a sequence of [SEQ ID NO: 3]; The ACTB first primer has a sequence of [SEQ ID NO: 1]; The ACTB second primer has a sequence of [SEQ ID NO: 2]; The ACTB probe oligonucleotide has a sequence of [SEQ ID NO: 16]; The GAPDH competitor polynucleotide has a sequence of [SEQ ID NO: 6]; The GAPDH first primer has a sequence of [SEQ ID NO: 4]; The GAPDH second primer has a sequence of [SEQ ID NO: 5]; The GAPDH probe oligonucleotide has a sequence of [SEQ ID NO: 16]; The GUSB competitor polynucleotide has a sequence of [SEQ ID NO: 9]; The GUSB first primer has a sequence of [SEQ ID NO: 7]; The GUSB second primer has a sequence of [SEQ ID NO: 8]; The GUBS probe oligonucleotide has a sequence of [SEQ ID NO: 16];The RPLPO competitor polynucleotide has a sequence of [SEQ ID NO: 12]; The RPLPO first primer has a sequence of [SEQ ID NO: 10]; The RPLPO second primer has a sequence of [SEQ ID NO: 11]; The RPLPO probe oligonucleotide has a sequence of [SEQ ID NO: 16]; The TFRC competitor polynucleotide has a sequence of [SEQ ID NO: 15]; The TFRC first primer has a sequence of [SEQ ID NO: 13]; The TFRC second primer has a sequence of [SEQ ID NO: 14]; and / or The TFRC probe oligonucleotide has a sequence of [SEQ ID NO: 16]. In some embodiments: a) The amplification is for the amplification of the House Keeping Module that comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: ACTB, GAPDH, GUSB, RPLPO and TFRC, and wherein the set of competitive amplification polynucleotides comprises or consists of: a first ACTB primer of SEQ ID NO: 1; a second ACTB primer of SEQ ID NO: 2; an ACTB competitor polynucleotide of SEQ ID NO: 3; a first GAPDH primer of SEQ ID NO: 4; a second GAPDH primer of SEQ ID NO: 5; an GAPDH competitor polynucleotide of SEQ ID NO: 6; a first GUSB primer of SEQ ID NO: 7; a second GUSB primer of SEQ ID NO: 8; an GUSB competitor polynucleotide of SEQ ID NO: 9; a first RPLPO primer of SEQ ID NO: 10; a second RPLPOprimer of SEQ ID NO: 11; an RPLPO competitor polynucleotide of SEQ ID NO: 12; a first TRFC primer of SEQ ID NO: 13; a second TRFC primer of SEQ ID NO: 14; an TRFC competitor polynucleotide of SEQ ID NO: 15; and a universal House Keeping Module probe oligonucleotide of SEQ ID NO: 16 labelled with a House Keeping Fluorescent label; b) The amplification is for the amplification of the Invasion Module that comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: CD68, CTSV and MMP11, and wherein the set of competitive amplification polynucleotides comprises or consists of: i) a first CD68 primer of SEQ ID NO: 17; a second CD68 primer of SEQ ID NO: 18; an CD68 competitor polynucleotide of SEQ ID NO: 20; and a CD68 probe oligonucleotide of SEQ ID NO: 19 labelled with an Invasion Module Fluorescent label; a first CTSV primer of SEQ ID NO: 21; a second CTSV primer of SEQ ID NO: 22; an CTSV competitor polynucleotide of SEQ ID NO: 24; and a CTSV probe oligonucleotide of SEQ ID NO: 23 labelled with an Invasion Module Fluorescent label; and a first MMP11 primer of SEQ ID NO: 25; a second MMP11 primer of SEQ ID NO: 26; an MMP11 competitor polynucleotide of SEQ ID NO: 28; and a MMP11 probe oligonucleotide of SEQ ID NO: 27 labelled with an Invasion Module Fluorescent label; or ii) a first CD68 primer of SEQ ID NO: 17; a second CD68 primer of SEQ ID NO: 18; an CD68 competitor polynucleotide of SEQ ID NO: 81; a first CTSV primer of SEQ ID NO: 21; a second CTSV primer of SEQ ID NO: 22; an CTSV competitor polynucleotide of SEQ ID NO: 82; a first MMP11 primer of SEQ ID NO: 25; a second MMP11 primer of SEQ ID NO: 26; an MMP11 competitor polynucleotide of SEQ ID NO: 83; and a universal Invasion Module probe oligonucleotide of SEQ ID NO: 84 labelled with an Invasion Module Fluorescent label; c) The amplification is for the amplification of the Proliferation Module that comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: AURKA, BIRC5, CCNB1, MK167 and MYBL2 and wherein the set of competitive amplification polynucleotides comprises or consists of: i) a first AURKA primer of SEQ ID NO: 29; a second AURKA primer of SEQ ID NO: 30; an AURKA competitor polynucleotide of SEQ ID NO: 32; and a AURKA probe oligonucleotide of SEQ ID NO: 31 labelled with a Proliferation Module Fluorescent label; a first BIRC5 primer of SEQ ID NO: 33; a second BIRC5 primer of SEQ ID NO: 34; an BIRC5 competitor polynucleotide of SEQ ID NO: 36; and a BIRC5 probe oligonucleotide of SEQ ID NO: 35 labelled with a Proliferation Module Fluorescent label; a first CCNB1 primer of SEQ ID NO: 37; a second CCNBlprimer of SEQ ID NO: 38; an CCNBlcompetitor polynucleotide of SEQ ID NO: 40; and a CCNBlprobe oligonucleotide of SEQ ID NO: 39 labelled with a Proliferation Module Fluorescent label; a first MK167 primer of SEQ ID NO: 41; a second MK167 of SEQ ID NO: 42; an MK167 competitor polynucleotide of SEQ ID NO: 44; and a MK167 probe oligonucleotide of SEQ ID NO: 43 labelled with a Proliferation Module Fluorescent label; a first MYBL2 primer of SEQ ID NO: 45; a second MYBL2 of SEQ ID NO: 46; an MYBL2 competitor polynucleotide of SEQ ID NO: 48; and a MYBL2 probe oligonucleotide of SEQ ID NO: 47 labelled with a Proliferation Module Fluorescent label; or ii) a first AURKA primer of SEQ ID NO: 29; a second AURKA primer of SEQ ID NO: 30; an AURKA competitor polynucleotide of SEQ ID NO: 32; and a first BIRC5 primer of SEQ ID NO: 33; a second BIRC5 primer of SEQ ID NO: 34; an BIRC5 competitor polynucleotide of SEQ ID NO: 36; and a first CCNB1 primer of SEQ ID NO: 37; a second CCNBlprimer of SEQ ID NO: 38; an CCNBlcompetitor polynucleotide of SEQ ID NO: 40; and a first MK167 primer of SEQ ID NO: 41; a second MK167 of SEQ ID NO: 42; an MK167 competitor polynucleotide of SEQ ID NO: 44; and a first MYBL2 primer of SEQ ID NO: 45; a second MYBL2 of SEQ ID NO: 46; an MYBL2 competitor polynucleotide of SEQ ID NO: 48; and a universal Proliferation Module probe oligonucleotide of SEQ ID NO: 85 labelled with a Proliferation Module Fluorescent label; d) The amplification is for the amplification of the HER2 Module that comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: ERBB2 and GRB7 and wherein the set of competitive amplification polynucleotides comprises or consists of: i) a first ERBB2 primer of SEQ ID NO: 49; a second ERBB2 of SEQ ID NO: 50; an ERBB2 competitor polynucleotide of SEQ ID NO: 52 and a ERBB2 probe oligonucleotide of SEQ ID NO: 51 labelled with a HER2 Module Fluorescent label; a first GRB7 primer of SEQ ID NO: 53; a second GRB7 of SEQ ID NO: 54; an GRB7 competitor polynucleotide of SEQ ID NO: 56 and a GRB7 probe oligonucleotide of SEQ ID NO: 55 labelled with a HER2 Module Fluorescent label; or ii) a first ERBB2 primer of SEQ ID NO: 49; a second ERBB2 of SEQ ID NO: 50; an ERBB2 competitor polynucleotide of SEQ ID NO: 52; and a first GRB7 primer of SEQ ID NO: 53; a second GRB7 of SEQ ID NO: 54; an GRB7 competitor polynucleotide of SEQ ID NO: 56 and a universal HER2 module probe oligonucleotide of SEQ ID NO: 86 labelled with a HER2 Module Fluorescent label; e) The amplification is for the amplification of the Estrogen Module that comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: BAG1, BCL2, ESRI, GSTM1, PGR and SCUBE2 and wherein the set of competitive amplification polynucleotides comprises or consists of: i) a first BAG1 primer of SEQ ID NO: 57; a second BAG1 of SEQ ID NO: 58; an BAG1 competitor polynucleotide of SEQ ID NO: 60 and a BAG1 probe oligonucleotide if SEQ ID NO: 59 labelled with an Estrogen Module Fluorescent label; a first BCL2 primer of SEQ ID NO: 61; a second BCL2 of SEQ ID NO: 62; an BCL2 competitor polynucleotide of SEQ ID NO: 64 and a BCL2 probe oligonucleotide if SEQ ID NO: 63 labelled with an Estrogen Module Fluorescent label; a first ESRI primer of SEQ ID NO: 65; a second ESRI of SEQ ID NO: 66; an ESRI competitor polynucleotide of SEQ ID NO: 68 and a ESRI probe oligonucleotide if SEQ ID NO: 67 labelled with an Estrogen Module Fluorescent label; a first GSTM1 primer of SEQ ID NO: 69; a second GSTM1 of SEQ ID NO: 70; an GSTM1 competitor polynucleotide of SEQ ID NO: 72 and a GSTM1 probe oligonucleotide if SEQ ID NO: 71 labelled with an Estrogen Module Fluorescent label; a first PGR primer of SEQ ID NO: 73 a second PGR of SEQ ID NO: 74; an PGR competitor polynucleotide of SEQ ID NO: 76 and a PGR 1 probe oligonucleotide if SEQ ID NO: 75 labelled with an Estrogen Module Fluorescent label; a first SCUBE2 primer of SEQ ID NO: 77; a second SCUBE2 of SEQ ID NO: 78; an SCUBE2 competitor polynucleotide of SEQ ID NO: 80 and a SCUBE2 probe oligonucleotide if SEQ ID NO: 79 labelled with an Estrogen Module Fluorescent label; or ii) a first BAG1 primer of SEQ ID NO: 57; a second BAG1 of SEQ ID NO: 58; an BAG1 competitor polynucleotide of SEQ ID NO: 87 a first BCL2 primer of SEQ ID NO: 61; a second BCL2 of SEQ ID NO: 62; an BCL2 competitor polynucleotide of SEQ ID NO: 88 a first ESRI primer of SEQ ID NO: 65; a second ESRI of SEQ ID NO: 66; an ESRI competitor polynucleotide of SEQ ID NO: 89 a first GSTM1 primer of SEQ ID NO: 69; a second GSTM1 of SEQ ID NO: 70; an GSTM1 competitor polynucleotide of SEQ ID NO: 90; a first PGR. primer of SEQ ID NO: 73; a second PGR of SEQ ID NO: 74; an PGR competitor polynucleotide of SEQ ID NO: 91 a first SCUBE2 primer of SEQ ID NO: 77; a second SCUBE2 of SEQ ID NO: 78; an SCUBE2 competitor polynucleotide of SEQ ID NO: 92; and a universal Estrogen Module probe oligonucleotide of SEQ ID NO: 93 labelled with an Estrogen Module Fluorescent label. In some embodiments, the concentration of each oligonucleotide is optionally as set out below: a first ACTB primer of SEQ ID NO: 1 of concentration 33 nM; a second ACTB primer of SEQ ID NO: 2 of concentration 33 nM; an ACTB competitor polynucleotide of SEQ ID NO: 3 of concentration 1.8e+02 copies / pL; a first GAPDH primer of SEQ ID NO: 4 of concentration 14 nM; a second GAPDH primer of SEQ ID NO: 5 of concentration; 14 nM an GAPDH competitor polynucleotide of SEQ ID NO: 6 of concentration le+02 copies / pL; a first GUSB primer of SEQ ID NO: 7 of concentration 22 nM; a second GUSB primer of SEQ ID NO: 8 of concentration 22 nM; an GUSB competitor polynucleotide of SEQ ID NO: 9 of concentration 1.3e+02 copies / pL; a first RPLPO primer of SEQ ID NO: 10 of concentration 66 nM; a second RPLPOprimer of SEQ ID NO: 11 of concentration 66 nM; an RPLPO competitor polynucleotide of SEQ ID NO: 12 of concentration 2.9 copies / pL; a first TRFC primer of SEQ ID NO: 13 of concentration 84 nM; a second TRFC primer of SEQ ID NO: 14 of concentration 84 nM; an TRFC competitor polynucleotide of SEQ ID NO: 15 of concentration 1.4 copies / pL; a universal House Keeping Module probe oligonucleotide of SEQ ID NO: 16 labelled with a House Keeping Fluorescent label of concentration 262 nM; a first CD68 primer of SEQ ID NO: 17 of concentration 23 nM; a second CD68 primer of SEQ ID NO: 18 of concentration 23 nM; an CD68 competitor polynucleotide of SEQ ID NO: 20 of concentration 0.6 copies / pL; a CD68 probe oligonucleotide of SEQ ID NO: 19 labelled with an Invasion Module Fluorescent label of concentration 28 nM; a first CTSV primer of SEQ ID NO: 21 of concentration 28 nM; a second CTSV primer of SEQ ID NO: 22 of concentration 28 nM; an CTSV competitor polynucleotide of SEQ ID NO: 24 of concentration 0.013 copies / pL; a CTSV probe oligonucleotide of SEQ ID NO: 23 labelled with an Invasion Module Fluorescent label of concentration 34 nM; a first MMP11 primer of SEQ ID NO: 25 of concentration 20 nM; a second MMP11 primer of SEQ ID NO: 26 of concentration 20 nM; an MMP11 competitor polynucleotide of SEQ ID NO: 28 of concentration 2.6 copies / pL; a MMP11 probe oligonucleotide of SEQ ID NO: 27 labelled with an Invasion Module Fluorescent label of concentration 24 nM; an CD68 competitor polynucleotide of SEQ ID NO: 81 of concentration; 0.6 copies / pL; an CTSV competitor polynucleotide of SEQ ID NO: 82 of concentration 0.013 copies / pL; an MMP11 competitor polynucleotide of SEQ ID NO: 83 of concentration 2.6 copies / pL; a universal Invasion Module probe oligonucleotide of SEQ ID NO: 84 labelled with an Invasion Module Fluorescent label of concentration 86 nM; a first AURKA primer of SEQ ID NO: 29 of concentration; 17 nM; a second AURKA primer of SEQ ID NO: 30 of concentration 17 nM; an AURKA competitor polynucleotide of SEQ ID NO: 32 of concentration 1.5 copies / pL; a AURKA probe oligonucleotide of SEQ ID NO: 31 labelled with a Proliferation Module Fluorescent label of concentration 20 nM; a first BIRC5 primer of SEQ ID NO: 33 of concentration 10 nM; a second BIRC5 primer of SEQ ID NO: 34 of concentration 10 nM; an BIRC5 competitor polynucleotide of SEQ ID NO: 36 of concentration 0.13 copies / pL; a BIRC5 probe oligonucleotide of SEQ ID NO: 35 labelled with a Proliferation Module Fluorescent label of concentration 12 nM; a first CCNB1 primer of SEQ ID NO: 37 of concentration 10 nM; a second CCNB1 primer of SEQ ID NO: 38 of concentration 10 nM; an CCNB1 competitor polynucleotide of SEQ ID NO: 40 of concentration 0.19 copies / pL; a CCNB1 probe oligonucleotide of SEQ ID NO: 39 labelled with a Proliferation Module Fluorescent label of concentration 12 nM; a first MK167 primer of SEQ ID NO: 41 of concentration 15 nM; a second MK167 of SEQ ID NO: 42 of concentration 15 nM; an MK167 competitor polynucleotide of SEQ ID NO: 44 of concentration 0.021 copies / pL; a MK167 probe oligonucleotide of SEQ ID NO: 43 labelled with a Proliferation Module Fluorescent label of concentration 19 nM; a first MYBL2 primer of SEQ ID NO: 45 of concentration 8 nM; a second MYBL2 of SEQ ID NO: 46 of concentration 8 nM; an MYBL2 competitor polynucleotide of SEQ ID NO: 48 of concentration 2.6e+03 copies / pL; a MYBL2 probe oligonucleotide of SEQ ID NO: 47 labelled with a Proliferation Module Fluorescent label of concentration 10 nM; a universal Proliferation Module probe oligonucleotide of SEQ ID NO: 85 labelled with a Proliferation Module Fluorescent label of concentration 73 nM; a first ERBB2 primer of SEQ ID NO: 49 of concentration 15 nM; a second ERBB2 of SEQ ID NO: 50 of concentration 15 nM; an ERBB2 competitor polynucleotide of SEQ ID NO: 52 of concentration 0.69 copies / pL; a ERBB2 probe oligonucleotide of SEQ ID NO: 51 labelled with a HER2 Module Fluorescent label of concentration 18 nM; a first GRB7 primer of SEQ ID NO: 53 of concentration 54 nM; a second GRB7 of SEQ ID NO: 54 of concentration 54 nM; an GRB7 competitor polynucleotide of SEQ ID NO: 56 of concentration 40 copies / pL; a GRB7 probe oligonucleotide of SEQ ID NO: 55 labelled with a HER.2 Module Fluorescent label of concentration 65 nM; a universal HER2 module probe oligonucleotide of SEQ ID NO: 86 labelled with a HER2 Module Fluorescent label of concentration 83 nM; a first BAG1 primer of SEQ ID NO: 57 of concentration 13 nM; a second BAG1 of SEQ ID NO: 58 of concentration 13 nM; an BAG1 competitor polynucleotide of SEQ ID NO: 60 of concentration 0.039 copies / pL; a BAG1 probe oligonucleotide if SEQ ID NO: 59 labelled with an Estrogen Module Fluorescent label of concentration 16 nM; a first BCL2 primer of SEQ ID NO: 61 of concentration 33 nM; a second BCL2 of SEQ ID NO: 62 of concentration 33 nM; an BCL2 competitor polynucleotide of SEQ ID NO: 64 of concentration 1.9 copies / pL; a BCL2 probe oligonucleotide if SEQ ID NO: 63 labelled with an Estrogen Module Fluorescent label of concentration 39 nM; a first ESRI primer of SEQ ID NO: 65 of concentration 40 nM; a second ESRI of SEQ ID NO: 66 of concentration 40 nM; an ESRI competitor polynucleotide of SEQ ID NO: 68 of concentration 0.83 copies / pL; a ESRI probe oligonucleotide if SEQ ID NO: 67 labelled with an Estrogen Module Fluorescent label of concentration 48 nM; a first GSTM1 primer of SEQ ID NO: 69 of concentration 11 nM; a second GSTM1 of SEQ ID NO: 70 of concentration 11 nM; an GSTM1 competitor polynucleotide of SEQ ID NO: 72 of concentration 0.075 copies / pL; a GSTM1 probe oligonucleotide if SEQ ID NO: 71 labelled with an Estrogen Module Fluorescent label of concentration 13 nM; a first PGR primer of SEQ ID NO: 73 of concentration 41 nM; a second PGR of SEQ ID NO: 74 of concentration 41 nM; an PGR competitor polynucleotide of SEQ ID NO: 76 of concentration 0.015 copies / pL; a PGR 1 probe oligonucleotide if SEQ ID NO: 75 labelled with an Estrogen Module Fluorescent label of concentration 50 nM; a first SCUBE2 primer of SEQ ID NO: 77 of concentration 22 nM; a second SCUBE2 of SEQ ID NO: 78 of concentration 22 nM; an SCUBE2 competitor polynucleotide of SEQ ID NO: 80 of concentration 94 copies / pL; a SCUBE2 probe oligonucleotide if SEQ ID NO: 79 labelled with an Estrogen Module Fluorescent label of concentration 26 nM; an BAG1 competitor polynucleotide of SEQ ID NO: 87 of concentration 0.039 copies / pL; an BCL2 competitor polynucleotide of SEQ ID NO: 88 of concentration 1.9 copies / pL; an ESRI competitor polynucleotide of SEQ ID NO: 89 of concentration 0.83 copies / pL; an GSTM1 competitor polynucleotide of SEQ ID NO: 90 of concentration 0.075 copies / pL; an PGR. competitor polynucleotide of SEQ ID NO: 91 of concentration 0.015 copies / pL; an SCUBE2 competitor polynucleotide of SEQ ID NO: 92 of concentration 94 copies / pL; and / or a universal Estrogen Module probe oligonucleotide of SEQ ID NO: 93 labelled with an Estrogen Module Fluorescent label of concentration 192 nM. In some embodiments, the method comprises: amplification of at least two of any of the House Keeping Module, the Proliferation Module, the Invasion Module, the HER2 Module and the Estrogen Module; amplification of at least three of any of the House Keeping Module, the Proliferation Module, the Invasion Module, the HER2 Module and the Estrogen Module in the same reaction; amplification of at least four of any of the House Keeping Module, the Proliferation Module, the Invasion Module, the HER2 Module and the Estrogen Module in the same reaction; amplification of all five of the House Keeping Module, the Proliferation Module, the Invasion Module, the HER2 Module and the Estrogen Module in the same reaction; and wherein the probe oligonucleotides associated with each Module are labelled with the same fluorescent label, and where each fluorescent label in the reaction is compatible with other fluorescent labels in the reaction. In some embodiments, each probe in the amplification reaction is labelled with the same fluorescent label. In some embodiments, at least two probes present in the amplification reaction are labelled with different fluorescent labels. In some embodiments, at least three, at least four or at least five probes present in the amplification are each labelled with a different fluorophore. In some embodiments, the amplification reaction comprises no more than 5 different fluorescent labels in total, optionally no more than 4, 3 or 2 different fluorescent labels. Suitable fluorescent labels are known to the person skilled in the art. In some embodiments, the fluorescent label may be selected from the group comprising ABY, FAM, JUN, VIC. In some embodiments, the plurality of target polynucleotides represent the following cDNA polynucleotides: A first module of cDNA polynucleotides; A second module of cDNA polynucleotides; A third module of cDNA polynucleotides; A fourth module of cDNA polynucleotides; A first module of cDNA polynucleotides; A first and second module of cDNA polynucleotides; A first and third module of cDNA polynucleotides; A first and fourth module of cDNA polynucleotides; A first and fifth module of cDNA polynucleotides; A second and third module of cDNA polynucleotides; A second and fourth module of cDNA polynucleotides; A second and fifth module of cDNA polynucleotides; A third and fourth module of cDNA polynucleotides; A third and fifth module of cDNA polynucleotides; A fourth and fifth module of cDNA polynucleotides; A first, second, and third module of cDNA polynucleotides; A first, second and fourth module of cDNA polynucleotides; A first, second and fifth module of cDNA polynucleotides; A first, third and fourth module of cDNA polynucleotides; A first, third and fifth module of cDNA polynucleotides; A first, fourth and fifth module of cDNA polynucleotides; A second, third and fourth module of cDNA polynucleotides; A second, third, and fifth module of cDNA polynucleotides; A second, fourth and fifth module of cDNA polynucleotides; A third, fourth and fifth module of cDNA polynucleotides; A first, second, third and fourth module of cDNA polynucleotides; A first, second, third and fifth module of cDNA polynucleotides; A first, second, fourth and fifth module of cDNA polynucleotides; A first, third, fourth and fifth module of cDNA polynucleotides; A second, third, fourth and fifth module of cDNA polynucleotides; or A first, second, third, fourth and fifth module of cDNA polynucleotides; Wherein: the first module is a House Keeping Module of cDNA polynucleotides derived from mRNA molecules expressed from the group of genes comprising or consisting of ACTB, GAPDH, GUSB, RPLPO and TFRC; the second module is an Invasion Module of cDNA polynucleotides derived from mRNA molecules expressed from the group of genes comprising or consisting of CD68, CTSV and MMP11; the third module is a Proliferation Module of cDNA polynucleotides derived from mRNA molecules expressed from the group of genes comprising or consisting of AURKA, CCNB1, MKI67 and MYBL2; the fourth module is a HER2 Module of cDNA polynucleotides derived from mRNA molecules expressed from the group of genes comprising or consisting of ERBB2 and GRB7; and and the fifth module is an Estrogen Module of cDNA polynucleotides derived from mRNA molecules expressed from the group of genes comprising or consisting of BAG1, BCL2, ESRI, GSTM1, PGY and SCUBE2. In some embodiments: The probe oligonucleotides of each of the sets of competitive target amplification oligonucleotides corresponding to each target in the first module comprises the same first module fluorescent label; The probe oligonucleotides of each of the sets of competitive target amplification oligonucleotides corresponding to each target in the second module comprises the same second module fluorescent label; The probe oligonucleotides of each of the sets of competitive target amplification oligonucleotides corresponding to each target in the third module comprises the same third module fluorescent label; The probe oligonucleotides of each of the sets of competitive target amplification oligonucleotides corresponding to each target in the fourth module comprises the same fourth module fluorescent label; and / or The probe oligonucleotides of each of the sets of competitive target amplification oligonucleotides corresponding to each target in the fifth module comprises the same fifth module fluorescent label. In some embodiments, the House Keeping Fluorescent Label, Proliferation Fluorescent Label, Invasion Fluorescent Label, HER2 Fluorescent Label and Estrogen Module Fluorescent Label are all different fluorescent labels, optionally compatible fluorescent labels. In some embodiments: Two of any of the House Keeping Fluorescent Label, Proliferation Fluorescent Label, Invasion Fluorescent Label, HER2 Fluorescent Label and Estrogen Module Fluorescent Label are the same fluorescent label; Three of any of the House Keeping Fluorescent Label, Proliferation Fluorescent Label, Invasion Fluorescent Label, HER2 Fluorescent Label and Estrogen Module Fluorescent Label are the same fluorescent label; Four of any of the House Keeping Fluorescent Label, Proliferation Fluorescent Label, Invasion Fluorescent Label, HER.2 Fluorescent Label and Estrogen Module Fluorescent Label are the same fluorescent label; or All of the House Keeping Fluorescent Label, Proliferation Fluorescent Label, Invasion Fluorescent Label, HER2 Fluorescent Label and Estrogen Module Fluorescent Label are the same fluorescent label. In some embodiments, the method comprises a step before step (a), wherein the target polynucleotide cDNA molecules are prepared by reverse transcription from the mRNA polynucleotides, optionally wherein the step of reverse transcription occurs in a single reverse transcription-qPCR step (rt-qPCR). Methods for preparing cDNA molecules from mRNA by reverse transcription are known the person skilled in the art. In some embodiments, the reverse transcription step is performed independently of the method of amplification of the at least two or plurality of target polynucleotides to produce cDNA, that is used in the method of amplification. In some embodiments, the sample obtained from a subject is a tumour sample, optionally a breast tumour biopsy. Suitable biopsy methods are known to the person skilled in the art. Any means of amplification is suitable for use with the present invention. However, preferred methods of amplification include the polymerase chain reaction (PCR) or the recombinase polymerase reaction (RPA). In some embodiments, the amplification is PCR. In some embodiments, the amplification reaction is a PCR based reaction and is performed for a specified number of cycles, optionally at least 35, 36, 37, 38, 39,40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 58, 59 or 60 cycles. In some embodiments, the method further comprises determining the fluorescent signal intensity of each fluorescent label associated with a probe oligonucleotide present in the amplification reaction generated after the specified number of cycles. In some embodiments, the fluorescent signal intensity of each fluorescent label associated with a probe oligonucleotide present in the amplification reaction is determined after 50 amplification cycles. The invention also provides a method for generating a score (a risk score or RS) for use in determining post-operative risk of breast cancer recurrence and / or for predicting response to chemotherapy wherein the method comprises the method of amplifying at least two or a plurality of target polynucleotides in a sample as provided herein. Preferences for the method for generating a score for use in determining post-operative risk of breast cancer recurrence and / or for predicting response to chemotherapy are as set out elsewhere in the context of the method of amplification of the invention. In some embodiments, the method comprises: a) amplification of the House Keeping Module that comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: ACTB, GAPDH, GUSB, RPLPO and TFRC, and wherein the set of competitive amplification polynucleotides used for the amplification comprises or consists of: a first ACTB primer of SEQ ID NO: 1; a second ACTB primer of SEQ ID NO: 2; an ACTB competitor polynucleotide of SEQ ID NO: 3; a first GAPDH primer of SEQ ID NO: 4; a second GAPDH primer of SEQ ID NO: 5; an GAPDH competitor polynucleotide of SEQ ID NO: 6; a first GUSB primer of SEQ ID NO: 7; a second GUSB primer of SEQ ID NO: 8; an GUSB competitor polynucleotide of SEQ ID NO: 9; a first RPLPO primer of SEQ ID NO: 10; a second RPLPOprimer of SEQ ID NO: 11; an RPLPO competitor polynucleotide of SEQ ID NO: 12; a first TRFC primer of SEQ ID NO: 13; a second TRFC primer of SEQ ID NO: 14; an TRFC competitor polynucleotide of SEQ ID NO: 15; and a universal House Keeping Module probe oligonucleotide of SEQ ID NO: 16 labelled with a House Keeping Fluorescent label; and b) amplification of the Invasion Module that comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: CD68, CTSV and MMP11, and wherein the set of competitive amplification polynucleotides used for the amplification comprises or consists of: i) a first CD68 primer of SEQ ID NO: 17; a second CD68 primer of SEQ ID NO: 18; an CD68 competitor polynucleotide of SEQ ID NO: 20; and a CD68 probe oligonucleotide of SEQ ID NO: 19 labelled with an Invasion Module Fluorescent label; a first CTSV primer of SEQ ID NO: 21; a second CTSV primer of SEQ ID NO: 22; an CTSV competitor polynucleotide of SEQ ID NO: 24; and a CTSV probe oligonucleotide of SEQ ID NO: 23 labelled with an Invasion Module Fluorescent label; and a first MMP11 primer of SEQ ID NO: 25; a second MMP11 primer of SEQ ID NO: 26; an MMP11 competitor polynucleotide of SEQ ID NO: 28; and a MMP11 probe oligonucleotide of SEQ ID NO: 27 labelled with an Invasion Module Fluorescent label; or ii) a first CD68 primer of SEQ ID NO: 17; a second CD68 primer of SEQ ID NO: 18; an CD68 competitor polynucleotide of SEQ ID NO: 81; a first CTSV primer of SEQ ID NO: 21; a second CTSV primer of SEQ ID NO: 22; an CTSV competitor polynucleotide of SEQ ID NO: 82; a first MMP11 primer of SEQ ID NO: 25; a second MMP11 primer of SEQ ID NO: 26; an MMP11 competitor polynucleotide of SEQ ID NO: 83; and a universal Invasion Module probe oligonucleotide of SEQ ID NO: 84 labelled with an Invasion Module Fluorescent label; and c) amplification of the Proliferation Module that comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: AURKA, BIRC5, CCNB1, MK167 and MYBL2 and wherein the set of competitive amplification polynucleotides used for the amplification comprises or consists of: i) a first AURKA primer of SEQ ID NO: 29; a second AURKA primer of SEQ ID NO: 30; an AURKA competitor polynucleotide of SEQ ID NO: 32; and a AURKA probe oligonucleotide of SEQ ID NO: 31 labelled with a Proliferation Module Fluorescent label; a first BIRC5 primer of SEQ ID NO: 33; a second BIRC5 primer of SEQ ID NO: 34; an BIRC5 competitor polynucleotide of SEQ ID NO: 36; and a BIRC5 probe oligonucleotide of SEQ ID NO: 35 labelled with a Proliferation Module Fluorescent label; a first CCNB1 primer of SEQ ID NO: 37; a second CCNBlprimer of SEQ ID NO: 38; an CCNBlcompetitor polynucleotide of SEQ ID NO: 40; and a CCNBlprobe oligonucleotide of SEQ ID NO: 39 labelled with a Proliferation Module Fluorescent label; a first MK167 primer of SEQ ID NO: 41; a second MK167 of SEQ ID NO: 42; an MK167 competitor polynucleotide of SEQ ID NO: 44; and a MK167 probe oligonucleotide of SEQ ID NO: 43 labelled with a Proliferation Module Fluorescent label; a first MYBL2 primer of SEQ ID NO: 45; a second MYBL2 of SEQ ID NO: 46; an MYBL2 competitor polynucleotide of SEQ ID NO: 48; and a MYBL2 probe oligonucleotide of SEQ ID NO: 47 labelled with a Proliferation Module Fluorescent label; or ii) a first AURKA primer of SEQ ID NO: 29; a second AURKA primer of SEQ ID NO: 30; an AURKA competitor polynucleotide of SEQ ID NO: 32; and a first BIRC5 primer of SEQ ID NO: 33; a second BIRC5 primer of SEQ ID NO: 34; an BIRC5 competitor polynucleotide of SEQ ID NO: 36; and a first CCNB1 primer of SEQ ID NO: 37; a second CCNBlprimer of SEQ ID NO: 38; an CCNBlcompetitor polynucleotide of SEQ ID NO: 40; and a first MK167 primer of SEQ ID NO: 41; a second MK167 of SEQ ID NO: 42; an MK167 competitor polynucleotide of SEQ ID NO: 44; and a first MYBL2 primer of SEQ ID NO: 45; a second MYBL2 of SEQ ID NO: 46; an MYBL2 competitor polynucleotide of SEQ ID NO: 48; and a universal Proliferation Module probe oligonucleotide of SEQ ID NO: 85 labelled with a Proliferation Module Fluorescent label; and d) amplification of the HER2 Module that comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: ERBB2 and GRB7 and wherein the set of competitive amplification polynucleotides used for the amplification comprises or consists of: i) a first ERBB2 primer of SEQ ID NO: 49; a second ERBB2 of SEQ ID NO: 50; an ERBB2 competitor polynucleotide of SEQ ID NO: 52; and a ERBB2 probe oligonucleotide of SEQ ID NO: 51 labelled with a HER2 Module Fluorescent label; a first GRB7 primer of SEQ ID NO: 53; a second GRB7 of SEQ ID NO: 54; an GRB7 competitor polynucleotide of SEQ ID NO: 56; and a GRB7 probe oligonucleotide of SEQ ID NO: 55 labelled with a HER2 Module Fluorescent label; or ii) a first ERBB2 primer of SEQ ID NO: 49; a second ERBB2 of SEQ ID NO: 50; an ERBB2 competitor polynucleotide of SEQ ID NO: 52; and a first GRB7 primer of SEQ ID NO: 53; a second GRB7 of SEQ ID NO: 54; an GRB7 competitor polynucleotide of SEQ ID NO: 56; and a universal HER2 module probe oligonucleotide of SEQ ID NO: 86 labelled with a HER2 Module Fluorescent label; and e) amplification of the Estrogen Module that comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: BAG1, BCL2, ESRI, GSTM1, PGR and SCUBE2 and wherein the set of competitive amplification polynucleotides used for the amplification comprises or consists of: i) a first BAG1 primer of SEQ ID NO: 57; a second BAG1 of SEQ ID NO: 58; an BAG1 competitor polynucleotide of SEQ ID NO: 60; and a BAG1 probe oligonucleotide if SEQ ID NO: 59 labelled with an Estrogen Module Fluorescent label; a first BCL2 primer of SEQ ID NO: 61; a second BCL2 of SEQ ID NO: 62; an BCL2 competitor polynucleotide of SEQ ID NO: 64; and a BCL2 probe oligonucleotide if SEQ ID NO: 63 labelled with an Estrogen Module Fluorescent label; a first ESRI primer of SEQ ID NO: 65; a second ESRI of SEQ ID NO: 66; an ESRI competitor polynucleotide of SEQ ID NO: 68; and a ESRI probe oligonucleotide if SEQ ID NO: 67 labelled with an Estrogen Module Fluorescent label; a first GSTM1 primer of SEQ ID NO: 69; a second GSTM1 of SEQ ID NO: 70; an GSTM1 competitor polynucleotide of SEQ ID NO: 72; and a GSTM1 probe oligonucleotide if SEQ ID NO: 71 labelled with an Estrogen Module Fluorescent label; a first PGR primer of SEQ ID NO: 73; a second PGR of SEQ ID NO: 74; an PGR competitor polynucleotide of SEQ ID NO: 76; and a PGR 1 probe oligonucleotide if SEQ ID NO: 75 labelled with an Estrogen Module Fluorescent label; a first SCUBE2 primer of SEQ ID NO: 77; a second SCUBE2 of SEQ ID NO: 78; an SCUBE2 competitor polynucleotide of SEQ ID NO: 80; and a SCUBE2 probe oligonucleotide if SEQ ID NO: 79 labelled with an Estrogen Module Fluorescent label; or ii) a first BAG1 primer of SEQ ID NO: 57; a second BAG1 of SEQ ID NO: 58; an BAG1 competitor polynucleotide of SEQ ID NO: 87 a first BCL2 primer of SEQ ID NO: 61; a second BCL2 of SEQ ID NO: 62; an BCL2 competitor polynucleotide of SEQ ID NO: 88; a first ESRI primer of SEQ ID NO: 65; a second ESRI of SEQ ID NO: 66; an ESRI competitor polynucleotide of SEQ ID NO: 89; a first GSTM1 primer of SEQ ID NO: 69; a second GSTM1 of SEQ ID NO: 70; an GSTM1 competitor polynucleotide of SEQ ID NO: 90; a first PGR. primer of SEQ ID NO: 73; a second PGR of SEQ ID NO: 74; an PGR competitor polynucleotide of SEQ ID NO: 91; a first SCUBE2 primer of SEQ ID NO: 77; a second SCUBE2 of SEQ ID NO: 78; an SCUBE2 competitor polynucleotide of SEQ ID NO: 92; and a universal Estrogen Module probe oligonucleotide of SEQ ID NO: 93 labelled with an Estrogen Module Fluorescent label. The risk score, or RS is a number of between 0 and 100 and is used to predict the risk of the breast cancer returning at a distant site and whether chemotherapy may help reduce the risk. The RS provided by the present invention is to be interpreted in the same manner as the RS provided by the Oncotype DX test. See for example information provided on the Oncotype website https: / / www.oncotypeiq.com for exa m p I e httDs: / / www.oncotvDeia.com / en-gb / breast-cancer / healthcare- Drofessionals / oncotype-dx-breast-recurrence-score / interD retina-the-results: Breast T 2022; 2022: 1199245: Breast Cancer Res Treat. 2020: 180(3): 809-817. Guidance for interpretating and ongoing clinical intervention may change over time see for example Cancers (Basel). 2023 Jun; 15(12): 3217. The test also provides a percentage risk that breast cancer will come back somewhere else in the body "distant recurrence" within 9 years when treated with hormonal therapy alone for 5 years. The test also provides a percentage that indicates the benefit expected from adding chemotherapy to hormonal therapy in order to reduce the risk of cancer recurrence or death for the recurrence score group. For example, in Node Negative patients, RS result of 0-25 generally indicates no benefit from the addition of chemotherapy to endocrine therapy. In patients with a RS of 26-100, as a group there is considered to be a significant (26%) benefit from the addition of chemotherapy to endocrine therapy. In node positive patients: Patients with a Recurrence Score result of 0-17 do not benefit from the addition of chemotherapy to endocrine therapy. Patients with a Recurrence Score result of 18-30 can derive a potential benefit from the addition of chemotherapy to endocrine therapy. Patients with Recurrence Score results 31-100 significantly benefit from the addition of chemotherapy to endocrine therapy. Also provided herein is a method for determining post-operative risk of breast cancer recurrence and / or for predicting response to chemotherapy wherein the method comprises the method of generating a score for use in determining post-operative risk of breast cancer recurrence and / or for predicting response to chemotherapy provided herein or the method of amplifying at least two or a plurality of target polynucleotides in a sample provided herein. In some embodiments, the sample obtained from a subject is breast tumour biopsy. In some embodiments, the subject has or has had: HR+ HER2- breast cancer; Anatomic stage I, II or Illa invasive breast cancer; and / or Positive for cancerous cells in zero, one, two or no more than three axillary lymph nodes. In some embodiments, in the amplification reaction the concentration of each oligonucleotide is optionally as set out below: a first ACTB primer of SEQ ID NO: 1 of concentration 33 nM; a second ACTB primer of SEQ ID NO: 2 of concentration 33 nM; an ACTB competitor polynucleotide of SEQ ID NO: 3 of concentration 1.8e+02 copies / pL; a first GAPDH primer of SEQ ID NO: 4 of concentration 14 nM; a second GAPDH primer of SEQ ID NO: 5 of concentration; 14 nM an GAPDH competitor polynucleotide of SEQ ID NO: 6 of concentration le+02 copies / pL; a first GUSB primer of SEQ ID NO: 7 of concentration 22 nM; a second GUSB primer of SEQ ID NO: 8 of concentration 22 nM; an GUSB competitor polynucleotide of SEQ ID NO: 9 of concentration 1.3e+02 copies / pL; a first RPLPO primer of SEQ ID NO: 10 of concentration 66 nM; a second RPLPOprimer of SEQ ID NO: 11 of concentration 66 nM; an RPLPO competitor polynucleotide of SEQ ID NO: 12 of concentration 2.9 copies / pL; a first TRFC primer of SEQ ID NO: 13 of concentration 84 nM; a second TRFC primer of SEQ ID NO: 14 of concentration 84 nM; an TRFC competitor polynucleotide of SEQ ID NO: 15 of concentration 1.4 copies / pL; a universal House Keeping Module probe oligonucleotide of SEQ ID NO: 16 labelled with a House Keeping Fluorescent label of concentration 262 nM; a first CD68 primer of SEQ ID NO: 17 of concentration 23 nM; a second CD68 primer of SEQ ID NO: 18 of concentration 23 nM; an CD68 competitor polynucleotide of SEQ ID NO: 20 of concentration 0.6 copies / pL; a CD68 probe oligonucleotide of SEQ ID NO: 19 labelled with an Invasion Module Fluorescent label of concentration 28 nM; a first CTSV primer of SEQ ID NO: 21 of concentration 28 nM; a second CTSV primer of SEQ ID NO: 22 of concentration 28 nM; an CTSV competitor polynucleotide of SEQ ID NO: 24 of concentration 0.013 copies / pL; a CTSV probe oligonucleotide of SEQ ID NO: 23 labelled with an Invasion Module Fluorescent label of concentration 34 nM; a first MMP11 primer of SEQ ID NO: 25 of concentration 20 nM; a second MMP11 primer of SEQ ID NO: 26 of concentration 20 nM; an MMP11 competitor polynucleotide of SEQ ID NO: 28 of concentration 2.6 copies / pL; a MMP11 probe oligonucleotide of SEQ ID NO: 27 labelled with an Invasion Module Fluorescent label of concentration 24 nM; an CD68 competitor polynucleotide of SEQ ID NO: 81 of concentration; 0.6 copies / pL; an CTSV competitor polynucleotide of SEQ ID NO: 82 of concentration 0.013 copies / pL; an MMP11 competitor polynucleotide of SEQ ID NO: 83 of concentration 2.6 copies / pL; a universal Invasion Module probe oligonucleotide of SEQ ID NO: 84 labelled with an Invasion Module Fluorescent label of concentration 86 nM; a first AURKA primer of SEQ ID NO: 29 of concentration; 17 nM; a second AURKA primer of SEQ ID NO: 30 of concentration 17 nM; an AURKA competitor polynucleotide of SEQ ID NO: 32 of concentration 1.5 copies / pL; a AURKA probe oligonucleotide of SEQ ID NO: 31 labelled with a Proliferation Module Fluorescent label of concentration 20 nM; a first BIRC5 primer of SEQ ID NO: 33 of concentration 10 nM; a second BIRC5 primer of SEQ ID NO: 34 of concentration 10 nM; an BIRC5 competitor polynucleotide of SEQ ID NO: 36 of concentration 0.13 copies / pL; a BIRC5 probe oligonucleotide of SEQ ID NO: 35 labelled with a Proliferation Module Fluorescent label of concentration 12 nM; a first CCNB1 primer of SEQ ID NO: 37 of concentration 10 nM; a second CCNB1 primer of SEQ ID NO: 38 of concentration 10 nM; an CCNB1 competitor polynucleotide of SEQ ID NO: 40 of concentration 0.19 copies / pL; a CCNB1 probe oligonucleotide of SEQ ID NO: 39 labelled with a Proliferation Module Fluorescent label of concentration 12 nM; a first MK167 primer of SEQ ID NO: 41 of concentration 15 nM; a second MK167 of SEQ ID NO: 42 of concentration 15 nM; an MK167 competitor polynucleotide of SEQ ID NO: 44 of concentration 0.021 copies / pL; a MK167 probe oligonucleotide of SEQ ID NO: 43 labelled with a Proliferation Module Fluorescent label of concentration 19 nM; a first MYBL2 primer of SEQ ID NO: 45 of concentration 8 nM; a second MYBL2 of SEQ ID NO: 46 of concentration 8 nM; an MYBL2 competitor polynucleotide of SEQ ID NO: 48 of concentration 2.6e+03 copies / pL; a MYBL2 probe oligonucleotide of SEQ ID NO: 47 labelled with a Proliferation Module Fluorescent label of concentration 10 nM; a universal Proliferation Module probe oligonucleotide of SEQ ID NO: 85 labelled with a Proliferation Module Fluorescent label of concentration 73 nM; a first ERBB2 primer of SEQ ID NO: 49 of concentration 15 nM; a second ERBB2 of SEQ ID NO: 50 of concentration 15 nM; an ERBB2 competitor polynucleotide of SEQ ID NO: 52 of concentration 0.69 copies / pL; a ERBB2 probe oligonucleotide of SEQ ID NO: 51 labelled with a HER2 Module Fluorescent label of concentration 18 nM; a first GRB7 primer of SEQ ID NO: 53 of concentration 54 nM; a second GRB7 of SEQ ID NO: 54 of concentration 54 nM; an GRB7 competitor polynucleotide of SEQ ID NO: 56 of concentration 40 copies / pL; a GRB7 probe oligonucleotide of SEQ ID NO: 55 labelled with a HER.2 Module Fluorescent label of concentration 65 nM; a universal HER2 module probe oligonucleotide of SEQ ID NO: 86 labelled with a HER2 Module Fluorescent label of concentration 83 nM; a first BAG1 primer of SEQ ID NO: 57 of concentration 13 nM; a second BAG1 of SEQ ID NO: 58 of concentration 13 nM; an BAG1 competitor polynucleotide of SEQ ID NO: 60 of concentration 0.039 copies / pL; a BAG1 probe oligonucleotide if SEQ ID NO: 59 labelled with an Estrogen Module Fluorescent label of concentration 16 nM; a first BCL2 primer of SEQ ID NO: 61 of concentration 33 nM; a second BCL2 of SEQ ID NO: 62 of concentration 33 nM; an BCL2 competitor polynucleotide of SEQ ID NO: 64 of concentration 1.9 copies / pL; a BCL2 probe oligonucleotide if SEQ ID NO: 63 labelled with an Estrogen Module Fluorescent label of concentration 39 nM; a first ESRI primer of SEQ ID NO: 65 of concentration 40 nM; a second ESRI of SEQ ID NO: 66 of concentration 40 nM; an ESRI competitor polynucleotide of SEQ ID NO: 68 of concentration 0.83 copies / pL; a ESRI probe oligonucleotide if SEQ ID NO: 67 labelled with an Estrogen Module Fluorescent label of concentration 48 nM; a first GSTM1 primer of SEQ ID NO: 69 of concentration 11 nM; a second GSTM1 of SEQ ID NO: 70 of concentration 11 nM; an GSTM1 competitor polynucleotide of SEQ ID NO: 72 of concentration 0.075 copies / pL; a GSTM1 probe oligonucleotide if SEQ ID NO: 71 labelled with an Estrogen Module Fluorescent label of concentration 13 nM; a first PGR primer of SEQ ID NO: 73 of concentration 41 nM; a second PGR of SEQ ID NO: 74 of concentration 41 nM; an PGR competitor polynucleotide of SEQ ID NO: 76 of concentration 0.015 copies / pL; a PGR. 1 probe oligonucleotide if SEQ ID NO: 75 labelled with an Estrogen Module Fluorescent label of concentration 50 nM; a first SCUBE2 primer of SEQ ID NO: 77 of concentration 22 nM; a second SCUBE2 of SEQ ID NO: 78 of concentration 22 nM; an SCUBE2 competitor polynucleotide of SEQ ID NO: 80 of concentration 94 copies / pL; a SCUBE2 probe oligonucleotide if SEQ ID NO: 79 labelled with an Estrogen Module Fluorescent label of concentration 26 nM; an BAG1 competitor polynucleotide of SEQ ID NO: 87 of concentration 0.039 copies / pL; an BCL2 competitor polynucleotide of SEQ ID NO: 88 of concentration 1.9 copies / pL; an ESRI competitor polynucleotide of SEQ ID NO: 89 of concentration 0.83 copies / pL; an GSTM1 competitor polynucleotide of SEQ ID NO: 90 of concentration 0.075 copies / pL; an PGR competitor polynucleotide of SEQ ID NO: 91 of concentration 0.015 copies / pL; an SCUBE2 competitor polynucleotide of SEQ ID NO: 92 of concentration 94 copies / pL; a universal Estrogen Module probe oligonucleotide of SEQ ID NO: 93 labelled with an Estrogen Module Fluorescent label of concentration 192 nM. In some embodiments, the method comprises performing 5 separate amplification reactions that comprise: a) A first amplification reaction for the invasion module wherein the set of competitive oligonucleotides comprise or consist of: a CD68 competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 20]; a CD68 first primer that optionally has a sequence of [SEQ ID NO: 17]; a CD68 second primer that optionally has a sequence of [SEQ ID NO: 18]; and a CD68 probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 19]; a CTSV competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 24]; a CTSV first primer that optionally has a sequence of [SEQ ID NO: 21]; a CTSV second primer that optionally has a sequence of [SEQ ID NO:22]; and a CTSV probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 23]; an MP11 competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 28]; an MP11 first primer that optionally has a sequence of [SEQ ID NO: 25]; an MP11 second primer that optionally has a sequence of [SEQ ID NO: 26]; and an MP11 probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 27] wherein the probe oligonucleotides are all labelled with a first module fluorescent label; b) A second amplification reaction for the proliferation module wherein the set of competitive oligonucleotides comprise or consist of: An AUR.KA competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 32]; An AUR.KA first primer that optionally has a sequence of [SEQ ID NO: 29]; An AUR.KA second primer that optionally has a sequence of [SEQ ID NO: 30]; and An AUR.KA probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 31]; a BIR.C5 competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 36]; a BIR.C5 first primer that optionally has a sequence of [SEQ ID NO: 33]; a BIR.C5 second primer that optionally has a sequence of [SEQ ID NO: 34]; and a BIR.C5 probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 35]; a CCNB1 competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 40]; a CCNB1 first primer that optionally has a sequence of [SEQ ID NO: 37]; a CCNB1 second primer that optionally has a sequence of [SEQ ID NO: 38]; and a CCNB1 probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 39]; an MKI67 competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 44]; a MKI67first primer that optionally has a sequence of [SEQ ID NO: 41]; a MKI67second primer that optionally has a sequence of [SEQ ID NO: 42]; and a MKI67probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 43]; an MYBL2 competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 48]; a MYBL2 first primer that optionally has a sequence of [SEQ ID NO: 45]; a MYBL2second primer that optionally has a sequence of [SEQ ID NO: 46]; and a MYBL2 probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 47] wherein the probe oligonucleotides are all labelled with a second module fluorescent label; c) A third amplification reaction for a third module of target polynucleotides wherein the set of competitive oligonucleotides comprise or consist of: An ER.BB2 competitor polynucleotide that has a sequence of [SEQ ID NO: 52]; An ERBB2 first primer that optionally has a sequence of [SEQ ID NO: 49]; An ERBB2 second primer that optionally has a sequence of [SEQ ID NO: 50]; and An ERBB2 probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 51]; a GRB7 competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 56]; a GRB7 first primer that optionally has a sequence of [SEQ ID NO: 53];a GRB7 second primer that optionally has a sequence of [SEQ ID NO: 54]; and a GRB7 probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 55]. wherein the probe oligonucleotides are all labelled with a third fluorescent label; d) A fourth amplification reaction for a fourth module of target polynucleotides wherein the set of competitive oligonucleotides comprise or consist of: a BAG1 competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 60]; a BAG1 first primer that optionally has a sequence of [SEQ ID NO: 57]; a BAG1 second primer that optionally has a sequence of [SEQ ID NO: 58]; a BAG1 probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 59]; a BCL2 competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 64]; a BCL2 first primer that optionally has a sequence of [SEQ ID NO: 61]; a BCL2 second primer that optionally has a sequence of [SEQ ID NO: 62]; a BCL2 probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 63] a ESRI competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 68]; a ESRI first primer that optionally has a sequence of [SEQ ID NO: 65]; a ESRI second primer that optionally has a sequence of [SEQ ID NO: 66]; a ESRI probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 67]; a GSTM1 competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 72]; a GSTM1 first primer that optionally has a sequence of [SEQ ID NO: 69]; a GSTM1 second primer that optionally has a sequence of [SEQ ID NO: 70]; a GSTM1 probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 71] a PGY competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 76]; a PGY first primer that optionally has a sequence of [SEQ ID NO: 73]; a PGY second primer that optionally has a sequence of [SEQ ID NO: 74]; a PGY probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 75] a SCUBE2 competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 80]; a SCUBE2 first primer that optionally has a sequence of [SEQ ID NO: 77]; a SCUBE2 second primer that optionally has a sequence of [SEQ ID NO: 78]; a SCUBE2 probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 79]; wherein the probe oligonucleotides are all labelled with a fourth module fluorescent label; and e) A fifth amplification reaction for a fifth module of target polynucleotides wherein the set of competitive oligonucleotides comprise or consist of: An ACTB competitor polynucleotide that has a sequence of [SEQ ID NO: 3]; An ACTB first primer that optionally has a sequence of [SEQ ID NO: 1]; An ACTB second primer that optionally has a sequence of [SEQ ID NO: 2]; An ACTB probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 16]; a GAPDH competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 6]; a GAPDH first primer that optionally has a sequence of [SEQ ID NO: 4]; a GAPDH second primer that optionally has a sequence of [SEQ ID NO: 5]; a GAPDH probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 16]; a GUSB competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 9]; a GUSB first primer that optionally has a sequence of [SEQ ID NO: 7]; a GUSB second primer that optionally has a sequence of [SEQ ID NO: 8]; a GUSB probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 16]; a RPLPO competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 12]; a RPLPO first primer that optionally has a sequence of [SEQ ID NO: 10];a RPLPO second primer that optionally has a sequence of [SEQ ID NO: 11]; a RPLPO probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 16]; a TRFC competitor polynucleotide that optionally has a sequence of [SEQ ID NO: 15]; a TRFC first primer that optionally has a sequence of [SEQ ID NO: 13]; a TRFC second primer that optionally has a sequence of [SEQ ID NO: 14]; a TRFC probe oligonucleotide that optionally has a sequence of [SEQ ID NO: 16]; where the probe oligonucleotides are labelled with a fifth module fluorescent label. In some embodiments, the first, second, third and fourth fluorophore are all different. In some embodiments, the amplification reaction is a PCR reaction. In some embodiments, each separate amplification reaction is performed for 50 cycles and the fluorescent signal intensity of each of fluorophore 1, fluorophore 2, fluorophore 3, fluorophore 4, and fluorophore 5 is determined. In some embodiments, the PCR reaction is performed for 50 cycles. In some embodiments, the fluorescent signal intensity of each fluorophore is determined after a set number of amplification cycles, optionally 35, 36, 37, 38, 39 , 40,41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 58, 59 or 60 cycles. In some embodiments, the fluorescent signal intensity of each fluorophore is determined after 50 amplification cycles. In one aspect provided herein is a kit comprising at least two polynucleotides as provided herein. In one embodiment, the kit comprises at least two polynucleotides having a sequence of any of SEQ ID NO: 1-93. The invention also provides a kit comprising any one two or more or all of the following groups of polynucleotides: a) a first ACTB primer of SEQ ID NO: 1; a second ACTB primer of SEQ ID NO: 2; an ACTB competitor polynucleotide of SEQ ID NO: 3; a first GAPDH primer of SEQ ID NO: 4; a second GAPDH primer of SEQ ID NO: 5; an GAPDH competitor polynucleotide of SEQ ID NO: 6; a first GUSB primer of SEQ ID NO: 7; a second GUSB primer of SEQ ID NO: 8; an GUSB competitor polynucleotide of SEQ ID NO: 9; a first RPLPO primer of SEQ ID NO: 10; a second RPLPOprimer of SEQ ID NO: 11; an RPLPO competitor polynucleotide of SEQ ID NO: 12; a first TRFC primer of SEQ ID NO: 13; a second TRFC primer of SEQ ID NO: 14; an TRFC competitor polynucleotide of SEQ ID NO: 15; and a universal House Keeping Module probe oligonucleotide of SEQ ID NO: 16 labelled with a House Keeping Fluorescent label; b) i) a first CD68 primer of SEQ ID NO: 17; a second CD68 primer of SEQ ID NO: 18; an CD68 competitor polynucleotide of SEQ ID NO: 20; and a CD68 probe oligonucleotide of SEQ ID NO: 19 labelled with an Invasion Module Fluorescent label; a first CTSV primer of SEQ ID NO: 21; a second CTSV primer of SEQ ID NO: 22; an CTSV competitor polynucleotide of SEQ ID NO: 24; and a CTSV probe oligonucleotide of SEQ ID NO: 23 labelled with an Invasion Module Fluorescent label; and a first MMP11 primer of SEQ ID NO: 25; a second MMP11 primer of SEQ ID NO: 26; an MMP11 competitor polynucleotide of SEQ ID NO: 28; and a MMP11 probe oligonucleotide of SEQ ID NO: 27 labelled with an Invasion Module Fluorescent label; or ii) a first CD68 primer of SEQ ID NO: 17; a second CD68 primer of SEQ ID NO: 18; an CD68 competitor polynucleotide of SEQ ID NO: 81; a first CTSV primer of SEQ ID NO: 21; a second CTSV primer of SEQ ID NO: 22; an CTSV competitor polynucleotide of SEQ ID NO: 82; a first MMP11 primer of SEQ ID NO: 25; a second MMP11 primer of SEQ ID NO: 26; an MMP11 competitor polynucleotide of SEQ ID NO: 83; and a universal Invasion Module probe oligonucleotide of SEQ ID NO: 84 labelled with an Invasion Module Fluorescent label; c) amplification of the Proliferation Module that comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: AURKA, BIRC5, CCNB1, MK167 and MYBL2 and wherein the set of competitive amplification polynucleotides used for the amplification comprises or consists of: i) a first AURKA primer of SEQ ID NO: 29; a second AURKA primer of SEQ ID NO: 30; an AURKA competitor polynucleotide of SEQ ID NO: 32; and a AURKA probe oligonucleotide of SEQ ID NO: 31 labelled with a Proliferation Module Fluorescent label; a first BIRC5 primer of SEQ ID NO: 33; a second BIRC5 primer of SEQ ID NO: 34; an BIRC5 competitor polynucleotide of SEQ ID NO: 36; and a BIRC5 probe oligonucleotide of SEQ ID NO: 35 labelled with a Proliferation Module Fluorescent label; a first CCNB1 primer of SEQ ID NO: 37; a second CCNBlprimer of SEQ ID NO: 38; an CCNBlcompetitor polynucleotide of SEQ ID NO: 40; and a CCNBlprobe oligonucleotide of SEQ ID NO: 39 labelled with a Proliferation Module Fluorescent label; a first MK167 primer of SEQ ID NO: 41; a second MK167 of SEQ ID NO: 42; an MK167 competitor polynucleotide of SEQ ID NO: 44; and a MK167 probe oligonucleotide of SEQ ID NO: 43 labelled with a Proliferation Module Fluorescent label; a first MYBL2 primer of SEQ ID NO: 45; a second MYBL2 of SEQ ID NO: 46; an MYBL2 competitor polynucleotide of SEQ ID NO: 48; and a MYBL2 probe oligonucleotide of SEQ ID NO: 47 labelled with a Proliferation Module Fluorescent label; or ii) a first AURKA primer of SEQ ID NO: 29; a second AURKA primer of SEQ ID NO: 30; an AURKA competitor polynucleotide of SEQ ID NO: 32; and a first BIRC5 primer of SEQ ID NO: 33; a second BIRC5 primer of SEQ ID NO: 34; an BIRC5 competitor polynucleotide of SEQ ID NO: 36; and a first CCNB1 primer of SEQ ID NO: 37; a second CCNBlprimer of SEQ ID NO: 38; an CCNBlcompetitor polynucleotide of SEQ ID NO: 40; and a first MK167 primer of SEQ ID NO: 41; a second MK167 of SEQ ID NO: 42; an MK167 competitor polynucleotide of SEQ ID NO: 44; and a first MYBL2 primer of SEQ ID NO: 45; a second MYBL2 of SEQ ID NO: 46; an MYBL2 competitor polynucleotide of SEQ ID NO: 48; and a universal Proliferation Module probe oligonucleotide of SEQ ID NO: 85 labelled with a Proliferation Module Fluorescent label; d) amplification of the HER2 Module that comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: ERBB2 and GRB7 and wherein the set of competitive amplification polynucleotides used for the amplification comprises or consists of: i) a first ERBB2 primer of SEQ ID NO: 49 a second ERBB2 of SEQ ID NO: 50; an ERBB2 competitor polynucleotide of SEQ ID NO: 52 and a ERBB2 probe oligonucleotide of SEQ ID NO: 51 labelled with a HER2 Module Fluorescent label; a first GRB7 primer of SEQ ID NO: 53 a second GRB7 of SEQ ID NO: 54; an GRB7 competitor polynucleotide of SEQ ID NO: 56 and a GRB7 probe oligonucleotide of SEQ ID NO: 55 labelled with a HER2 Module Fluorescent label; or ii) a first ERBB2 primer of SEQ ID NO: 49 a second ERBB2 of SEQ ID NO: 50; an ERBB2 competitor polynucleotide of SEQ ID NO: 52 and a first GRB7 primer of SEQ ID NO: 53 a second GRB7 of SEQ ID NO: 54; an GRB7 competitor polynucleotide of SEQ ID NO: 56 and a universal HER2 module probe oligonucleotide of SEQ ID NO: 86 labelled with a HER2 Module Fluorescent label; and e) amplification of the Estrogen Module that comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: BAG1, BCL2, ESRI, GSTM1, PGR and SCUBE2 and wherein the set of competitive amplification polynucleotides used for the amplification comprises or consists of: i) a first BAG1 primer of SEQ ID NO: 57 a second BAG1 of SEQ ID NO: 58; an BAG1 competitor polynucleotide of SEQ ID NO: 60 and a BAG1 probe oligonucleotide if SEQ ID NO: 59 labelled with an Estrogen Module Fluorescent label; a first BCL2 primer of SEQ ID NO: 61 a second BCL2 of SEQ ID NO: 62; an BCL2 competitor polynucleotide of SEQ ID NO: 64 and a BCL2 probe oligonucleotide if SEQ ID NO: 63 labelled with an Estrogen Module Fluorescent label; a first ESRI primer of SEQ ID NO: 65 a second ESRI of SEQ ID NO: 66; an ESRI competitor polynucleotide of SEQ ID NO: 68 and a ESRI probe oligonucleotide if SEQ ID NO: 67 labelled with an Estrogen Module Fluorescent label; a first GSTM1 primer of SEQ ID NO: 69 a second GSTM1 of SEQ ID NO: 70; an GSTM1 competitor polynucleotide of SEQ ID NO: 72 and a GSTM1 probe oligonucleotide if SEQ ID NO: 71 labelled with an Estrogen Module Fluorescent label; a first PGR primer of SEQ ID NO: 73 a second PGR of SEQ ID NO: 74; an PGR. competitor polynucleotide of SEQ ID NO: 76 and a PGR 1 probe oligonucleotide if SEQ ID NO: 75 labelled with an Estrogen Module Fluorescent label; a first SCUBE2 primer of SEQ ID NO: 77; a second SCUBE2 of SEQ ID NO: 78; an SCUBE2 competitor polynucleotide of SEQ ID NO: 80 and a SCUBE2 probe oligonucleotide if SEQ ID NO: 79 labelled with an Estrogen Module Fluorescent label; or ii) a first BAG1 primer of SEQ ID NO: 57 a second BAG1 of SEQ ID NO: 58; an BAG1 competitor polynucleotide of SEQ ID NO: 87 a first BCL2 primer of SEQ ID NO: 61 a second BCL2 of SEQ ID NO: 62; an BCL2 competitor polynucleotide of SEQ ID NO: 88 a first ESRI primer of SEQ ID NO: 65 a second ESRI of SEQ ID NO: 66; an ESRI competitor polynucleotide of SEQ ID NO: 89 a first GSTM1 primer of SEQ ID NO: 69 a second GSTM1 of SEQ ID NO: 70; an GSTM1 competitor polynucleotide of SEQ ID NO: 90 a first PGR primer of SEQ ID NO: 73 a second PGR of SEQ ID NO: 74; an PGR competitor polynucleotide of SEQ ID NO: 91 a first SCUBE2 primer of SEQ ID NO: 77; a second SCUBE2 of SEQ ID NO: 78; an SCUBE2 competitor polynucleotide of SEQ ID NO: 92 and a universal Estrogen Module probe oligonucleotide of SEQ ID NO: 93 labelled with an Estrogen Module Fluorescent label. As will be understood, the results and / or readouts of the methods performed herein may be interpreted using algorithms, for example algorithms suitable for the analysis of PCR data, qPCR data, and the like. Such algorithms are known to the person skilled in the art. As will be understood, the algorithms may be used to calculate a recurrence score (RS) as disclosed herein. An algorithm as described herein may be computer implemented. According to a further aspect, there is provided an apparatus comprising: at least one processor; and at least one memory including computer program code for one or more programs, the at least one memory and the computer program code configured to, with the at least one processor, cause the apparatus to perform any algorithm disclosed herein. Corresponding computer programs for implementing one or more steps of any algorithm disclosed herein are also within the present disclosure and are encompassed by one or more of the described examples. One or more of the computer programs may, when run on a computer, cause the computer to configure any apparatus disclosed herein or perform any algorithm disclosed herein. One or more of the computer programs may be software implementations, and the computer may be considered as any appropriate hardware, including a digital signal processor, a microcontroller, and an implementation in read only memory (ROM), erasable programmable read only memory (EPROM) or electronically erasable programmable read only memory (EEPROM), as non-limiting examples. The software may be an assembly program. One or more of the computer programs may be provided on a computer readable medium, which may be a physical computer readable medium such as a disc or a memory device, or may be embodied as a transient signal. Such a transient signal may be a network download, including an internet download. The listing or discussion of an apparently prior-published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge. Preferences and options for a given aspect, feature or parameter of the invention should, unless the context indicates otherwise, be regarded as having been disclosed in combination with any and all preferences and options for all other aspects, features and parameters of the invention. Sequences of the disclosure Table 1 - Exemplary sequences for putting the invention into practice. Multi-probe approach where in some instances each set of competitive amplification oligonucleotides that corresponds to a particular Module contains a unique probe Module Component Name SEQ ID NO: Sequence Cone Housekeeping (HK) ACTB Primer 1 1 GCCTAGAAGCATTTGCGGT 33 nM Primer 2 2 AGCAGATGTGGATCAGCAAGC 33 nM Competitor 3 AGCAGATGTGGATCAGCAAGCAGGAGTATGGCATGTCGGCTCGGTCT GTCTCTTTCCCCTCATCTCTCGGTACACTCCTTACCTCGCCCACCCCG GCAACGCTCTGGTAACCTCTCTATCTGGCCTGTCACGAATCACTGTCC ATCTAACCTCGGAGCCCTGTCACGCGGCGGACTTGGAGAAAGCAGG AGTATGACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTCTAGG C 1.8e+02 copies / pL GAPDH Primer 1 4 GTGATGGGATTTCCATTGATGACAAGC 14 nM Primer 2 5 CACCCATGGCAAATTCCAT 14 nM Competitor 6 CACCCATGGCAAATTCCATGGCACCGGCATGTCGGCTCGGTCTGTCT CTTTCCCCTCATCTCTCGGTACACTCCTTACCTCGCCCACCCCGGCAA CGCTCTGGTAACCTCTCTATCTGGCCTGTCACGAATCACTGTCCATCTA ACCTCGGAGCCCTGTCACGCGGCGGACTTGGAGATGGCACCGTCAA GGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCAC le+02 copies / pL GUSB Primer 1 7 AGGGACACGCAGGTGGTATCA 22 nM Primer 2 8 AGTAGCCAAGTCACAATGTTTG 22 nM Competitor 9 AGTAGCCAAGTCACAATGTTTGGGCATGTCGGCTCGGTCTGTCTCTTT CCCCTCATCTCTCGGTACACTCCTTACCTCGCCCACCCCGGCAACGCT CTGGTAACCTCTCTATCTGGCCTGTCACGAATCACTGTCCATCTAACCT CGGAGCCCTGTCACGCGGCGGACTTGGAGATGTTTGGAAAACAGCCT GTTTACTTGAGCAAGACTGATACCACCTGCGTGTCCCT 1.3e+02 copies / pL RPLPO Primer 1 10 GCCTTGACC Illi CAGCAAGT 66 nM Primer 2 11 TGCATCAGTACCCCATTCTAT 66 nM Module Component Name SEQ ID NO: Sequence Cone Competitor 12 TGCATCAGTACCCCATTCTATCATCAACGGGTACAAACGAGTCCTGGC CTTTATCCCAAGTGTTCTCTGCTTCATATTCTGGTAACCTCTCTAAATTG ATAGTTCCGATTGCAACTTGACGTCTTGTCTGTGGAGACGGATTACAC CTTCCCACTTGCTGAAAAGGTCAAGGC 2.9 copies / pL TFR.C Primer 1 13 AGGCCCATTTCCTTTATGTCTG 84 nM Primer 2 14 ACAGCCAACTGCTTTCATTT 84 nM Competitor 15 ACAGCCAACTGCTTTCATTTGTGAGGGATCTGACGGTAATTACTGTTA G ACTG GTGGGTATAA ACTTCGTTATTTG G ATTG G A ATTGTTG AG CCCTA CCTGACTCTGTATCCCAAGTGTTCTCTGCTTCATATTGGCAACGCTCTG GTAACCTCTCTAAATTGATAGTTCCGATTGCAACTTGACGTCTAGCCCG TATAAATAGCCGGTCTAAACAGCGATGAAATTTCTGTAGAATCAACTAA Al 1 1 1CCGTTCAACGGATCCTTGAGGGATCTGAACCAATACAGAGCAG ACATAAAGGAAATGGGCCT 1.4 copies / pL Probe 16 HK Module Fluorescent label e.g. VIC as per Examples, but can be any suitable fluorescent label and TAGAGAGGTTACCAG -optionally comprising an minor groove binder (MGB) moiety at the 3' end that increases the melting temperature (Tm) of the probe and stabilizes probe / target hybrids 262 nM Invasion Module version 1 (multiple probes) (Exemplary fluorescent label ABY) CD68 Primer 1 17 CCCTGGGTTGTGTACATGACT 23 nM Primer 2 18 TGGTTCCCAGCCCTGTGT 23 nM Probe 19 probe sequence CTCGATATGCCAGATTCAGACGTTC labelled with Invasion Module Fluorescent label e.g. ABY as per Examples, but can be any suitable fluorescent label plus optional quencher for example QSY e.g. ABY / CTCGATATGCCAGATTCAGACGTTC / QSY 28 nM Competitor 20 TGGTTCCCAGCCCTGTGTCCACCTCCAAGCCCAGATTCAGATTCGAGT TATCCCAAGTGTTCTCTGCTTCATATTACCGCTCGGAGAAAACCGCTAA AGGAACGTCTGAATCTGGCATATCGAGAATTGATAGTTCCGATTGCAA CTTGACGTCAAGCCCAGATTCAGATTCGAGTCATGTACACAACCCAGG G 0.6 copies / pL CTSV Primer 1 21 AACTTGTCTCACTGAGCGA 28 nM Module Component Name SEQ ID NO: Sequence Cone Primer 2 22 GCCACCATTGCAGCCCTGAT 28 nM Probe 23 probe sequence CATTCACGAGACGCATTAGCCTATA labelled with Invasion Module Fluorescent label e.g. ABY as per Examples, but can be any suitable fluorescent label plus optional quencher for example QSY for example Invasion Module Fluorescent label e.g. ABY as per Examples, but can be any suitable fluorescent label plus optional quencher for example QSY - e.g. ABY / CATTCACGAGACGCATTAGCCTATA / QSY 34 nM Competitor 24 AACTTGTCTCACTGAGCGAGCAGAATCTGGTGGACTGTTCGCGTCCT CAAGGCAATATCCCAAGTGTTCTCTGCTTCATATTACCGCTCGGAGAA AACCGCTAAAGTATAGGCTAATGCGTCTCGTGAATGAATTGATAGTTCC GATTGCAACTTGACGTGAATCTGGTGGACTGTTCGCGTCCTCAAGGC AATCAGGGCTGCAATGGTGGC 0.013 copies / pL MMP11 Primer 1 25 GGAGGCTGCAACATACCTCAA 20 nM Primer 2 26 TACAATGGCTTTGGAGGATAGCA 20 nM Probe 27 Probe sequence CCAATCACTCGCTTGGCATCTCTAC -labelled with Invasion Module Fluorescent label e.g. ABY as per Examples, but can be any suitable fluorescent label plus optional quencher for example QSY for example Invasion Module Fluorescent label e.g. ABY as per Examples, but can be any suitable fluorescent label plus optional quencher for example QSY -e.g. / ABY / CCAATCACTCGCTTGGCATCTCTAC / QSY / 24 nM Competitor 28 GGAGGCTGCAACATACCTCAATCCTGTCCCAGGCCGGATCCTCCTGA CGGTAATTACTGTTAGACTGGTGGGTATAAACTTCGTTATTTGGATTGG AATTGTTGAGCCCTACCTGACTCTGTATCCCAAGTGTTCTCTGCTTCAT ATTACCGCTCGGAGAAAACCGCTAAAGGTAGAGATGCCAAGCGAGTG ATTGGAATTGATAGTTCCGATTGCAACTTGACGTCTAGCCCGTATAAAT AGCCGGTCTAAACAGCGATGAAA1 1 1C 1 G 1AGAA1 CAAC 1 AAA 1 1 1 1CC GTTCAACGGATCCTCGGATCCTCCTGAAGCCC Illi CGCAGCACTGCT ATCCTCCAAAGCCATTGTA 2.6 copies / pL Module Component Name SEQ ID NO: Sequence Cone Proliferation Module version 1 (multiple probes)(Exempl ary fluorescent label FAM) AURKA Primer 1 29 CATCCGACCTTCAATCATTTCA 17 nM Primer 2 30 CAGGAGGACCACTCTCTGT 17 nM Probe 31 Probe sequence CAAGAGTATCTACCTGTC labelled with Proliferation Module Fluorescent label e.g. FAM as per Examples, but can be any suitable fluorescent label plus optional minor groove binder (MGB) moiety at the 3' end that increases the melting temperature (Tm) of the probe and stabilizes probe / target hybrid - e.g. / FAM / CAAGAGTATCTACCTGTC / MGB / 20 nM Competitor 32 CAGGAGGACCACTCTCTGTGGCACCCTGGACTACCTGCCCCCTTATC CCAAGTGTTCTCTGCTTCATATTGACAGGTAGATACTCTTGAATTGATA GTTCCGATTGCAACTTGACGTTCTCTGTGGCACCCTGGACTACCTGCC CCCTGAAATGATTGAAGGTCGGATG 1.5 copies / pL BIRC5 Primer 1 33 ATTCCCGGGCTTACCAGGTGA 10 nM Primer 2 34 GCGAACAAAGCTGTCAGCTCTAGC 10 nM Probe 35 Probe sequence TCTCCAAACCAAATCCT labelled with Proliferation Module Fluorescent label e.g. FAM as per Examples, but can be any suitable fluorescent label plus optional minor groove binder (MGB) moiety at the 3' end that increases the melting temperature (Tm) of the probe and stabilizes probe / target hybrid - e.g. / FAM / TCTCCAAACCAAATCCT / MGB / 12 nM Competitor 36 ATTCCCGGGCTTACCAGGTGAGAAGTGAGGGAGGAAGAAGGCACGG TA ATTACTGTTAG ACTGGTGG GTATA AACTTCGTTATTTG G ATTG G AATT GTTGAGCCCTACCTGACTCTGTATCCCAAGTGTTCTCTGCTTCATATTA GGATTTGGTTTGGAGAAATTGATAGTTCCGATTGCAACTTGACGTCTA GCCCGTATAAATAGCCGGTCTAAACAGCGATGAAAI 1 ICIGTAGAATC AACTAAAI 1 1 1CCGTTCAACGGATCCTGAGAAGTGAGGGAGGAAGAA GGCAGTGTCCC Illi GCTAGAGCTGACAGCTTTGTTCGC 0.13 copies / pL CCNB1 Primer 1 37 GCATCTTCTTGGGCACACAATTATTCTG 10 nM Primer 2 38 CAGGTTGTTGCAGGAGACCA 10 nM Module Component Name SEQ ID NO: Sequence Cone Probe 39 Probe sequence CGAACTTAGTCCCTTAC labelled with Proliferation Module Fluorescent label e.g. FAM as per Examples, but can be any suitable fluorescent label plus optional minor groove binder (MGB) moiety at the 3' end that increases the melting temperature (Tm) of the probe and stabilizes probe / target hybrids- e.g. / FAM / CGAACTTAGTCCCTTAC / MGB / 12 nM Competitor 40 CAGGTTGTTGCAGGAGACCATGTACATGACTGTCTCCATTATTGATCG TATCCCAAGTGTTCTCTGCTTCATATTGTAAGGGACTAAGTTCGAATTG ATAGTTCCGATTGCAACTTGACGTTCTCCATTATTGATCGGTTCATGCA GAATAATTGTGTGCCCAAGAAGATGC 0.19 copies / pL MKI67 Primer 1 41 TTCCACTGGGACGATCCG 15 nM Primer 2 42 GGTGCGACTTGACGAGCGGT 15 nM Probe 43 Probe sequence CGCTATTAACGCTT labelled with Proliferation Module Fluorescent label e.g. FAM as per Examples, but can be any suitable fluorescent label plus optional minor groove binder (MGB) moiety at the 3' end that increases the melting temperature (Tm) of the probe and stabilizes probe / target hybrids e.g. / FAM / CGCTATTAACGCTT / MGB / 19 nM Competitor 44 GGTGCGACTTGACGAGCGGTGGTTCGACAAGTGGCCTTGCGCATGTC GGCTCGGTCTGTCTCTTTCCCCTCATCTCTCGGTACACTCCTTACCTCG CCCACCCCAAGCGTTAATAGCGTCTGGCCTGTCACGAATCACTGTCCA TCTAACCTCGGAGCCCTGTCACGCGGCGGACTTGGAGAGGTGGTTC GACAAGTGGCCTTGCGGGCCGGATCGTCCCAGTGGAA 0.021 copies / pL MYBL2 Primer 1 45 GGCCGAGATCGCCAAGATGTTG 8 nM Primer 2 46 GGTAGAGTTCCAGTGATTCTTCA 8 nM Probe 47 probe sequence CACCCATAAAGTATGC labelled with Proliferation Module Fluorescent label e.g. FAM as per Examples, but can be any suitable fluorescent label plus optional minor groove binder (MGB) moiety at the 3' end that increases the melting temperature (Tm) of the probe and stabilizes probe / target hybrids e.g. / FAM / CACCCATAAAGTATGC / MGB / 10 nM Module Component Name SEQ ID NO: Sequence Cone Competitor 48 GGCCGAGATCGCCAAGATGTTGCCAGGGAGGACAGACAATGCTGTG AAGCGGTAATTACTGTTAGACTGGTGGGTATAAACTTCGTTATTTGGAT TGGAATTGTTGAGCCCTACCTGACTCTGTATCCCAAGTGTTCTCTGCTT CATATTGCATACTTTATGGGTGAATTGATAGTTCCGATTGCAACTTGAC GTCTAGCCCGTATAAATAGCCGGTCTAAACAGCGATGAAATTTCTGTA GAATCAACTAAA Illi CCGTTCAACGGATCCTGTTGCCAGGGAGGACA GACAATGCTGTGAAGAATCACTGGAACTCTACC 2.6e+03 copies / pL HER2 module version 1 (multiple probes) (Exemplary fluorescent label JUN) ERBB2 Primer 1 49 CCTGGATATTGGCACTGGTAACT 15 nM Primer 2 50 GCGGTGTGAGAAGTGCAGC 15 nM Probe 51 Probe sequence ACTTTCTTGTGTTCTTCGGCATTGACC labelled with HER2 Module Fluorescent label e.g. JUN as per Examples, but can be any suitable fluorescent label plus optional quencher such as QSY e.g. / JUN / ACTTTCTTGTGTTCTTCGGCATTGACC / QSY / 18 nM Competitor 52 GCGGTGTGAGAAGTGCAGCAAGCCCTGTGCCCGAGTGTGCTATGGT CTGGGGCATGTCGGCTCGGTCTGTCTCTTTCCCCTCATCTCTCGGTAC ACTCCTTACCTCGCCCACCCCATATCGTCGGGTCGAACGAAGCAATG GTCAATGCCGAAGAACACAAGAAAGTTCTGGCCTGTCACGAATCACT GTCCATCTAACCTCGGAGCCCTGTCACGCGGCGGACTTGGAGACCCT GTGCCCGAGTGTGCTATGGTCTGGGCATGGAGCACTTGCGAGAGGT GAGGGCAGTTACCAGTGCCAATATCCAGG 0.69 copies / pL GRB7 Primer 1 53 CGCCATCTGCATCCATCTTGTTTGG 54 nM Primer 2 54 ACCAGGGTATTATCTGAGGCA 54 nM Probe 55 Probe sequence TCACTATTTGTGCGTAACACTTCCGAC labelled with HER2 Module Fluorescent label e.g. JUN as per Examples, but can be any suitable fluorescent label plus optional quencher such as QSY e.g. / JUN / TCACTATTTGTGCGTAACACTTCCGAC / QSY / 65 nM Competitor 56 CGCCATCTGCATCCATCTTGTTTGGGCTCCCCACCCTTGAGAAGTGCC TCAGTATCCCAAGTGTTCTCTGCTTCATATTATATCGTCGGGTCGAACG 40 copies / pL Module Component Name SEQ ID NO: Sequence Cone AAGCAATGTCGGAAGTGTTACGCACAAATAGTGAAATTGATAGTTCCG ATTGCAACTTGACGTGTTTGGGCTCCCCACCCTTGAGAAGTGCCTCAG ATAATACCCTGGT Estrogen + Module version 1 (multiple probes) (Exemplary fluorescent label VIC) BAG1 Primer 1 57 GTTGTCAGCACTTGGAATACAA 13 nM Primer 2 58 TCCTGTGGACTGTTC 1 1 1 1 1C 13 nM Probe 59 Probe sequence TCGTACATAACACGT labelled with Estrogen Module Fluorescent label e.g. VIC as per Examples, but can be any suitable fluorescent label plus optional minor groove binder (MGB) moiety at the 3' end that increases the melting temperature (Tm) of the probe and stabilizes probe / target hybrids e.g. / VIC / TCGTACATAACACGT / MGB / 16 nM Competitor 60 GTTGTCAGCACTTGGAATACAAGATGGTTGCCGGGTCATGTTAATTGG GAAACGGTAATTACTGTTAGACTGGTGGGTATAAACTTCGTTATTTGGA TTGGAATTGTTGAGCCCTACCTGACTCTGTATCCCAAGTGTTCTCTGCT TCATATTACGTGTTATGTACGAAATTGATAGTTCCGATTGCAACTTGAC GTCTAGCCCGTATAAATAGCCGGTCTAAACAGCGATGAAATTTCTGTA GAATCAACTAAAI 1 1 1CCGTTCAACGGATCCTGTTGCCGGGTCATGTTA ATTGGGAAAAAGAACAGTCCACAGGA 0.039 copies / pL BCL2 Primer 1 61 GACCTAGTACCCACTGAGATTTC 33 nM Primer 2 62 Cl 1 ICCTATGAI 1 IAAGGGCAI 1 1 1 IC 33 nM Probe 63 Probe sequence CATCTTTGACTAACCTC labelled with Estrogen Module Fluorescent label e.g. VIC as per Examples, but can be any suitable fluorescent label plus optional minor groove binder (MGB) moiety at the 3' end that increases the melting temperature (Tm) of the probe and stabilizes probe / target hybrids e.g. / VIC / CATCTTTGACTAACCTC / MGB / 39 nM Competitor 64 GACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGGGAA AATATCCCAAGTGTTCTCTGCTTCATATTGAGGTTAGTCAAAGATGAAT TGATAGTTCCGATTGCAACTTGACGTCTGAGATTTCCACGCCGAAGGA CAGCGATGGGAAAAATGCCCTTAAATCATAGGAAAG 1.9 copies / pL ESRI Primer 1 65 TGGTGCCCCTCTATGACCT 40 nM Module Component Name SEQ ID NO: Sequence Cone Primer 2 66 GTGGGCGCATGTAGGCGGT 40 nM Probe 67 Probe sequence CATGAGTATGACATTCG labelled with Estrogen Module Fluorescent label e.g. VIC as per Examples, but can be any suitable fluorescent label plus optional minor groove binder (MGB) moiety at the 3' end that increases the melting temperature (Tm) of the probe and stabilizes probe / target hybrids e.g. VIC / CATGAGTATGACATTCG / MGB / 48 nM Competitor 68 TGGTGCCCCTCTATGACCTGCTGCTGGAGATGCTGGACGCCCACCGC CGGTAATTACTGTTAGACTGGTGGGTATAAACTTCGTTATTTGGATTGG AATTGTTGAGCCCTACCTGACTCTGTATCCCAAGTGTTCTCTGCTTCAT ATTCGAATGTCATACTCATGAATTGATAGTTCCGATTGCAACTTGACGT CTAGCCCGTATAAATAGCCGGTCTAAACAGCGATGAAATTTCTGTAGA ATCAACTAAAI 1 1 1CCGTTCAACGGATCCTCTGCTGCTGGAGATGCTG GACGCCCACCGCCTACATGCGCCCAC 0.83 copies / pL GSTM1 Primer 1 69 GCCCAGCTTGAAI 1 1 1 ICATTCA 11 nM Primer 2 70 AGAAGTACACGATGGGGGACGC 11 nM Probe 71 Probe sequence CTGGCTTATAACGACT labelled with Estrogen Module Fluorescent label e.g. VIC as per Examples, but can be any suitable fluorescent label plus optional minor groove binder (MGB) moiety at the 3' end that increases the melting temperature (Tm) of the probe and stabilizes probe / target hybrids e.g. / VIC / CTGGCTTATAACGACT / MGB / 13 nM Competitor 72 AGAAGTACACGATGGGGGACGCTCCTGATTATGACAGAAGCCAGCAT GTCGGCTCGGTCTGTCTCTTTCCCCTCATCTCTCGGTACACTCCTTACC TCGCCCACCCCAGTCGTTATAAGCCAGTCTGGCCTGTCACGAATCACT GTCCATCTAACCTCGGAGCCCTGTCACGCGGCGGACTTGGAGATCCT GATTATGACAGAAGCCAGTGGCTGAATGAAAAATTCAAGCTGGGC 0.075 copies / pL PGR. Primer 1 73 TCTTCCAGCACATAAGTAGTTG 41 nM Primer 2 74 GGCTGTCATTATGGTGTCCTTAC 41 nM Probe 75 probe sequence CGTTGTATGGATTCCTT labelled with Estrogen Module Fluorescent label e.g. VIC as per Examples, but can be 50 nM Module Component Name SEQ ID NO: Sequence Cone any suitable fluorescent label plus optional minor groove binder (MGB) moiety at the 3' end that increases the melting temperature (Tm) of the probe and stabilizes probe / target hybrids e.g. / VIC / CGTTGTATGGATTCCTT / MGB / Competitor 76 GGCTGTCATTATGGTGTCCTTACCTGTGGGAGCTGTAAGGTCTTGCAT GTCGGCTCGGTCTGTCTCTTTCCCCTCATCTCTCGGTACACTCCTTACC TCGCCCACCCCAAGGAATCCATACAACGTCTGGCCTGTCACGAATCAC TGTCCATCTAACCTCGGAGCCCTGTCACGCGGCGGACTTGGAGAGAG CTGTAAGGTCTTCTTTAAGAGGGCAATGGAAGGGCAGCACAACTACTT ATGTGCTGGAAGA 0.015 copies / pL SCUBE2 Primer 1 77 ACAGCCGTGATCCTTATTCA 22 nM Primer 2 78 G 1 1 1 11CC1GAGTGACAATCAGC 22 nM Probe 79 Probe sequence CGTCATAATTACGCGA labelled with Estrogen Module Fluorescent label e.g. VIC as per Examples, but can be any suitable fluorescent label plus optional minor groove binder (MGB) moiety at the 3' end that increases the melting temperature (Tm) of the probe and stabilizes probe / target hybrids e.g / VIC / CGTCATAATTACGCGA / MGB / 26 nM Competitor 80 G 1 1 1 1 1CCTGAGTGACAATCAGCACACCTGCATTCACCGCTCGGAAGA GGGCCTGAGCTGCATTAGCAATATTGAATTCTAGATTATACGATCGCGT AATTATGACGTTATTTAAGCTATCATACTCTAGTGTTTCCGCTCGGAAG AGGGCCTGAGCTGCATGAATAAGGATCACGGCTGT 94 copies / pL Table 2 - Exemplary sequences for putting the invention into practice. Single-probe approach where in each set of competitive amplification oligonucleotides that corresponds to a particular Module contains a unique probe. Sequence ID numbers in Table 2 correspond to those in Table 1. Module Component Name SEQ ID NO: Sequence Cone Invasion Module version 2 [single- CD68 Primer 1 17 23 nM Primer 2 18 23 nM Module Component Name SEQ ID NO: Sequence Cone probe] (Exemplary fluorophore ABY) Competitor 81 TGGTTCCCAGCCCTGTGTCCACCTCCAAGCCCAGATTCAGATTCG AGTTATCCCAAGTGTTCTCTGCTTCATATTACCGCTCGGAGAAAAC CGCTAAAGGAACGTCTGAATCTGGCATATCGAGAATTGATAGTTC CGATTGCAACTTGACGTCAAGCCCAGATTCAGATTCGAGTCATGT ACACAACCCAGGG 0.6 copies / pL CTSV Primer 1 21 28 nM Primer 2 22 28 nM Competitor 82 AACTTGTCTCACTGAGCGAGCAGAATCTGGTGGACTGTTCGCGT CCTCAAGGCAATATCCCAAGTGTTCTCTGCTTCATATTACCGCTCG GAGAAAACCGCTAAAGTATAGGCTAATGCGTCTCGTGAATGAATT GATAGTTCCGATTGCAACTTGACGTGAATCTGGTGGACTGTTCGC GTCCTCAAGGCAATCAGGGCTGCAATGGTGGC 0.013 copies / pL MMP11 Primer 1 25 20 nM Primer 2 26 20 nM Competitor 83 GGAGGCTGCAACATACCTCAATCCTGTCCCAGGCCGGATCCTCC TGACGGTAATTACTGTTAGACTGGTGGGTATAAACTTCGTTATTTG GATTGGAATTGTTGAGCCCTACCTGACTCTGTATCCCAAGTGTTC TCTGCTTCATATTACCGCTCGGAGAAAACCGCTAAAGGTAGAGAT GCCAAGCGAGTGATTGGAATTGATAGTTCCGATTGCAACTTGACG TCTAGCCCGTATAAATAGCCGGTCTAAACAGCGATGAAATTTCTG TAGAATCAACTAAAI 1 1 1CCGTTCAACGGATCCTCGGATCCTCCTG AAGCCC Illi CGCAGCACTGCTATCCTCCAAAGCCATTGTA 2.6 copies / pL Probe 84 Probe sequence C1 1 1AGCGGll l l c l cCGAGCGGT labelled with Invasion Module Fluorescent label e.g. ABY as per Examples, but can be any suitable fluorescent label, plus optional quencher for example QSY e.g. / ABY / CTTTAGCGG 1 1 1 1C 1CCGAGCGGT / QSY / 86 nM Module Component Name SEQ ID NO: Sequence Cone Proliferation Module version 2 [single-probe] (Exemplary label FAM) AURKA Primer 1 29 17 nM Primer 2 30 17 nM Competitor 32 1.5 copies / pL BIRC5 Primer 1 33 10 nM Primer 2 34 10 nM Competitor 36 0.13 copies / pL CCNB1 Primer 1 37 10 nM Primer 2 38 10 nM Competitor 40 0.19 copies / pL MKI67 Primer 1 41 15 nM Primer 2 42 15 nM Competitor 44 0.021 copies / pL MYBL2 Primer 1 45 8 nM Primer 2 46 8 nM Competitor 48 2.6e+03 copies / pL Module Component Name SEQ ID NO: Sequence Cone Probe 85 Probe sequence CAACAGTATCGACC labelled with Proliferation Module Fluorescent label e.g. FAM as per Examples, but can be any suitable fluorescent label plus optional minor groove binder (MGB) moiety at the 3' end that increases the melting temperature (Tm) of the probe and stabilizes probe / target hybrids- e.g. / FAM / CAACAGTATCGACC / MGB / 73 nM HER2 Module version 2 [singleprobe] (JUN) ERBB2 Primer 1 49 15 nM Primer 2 50 15 nM Competitor 52 0.69 copies / pL GRB7 Primer 1 53 54 nM Primer 2 54 54 nM Competitor 56 40 copies / pL Probe 86 Probe sequence ATTGCTTCGTTCGACCCGACGATAT labelled with HER2 Module Fluorescent label e.g. JUN as per Examples, but can be any suitable fluorescent label plus optional quencher such as QSY e.g. / J U N / ATTGCTTCGTTCG ACCCG ACG ATAT / QSY / 83 nM Estrogen + Module version 2 [single-probe] (VIC) BAG1 Primer 1 57 13 nM Primer 2 58 13 nM Competitor 87 GTTGTCAGCACTTGGAATACAAGATGGTTGCCGGGTCATGTTAAT TGGGAAACGGTAATTACTGTTAGACTGGTGGGTATAAACTTCGTT ATTTGGATTGGAATTGTTGAGCCCTACCTGACTCTGTATCCCAAGT GTTCTCTGCTTCATATTACGTGTTATGTACGAGATACGGGTTTCTT ATTGCAACTTGACGTCTAGCCCGTATAAATAGCCGGTCTAAACAG CGATGAAA1 1 1C 1 G 1AGAA1CAAC 1 AAA Illi CCGTTCAACGGATC CTGTTGCCGGGTCATGTTAATTGGGAAAAAGAACAGTCCACAGG A 0.039 copies / pL Module Component Name SEQ ID NO: Sequence Cone BCL2 Primer 1 61 33 nM Primer 2 62 33 nM Competitor 88 GACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGG GAAAATATCCCAAGTGTTCTCTGCTTCATATTGAGGTTAGTCAAAG ATGGATACGGGTTTCTTATTGCAACTTGACGTCTGAGATTTCCACG CCGAAGGACAGCGATGGGAAAAATGCCCTTAAATCATAGGAAAG 1.9 copies / pL ESRI Primer 1 65 40 nM Primer 2 66 40 nM Competitor 89 TGGTGCCCCTCTATGACCTGCTGCTGGAGATGCTGGACGCCCAC CGCCGGTAATTACTGTTAGACTGGTGGGTATAAACTTCGTTATTTG GATTGGAATTGTTGAGCCCTACCTGACTCTGTATCCCAAGTGTTC TCTGCTTCATATTCGAATGTCATACTCATGGATACGGGTTTCTTATT GCAACTTGACGTCTAGCCCGTATAAATAGCCGGTCTAAACAGCGA TGAAA1 1 1C 1G 1AGAA1CAAC 1 AAA Illi CCGTTCAACGGATCCTC TGCTGCTGGAGATGCTGGACGCCCACCGCCTACATGCGCCCAC 0.83 copies / pL GSTM1 Primer 1 69 11 nM Primer 2 70 11 nM Competitor 90 AGAAGTACACGATGGGGGACGCTCCTGATTATGACAGAAGCCAG CATGTCGGCTCGGTCTGTCTCTTTCCCCTCATCTCTCGGTACACT CCTTACCTCGCCCACCCCAGTCGTTATAAGCCAGGATACGGGTTT CTTAATCACTGTCCATCTAACCTCGGAGCCCTGTCACGCGGCGG ACTTGGAGATCCTGATTATGACAGAAGCCAGTGGCTGAATGAAAA ATTCAAGCTGGGC 0.075 copies / pL PGR Primer 1 73 41 nM Primer 2 74 41 nM Module Component Name SEQ ID NO: Sequence Cone Competitor 91 GGCTGTCATTATGGTGTCCTTACCTGTGGGAGCTGTAAGGTCTTG CATGTCGGCTCGGTCTGTCTCTTTCCCCTCATCTCTCGGTACACT CCTTACCTCGCCCACCCCAAGGAATCCATACAACGGATACGGGTT TCTTAATCACTGTCCATCTAACCTCGGAGCCCTGTCACGCGGCGG ACTTGGAGAGAGCTGTAAGGTCTTCTTTAAGAGGGCAATGGAAG GGCAGCACAACTACTTATGTGCTGGAAGA 0.015 copies / pL SCUBE2 Primer 1 77 22 nM Primer 2 78 22 nM Competitor 92 G 1 1 1 1 1CCTGAGTGACAATCAGCACACCTGCATTCACCGCTCGGA AGAGGGCCTGAGCTGCATTAGCAATATTGAATTCTAGATTATACG ATCGCGTAATTATGACGGATACGGGTTTCTTATACTCTAGTGTTTC CGCTCGGAAGAGGGCCTGAGCTGCATGAATAAGGATCACGGCT GT 94 copies / pL Probe 93 Probe sequence AAGAAACCCGTATC labelled with Estrogen Module Fluorescent label e.g. VIC as per Examples, but can be any suitable fluorescent label plus optional minor groove binder (MGB) moiety at the 3' end that increases the melting temperature (Tm) of the probe and stabilizes probe / target hybrids e.g. / VIC / AAGAAACCCGTATC / MGB / 192 nM Figure Legends Figure 1: a) the normalized emission spectra for a series of fluorophores provide a reference to choose potential candidates for multiplexing. B) optimal reporters for a pentaplexed assay on the Rotor-Gene™ Q are identified by comparing spectra to the instrument's filter specifications; C) signal bleeds through from CAL Fluor Red 610 (red traces) into the channel detection Quasar 670 (blue traces). Crosstalk is subsequently removed using software settings. Figure 2: (A) A single competitive amplification unit consists of a natural target (cDNA derived from mRNA), a synthetic competitor polynucleotide, primers shared by both the natural target and the competitor, and one or more probes. Each probe hybridizes to either the natural target or the competitor, but not both, and each probe is labelled with a distinct fluorophore (here, FAM and HEX). The diagram on the right describes the architecture of the competitive unit in a simplistic way: a square represents the natural target, a circle a competitor, small dots the primers, and shaded region any probes and their respective fluorophores. (B) A reaction module is a collection of competitive amplification units, each specific to a different natural target, and all of which utilize probes with the same fluorophore. For example, a given reaction module may contain a single probe sequence with the FAM fluorophore, or multiple different probe sequences, each with the FAM fluorophore. A single probe sequence may hybridize to only one competitor or it may be designed to hybridize to multiple competitors. A given reaction module may contain probes specific to competitor sequences, natural targets, or a mix of both. It will be understood by the skilled practitioner that the fluorophore for a given module can be changed without meaningfully altering its behaviour. Figure 3: Assay Configuration X. An assay configuration in accordance with the methods provided herein consists of multiple reactions, each performed in separate qPCR wells. Each reaction consists of one or more modules. In addition, a reaction may optionally contain a non-specific fluorescent dye, such as SYBR Green, EvaGreen, EvaGreen Plus, EvaRuby, or similar, which exhibit increased fluorescence in the presence of any double-stranded DNA, regardless of sequence. If a given reaction contains a single module, the probes in that module can utilize any fluorophore known to the art, as long as it is compatible with any non-specific fluorescent dye present. If a reaction consists of multiple modules, each module utilizes a distinct fluorophore. These can be any fluorophores known to the art, so long as they are all compatible with each other and any non-specific fluorescent dye present. "Compatible" will be understood by the skilled practitioner to imply any two dyes which exhibited limited overlap in their excitation and / or emission spectra, yet which individually exhibit significant overlap with the excitation and emission spectra of a given qPCR instrument. Figure 4: Modules A, B, C, D, E and F. The skilled practitioner will recognize that many alternative permutations exist to give rise to configuration with 3 and 4 reactions as well, that choice of the specific non-specific dye (EvaGreen, EvaRuby, or similar) relates only to the choice of fluorophore for a given module, not to the exemplary module targets shown here. E.g., configuration F could be altered so that Reaction F4 utilizes the FAM fluorophore for the Estrogen+ module and contains EvaRuby while Reaction F3 utilizes the VIC fluorophore for the HER2 module and contains EvaGreen. Note that, in the illustrated configurations, just because two modules in different reactions have the same shading, this does not imply that they must share the same fluorophore. Choices of fluorophores in different reactions are independent of one another. Figure 5: Exemplary assay Configurations A, B, C, D, E, F, G and H. One exemplary embodiment consists of Assay Configuration B of Figure 5, which is the configuration demonstrated by the data and Examples below, wherein • Reaction Bl contains the Housekeeping module consisting of SEQ ID No: 1-16, and the fluorophore is VIC, and the reaction contains EvaGreen Plus; • Reaction B2 contains the Proliferation module consisting of SEQ ID No: 29-48, and the fluorophore is FAM; • Reaction B3 contains the HER2 module consisting of SEQ ID No: 49-56, and the fluorophore is JUN; • Reaction B4 contains the Estrogen+ module consisting of SEQ ID No: 57-80, and the fluorophore is VIC; •Reaction B5 contains the Invasion+ module consisting of SEQ ID No: 17-28, and the fluorophore is ABY. Figure 6: Iterative optimization of primer sequences for 32-primer (informative genes only) sets. (A) the evolution of the Pareto front - the best (highest) CT observed for any reaction containing a given number of primers - over time. (B) box-and-whisker plots indicating the distribution of primer-dimer CTs for different reaction primer counts. (C) the empirical cumulative density function (eCDF) for just the largest collection in each subset. Horizontal or vertical dashed line indicates the acceptable primer-dimer CT threshold of 32.5. In total, 123 iterations totalling 47,232 reactions were run to identify the optimal set of sequences for each subset. Out of 631 different combinations of the 32 informative gene primer candidate sequences, only one (0.16%) had an acceptable CT >32.5. Figure 7: Iterative optimization of primer sequences 42-primer (all genes) sets. (A) shows the evolution of the Pareto front - the best (highest) CT observed for any reaction containing a given number of primers - over time. (B) box-and-whisker plots indicating the distribution of primer-dimer CTs for different reaction primer counts. (C) the empirical cumulative density function (eCDF) for just the largest collection in each subset. Horizontal or vertical dashed line indicates the acceptable primer-dimer CT threshold of 32.5. In total, 123 iterations totalling 47,232 reactions were run to identify the optimal set of sequences for each subset. Out of 588 different combinations of the 42 primer candidate sequences for all genes in the assay, only one (0.16%) had an acceptable CT >32.5. Figure 8: Optimization of component concentrations for each module. The invention required careful optimization of the concentration of each synthetic DNA component (primers, probes, and competitors). We initially screened 177 different configurations of the HK module and 499 different configurations of each of the FAM, VIC, ABY, and JUN modules. For each candidate configuration for each module, we tested 6 synthetic patient samples, measuring the correlation between the expected and observed signal. (A) The vast majority of the configurations displayed poor (low) correlation (top row). (B) We selected the 24 most promising configurations for each module and tested this subset against 60 synthetic patient samples. Despite such expert selection, many of these too displayed poor correlation in this higher-resolution experiment. Figure 9: Performance of the OncoSignatur Breast assay. The assay modules are each run in separate reactions (five total: HK, FAM, VIC, ABY, JUN). Each module consists of primers for the relevant mRNA targets ("wildtype amplicons"), competitor sequences, and fluorescent probes specific to the competitor sequences. (A) shows the correlation between the expected score from each module (x-axis) and the score we observed from our assays (y-axis) for each synthetic patient (individual dots). The R value indicates the Pearson correlation coefficient between the expected and observed values. Since correlation is highly sensitive to outliers, we omitted the worst 10% of data points (6) for each module. We then used a modified Bayesian linear regression approach to convert our five module measurements to a standardized "unsealed Recurrence Score" (RSu), imputing outliers from standard Normal distributions. (B) This was converted to a final Recurrence Score using the method in the OTDX patent. These results demonstrate that the OncoSignatur Breast assay faithfully reproduces the OncoType DX Recurrence score with high correlation. Figure 10: Readout for a representative sample. In an exemplary configuration, the invention provides a distinct fluorescent signal from each module. Shown here are the signals resulting from a representative synthetic sample. These signals are then processed by extracting the final fluorescence intensity at the end of the reaction (indicated here by a dot). For comparison, the expected readout for each module is shown as a horizontal dashed line. It is clear that the assay produces the expected signal from each module. Figure 11: One embodiment of the Housekeeping Module was used to test six patient samples. Samples consisted of resected breast tumor tissue that was formalin-fixed and paraffin embedded (FFPE), followed by RNA extraction from three 5 pm sections. Total RNA for each sample was quantified, then samples were diluted to the indicated concentrations. Each reaction consisted of 1 pL sample, 1 pL 5x Housekeeping Module (including EvaGreen), 1.25 pL 4x one-step RT-qPCR mastermix, and 1.75 pL water. Samples were incubated in a thermocycler for 10 minutes at 53 °C for reversetranscriptase conversion of RNA to DNA, followed by a 2 minute incubation at 95 °C, and finally 50 cycles of 3 seconds at 95 °C and 30 seconds at 60 °C. The resulting fluorescence was normalized and background subtracted, and the average fluorescence intensity at cycles 48, 49, and 50 were taken as the Housekeeping Signal. This signal displayed strong dependence on sample dilution as well as strong correlation with the cycle threshold of the EvaGreen signal, both indicating that the Housekeeping Signal is an accurate representation of the geometric average CT of the five housekeeping gene transcripts in patient samples. Examples Example 1 Optimisation of primer sequences As set out elsewhere herein, and in the Figures and Figure Legends, the methods of the invention may be performed in up to five separate reactions, or may be performed in a single reaction. A single reaction for the amplification of all of the informative modules (Proliferation, Invasion, HER2 and Estrogen) requires the amplification of 16 target polynucleotides, meaning that 32 primers are present in the reaction. A single reaction for the amplification of all of the modules (House Keeping, Proliferation, Invasion, HER2 and Estrogen) requires the amplification of 21 target polynucleotides, meaning that 42 primers are present in the reaction. The invention required careful optimization of primer sequences in order to avoid detrimental primer-dimer formation. Primer sequences were optimised using high-throughput experimentation and sophisticated in silico techniques. Figure 6A shows the evolution of the Pareto front - the best (highest) CT observed for any reaction containing a given number of primers - over time. Each iteration consisted of testing different combinations of candidate primer sequences in each well of a 384 qPCR plate (using qPCR mastermix and EvaGreen dye) and observing the resulting signal over 50 PCR cycles and determining the reaction's CT. In an ideal scenario, no primer-dimer would form, resulting in no detectable signal (recorded as a CT of 50). Figure 6B shows box-and-whisker plots indicating the distribution of primer-dimer CTs for different reaction primer counts, and Figure 6C shows the empirical cumulative density function (eCDF) for just the largest collection in each subset. Horizontal or vertical dashed line indicates the acceptable primer-dimer CT threshold of 32.5. In total, 123 iterations totalling 47,232 reactions were run to identify the optimal set of sequences for each subset. Out of 631 different combinations of the 32 informative gene primer candidate sequences, only one (0.16%) had an acceptable CT >32.5. Figure 7 shows the iterative optimization of primer sequences 42-primer (all genes) sets. (A) shows the evolution of the Pareto front - the best (highest) CT observed for any reaction containing a given number of primers - over time. Each iteration consisted of testing different combinations of candidate primer sequences in each well of a 384 qPCR. plate (using qPCR mastermix and EvaGreen dye) and observing the resulting signal over 50 PCR cycles and determining the reaction's CT. In an ideal scenario, no primer-dimer would form, resulting in no detectable signal (recorded as a CT of 50). Figure 7B shows box-and-whisker plots indicating the distribution of primer-dimer CTs for different reaction primer counts, and Figure 7C shows the empirical cumulative density function (eCDF) for just the largest collection in each subset. Horizontal or vertical dashed line indicates the acceptable primer-dimer CT threshold of 32.5. In total, 123 iterations totalling 47,232 reactions were run to identify the optimal set of sequences for each subset. Out of 588 different combinations of the 42 primer candidate sequences for all genes in the assay, only one (0.16%) had an acceptable CT >32.5. The sequence of those primers are described elsewhere herein for example in Table 1. Example 2 Optimization of component concentrations for each module The invention required careful optimization of the concentration of each synthetic DNA component (primers, probes, and competitors). 177 different configurations of the HK module and 499 different configurations of each of the FAM, VIC, ABY, and JUN modules were screened. For each candidate configuration for each module, 6 synthetic patient samples were tested, measuring the correlation between the expected and observed signal. Figure 8A shows that the vast majority of the configurations displayed poor (low) correlation. The 24 most promising configurations for each module were selected and tested against 60 synthetic patient samples. Despite such expert selection, many of these too displayed poor correlation in this higher-resolution experiment (Figure 8B). Example 3 Performance of the Assay of the invention (the OncoSignatur Breast assay) As set out elsewhere here, and for example in Figure 5, there are many different permutations in which the assay and methods of the invention can be conducted. Figure 9 sets out data obtained when performing the assay according to the embodiment set out in Configuration B of Figure 5. The assay modules are each run in separate reactions (five total: HK, FAM, VIC, ABY, JUN). Each module consists of primers for the relevant mRNA targets ("wildtype amplicons"), competitor sequences, and fluorescent probes specific to the competitor sequences. [Note that there are not probes specific to the "wildtype amplicons" (herein terms the "target amplicon"). However, as will be apparent to the skilled person, in some embodiments of the invention the probes may be specific to the target amplicon rather than the competitor amplicon.] After background subtraction, the readout from each module consists of the fluorescence intensity from the relevant fluorophore after 50 cycles of qPCR amplification. Figure 10 shows the readout for a representative sample. In an exemplary configuration, the invention provides a distinct fluorescent signal from each module. Shown here are the signals resulting from a representative synthetic sample. These signals are then processed by extracting the final fluorescence intensity at the end of the reaction (indicated here by a dot). For comparison, the expected readout for each module is shown as a horizontal dashed line. It is clear that the assay produces the expected signal from each module. We tested these modules against 60 "synthetic patients" - mixtures of synthetic DNA in buffer designed to statistically mimic realistic mRNA levels in actual patients. Figure 9A shows the correlation between the expected score from each module (x-axis) and the score we observed from our assays (y-axis) for each synthetic patient (individual dots). The R value indicates the Pearson correlation coefficient between the expected and observed values. Since correlation is highly sensitive to outliers, we omitted the worst 10% of data points (6) for each module. We then used a modified Bayesian linear regression approach to convert our five module measurements to a standardized "unsealed Recurrence Score" (RSu), imputing outliers from standard Normal distributions. This was converted to a final Recurrence Score using the method in the OTDX patent (Figure 9B). The final formula is: RSuZ = max(P_FAM * (HK - FAM), -y_FAM) - p_VIC * (HK - VIC) + p_ABY * (HK -ABY) + max(P_JUN * (HK - JUN), -y_JUN) RSu = RSuZ * 1.47 + 9.98 RS = min(max(20 * (RSu - 6.7), 0), 100) where p_FAM = 0.35, p_VIC = 0.42, p_ABY = 0.17, p_JUN = 0.46, y_FAM = 1.14, y_JUN = 0.76, and HK, FAM, VIC, ABY, and JUN are the standardized endpoint fluorescent intensities from the relevant module. These results demonstrate that the OncoSignatur Breast assay faithfully reproduces the OncoType DX Recurrence score with high correlation. Example 4 Housekeeping module accurately reports sample quantity See Figure 11. One embodiment of the Housekeeping Module was used to test six patient samples. Samples consisted of resected breast tumor tissue that was formalin-fixed and paraffin embedded (FFPE), followed by RNA extraction from three 5 pm sections. Total RNA for each sample was quantified, then samples were diluted to the indicated concentrations. Each reaction consisted of 1 pL sample, 1 pL 5x Housekeeping Module (including EvaGreen), 1.25 pL 4x one-step RT-qPCR mastermix, and 1.75 pL water. Samples were incubated in a thermocycler for 10 minutes at 53 °C for reversetranscriptase conversion of RNA to DNA, followed by a 2 minute incubation at 95 °C, and finally 50 cycles of 3 seconds at 95 °C and 30 seconds at 60 °C. The resulting fluorescence was normalized and background subtracted, and the average fluorescence intensity at cycles 48, 49, and 50 were taken as the Housekeeping Signal. This signal displayed strong dependence on sample dilution as well as strong correlation with the cycle threshold of the EvaGreen signal, both indicating that the Housekeeping Signal is an accurate representation of the geometric average CT of the five housekeeping gene transcripts in patient samples.

Claims

1. A method of amplifying a plurality of target polynucleotides in a sample, wherein the method comprises:a) providing a sample potentially comprising the target polynucleotides;b) providing a plurality of sets of competitive target amplification oligonucleotides, wherein each set of competitive target amplification oligonucleotides is designed to amplify a particular target polynucleotide, and where each target to be amplified has a corresponding set of competitive target amplification oligonucleotides, and where within each set there comprises:i) a competitor polynucleotide;ii) a first primer and a second primer that are capable of hybridising to the particular target polynucleotide and to the first competitor polynucleotide of the set, wherein said first primer and second primer are arranged so that: hybridisation of the first and second primers to the particular target polynucleotide allows amplification of a portion of the particular target polynucleotide producing a target amplicon; and hybridisation of the first and second primers to the first competitor polynucleotide allows amplification of the first competitor polynucleotide, or of portion of the first competitor polynucleotide producing a competitor amplicon; andiii) a probe oligonucleotide which comprises a fluorescent label and which is capable of hybridising to the first competitor amplicon or the first target ampliconwherein the first competitor polynucleotide of each set is designed to have different amplification kinetics to that of the first target polynucleotide of each set;c) initiating a primer extension reaction such that:amplification of a portion of each of the at least two or plurality of target polynucleotides occurs resulting in the production of at least two, or a plurality of different target amplicons corresponding to each particular target; andamplification of each competitor polynucleotide, or a portion of each competitor polynucleotide of each set of competitive target amplificationoligonucleotides occurs, resulting in the production of at least two or a plurality of different competitor ampliconswherein the plurality of target polynucleotides are cDNA molecules derived from a first and a second or a plurality of different mRNA polynucleotides present in a sample obtained from a subject and wherein the plurality of mRNA polynucleotides are expressed from the group comprising or consisting of the following genes:ACTB, GAPDH, GUSB, RPLPO, TFRC which together comprise a House Keeping Module;CD68, CTSV, MMP11 which together comprise an Invasion Module;AURKA, BIRC5, CCNB1, MKI67, MYBL2 which together comprise a Proliferation Module;ERBB2, GRB7 which together comprise a HER2 Module; andBAG1, BCL2, ESRI, GSTM1, PGR, SCUBE2 which together comprise an Estrogen Module;And wherein:i) the sets of competitive amplification oligonucleotides for amplification of the House Keeping Module comprises or consists of:a first ACTB primer of SEQ ID NO: 1;a second ACTB primer of SEQ ID NO: 2;an ACTB competitor polynucleotide of SEQ ID NO: 3;a first GAPDH primer of SEQ ID NO: 4;a second GAPDH primer of SEQ ID NO: 5;an GAPDH competitor polynucleotide of SEQ ID NO: 6;a first GUSB primer of SEQ ID NO: 7;a second GUSB primer of SEQ ID NO: 8;an GUSB competitor polynucleotide of SEQ ID NO: 9;a first RPLPO primer of SEQ ID NO: 10;a second RPLPOprimer of SEQ ID NO: 11;an RPLPO competitor polynucleotide of SEQ ID NO: 12;a first TRFC primer of SEQ ID NO: 13;a second TRFC primer of SEQ ID NO: 14;an TRFC competitor polynucleotide of SEQ ID NO: 15; anda universal House Keeping Module probe oligonucleotide of SEQ ID NO: 16 labelled with a House Keeping Fluorescent label;ii) the sets of competitive amplification oligonucleotides for amplification of the Invasion Module comprises or consists of:a)a first CD68 primer of SEQ ID NO: 17;a second CD68 primer of SEQ ID NO: 18;an CD68 competitor polynucleotide of SEQ ID NO: 20; anda CD68 probe oligonucleotide of SEQ ID NO: 19 labelled with an Invasion Module Fluorescent label;a first CTSV primer of SEQ ID NO: 21;a second CTSV primer of SEQ ID NO: 22;an CTSV competitor polynucleotide of SEQ ID NO: 24; anda CTSV probe oligonucleotide of SEQ ID NO: 23 labelled with an Invasion Module Fluorescent label;anda first MMP11 primer of SEQ ID NO: 25;a second MMP11 primer of SEQ ID NO: 26;an MMP11 competitor polynucleotide of SEQ ID NO: 28; anda MMP11 probe oligonucleotide of SEQ ID NO: 27 labelled with an Invasion Module Fluorescent label;orb)a first CD68 primer of SEQ ID NO: 17;a second CD68 primer of SEQ ID NO: 18;an CD68 competitor polynucleotide of SEQ ID NO: 81;a first CTSV primer of SEQ ID NO: 21;a second CTSV primer of SEQ ID NO: 22;an CTSV competitor polynucleotide of SEQ ID NO: 82;a first MMP11 primer of SEQ ID NO: 25;a second MMP11 primer of SEQ ID NO: 26;an MMP11 competitor polynucleotide of SEQ ID NO: 83;anda universal Invasion Module probe oligonucleotide of SEQ ID NO: 84 labelled with an Invasion Module Fluorescent label;iii) the sets of competitive amplification oligonucleotides for amplification of the Proliferation Module that comprises or consists of:a)a first AURKA primer of SEQ ID NO: 29;a second AURKA primer of SEQ ID NO: 30;an AURKA competitor polynucleotide of SEQ ID NO: 32; anda AURKA probe oligonucleotide of SEQ ID NO: 31 labelled with a Proliferation Module Fluorescent label;a first BIRC5 primer of SEQ ID NO: 33;a second BIRC5 primer of SEQ ID NO: 34;an BIRC5 competitor polynucleotide of SEQ ID NO: 36; anda BIRC5 probe oligonucleotide of SEQ ID NO: 35 labelled with a Proliferation Module Fluorescent label;a first CCNB1 primer of SEQ ID NO: 37;a second CCNBlprimer of SEQ ID NO: 38;an CCNBlcompetitor polynucleotide of SEQ ID NO: 40; anda CCNBlprobe oligonucleotide of SEQ ID NO: 39 labelled with a Proliferation Module Fluorescent label;a first MK167 primer of SEQ ID NO: 41;a second MK167 of SEQ ID NO: 42;an MK167 competitor polynucleotide of SEQ ID NO: 44; anda MK167 probe oligonucleotide of SEQ ID NO: 43 labelled with a Proliferation Module Fluorescent label;a first MYBL2 primer of SEQ ID NO: 45;a second MYBL2 of SEQ ID NO: 46;an MYBL2 competitor polynucleotide of SEQ ID NO: 48; anda MYBL2 probe oligonucleotide of SEQ ID NO: 47 labelled with a Proliferation Module Fluorescent label;orb)a first AURKA primer of SEQ ID NO: 29;a second AURKA primer of SEQ ID NO: 30;an AURKA competitor polynucleotide of SEQ ID NO: 32; anda first BIRC5 primer of SEQ ID NO: 33;a second BIRC5 primer of SEQ ID NO: 34;an BIRC5 competitor polynucleotide of SEQ ID NO: 36; anda first CCNB1 primer of SEQ ID NO: 37;a second CCNBlprimer of SEQ ID NO: 38;an CCNBlcompetitor polynucleotide of SEQ ID NO: 40; anda first MK167 primer of SEQ ID NO: 41;a second MK167 of SEQ ID NO: 42;an MK167 competitor polynucleotide of SEQ ID NO: 44; anda first MYBL2 primer of SEQ ID NO: 45;a second MYBL2 of SEQ ID NO: 46;an MYBL2 competitor polynucleotide of SEQ ID NO: 48; anda universal Proliferation Module probe oligonucleotide of SEQ ID NO: 85 labelled with a Proliferation Module Fluorescent label;iv) the sets of competitive amplification oligonucleotides for amplification of the HER2 Module that comprises or consists of:a)a first ERBB2 primer of SEQ ID NO: 49a second ERBB2 of SEQ ID NO: 50;an ERBB2 competitor polynucleotide of SEQ ID NO: 52 anda ERBB2 probe oligonucleotide of SEQ ID NO: 51 labelled with a HER2 Module Fluorescent label;a first GRB7 primer of SEQ ID NO: 53a second GRB7 of SEQ ID NO: 54;an GRB7 competitor polynucleotide of SEQ ID NO: 56 anda GRB7 probe oligonucleotide of SEQ ID NO: 55 labelled with a HER2 Module Fluorescent label;orb)a first ERBB2 primer of SEQ ID NO: 49a second ERBB2 of SEQ ID NO: 50;an ERBB2 competitor polynucleotide of SEQ ID NO: 52 anda first GRB7 primer of SEQ ID NO: 53a second GRB7 of SEQ ID NO: 54;an GRB7 competitor polynucleotide of SEQ ID NO: 56 anda universal HER2 module probe oligonucleotide of SEQ ID NO: 86 labelled with a HER2 Module Fluorescent label;andiv) the sets of competitive amplification oligonucleotides for amplification of the Estrogen Module that comprises or consists of:a)a first BAG1 primer of SEQ ID NO: 57a second BAG1 of SEQ ID NO: 58;an BAG1 competitor polynucleotide of SEQ ID NO: 60 anda BAG1 probe oligonucleotide if SEQ ID NO: 59 labelled with an Estrogen Module Fluorescent label;a first BCL2 primer of SEQ ID NO: 61a second BCL2 of SEQ ID NO: 62;an BCL2 competitor polynucleotide of SEQ ID NO: 64 anda BCL2 probe oligonucleotide if SEQ ID NO: 63 labelled with an Estrogen Module Fluorescent label;a first ESRI primer of SEQ ID NO: 65a second ESRI of SEQ ID NO: 66;an ESRI competitor polynucleotide of SEQ ID NO: 68 anda ESRI probe oligonucleotide if SEQ ID NO: 67 labelled with an Estrogen Module Fluorescent label;a first GSTM1 primer of SEQ ID NO: 69a second GSTM1 of SEQ ID NO: 70;an GSTM1 competitor polynucleotide of SEQ ID NO: 72 anda GSTM1 probe oligonucleotide if SEQ ID NO: 71 labelled with an Estrogen Module Fluorescent label;a first PGR primer of SEQ ID NO: 73a second PGR of SEQ ID NO: 74;an PGR competitor polynucleotide of SEQ ID NO: 76 anda PGR 1 probe oligonucleotide if SEQ ID NO: 75 labelled with an Estrogen Module Fluorescent label;a first SCUBE2 primer of SEQ ID NO: 77;a second SCUBE2 of SEQ ID NO: 78;an SCUBE2 competitor polynucleotide of SEQ ID NO: 80 anda SCUBE2 probe oligonucleotide if SEQ ID NO: 79 labelled with an Estrogen Module Fluorescent label;orb)a first BAG1 primer of SEQ ID NO: 57a second BAG1 of SEQ ID NO: 58;an BAG1 competitor polynucleotide of SEQ ID NO: 87a first BCL2 primer of SEQ ID NO: 61a second BCL2 of SEQ ID NO: 62;an BCL2 competitor polynucleotide of SEQ ID NO: 88a first ESRI primer of SEQ ID NO: 65a second ESRI of SEQ ID NO: 66;an ESRI competitor polynucleotide of SEQ ID NO: 89a first GSTM1 primer of SEQ ID NO: 69a second GSTM1 of SEQ ID NO: 70;an GSTM1 competitor polynucleotide of SEQ ID NO: 90a first PGR. primer of SEQ ID NO: 73a second PGR of SEQ ID NO: 74;an PGR competitor polynucleotide of SEQ ID NO: 91a first SCUBE2 primer of SEQ ID NO: 77;a second SCUBE2 of SEQ ID NO: 78;an SCUBE2 competitor polynucleotide of SEQ ID NO: 92 anda universal Estrogen Module probe oligonucleotide of SEQ ID NO: 93 labelled with an Estrogen Module Fluorescent label.

2. The method of claim 1 wherein the plurality of target polynucleotides are cDNA molecules derived from mRNA polynucleotides that are expressed from more than one module.

3. The method of claim 1 or 2 wherein the method comprises amplifying target polynucleotides of the House Keeping Module, Invasion Module, Proliferation Module, HER2 Module and the Estrogen Module in separate reactions.

4. The method of claim 1 or 2 wherein the method comprises amplifying target polynucleotides of the House Keeping Module, Invasion Module, Proliferation Module, HER2 Module and the Estrogen Module in the same reaction.

5. The method of any of claims 1-4 wherein each Module fluorescent label present in the amplification reaction has a different but compatible fluorescent label.

6. The method of any of claims 1-5 wherein the Module fluorescent labels are selected from ABY, FAM, JUN, VIC.

7. The method of any of claims 1-6 wherein the sample obtained from a subject is a tumour sample, optionally a breast tumour biopsy.

8. The method of any of claims 1-7 wherein the amplification reaction is a PCR reaction.

9. The method of any one of claims 1-8 wherein the amplification reaction is a PCR based reaction and is performed for a specified number of cycles, optionally at least 35, 36, 37, 38, 39,40,41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 58, 59 or 60 cycles.

10. The method of claim 9 further comprising determining the fluorescent signal intensity of each fluorescent label associated with a probe oligonucleotide present in the amplification reaction generated after the specified number of cycles.

11. The method of any of claims 1-10 wherein the fluorescent signal intensity of each fluorescent label associated with a probe oligonucleotide present in the amplification reaction is determined after 50 amplification cycles.

12. The method of any of claims 1-11 wherein the method further comprises determining the end point fluorescence obtained after a specific number of cycles of the fluorescent label associated with the House Keeping Module, the Invasion Module, the Proliferation Module, the HER2 Module and the Estrogen Module.

13. A method for generating a risk score for use in determining post-operative risk of breast cancer recurrence and / or for predicting response to chemotherapy wherein the method comprises performing the method of any of claims 1-12.

14. The method of any of claims 1-13 wherein in the amplification reaction the:first ACTB primer of SEQ ID NO: 1 is at a concentration of 33 nMsecond ACTB primer of SEQ ID NO: 2 is at a concentration of 33 nMACTB competitor polynucleotide of SEQ ID NO: 3 is at a concentration of 1.8e+02 copies / pLfirst GAPDH primer of SEQ ID NO: 4 is at a concentration of 14 nMsecond GAPDH primer of SEQ ID NO: 5 is at a concentration of 14 nMGAPDH competitor polynucleotide of SEQ ID NO: 6 is at a concentration of le+02 copies / pLfirst GUSB primer of SEQ ID NO: 7 is at a concentration of 22 nMsecond GUSB primer of SEQ ID NO: 8 is at a concentration of 22 nMGUSB competitor polynucleotide of SEQ ID NO: 9 is at a concentration of 1.3e+02 copies / pLfirst RPLPO primer of SEQ ID NO: 10 is at a concentration of 66 nMsecond RPLPOprimer of SEQ ID NO: 11 is at a concentration of 66 nMRPLPO competitor polynucleotide of SEQ ID NO: 12 is at a concentration of 2.9 copies / pLfirst TRFC primer of SEQ ID NO: 13 is at a concentration of 84 nMsecond TRFC primer of SEQ ID NO: 14 is at a concentration of 84 nMTRFC competitor polynucleotide of SEQ ID NO: 15 is at a concentration of 1.4 copies / pLuniversal House Keeping Module probe oligonucleotide of SEQ ID NO: 16 labelled with a House Keeping Fluorescent label is at a concentration of 262 nMfirst CD68 primer of SEQ ID NO: 17 is at a concentration of 23 nMsecond CD68 primer of SEQ ID NO: 18 is at a concentration of 23 nMCD68 competitor polynucleotide of SEQ ID NO: 20 is at a concentration of 0.6 copies / pLCD68 probe oligonucleotide of SEQ ID NO: 19 labelled with an Invasion Module Fluorescent label is at a concentration of 28 nMfirst CTSV primer of SEQ ID NO: 21 is at a concentration of 28 nM second CTSV primer of SEQ ID NO: 22 is at a concentration of 28 nMCTSV competitor polynucleotide of SEQ ID NO: 24 is at a concentration of 0.013 copies / pLCTSV probe oligonucleotide of SEQ ID NO: 23 labelled with an Invasion Module Fluorescent label is at a concentration of 34 nMfirst MMP11 primer of SEQ ID NO: 25 is at a concentration of 20 nMsecond MMP11 primer of SEQ ID NO: 26 is at a concentration of 20 nMMMP11 competitor polynucleotide of SEQ ID NO: 28 is at a concentration of 2.6 copies / pLMMP11 probe oligonucleotide of SEQ ID NO: 27 labelled with an Invasion Module Fluorescent label is at a concentration of 24 nMCD68 competitor polynucleotide of SEQ ID NO: 81 is at a concentration of 0.6 copies / pLCTSV competitor polynucleotide of SEQ ID NO: 82 is at a concentration of 0.013 copies / pLMMP11 competitor polynucleotide of SEQ ID NO: 83 is at a concentration of 2.6 copies / pLuniversal Invasion Module probe oligonucleotide of SEQ ID NO: 84 labelled withInvasion Module Fluorescent label is at a concentration of 86 nMfirst AURKA primer of SEQ ID NO: 29 is at a concentration of 17 nM second AURKA primer of SEQ ID NO: 30 is at a concentration of 17 nMAURKA competitor polynucleotide of SEQ ID NO: 32 is at a concentration of 1.5 copies / pLAURKA probe oligonucleotide of SEQ ID NO: 31 labelled with a Proliferation Module Fluorescent label is at a concentration of 20 nMfirst BIRC5 primer of SEQ ID NO: 33 is at a concentration of 10 nMsecond BIRC5 primer of SEQ ID NO: 34 is at a concentration of 10 nMBIRC5 competitor polynucleotide of SEQ ID NO: 36 is at a concentration of 0.13 copies / pLBIRC5 probe oligonucleotide of SEQ ID NO: 35 labelled with a Proliferation Module Fluorescent label is at a concentration of 12 nMfirst CCNB1 primer of SEQ ID NO: 37 is at a concentration of 10 nM second CCNB1 primer of SEQ ID NO: 38 is at a concentration of 10 nMCCNB1 competitor polynucleotide of SEQ ID NO: 40 is at a concentration of 0.19 copies / pLCCNB1 probe oligonucleotide of SEQ ID NO: 39 labelled with a Proliferation Module Fluorescent label is at a concentration of 12 nMfirst MK167 primer of SEQ ID NO: 41 is at a concentration of 15 nMsecond MK167 of SEQ ID NO: 42 is at a concentration of 15 nMMK167 competitor polynucleotide of SEQ ID NO: 44 is at a concentration of 0.021 copies / pLMK167 probe oligonucleotide of SEQ ID NO: 43 labelled with a Proliferation ModuleFluorescent label is at a concentration of 19 nMfirst MYBL2 primer of SEQ ID NO: 45 is at a concentration of 8 nMsecond MYBL2 of SEQ ID NO: 46 is at a concentration of 8 nMMYBL2 competitor polynucleotide of SEQ ID NO: 48 is at a concentration of 2.6e+03 copies / pLMYBL2 probe oligonucleotide of SEQ ID NO: 47 labelled with a Proliferation Module Fluorescent label is at a concentration of 10 nMuniversal Proliferation Module probe oligonucleotide of SEQ ID NO: 85 labelled with a Proliferation Module Fluorescent label is at a concentration of 73 nMfirst ERBB2 primer of SEQ ID NO: 49 is at a concentration of 15 nMsecond ERBB2 of SEQ ID NO: 50 is at a concentration of 15 nMERBB2 competitor polynucleotide of SEQ ID NO: 52 is at a concentration of 0.69 copies / pLERBB2 probe oligonucleotide of SEQ ID NO: 51 labelled with a HER2 Module Fluorescent label is at a concentration of 18 nMfirst GRB7 primer of SEQ ID NO: 53 is at a concentration of 54 nMsecond GRB7 of SEQ ID NO: 54 is at a concentration of 54 nMGRB7 competitor polynucleotide of SEQ ID NO: 56 is at a concentration of 40 copies / pLGRB7 probe oligonucleotide of SEQ ID NO: 55 labelled with a HER2 Module Fluorescent label is at a concentration of 65 nMuniversal HER2 module probe oligonucleotide of SEQ ID NO: 86 labelled with a HER2 Module Fluorescent label is at a concentration of 83 nMfirst BAG1 primer of SEQ ID NO: 57 is at a concentration of 13 nMsecond BAG1 of SEQ ID NO: 58 is at a concentration of 13 nMBAG1 competitor polynucleotide of SEQ ID NO: 60 is at a concentration of 0.039 copies / pLBAG1 probe oligonucleotide if SEQ ID NO: 59 labelled with an Estrogen Module Fluorescent label is at a concentration of 16 nMfirst BCL2 primer of SEQ ID NO: 61 is at a concentration of 33 nMsecond BCL2 of SEQ ID NO: 62 is at a concentration of 33 nMBCL2 competitor polynucleotide of SEQ ID NO: 64 is at a concentration of 1.9 copies / pLBCL2 probe oligonucleotide if SEQ ID NO: 63 labelled with an Estrogen Module Fluorescent label is at a concentration of 39 nMfirst ESRI primer of SEQ ID NO: 65 is at a concentration of 40 nMsecond ESRI of SEQ ID NO: 66 is at a concentration of 40 nMESRI competitor polynucleotide of SEQ ID NO: 68 is at a concentration of 0.83 copies / pLESRI probe oligonucleotide if SEQ ID NO: 67 labelled with an Estrogen Module Fluorescent label is at a concentration of 48 nMfirst GSTM1 primer of SEQ ID NO: 69 is at a concentration of 11 nMsecond GSTM1 of SEQ ID NO: 70 is at a concentration of 11 nMGSTM1 competitor polynucleotide of SEQ ID NO: 72 is at a concentration of 0.075 copies / pLGSTM1 probe oligonucleotide if SEQ ID NO: 71 labelled with an Estrogen Module Fluorescent label is at a concentration of 13 nMfirst PGR primer of SEQ ID NO: 73 is at a concentration of 41 nMsecond PGR of SEQ ID NO: 74 is at a concentration of 41 nMPGR competitor polynucleotide of SEQ ID NO: 76 is at a concentration of 0.015 copies / pLPGR 1 probe oligonucleotide if SEQ ID NO: 75 labelled with an Estrogen Module Fluorescent label is at a concentration of 50 nMfirst SCUBE2 primer of SEQ ID NO: 77 is at a concentration of 22 nMsecond SCUBE2 of SEQ ID NO: 78 is at a concentration of 22 nMSCUBE2 competitor polynucleotide of SEQ ID NO: 80 is at a concentration of 94 copies / pLSCUBE2 probe oligonucleotide if SEQ ID NO: 79 labelled with an Estrogen Module Fluorescent label is at a concentration of 26 nMBAG1 competitor polynucleotide of SEQ ID NO: 87 is at a concentration of 0.039 copies / pLBCL2 competitor polynucleotide of SEQ ID NO: 88 is at a concentration of 1.9 copies / pLESRI competitor polynucleotide of SEQ ID NO: 89 is at a concentration of 0.83 copies / pLGSTM1 competitor polynucleotide of SEQ ID NO: 90 is at a concentration of 0.075 copies / pLPGR competitor polynucleotide of SEQ ID NO: 91 is at a concentration of 0.015 copies / pLSCUBE2 competitor polynucleotide of SEQ ID NO: 92 is at a concentration of 94 copies / pL anduniversal Estrogen Module probe oligonucleotide of SEQ ID NO: 93 labelled with Estrogen Module Fluorescent label is at a concentration of 192 nM.

15. The method of any of claims 1-14 wherein the subject has or has had:HR+ HER2- breast cancer;Anatomic stage I, II or Illa invasive breast cancer; and / orIs positive for cancerous cells in zero, one, two or no more than three axilliary lymph nodes.

16. The method of any of claims 1-15 wherein the:House Keeping Module fluorescent label is VIC;Proliferation Module fluorescent label is FAM;Invasion Module fluorescent label is ABY;HER2 Module fluorescent label is JUN; and Estrogen Module fluorescent label is VIC.

17. The method of claim 13-16 further comprising the step of generating a risk score based on the end point fluorescence obtained after a specific number of cycles of the fluorescent label associated with the House Keeping Module, the Invasion Module, the Proliferation Module, the HER2 Module and the Estrogen Module.

18. The method of claim 17 wherein the end point fluorescence is determined after 50 amplification cycles.

19. The method of any of claim 17 wherein the end point fluorescence is determined after 50 amplification cycles and the:House Keeping Module fluorescent label is VIC;Proliferation Module fluorescent label is FAM;Invasion Module fluorescent label is ABY;HER2 Module fluorescent label is JUN; and Estrogen Module fluorescent label is VIC.

20. The method of any of claims 16-19 wherein the risk score is determined according to the following calculation:RSuZ = max(P_FAM * (HK - FAM), -y_FAM) - P_VIC * (HK - VIC) + 0ABY * (HK - ABY) + max(P_JUN * (HK - JUN), -y_JUN)RSu = RSuZ * 1.47 + 9.98RS = min(max(20 * (RSu - 6.7), 0), 100)where |3_FAM = 0.35, 3_VIC = 0.42, |3_ABY = 0.17, 3_JUN = 0.46, y_FAM = 1.14, y_JUN = 0.76, and HK, FAM, VIC, ABY, and JUN are the standardized endpoint fluorescent intensities from the relevant module.

21. A method for determining post-operative risk of breast cancer recurrence and / or for predicting response to chemotherapy wherein the method comprises the method of calculating a risk score according to any of claims 13-20.

22. A kit comprising all of the polynucleotides having a sequence of any of SEQ ID NO: 1-93.

23. A kit comprising any one or more of the following groups of polynucleotides:i) a first ACTB primer of SEQ ID NO: 1;a second ACTB primer of SEQ ID NO: 2;an ACTB competitor polynucleotide of SEQ ID NO: 3;a first GAPDH primer of SEQ ID NO: 4;a second GAPDH primer of SEQ ID NO: 5;an GAPDH competitor polynucleotide of SEQ ID NO: 6;a first GUSB primer of SEQ ID NO: 7;a second GUSB primer of SEQ ID NO: 8;an GUSB competitor polynucleotide of SEQ ID NO: 9;a first RPLPO primer of SEQ ID NO: 10;a second RPLPOprimer of SEQ ID NO: 11;an RPLPO competitor polynucleotide of SEQ ID NO: 12;a first TRFC primer of SEQ ID NO: 13;a second TRFC primer of SEQ ID NO: 14;an TRFC competitor polynucleotide of SEQ ID NO: 15; anda universal House Keeping Module probe oligonucleotide of SEQ ID NO: 16 labelled with a House Keeping Fluorescent label;a first CD68 primer of SEQ ID NO: 17;a second CD68 primer of SEQ ID NO: 18;an CD68 competitor polynucleotide of SEQ ID NO: 20; anda CD68 probe oligonucleotide of SEQ ID NO: 19 labelled with an Invasion Module Fluorescent label;a first CTSV primer of SEQ ID NO: 21;a second CTSV primer of SEQ ID NO: 22;an CTSV competitor polynucleotide of SEQ ID NO: 24; anda CTSV probe oligonucleotide of SEQ ID NO: 23 labelled with an Invasion Module Fluorescent label;anda first MMP11 primer of SEQ ID NO: 25;a second MMP11 primer of SEQ ID NO: 26;an MMP11 competitor polynucleotide of SEQ ID NO: 28; anda MMP11 probe oligonucleotide of SEQ ID NO: 27 labelled with an Invasion Module Fluorescent label;orb)a first CD68 primer of SEQ ID NO: 17;a second CD68 primer of SEQ ID NO: 18;an CD68 competitor polynucleotide of SEQ ID NO: 81;a first CTSV primer of SEQ ID NO: 21;a second CTSV primer of SEQ ID NO: 22;an CTSV competitor polynucleotide of SEQ ID NO: 82;a first MMP11 primer of SEQ ID NO: 25;a second MMP11 primer of SEQ ID NO: 26;an MMP11 competitor polynucleotide of SEQ ID NO: 83;anda universal Invasion Module probe oligonucleotide of SEQ ID NO: 84 labelled with an Invasion Module Fluorescent label;a first AURKA primer of SEQ ID NO: 29;a second AURKA primer of SEQ ID NO: 30;an AURKA competitor polynucleotide of SEQ ID NO: 32; anda AURKA probe oligonucleotide of SEQ ID NO: 31 labelled with a Proliferation Module Fluorescent label;a first BIRC5 primer of SEQ ID NO: 33;a second BIRC5 primer of SEQ ID NO: 34;an BIRC5 competitor polynucleotide of SEQ ID NO: 36; anda BIRC5 probe oligonucleotide of SEQ ID NO: 35 labelled with a Proliferation Module Fluorescent label;a first CCNB1 primer of SEQ ID NO: 37;a second CCNBlprimer of SEQ ID NO: 38;an CCNBlcompetitor polynucleotide of SEQ ID NO: 40; anda CCNBlprobe oligonucleotide of SEQ ID NO: 39 labelled with a Proliferation Module Fluorescent label;a first MK167 primer of SEQ ID NO: 41;a second MK167 of SEQ ID NO: 42;an MK167 competitor polynucleotide of SEQ ID NO: 44; anda MK167 probe oligonucleotide of SEQ ID NO: 43 labelled with a Proliferation Module Fluorescent label;a first MYBL2 primer of SEQ ID NO: 45;a second MYBL2 of SEQ ID NO: 46;an MYBL2 competitor polynucleotide of SEQ ID NO: 48; anda MYBL2 probe oligonucleotide of SEQ ID NO: 47 labelled with a Proliferation Module Fluorescent label;orb)a first AURKA primer of SEQ ID NO: 29;a second AURKA primer of SEQ ID NO: 30;an AURKA competitor polynucleotide of SEQ ID NO: 32; anda first BIRC5 primer of SEQ ID NO: 33;a second BIRC5 primer of SEQ ID NO: 34;an BIRC5 competitor polynucleotide of SEQ ID NO: 36; anda first CCNB1 primer of SEQ ID NO: 37;a second CCNBlprimer of SEQ ID NO: 38;an CCNBlcompetitor polynucleotide of SEQ ID NO: 40; anda first MK167 primer of SEQ ID NO: 41;a second MK167 of SEQ ID NO: 42;an MK167 competitor polynucleotide of SEQ ID NO: 44; anda first MYBL2 primer of SEQ ID NO: 45;a second MYBL2 of SEQ ID NO: 46;an MYBL2 competitor polynucleotide of SEQ ID NO: 48; anda universal Proliferation Module probe oligonucleotide of SEQ ID NO: 85 labelled with a Proliferation Module Fluorescent label;a first ERBB2 primer of SEQ ID NO: 49a second ERBB2 of SEQ ID NO: 50;an ERBB2 competitor polynucleotide of SEQ ID NO: 52 anda ERBB2 probe oligonucleotide of SEQ ID NO: 51 labelled with a HER2 Module Fluorescent label;a first GRB7 primer of SEQ ID NO: 53a second GRB7 of SEQ ID NO: 54;an GRB7 competitor polynucleotide of SEQ ID NO: 56 anda GRB7 probe oligonucleotide of SEQ ID NO: 55 labelled with a HER2 Module Fluorescent label;orb)a first ERBB2 primer of SEQ ID NO: 49a second ERBB2 of SEQ ID NO: 50;an ERBB2 competitor polynucleotide of SEQ ID NO: 52 anda first GRB7 primer of SEQ ID NO: 53a second GRB7 of SEQ ID NO: 54;an GRB7 competitor polynucleotide of SEQ ID NO: 56 anda universal HER2 module probe oligonucleotide of SEQ ID NO: 86 labelled with a HER2 Module Fluorescent label;andv) amplification of the Estrogen Module that comprises or consists of target polynucleotides that are cDNA molecules derived from mRNA polynucleotides that are expressed from the group comprising or consisting of the following genes: BAG1, BCL2, ESRI, GSTM1, PGR and SCUBE2 and wherein the set of competitive amplification polynucleotides used for the amplification comprises or consists of:a)a first BAG1 primer of SEQ ID NO: 57a second BAG1 of SEQ ID NO: 58;an BAG1 competitor polynucleotide of SEQ ID NO: 60 anda BAG1 probe oligonucleotide if SEQ ID NO: 59 labelled with an Estrogen Module Fluorescent label;a first BCL2 primer of SEQ ID NO: 61a second BCL2 of SEQ ID NO: 62;an BCL2 competitor polynucleotide of SEQ ID NO: 64 anda BCL2 probe oligonucleotide if SEQ ID NO: 63 labelled with an Estrogen Module Fluorescent label;a first ESRI primer of SEQ ID NO: 65a second ESRI of SEQ ID NO: 66;an ESRI competitor polynucleotide of SEQ ID NO: 68 anda ESRI probe oligonucleotide if SEQ ID NO: 67 labelled with an Estrogen Module Fluorescent label;a first GSTM1 primer of SEQ ID NO: 69a second GSTM1 of SEQ ID NO: 70;an GSTM1 competitor polynucleotide of SEQ ID NO: 72 anda GSTM1 probe oligonucleotide if SEQ ID NO: 71 labelled with an Estrogen Module Fluorescent label;a first PGR primer of SEQ ID NO: 73a second PGR of SEQ ID NO: 74;an PGR competitor polynucleotide of SEQ ID NO: 76 anda PGR 1 probe oligonucleotide if SEQ ID NO: 75 labelled with an Estrogen Module Fluorescent label;a first SCUBE2 primer of SEQ ID NO: 77;a second SCUBE2 of SEQ ID NO: 78;an SCUBE2 competitor polynucleotide of SEQ ID NO: 80 anda SCUBE2 probe oligonucleotide if SEQ ID NO: 79 labelled with an Estrogen Module Fluorescent label;orb)a first BAG1 primer of SEQ ID NO: 57a second BAG1 of SEQ ID NO: 58;an BAG1 competitor polynucleotide of SEQ ID NO: 87a first BCL2 primer of SEQ ID NO: 61a second BCL2 of SEQ ID NO: 62;an BCL2 competitor polynucleotide of SEQ ID NO: 88a first ESRI primer of SEQ ID NO: 65a second ESRI of SEQ ID NO: 66;an ESRI competitor polynucleotide of SEQ ID NO: 89a first GSTM1 primer of SEQ ID NO: 69a second GSTM1 of SEQ ID NO: 70;an GSTM1 competitor polynucleotide of SEQ ID NO: 90a first PGR. primer of SEQ ID NO: 73a second PGR of SEQ ID NO: 74;an PGR competitor polynucleotide of SEQ ID NO: 91a first SCUBE2 primer of SEQ ID NO: 77;a second SCUBE2 of SEQ ID NO: 78;an SCUBE2 competitor polynucleotide of SEQ ID NO: 92 anda universal Estrogen Module probe oligonucleotide of SEQ ID NO: 93 labelled with an Estrogen Module Fluorescent label.

Citation Information

Patent Citations

  • Multiplex fluorescence PCR detection kit used for detecting expression level of 21 genes of breast cancer

    CN106978492A

  • Biomarkers for breast cancer and methods of use thereof

    US20170342502A1