Modified bacterial retroelement with enhanced DNA production

Abstract

To provide a modified bacterial retroelement with enhanced DNA production.SOLUTION: Modified retrons, modified to enhance production of multicopy single-stranded DNA (msDNA), are provided. In addition, vector systems encoding such modified retrons and methods of using modified retrons and vector systems encoding them in various applications such as CRISPR / Cas-mediated genome editing, recombineering, cellular barcoding, and molecular recording are also disclosed.SELECTED DRAWING: Figure 7C-2

Description

[Technical field]

[0001] The present invention relates to modified bacterial retroelements with enhanced DNA production. [Background technology]

[0002] Retrons are elements that undergo reverse transcription and are found in almost all myxobacteria (Non-Patent Document 1) and in small quantities in E. coli (Non-Patent Document 2), V. cholerae (Non-Patent Document 3) and other bacteria. The retron operon encodes, in that order, an RNA primer (multicopy single-stranded RNA, msr), an RNA sequence to be reverse transcribed (multicopy single-stranded DNA, msd), and a reverse transcriptase. The retron transcript folds back on itself, and a portion is reverse transcribed to generate a single-stranded DNA (ssDNA) of about 80 bases. The DNA derived from the retron is single-stranded, but it contains a hairpin of double-stranded DNA. Multiple retron ssDNAs can also complement each other to form large double-stranded elements. Retron variants vary in DNA length and base content, but broadly share this overall format.

[0003] The ssDNA generated by retrons has been used for genome modification in two contexts: in bacterial contexts, for recombineering with λ Redβ recombinase (Non-Patent Document 4); and in eukaryotic contexts, in yeast, as a homology-directed repair (HDR) template for Cas9 editing (Non-Patent Document 5). Although these applications are very promising, they have faced unexpected inefficiencies and contextual limitations that are believed to arise from factors in the endogenous form of retron. These factors include (1) a branched structure in which a phosphodiester bond links the 5' end of the ssDNA to the 2' hydroxyl of the msr RNA, (2) invariant flanking regions that may be required for retron reverse transcription but are not part of the repair template, (3) a limited overall length, and (4) a natural poly-T stretch that functions as a terminator for Pol III transcription. [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Dhundale et al., Journal of Bacteriology, Vol. 164, pp. 914-917, 1985 [Non-Patent Document 2] Lampson et al., Science, Vol. 243, pp. 1033-1038, 1989 [Non-Patent Document 3] Inouye et al., Microbiology and Immunology, vol. 55, pp. 510-513 [Non-Patent Document 4] Farzadfard et al., Science, Vol. 346, p. 1256272, 2014 [Non-Patent Document 5] Sharon et al., Cell, vol. 175, pp. 544-557, e516, 2018 Summary of the Invention [Problem to be solved by the invention]

[0005] It is an object of the present invention to provide modified bacterial retroelements with enhanced DNA production. [Means for solving the problem]

[0006] Provided are engineered retrons that are modified to enhance the production of multicopy single-stranded DNA (msDNA), which overcomes many of the existing problems associated with efficiency and low copy number. Also described herein are vector systems encoding such engineered retrons, as well as methods of using the engineered retrons and vector systems in various applications, such as CRISPR / Cas-mediated genome editing, recombineering, cell barcoding, and molecular recording.

[0007] In one aspect, a modified retron is provided, the modified retron comprising: a) a pre-msr sequence; b) an msr gene encoding a multicopy single-stranded RNA (msRNA); c) an msd gene encoding a multicopy single-stranded DNA (msDNA); d) a post-msd sequence comprising a self-complementary region having sequence complementarity with the pre-msr sequence, the self-complementary region having a length at least 1-50 nucleotides longer than the wild-type complementary region, whereby the modified retron is capable of enhanced production of msDNA; and e) a ret gene encoding a reverse transcriptase.

[0008] The self-complementary region is formed by hydrogen bonds between the 3' and 5' ends of the ncRNA. In certain embodiments, the complementary region has a length that is at least 1, at least 2, at least 4, at least 6, at least 8, at least 10, at least 12, at least 14, at least 16, at least 18, at least 20, at least 30, at least 40, or at least 50 nucleotides longer than the wild-type complementary region. For example, the self-complementary region can have a length in the range of 1 to 50 nucleotides longer than the wild-type complementary region, such as, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides longer, including any length within this range. In certain embodiments, the self-complementary region has a length in the range of 1 to 16 nucleotides longer than the wild-type complementary region.

[0009] In certain embodiments, the msr and msd genes are provided in trans or cis configuration, hi some embodiments, the ret gene is provided in trans configuration relative to the msr and / or msd genes.

[0010] In certain embodiments, the msr, msd and ret genes are derived from bacterial retrons, including, without limitation, myxobacterial retrons (e.g., Mx65, Mx162), Escherichia coli retrons (e.g., E67, Ec73, EC83, EC86, EC107), Salmonella enterica retrons (e.g., msDNA-St85) and Vibrio cholerae retrons (e.g., Vc81, Vc95, Vc137).

[0011] In certain embodiments, the modified retron further comprises a heterologous sequence of interest. The heterologous sequence can be inserted, for example, into the msr gene or the msd gene. For example, the heterologous sequence can be inserted into the loop of the msd stem-loop. In some embodiments, the heterologous sequence encodes a polypeptide or peptide. In other embodiments, the heterologous sequence encodes a donor polynucleotide comprising a 5' homology arm that hybridizes to a 5' genomic target sequence and a 3' homology arm that hybridizes to a 3' genomic target sequence adjacent to the nucleotide sequence comprising the intended edit to be incorporated into the genomic target locus by homology directed repair (HDR) or recombineering. In yet other embodiments, the heterologous sequence comprises a CRISPR protospacer DNA sequence. In one embodiment, the CRISPR protospacer DNA sequence comprises a modified "AAG" protospacer adjacent motif (PAM).

[0012] In certain embodiments, the modified retron further comprises a barcode sequence, which may be located, for example, in a hairpin loop of the msDNA. In another aspect, a vector system is provided, the vector system comprising one or more vectors comprising the modified retrons described herein. In certain embodiments, the msr gene and the msd gene are provided by the same vector or different vectors. In some embodiments, the msr gene, the msd gene and the ret gene are provided by the same vector, the vector comprising a promoter operably linked to the msr gene and the msd gene. In some embodiments, the promoter is further operably linked to the ret gene. In other embodiments, the vector further comprises a second promoter operably linked to the ret gene. In certain embodiments, the msr gene, the msd gene and the ret gene are provided by different vectors.

[0013] In certain embodiments, one or more of the vectors of the vector system is a viral vector or a non-viral vector (eg, a plasmid). In certain embodiments, the vector system comprises a modified retron comprising a heterologous sequence encoding a donor polynucleotide comprising a 5' homology arm that hybridizes to a 5' genomic target sequence and a 3' homology arm that hybridizes to a 3' genomic target sequence flanking a donor polynucleotide sequence. The donor polynucleotide sequence can replace or edit a genomic target locus, for example, by homology directed repair (HDR) or recombineering.

[0014] In certain embodiments, the vector system further comprises a vector encoding an RNA-guided nuclease. Exemplary RNA-guided nucleases include, without limitation, Cas nucleases (e.g., Cas9, Cpf1) and modified RNA-guided FokI nucleases.

[0015] In certain embodiments, the vector system further comprises a vector encoding a bacteriophage recombination protein for recombineering, hi some embodiments, the vector is a replication-defective prophage encoding a bacteriophage recombination protein.

[0016] In certain embodiments, the vector system comprises a modified retron comprising a heterologous sequence encoding a CRISPR protospacer DNA sequence. In some embodiments, the vector system further comprises a vector encoding a Cas1 or Cas2 protein. In some embodiments, the vector system further comprises a vector comprising a CRISPR array sequence.

[0017] In another aspect, an isolated host cell is provided, which comprises the modified retron or vector system described herein. In certain embodiments, the host cell is a prokaryotic, archaeal or eukaryotic host cell. For example, the host cell can be a bacterial, protist, fungal, animal or plant host cell. In some embodiments, the host cell is a mammalian host cell. The host cell can be a human or non-human mammalian host cell. In other embodiments, the host cell is an artificial or genetically modified cell.

[0018] In another aspect, a kit is provided that comprises the modified retrons described herein, or a vector system or host cell that comprises such a modified retron. In some embodiments, the kit further comprises instructions on how to use the modified retron.

[0019] In another embodiment, a method for genetically modifying a cell is provided.In some cases, the method includes transfecting a modified retron into a cell.For example, the method can include: a) transfecting a cell with a modified retron that includes a heterologous sequence that encodes a donor polynucleotide that includes a 5' homology arm that hybridizes to a 5' genomic target sequence and a 3' homology arm that hybridizes to a 3' genomic target sequence, adjacent to the nucleotide sequence that includes the intended edit that is integrated into the genomic target locus by homology-directed repair (HDR); and b) introducing an RNA-guided nuclease and a guide RNA into the cell, wherein the RNA-guided nuclease forms a complex with the guide RNA, the guide RNA guides the complex to the genomic target locus, the RNA-guided nuclease creates a double-strand break in genomic DNA at the genomic target locus, and the donor polynucleotide generated by the modified retron is integrated into the genomic target locus recognized by its 5' homology arm and 3' homology arm by homology-directed repair (HDR). HDR with modified retrons encoding donor polynucleotides can be used to create, for example, gene replacement, gene knockout, deletion, insertion, inversion, or point mutation. In some cases, HDR with modified retrons encoding donor polynucleotides can be used to repair, for example, genes, gene knockout, deletion, insertion, inversion, or point mutation. Thus, such methods can create genetically modified cells. In some embodiments, the method further comprises phenotyping the genetically modified cells or sequencing the genome of the genetically modified cells.

[0020] In another embodiment, a method for genetically modifying a cell by recombineering is provided, comprising: a) transfecting the cell with a modified retron comprising a heterologous sequence encoding a donor polynucleotide comprising a 5' homology arm hybridizing to a 5' genomic target sequence and a 3' homology arm hybridizing to a 3' genomic target sequence adjacent to a nucleotide sequence comprising an intended edit to be integrated into a genomic target locus by recombineering; and b) introducing a bacteriophage recombination protein into the cell, the bacteriophage recombination protein mediating homologous recombination at the target locus, whereby the donor polynucleotide generated by the modified retron is integrated into the target locus recognized by its 5' and 3' homology arms, producing a genetically modified cell. Recombineering by the modified retron encoding donor polynucleotide can be used to create, for example, gene replacements, gene knockouts, deletions, insertions, inversions or point mutations. In certain embodiments, the donor polynucleotide is used to modify a plasmid, a bacterial artificial chromosome (BAC), or a bacterial chromosome of the bacterial cell by recombineering. In some embodiments, the method further comprises phenotyping the genetically modified cell or sequencing the genome of the genetically modified cell.

[0021] In certain embodiments, the bacteriophage recombination proteins are introduced into the bacterial cell by insertion of a replication-defective λ prophage into the bacterial genome. In one embodiment, the bacteriophage comprises the exo, bet and gam genes.

[0022] In another aspect, a method of barcoding a cell is provided, the method comprising transfecting a cell with a modified retron comprising a barcode as described herein.

[0023] In another aspect, a method for making an in vivo molecular recording system is provided, the method comprising: a) introducing a Casl protein or a Cas2 protein of a CRISPR adaptation system into a host cell; b) introducing a CRISPR array nucleic acid sequence comprising a leader sequence and at least one repeat sequence into the host cell, the CRISPR array nucleic acid sequence being integrated into genomic DNA in the host cell or a vector; and c) introducing a plurality of modified retrons comprising a CRISPR protospacer DNA sequence into the host cell, each retron comprising a different protospacer DNA sequence that can be processed and inserted into the CRISPR array nucleic acid sequence. In certain embodiments, the Casl protein or the Cas2 protein is provided by a vector. In certain embodiments, the modified retrons are provided by a vector. In certain embodiments, the plurality of modified retrons comprises at least three different protospacer DNA sequences.

[0024] In another aspect, a modified cell is provided that includes an in vivo molecular recording system, the modified cell comprising: a) a Casl protein or a Cas2 protein of a CRISPR adaptation system; b) a CRISPR array nucleic acid sequence that includes a leader sequence and at least one repeat sequence to a host cell, the CRISPR array nucleic acid sequence being integrated into genomic DNA or a vector in the modified cell; and c) a plurality of modified retrons, each of which includes a CRISPR protospacer DNA sequence, each retron including a different protospacer DNA sequence that can be processed and inserted into the CRISPR array nucleic acid sequence. In certain embodiments, the Casl protein or the Cas2 protein is provided by a vector. In certain embodiments, the modified retron is provided by a vector. In certain embodiments, the plurality of modified retrons includes at least three different protospacer DNA sequences.

[0025] In another aspect, a kit is provided that comprises a modified cell comprising an in vivo molecular recording system as described herein. In some embodiments, the kit further comprises instructions for in vivo molecular recording.

[0026] In another aspect, a method of producing recombinant msDNA is provided, the method comprising: a) transfecting a host cell with a modified retron or vector system described herein; and b) culturing the host cell under suitable conditions, wherein msDNA is produced. Effect of the Invention

[0027] According to the present invention it has been possible to provide modified bacterial retroelements with enhanced DNA production. [Brief description of the drawings]

[0028] [Figure 1A] Schematic diagram of the retron operon and potential uses of retrons: Figure 1A shows a schematic diagram of the retron operon encoding msr, msd, and reverse transcriptase, which can synthesize DNA copies of a portion of the msd gene that encodes multicopy single-stranded DNA. [Figure 1B] A schematic diagram of the retron operon and potential uses of retrons is shown in Figure 1B. Recombineering is a potential use of retrons, where Beta can protect ssDNA and promote annealing of ssDNA to complementary ssDNA targets, such as DNA targets in cells. [Figure 1C] A schematic diagram of the retron operon and potential uses of retrons are shown in Figure 1C, which illustrates that CRISPR / Cas9 gene editing is a potential use of retrons, which can provide ssDNA templates that can repair mutant or mutant target sites. [Figure 1D]A schematic diagram of the retron operon and potential uses of retrons is shown. Figure ID illustrates that molecular recording is a potential use of retrons (e.g., as provided in WO2018191525 A1, which is specifically incorporated by reference in its entirety). [Figure 2A] Retron elements and their assembly. Figure 2A shows retron elements: (1) the 5'-ends of msr ​​and msd to be reverse transcribed are covalently linked to a priming guanosine with a 2'-5' linkage, which prevents their use in genome engineering; (2) invariant flanking regions that may be required for retron reverse transcription, so that they cannot easily become part of the repair template; and (3) a stem that is currently thought to have a limited overall length. Another problem for genome engineering is the natural retron poly-T stretch that serves as a terminator for Pol III transcription. [Figure 2B] Retron factors and their assembly. Figure 2B illustrates that the non-protein-coding (msr-msd) portion of the retron operon produces a transcript with significant secondary structure, and that reverse transcriptase (RT) recognizes a specific start site in this transcript and then partially reverse transcribes the transcript into RT-DNA (msd). [Figure 3A] Figure 3A shows the base structure of wild-type ec86 (also called retron-Eco1 ncRNA), with the msd DNA at the top (SEQ ID NO:1, GTCAGAAAAAACGGGTTTCCTGGTTGGCTCGGAGAGCATCAGGCGATGCTCTCCGTTCCAACAAGGAAAACAGACAGTAACTCAGA) and the msr RNA at the bottom (SEQ ID NO:2 - AUGCGCACCCUUAGCGAGAGGUUUAUCAUUAAGGUCAACCUCUGGAUGUUUCGGCAUCCUGCAUUGAAUCUGAGUUACU) after reverse transcription. [Figure 3B] FIG. 3B illustrates the quantification of ssDNA produced following expression of ec86 as detected by qPCR analysis. [Figure 3C] Figure 3C shows the PAGE analysis of wild-type and mutant msd. [Figure 3D] Figure 3D shows the base structures of two mutant msds, a retrone-Eco1 v32 ncRNA (GTCAGAAAAAACGGGTTGTCGCCAGTCTGACTGGCGACAAACAGCTTGTAACTCAGA, SEQ ID NO: 3) changed from ec86 wild-type, and a retrone-Eco1 v35 ncRNA (GTCAGAAAAAACGGGTGGAGAGGTTGCTGCAACCTCTCCATTTTCTTGTAACTCAGA, SEQ ID NO: 4) changed from v32 ncRNA. [Figure 4A] An expression system for producing extended msd ssDNA is illustrated. Figure 4A shows an expression construct that separates msr / msd from the retrone reverse transcriptase (RT), thereby enabling the production of longer (modified) reverse-transcribed msd ssDNA. [Figure 4B] An expression system for producing extended msd ssDNA is illustrated. Figure 4B shows the composition of msr and msd in an expression cassette that is distant from (trans to) the reverse transcriptase coding region. [Figure 4C] An expression system for producing extended msd ssDNA is illustrated. Figure 4C illustrates several extensions of msd ssDNA in an msr / msd expression cassette that is distant from (trans to) the reverse transcriptase coding region, showing that the msd region can be greatly expanded to incorporate heterologous sequences. [Figure 4D] An expression system for producing extended msd ssDNA is illustrated. Figure 4D shows the PAGE analysis of msd ssDNA, including the extended msd ssDNA produced as shown in Figures 4A - 4C. [Diagram 5] Retron parameters that can be modified are shown. [Figure 6A]Figure 6A illustrates the schematic of the customized sequencing prep pipeline: ssDNA is treated with debranching RNA lariat 1 (DBR1) in the presence of RNase, then a single polynucleotide stretch is added using template independent polymerase (TdT), a reverse anchored primer containing an adaptor is used to generate the complementary strand, a second adaptor is ligated, and the adaptor-ligated double-stranded DNA is then indexed and subjected to multiplex sequencing (SEQ ID NO: 29). [Figure 6B] FIG. 6B shows that the number of nucleotides added by TdT is controllable. [Figure 6C] FIG. 6C shows the ordered msd ssDNA ec86 v32 sequence (GTCAGAAAAAACGGGTTGTCGCCAGTCTGACTGGCGACAAACAGCTTGTAACTCAGA, SEQ ID NO:5) and illustrates confirmation by sequencing. [Figure 6D] FIG. 6D shows the predicted msd ssDNA ec86 v 32 sequence (GTCAGAAAAAAACGGGTT GTCGCCAGTCTGACTGGCGACAAACAGCTTGTAACTCAGA, SEQ ID NO: 6) and illustrates the sequencing results (GTCAGAAAAAAACGGGTTGTCGCCAGTCTGACTGGCGACAAACAGCTTGTAACTCAG, SEQ ID NO: 7). [Figure 6E] FIG. 6E shows the literature wild type msd ssDNA ec86 sequence (GTCAGAAAAAAACGGGTTTCCTGGTTGGCTCGGAGAGCATCAGGCGATGCTCTCTCCGTTCCAACAAGGAAAACAGACAGTAACTCAGA, SEQ ID NO: 8) and illustrates the sequencing results (GTCAGAAAAAAACGGGTTTCCTGGTTGGCTCGGAGAGCATCAGGCGATGCTCTCTCCGTTCCAACAAGGAAAACAGACAGTAACTCAG, SEQ ID NO: 9). [Figure 6F] FIG. 6F shows the literature wild type msd ssDNA ec83 sequence (TTGAAGCCGCGGAACAAACTTTTTGATCCGCAACCTACTGGATTGCGGCTCAAAAAGTTTGTTCCGCAACTGTAAATGTAATC, SEQ ID NO: 10) and illustrates the sequencing results (AGCCGCGGAACAAACTTTTTGATCCGCAACCTACTGGATTGCGGCTCAAAAAGTTTGTTCCGCAACTGTAAATGTAATC, SEQ ID NO: 11). [Figure 7A] Illustrating the Modification of msd DNA: Figure 7A illustrates the linkage of retron RNA alterations to a barcode that ends in msd DNA. [Figure 7B] Illustrating the modification of msd DNA, Figure 7B shows increased ssDNA production from retrons with long post-msd complementary regions compared to wild-type retrons without the long post-msd region. [Figure 7C-1] 7C-1 and 7C-2 illustrate the modification of msd DNA. Figure 7C-1 and 7C-2 illustrate the extension and shortening of regions at the 5' and 3' ends of retron non-coding RNA (ncRNA). Figure 7C-1 shows a schematic of the basic retron structure used, where the extended complementary region in the ncRNA is shown as a solid black line, while the remaining ncRNA is dashed. [Figure 7C-2] Illustrates the modification of msd DNA. Figures 7C-1 and 7C-2 illustrate the extension and shortening of regions at the 5' and 3' ends of retron non-coding RNA (ncRNA). Figure 7C-2 graphically illustrates that the extension of the ncRNA complementary region increases the abundance of RT-DNA compared to the wild-type sequence (where the abundance of the wild-type is 100%), but shortening the ncRNA complementary region decreases the abundance of RT-DNA. Data shown are from pooled experiments per mutant (n=3, replicates shown). [Figure 8A]The graph illustrates that shortening the reverse transcribed stem of the ncRNA can reduce the amount of ssDNA, but extending the stem does not negatively affect ssDNA production. Figure 8A shows a schematic of a portion of the ncRNA structure that is modified, with the stem region shown in solid black lines, while the rest of the ncRNA is shown in dashed lines. [Figure 8B] We graphically illustrate that shortening the reverse transcribed stem of an ncRNA can reduce the amount of ssDNA, but extending the stem does not negatively affect ssDNA production. Figure 8B graphically illustrates that extending the ncRNA region by approximately 15-30 nucleotides maintains approximately the same level of RT-DNA abundance as observed for the unextended wild-type ncRNA sequence, however, reducing the length of the ncRNA region to less than approximately 14 nucleotides reduces the amount of ssDNA generated by reverse transcription compared to the unextended wild-type ncRNA sequence. [Figure 9A] Figure 9 illustrates the effect of breaking and fixing the reverse transcribed stem region of an ncRNA. Figure 9A is a schematic diagram of an ncRNA, with the reverse transcribed stem region of the ncRNA shown as a solid black line. [Figure 9B] Figure 9B illustrates the effect of breaking and fixing the reverse transcribed stem region of ncRNA. Figure 9B graphically illustrates the abundance of reverse transcribed DNA of ncRNA structural variants compared to wild-type sequences. Data are from experiments pooled per variant. Sequences for broken stem, repaired stem and tolerable broken stem ncRNA structural variants are provided in the Examples. [Figure 10A] FIG. 10 illustrates the effect of insertions and deletions in the reverse transcribed region of ncRNA on the abundance of DNA reverse transcribed from the ncRNA. FIG. 10A illustrates a schematic of an ncRNA, with the reverse transcribed region of the ncRNA shown as black dashed and solid lines. The dashed lines identify the regions adjacent to the msd stem. [Figure 10B]Illustrates the effect of insertions and deletions in the reverse transcription region of ncRNA on the abundance of DNA reverse transcribed from ncRNA. Figure 10B graphically illustrates the abundance of RT-DNA produced by reverse transcription for a series of ncRNA mutants, each of which has a three-base deletion at a distinct position along the msd stem loop, compared to the wild-type sequence. The positions of the deletions are plotted along the x-axis. [Figure 10C] Illustrates the effect of insertions and deletions in the reverse transcription region of ncRNA on the abundance of DNA reverse transcribed from ncRNA. Figure 10C graphically illustrates the abundance of RT-DNA produced by reverse transcription for a series of ncRNA mutants, each with a three-base insertion at a distinct position along the msd stem loop, compared to the wild-type sequence. The position of the insertion is plotted along the x-axis. [Figure 10D] Figure 10 illustrates the effect of insertions and deletions in the reverse transcription region of ncRNA on the abundance of DNA reverse transcribed from ncRNA. Figure 10D graphically illustrates the abundance of RT-DNA produced by reverse transcription for a series of ncRNA mutants, each of which has a single base change at a distinct position along the msd stem loop, compared to the wild-type sequence. The position of the insertion is plotted along the x-axis. [Figure 10E] Figure 10 illustrates the effect of insertions and deletions in the reverse transcribed region of ncRNA on the abundance of DNA reverse transcribed from the ncRNA. Figure 10E graphically illustrates the structural changes and the modification fitness scores of the msd loop positions given the results observed for Figures 10B-10D. The modification fitness scores are based on the average effect of these changes and data were from pooled experiments per variant. Schematics of the stem, loop and flanking regions for the folded ncRNA are shown in Figures 10B-10C. [Figure 11A] Figure 11 illustrates the use of modified retrons to improve CRISPR-based genomic alterations. Figure 11A is a schematic diagram illustrating the integration of retron RT-DNA by CRISPR integrases Cas1 and Cas2 to modify genomic CRISPR arrays. [Figure 11B]Figure 11B illustrates that the use of modified retrons improves CRISPR-based genomic alterations. Figure 11B graphically illustrates that retron-derived spacer DNA can be enhanced by extending self-complementary regions at the 5' and 3' ends of ncRNA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0029] definition As used herein, the term "about" as used when referring to a measurable value such as an amount, length, and the like, is intended to encompass a variation of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and even more preferably ±0.1% from the specified value.

[0030] "Recombinant," as used herein to describe a nucleic acid molecule, means that a polynucleotide of genomic, cDNA, bacterial, semisynthetic, or synthetic origin is not linked, by reason of its origin or manipulation, to all or a portion of the polynucleotides with which it is associated in nature.

[0031] The term "recombinant" when used in reference to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide. Generally, a gene of interest is cloned and then expressed in a transformed organism, as described in more detail below. The host organism expresses the foreign gene under expression conditions to produce the protein.

[0032] As used herein, "cell" refers to any type of cell isolated from prokaryotic, eukaryotic or archaeal organisms, including bacteria, archaea, fungi, protists, plants and animals, including cells from tissues, organs and biopsies, as well as recombinant cells, cells and cell fragments from in vitro cultured cell lines, cellular components or organelles that contain nucleic acids. The term also encompasses artificial cells, such as nanoparticles, liposomes, polymersomes or microcapsules that encapsulate nucleic acids. The methods described herein can be performed, for example, on samples that include single cells or cell populations. The term also includes genetically modified cells.

[0033] The term "transformation" refers to the insertion of an exogenous polynucleotide (e.g., a modified retron) into a host cell, regardless of the method used for the insertion, including direct uptake, transduction, or F-mating. The exogenous polynucleotide may be maintained as a non-integrated vector, such as a plasmid, or alternatively, may be integrated into the host genome.

[0034] "Recombinant host cell," "host cell," "cell," "cell line," "cell culture," and other such terms designating microorganisms or higher eukaryotic cell lines cultured as unicellular entities, refer to cells that can be or have been used as recipients of recombinant vectors or other transferred DNA, and include the original progeny of the original cell that was transfected.

[0035] A "coding sequence" or a sequence that "encodes" a selected polypeptide is a nucleic acid molecule that is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vivo when it is under the control of appropriate regulatory sequences (i.e., "control elements"). The boundaries of the coding sequence may be determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. Coding sequences can include, but are not limited to, cDNA from viral, prokaryotic, or eukaryotic mRNA, genomic DNA sequences from viral or prokaryotic DNA, and even synthetic DNA sequences. A transcription termination sequence may be located 3' to the coding sequence.

[0036] Exemplary "control elements" include, but are not limited to, transcriptional promoters, transcriptional enhancer elements, transcriptional termination signals, polyadenylation sequences (located 3' to the translation stop codon), sequences for optimizing translation initiation (located 5' to the coding sequence), and translation termination sequences.

[0037] "Operably linked" refers to an arrangement of elements in which the components so described are configured to perform their normal functions. Thus, a given promoter operably linked to a coding sequence has the ability to effect expression of that coding sequence when the proper enzymes are present. A promoter need not be contiguous with a coding sequence, so long as it functions to direct its expression. Thus, for example, there may be intervening sequences between the promoter sequence and the coding sequence that are still untranslated, but are transcribed, and the promoter sequence can still be considered "operably linked" to the coding sequence.

[0038] "Encoded by" refers to a nucleic acid sequence that encodes a polypeptide or an RNA sequence. For example, a polypeptide sequence or a portion thereof contains an amino acid sequence of at least 3-5 amino acids, more preferably at least 8-10 amino acids, and even more preferably at least 15-20 amino acids from the polypeptide encoded by the nucleic acid sequence. An RNA sequence or a portion thereof contains a nucleotide sequence of at least 3-5 nucleotides, more preferably at least 8-10 nucleotides, and even more preferably at least 15-20 nucleotides.

[0039] The terms "isolated," "purified," or "biologically pure" refer to a material that is free, to a greater or lesser extent, from components that normally accompany it when found in its native state. "Isolate" refers to some degree of separation from the original source or surrounding environment. "Purify" refers to a degree of separation greater than isolation. A "purified" or "biologically pure" protein is sufficiently devoid of other materials such that any impurities do not substantially affect the biological properties of the protein or cause other deleterious consequences. That is, a nucleic acid or peptide of the invention is purified when it is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. Purity and homogeneity are typically determined using analytical chemistry techniques, such as polyacrylamide gel electrophoresis or high performance liquid chromatography. The term "purified" can mean that the nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. For proteins that may be subject to modification, such as phosphorylation or glycosylation, different modifications may result in different isolated proteins, which may be purified separately.

[0040] "Substantially purified" generally refers to the isolation of a substance (a compound, polynucleotide, protein, polypeptide, peptide composition) such that the substance constitutes a majority percentage of the sample in which it is found. Typically, in a sample, the substantially purified component constitutes 50%, preferably 80%-85%, more preferably 90%-95% of the sample. Techniques for purifying polynucleotides and polypeptides of interest are well known in the art and include, for example, ion exchange chromatography, affinity chromatography, and density-based sedimentation.

[0041] "Expression" refers to the detectable production of a gene product by a cell. The gene product may be a transcription product (i.e., RNA), which may be referred to as "gene expression," or the gene product may be a translation product of a transcription product (i.e., protein), depending on the context. A "purified polynucleotide" refers to a polynucleotide of interest or a fragment thereof that is essentially free, e.g., contains less than about 50%, preferably less than about 70%, and more preferably at least about 90%, of the proteins and / or nucleic acids with which the polynucleotide is naturally associated. Techniques for purifying a polynucleotide of interest are available in the art and include, for example, disruption of cells containing the polynucleotide with chaotropic agents and separation of one or more polynucleotides and proteins by ion exchange chromatography, affinity chromatography, and density-based sedimentation.

[0042] The term "transfection" is used to refer to the uptake of foreign DNA by a cell. A cell is "transfected" when exogenous DNA has been introduced inside the cell membrane. A number of transfection techniques are generally known in the art. See, for example, Graham et al., 1973, Virology 52:456; Sambrook et al., 2001, Molecular Cloning, a laboratory manual, 3rd ed., Cold Spring Harbor Laboratories, New York; Davis et al., 1995, Basic Methods in Molecular Biology, 2nd ed., McGraw-Hill; and Chu et al., 1981, Gene 13:197. Such techniques can be used to introduce one or more exogenous DNA moieties into a suitable host cell. The term refers to both stable and transient uptake of genetic material, including uptake of DNA linked to a peptide or linked to an antibody.

[0043] A "vector" has the ability to transfer a nucleic acid sequence to a target cell (e.g., viral vectors, non-viral vectors, particulate carriers, and liposomes). Typically, "vector construct", "expression vector" and "gene transfer vector" refer to any nucleic acid construct capable of directing the expression of a nucleic acid of interest and capable of transferring a nucleic acid sequence to a target cell. Thus, the term includes cloning and expression vehicles as well as viral vectors.

[0044] "Mammalian cell" refers to any cell derived from a mammalian subject that is suitable for transfection with an engineered retron or a vector system comprising an engineered retron as described herein. The cell may be a xenogeneic, autologous or allogeneic cell. The cell may be a primary cell obtained directly from a mammalian subject. The cell may also be a cell derived from the culture and expansion of a cell obtained from a mammalian subject. Immortalized cells are also included within this definition. In some embodiments, the cell is genetically modified to express recombinant proteins and / or nucleic acids.

[0045] The term "subject" includes animals, including both vertebrates and invertebrates, including, without limitation, invertebrates such as arthropods, mollusks, annelids, and cnidarians; amphibians, including frogs, salamanders, and caecilians; reptiles, including lizards, snakes, turtles, crocodiles, and alligators; fish; mammals, including humans and non-human mammals, such as non-human primates, including chimpanzees and other ape and monkey species; laboratory animals, such as mice, rats, rabbits, hamsters, guinea pigs, and chinchillas; domestic animals, such as dogs and cats; farm animals, such as sheep, goats, pigs, horses, and cows; and vertebrates, such as birds, such as poultry, wild birds, and game birds, including chickens, turkeys and other pheasants, ducks, geese, and the like. In some cases, the methods of the present disclosure find use in experimental animals, veterinary applications and the development of animal models for disease, including, but not limited to, rodents, including mice, rats and hamsters; primates and transgenic animals.

[0046] "Gene transfer" or "gene delivery" refers to a method or system for reliably inserting DNA or RNA of interest into a host cell. Such methods may result in transient expression of unintegrated transfected DNA, extrachromosomal replication and expression of transferred replicons (e.g., episomes) or integration of the transferred genetic material into the genomic DNA of the host cell. Gene delivery expression vectors include, but are not limited to, bacterial plasmid vectors, viral vectors, non-viral vectors, vectors derived from alphaviruses, poxviruses and vaccinia viruses.

[0047] The term "derived from" is used herein to identify the original source of a molecule, but is not intended to limit the manner in which the molecule is made, which may be, for example, by chemical synthesis or by recombinant means.

[0048] A polynucleotide "derived from" a specified sequence refers to a polynucleotide sequence that contains a contiguous sequence of approximately at least about 6 nucleotides, preferably at least about 8 nucleotides, more preferably at least about 10-12 nucleotides, and even more preferably at least about 15-20 nucleotides that corresponds to, i.e., is identical to, or complementary to, a region of the specified nucleotide sequence. A derived polynucleotide is not necessarily physically derived from the nucleotide sequence of interest, and may be generated by any method based on information provided by the base sequence in the region or regions from which the polynucleotide is derived, including, but not limited to, chemical synthesis, replication, reverse transcription, or transcription. As such, it may represent either the sense or antisense orientation of the original polynucleotide.

[0049] "Barcode" refers to one or more nucleotide sequences used to identify a nucleic acid or cell to which the barcode is associated. Barcodes can be 3-1000 or more nucleotides in length, preferably 10-250 nucleotides in length and more preferably 10-30 nucleotides in length, such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides in length, including any length within these ranges. Barcodes can be used, for example, to identify a single cell, a subpopulation of cells, a colony, or a sample from which the nucleic acid originated. Barcodes can also be used to identify the location of a cell, colony, or sample from which a nucleic acid originated, such as the location of a colony in a cell array, the location of a well in a multi-well plate, or the location of a tube, flask, or other container in a rack (i.e., positional barcodes). For example, barcodes can be used to identify the genetically modified cell from which a nucleic acid originated. In some embodiments, barcodes are used to identify a particular type of genome editing or a particular type of donor nucleic acid.

[0050] The terms "hybridize" and "hybridization" refer to the formation of a complex between nucleotide sequences that are sufficiently complementary to form a complex by Watson-Crick base pairing.

[0051] The term "homologous region" refers to a region of a nucleic acid that is homologous to another nucleic acid region. Thus, the presence of a "homologous region" in a nucleic acid molecule is determined by reference to another nucleic acid region of the same or different molecule. Furthermore, since nucleic acids are often double-stranded, the term "homologous region" as used herein refers to the ability of nucleic acid molecules to hybridize with each other. For example, a single-stranded nucleic acid molecule may have two homologous regions that have the ability to hybridize with each other. Thus, the term "homologous region" includes nucleic acid segments that have complementary sequences. The length of the homologous region can vary, but is typically 4 to 500 nucleotides (e.g., about 4 to about 40, about 40 to about 80, about 80 to about 120, about 120 to about 160, about 160 to about 200, about 200 to about 240, about 240 to about 280, about 280 to about 320, about 320 to about 360, about 360 to about 400, about 400 to about 440, etc.).

[0052] As used herein, the term "complementary" or "complementarity" refers to polynucleotides capable of base pairing with each other. Base pairs are typically formed by hydrogen bonds between nucleotide units in an antiparallel orientation between polynucleotide strands. Complementary polynucleotide strands can base pair in a Watson-Crick manner (e.g., A to T, A to U, C to G) or any other manner that allows for the formation of a duplex. As one of skill in the art will recognize, when using RNA as opposed to DNA, uracil (U), rather than thymine (T), is the base that is considered complementary to adenosine. However, when uracil is indicated in the context of the present invention, it is implied that it is substitutable for thymine unless otherwise specified. "Complementarity" can exist between two RNA strands, between two DNA strands, or between an RNA strand and a DNA strand. In general, it is understood that two or more polynucleotides can be "complementary" and capable of forming a duplex even if the complementarity is not complete or less than 100%. Two sequences are "fully complementary" or "100% complementary" if at least a contiguous portion of each polynucleotide sequence, including the complementary region, is perfectly base-paired with the other polynucleotide without any mismatch or interruption within such region. Two or more sequences are considered "fully complementary" or "100% complementary" even if either or both polynucleotides contain additional non-complementary sequences, as long as the contiguous complementary regions within each polynucleotide are perfectly hybridizable with the other. "Non-perfect" complementarity refers to a situation where not all of the contiguous nucleotides within such complementary regions are capable of base-pairing with each other. Determining the percentage of complementarity between two polynucleotide sequences is within the ordinary skill of the art.

[0053] The term "Cas9" as used herein encompasses type II clustered regularly interspaced short palindromic repeat (CRISPR) system Cas9 endonuclease from any species, including biologically active fragments, variants, analogs, and derivatives thereof that retain Cas9 endonuclease activity (i.e., catalyzes site-specific cleavage of DNA to generate double-stranded breaks). Cas9 endonuclease binds to and cleaves DNA at sites that contain a sequence complementary to its bound guide RNA (gRNA). For purposes of Cas9 targeting, the gRNA may contain a sequence that is "complementary" to the target sequence (e.g., major or minor allele) and capable of sufficient base pairing to form a duplex (i.e., the gRNA hybridizes with the target sequence). In addition, the gRNA may contain a sequence complementary to the PAM sequence, where the gRNA also hybridizes with the PAM sequence of the target DNA.

[0054] The term "donor polynucleotide" refers to a polynucleotide that provides the sequence of the intended edit to be integrated into the genome of the target locus by HDR or recombineering. A "target site" or "target sequence" is a nucleic acid sequence that is recognized (i.e., sufficiently complementary for hybridization) by a homology arm of a guide RNA (gRNA) or a donor polynucleotide. A target site can be specific to an allele (e.g., a major or minor allele). For example, a target site can be a genomic site that is intended to be modified, such as by the insertion of one or more nucleotides, the substitution of one or more nucleotides, the deletion of one or more nucleotides, or a combination thereof.

[0055] By "homology arm" is meant a portion of the donor polynucleotide that is involved in targeting the donor polynucleotide to the genomic sequence to be edited in the cell. The donor polynucleotide typically comprises a 5' homology arm that hybridizes to the 5' genomic target sequence and a 3' homology arm that hybridizes to the 3' genomic target sequence adjacent to the nucleotide sequence that contains the intended edit to the genomic DNA. The homology arms are referred to herein as 5' and 3' (i.e., upstream and downstream) homology arms, which refer to the relative position of the homology arm to the nucleotide sequence that contains the intended edit in the donor polynucleotide. The 5' and 3' homology arms hybridize to regions that are referred to herein as the "5' target sequence" and "3' target sequence," respectively, within the target locus of the genomic DNA to be modified. For example, a nucleotide sequence containing the intended edit can be integrated into genomic DNA by HDR or recombineering at a genomic target locus that is recognized by the 5' and 3' homology arms (i.e., sufficiently complementary for hybridization).

[0056] In general, a "CRISPR adaptation system" refers to the transcripts and other elements involved in directing the expression or activity of CRISPR-associated ("Cas") genes, collectively including sequences encoding Cas genes and CRISPR array nucleic acid sequences that include a leader sequence and at least one repeat sequence. In some embodiments, one or more elements of the CRISPR adaptation system are derived from a type I, type II, or type III CRISPR system. Casl and Cas2 are found in all three types of CRISPR-Cas systems and are involved in spacer acquisition. In the E. coli IE system, Casl and Cas2 form a complex in which two Casl dimers are bridged by a Cas2 dimer. In this complex, Cas2 acts as a nonenzymatic scaffold and binds the double-stranded fragment of the invading DNA, while Casl binds the single-stranded adjacent portion of the DNA and catalyzes its incorporation into the CRISPR array.

[0057] In some embodiments, one or more elements of the CRISPR system are derived from a particular organism that contains an endogenous CRISPR system, such as Streptococcus pyogenes. In general, CRISPR systems are characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system).

[0058] In some embodiments, the vector comprises a regulatory element operably linked to an enzyme coding sequence that encodes a CRISPR enzyme, such as a Cas protein. Non-limiting examples of Cas proteins include Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, homologs thereof or modified versions thereof.

[0059] In certain embodiments, the present disclosure provides protospacers flanked by short (3-5 bp) DNA sequences called protospacer adjacent motifs (PAMs). PAMs are important in acquisition for type I and type II systems. In type I and type II systems, the protospacer is excised adjacent to the PAM sequence and the other end of the spacer is cut using a ruler mechanism, thus maintaining the regularity of spacer size in CRISPR arrays. Conservation of PAM sequences varies among CRISPR-Cas systems and may be evolutionarily linked to Casl and leader sequences.

[0060] In some embodiments, the present disclosure provides for the integration of defined synthetic DNA produced in a cell, such as by using a modified retron system in a cell, into a CRISPR array, preferentially, but not exclusively, adjacent to a leader sequence. In the IE-type system from E. coli, it has been demonstrated that the first direct repeat adjacent to the leader sequence is copied and a newly acquired spacer is inserted between the first and second direct repeats.

[0061] In one embodiment, the protospacer is a defined synthetic DNA. In some embodiments, the defined synthetic DNA is at least 3, 5, 10, 20, 30, 40, or 50 nucleotides, or 3-50, or 10-100, or 20-90, or 30-80, or 40-70, or 50-60 nucleotides in length. In one embodiment, the oligonucleotide sequence or defined synthetic DNA comprises a modified "AAG" protospacer adjacent motif (PAM).

[0062] In some embodiments, one or more elements of the CRISPR system are operably linked with a regulatory element to drive the expression of one or more elements of the CRISPR system.Generally, CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat), also known as SPIDR (SPacer Interspersed Direct Repeat), constitutes a family of DNA loci that are usually specific to certain bacterial species. CRISPR loci contain a distinctive class of interspersed short sequence repeats (SSRs) found in E. coli (Ishino et al., J. Bacteriol. 169:5429-5433, 1987; and Nakata et al., J. Bacteriol. 171:3553-3556, 1989) and associated genes. Similar interspersed SSRs have been found in Haloferax mediterranei, Streptococcus pyogenes, Anabaena, and Mycobacterium tuberculosis. tuberculosis (see Groenen et al., Mol. Microbiol. 10:1057-1065, 1993; Hoe et al., Emerg. Infect. Dis. 5:254-263, 1999; Masepohl et al., Biochim. Biophys. Acta 1307:26-30, 1996; and Mojica et al., Mol. Microbiol. 17:85-93, 1995). CRISPR loci typically differ from other SSRs in the structure of their repeats, whichThey are called short regularly spaced repeats (SRSR) (Janssen et al., OMICS J. Integ. Biol. 6:23-33, 2002; and Mojica et al., Mol. Microbiol. 36:244-246, 2000). In general, repeats are short elements that occur in regularly spaced clusters separated by unique intervening sequences of substantially constant length (Mojica et al., 2000, supra). The repeat sequences are highly conserved among strains, but the number of interspersed repeats and the sequence of the spacer region typically vary from strain to strain (van Embden et al., J. Bacteriol. 182:2393-2401, 2000). CRISPR loci have been identified in over 40 prokaryotic species (see, e.g., Jansen et al., Mol. Microbiol. 43:1565-1575, 2002; and Mojica et al., 2005), including but not limited to the genera Aeropyrum, Pyrobaculum, Sulfolobus, Archaeoglobus, Haloarcula, Methanobacterium, and the like. bacteriumn, Methanococcus, Methanosarcina, Methanopyrus, Pyrococcus, Picrophilus, Thernioplasnia, Corynebacterium, Mycobacterium, Streptomyces, Aquifrx, Porphyromonas,Chlorobium, Thermus, Bacillus, Listeria, Staphylococcus, Clostridium, Thermoanaerobacter, Mycoplasma, Fusobacterium, Azarcus, Chromobacterium, Neisseria, Nitrosomonas, Desulfovibrio, Geobacter ter, Micrococcus, Campylobacter, Wolinella, Acinetobacter, Erwinia, Escherichia, Legionella, Methylococcus, Pasteurella, Photobacterium, Salmonella, Xanthomonas, Yersinia, Treponema, and Thermotoga.

[0063] In some embodiments, the enzyme coding sequence encoding the CRISPR enzyme is codon-optimized for expression in a particular cell, such as a eukaryotic cell. The eukaryotic cell may be of or derived from a particular organism, such as a mammal, including but not limited to a human, mouse, rat, rabbit, dog, or non-human primate. In general, codon optimization refers to the process of modifying a nucleic acid sequence by replacing at least one codon (e.g., about one or more than about one, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons) of the native sequence with a more frequently or most frequently used codon in the genes of the host cell, while maintaining the native amino acid sequence, to enhance expression in the host cell of interest. Different species exhibit a particular bias for certain codons of a particular amino acid. Codon bias (differences in codon usage between organisms) is often correlated with the efficiency of messenger RNA (mRNA) translation and is therefore believed to depend, among other things, on the properties of the codon being translated and on the availability of specific transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell generally reflects the codons most frequently used in peptide synthesis. Thus, genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example in the "Codon Usage Database," and such tables can be applied in a number of ways. See Nakamura, Y. et al., "Codon usage tabulated from the international DNA sequence databases: status for the year 2000," Nucl. Acids Res., vol. 28, p. 292, 2000.Computer algorithms are also available that codon-optimize a particular sequence for expression in a particular host cell, such as Gene Forge (Aptagen; Jacobus, Pa.). In some embodiments, one or more codons (e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more, or all codons) in a sequence encoding a CRISPR enzyme correspond to the most frequently used codon for a particular amino acid.

[0064] "Administering" a nucleic acid, such as a modified retron construct or a vector containing a modified retron construct, to a cell includes transduction, transfection, electroporation, translocation, fusion, phagocytosis, gunnery or ballistic methods, etc., i.e., any means capable of transporting the nucleic acid across the cell membrane.

[0065] Before the present disclosure is further described, it should be understood that the disclosed subject matter is not limited to the detailed embodiments described, as these may, of course, vary. It should also be understood that the terminology used herein is for the purpose of describing the detailed embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims.

[0066] Where a range of values ​​is provided, unless the context clearly dictates otherwise, it is understood that each intermediate value between the upper and lower limits of that range, to the tenth of the unit of the lower limit, and any other stated or intermediate value in that stated range, is encompassed within the scope of the disclosed subject matter. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, which are also encompassed within the scope of the disclosed subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosed subject matter.

[0067] Unless otherwise defined, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosed subject matter belongs. In the practice or testing of the disclosed subject matter, any methods and materials similar or equivalent to those described herein can be used, but the preferred methods and materials are described herein. All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited.

[0068] It should be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a "cell" includes a plurality of such cells, reference to "the nucleic acid" includes reference to one or more nucleic acids and equivalents thereof known to those of skill in the art, and so forth. It is further noted that the claims may be written to exclude any optional element. As such, it is intended that this statement be the basis for antecedent limitations in the use of exclusionary language such as "solely," "only," and the like in connection with the recitation of any feature or element described herein, including the use of "negative" limitations.

[0069] For clarity, it is understood that certain features of the disclosed subject matter that are described in the context of separate embodiments may also be provided in combination in a single embodiment. Conversely, for brevity, various features of the disclosed subject matter that are described in the context of a single embodiment may also be provided individually or in any suitable subcombination. All combinations of the embodiments related to the present disclosure are specifically embraced in the disclosed subject matter and are disclosed herein as if each and every combination were individually and explicitly disclosed. In addition, all subcombinations of the various embodiments and elements thereof are specifically embraced in the present disclosure and are disclosed herein as if each and every such subcombination were individually and explicitly disclosed herein.

[0070] Publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the disclosed subject matter is not entitled to antedate such publications. Further, the publication dates provided may be different from the actual publication dates, which may need to be independently confirmed.

[0071] Modified retrons are provided that are modified to enhance the production of multicopy single-stranded DNA (msDNA), as well as vector systems encoding such modified retrons and methods of using the modified retrons and vector systems encoding same in various applications, such as CRISPR / Cas-mediated genome editing, recombineering, cell barcoding, and molecular recording.

[0072] Modified Retron The present disclosure provides a modified retron that is modified to enhance the production of msDNA in cells. The modified retron includes a pre-msr sequence, an msr gene encoding a multicopy single-stranded RNA (msRNA); an msd gene encoding a multicopy single-stranded DNA (msDNA); a post-msd sequence, and a ret gene encoding a reverse transcriptase. DNA synthesis by the reverse transcriptase encoded by the retron can result in a DNA / RNA chimeric product composed of a single-stranded DNA encoded by the msd gene linked to a single-stranded RNA encoded by the msr gene. The retron msr RNA contains a conserved guanosine residue at the end of the stem-loop structure. The strand of the msr RNA is spliced ​​to the 5' end of the msd single-stranded DNA by a 2'-5' phosphodiester bond at the 2' position of the conserved guanosine residue.

[0073] In the modified retron, the post-msd sequence is modified, for example, within its self-complementary region (which has sequence complementarity with the pre-msr sequence), where the length of the self-complementary region is increased relative to the corresponding region of the native retron. Such modifications result in the modified retron leading to enhanced msDNA production. In certain embodiments, the complementary region has a length at least 1, at least 2, at least 4, at least 6, at least 8, at least 10, at least 12, at least 14, at least 16, at least 18, at least 20, at least 30, at least 40, or at least 50 nucleotides longer than the wild-type self-complementary region. For example, the self-complementary region may have a length in the range of 1-50 nucleotides longer than the natural or wild-type complementary region, such as, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides longer, including any length within this range. In certain embodiments, the self-complementary region has a length in the range of 1-16 nucleotides longer than the wild-type complementary region. The single-stranded DNA generated by the modified retron can be used in a variety of applications.

[0074] For example, the sequence of ncRNA SEQ ID NO:12 shown below (with the natural self-complementary 3' and 5' ends (at positions 1-12 and 158-169) highlighted in bold) can be extended at positions 1 and 169 so that more ssDNA is produced.

[0075] [ka]

[0076] For example, as shown below for the modified "ncRNA extension" (SEQ ID NO: 13) (where the additional nucleotides extending the self-complementary region are underlined and italicized):

[0077] [ka]

[0078] Optionally, additional nucleotides can be added at any position within the self-complementary region, for example, within any of positions 1-12 and 158-169 of the sequence of SEQ ID NO:12. In certain embodiments, the msr, msd and ret gene sequences used in the engineered retron may be derived from a bacterial retron operon. Representative retrons include, without limitation, myxobacterial retrons such as Myxococcus xanthus retrons (e.g., Mx65, Mx162) and Stigmatella aurantiaca retrons (e.g., Sa163); Escherichia coli retrons (e.g., Ec48, E67, Ec73, Ec78, EC83, EC86, EC107, and Ec107); Salmonella enterica; Vibrio cholerae retrons (e.g., Vc81, Vc95, Vc137); Vibrio parahaemolyticus (e.g., Vc96); and Nannocystis excedens retrons (e.g., Vc97, Vc99, Vc107 ... exedens retrons (e.g., Ne144) and those of gram-negative bacteria are available. The retron msr, msd and ret gene nucleic acid sequences and the retron reverse transcriptase protein sequence may be derived from any source. Representative retron sequences, including the msr, msd and ret gene nucleic acid sequences and the reverse transcriptase protein sequences, are listed in the National Center for Biotechnology Information (NCBI) database. See, for example, NCBI entries: Accession Nos. EF428983, M55249, EU250030, X60206, X62583, AB299445, AB436696, AB436695, M86352, M30609, M24392, AF427793, AQ3354 and AB079134; all of which sequences (as registered as of the filing date of this application) are incorporated herein by reference in their entirety. Any of these retron sequences or variants thereof containing a sequence may contain variant nucleotides, additional nucleotides or fewer nucleotides.For example, the retron can have at least about 80-100% sequence identity thereto, including any percent identity within this range, such as 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, with any of the retron sequences described herein (including those defined by accession number) and can be used in the construction of modified retrons or vector systems comprising modified retrons as described herein.

[0079] In some embodiments, the recombinant retron construct has a non-native configuration in which the spacing between the msr, msd and ret genes is non-natural. The msr and msd genes can be separated in a trans configuration rather than provided in the endogenous cis configuration. In addition, the ret gene can be provided in a trans configuration relative to either the msr or msd genes. In some embodiments, providing the ret gene in a trans configuration eliminates the cryptic stop signal of reverse transcriptase, thus allowing the generation of longer single-stranded DNA from the modified retron construct.

[0080] In some embodiments, the retron construct is modified to include a heterologous sequence of interest relative to the natural retron. In this regard, the retron can be modified with a heterologous sequence for use in various applications. For example, the addition of a heterologous sequence to the retron construct can provide a cell with a nucleic acid encoding a protein or regulatory RNA of interest, such as a donor polynucleotide suitable for use in gene editing by homology-directed repair (HDR) or recombination-mediated gene modification (recombineering), or a CRISPR protospacer DNA sequence used for molecular recording, as discussed further below. Such a heterologous sequence can be inserted, for example, into an msr gene or msd gene, such that the heterologous sequence is transcribed by retron reverse transcriptase as part of the msDNA product.

[0081] In some cases, a heterologous sequence of interest can be inserted into the loop of the msd stem-loop. For example, the modified retrons may include a unique barcode to facilitate multiplexing. The barcode may include one or more nucleotide sequences used to identify the nucleic acid or cell to which the barcode is attached. Such a barcode may be inserted, for example, within the loop region of the msd-encoded DNA. The barcode may be 3-1000 or more nucleotides in length, preferably 10-250 nucleotides in length and more preferably 10-30 nucleotides in length, such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides in length, including any length within these ranges. In some embodiments, barcodes are also used to identify the location of a cell, colony, or sample from which a retron originates, such as the location of a colony in a cell array, the location of a well in a multi-well plate, the location of a tube in a rack, or the location of a sample in a laboratory (i.e., positional barcodes). In particular, barcodes can be used to identify the location of genetically modified cells that contain retrons. The use of barcodes allows retrons from different cells to be pooled into a single reaction mixture for sequencing, while still being able to trace a particular retron back to its colony of origin.

[0082] In addition, the addition of adapter sequences to retron constructs may facilitate high-throughput amplification or sequencing. For example, the addition of a pair of adapter sequences to the 5' and 3' ends of a retron construct may allow multiple retron constructs to be amplified or sequenced simultaneously with the same set of primers. Amplification of retron constructs may be performed, for example, before transfection of cells or before ligation into a vector. Any method may be used to amplify retron constructs, including, but not limited to, polymerase chain reaction (PCR), isothermal amplification, nucleic acid sequence-based amplification (NASBA), transcription mediated amplification (TMA), strand displacement amplification (SDA), and ligase chain reaction (LCR). In one embodiment, retron constructs contain common 5' and 3' priming sites, allowing retron sequences to be amplified in parallel with a set of universal primers. In another embodiment, a subset of retron sequences are selectively amplified from the pooled mixture using a set of selective primers.

[0083] Delivery of the modified retron to a cell will generally be accomplished with or without a vector. The modified retron (or a vector containing it) can be introduced into any type of cell, including any cell from prokaryotic, eukaryotic or archaeal organisms, including bacteria, archaea, fungi, protists, plants (e.g., monocotyledonous and dicotyledonous plants); and animals (e.g., vertebrates and invertebrates). Examples of animals that can be transfected with the modified retron include, without limitation, vertebrates such as fish, birds, mammals (e.g., human and non-human primates, farm animals, pets and laboratory animals), reptiles and amphibians. Examples of plants that can be transfected with the modified retron include, without limitation, crops including cereals such as wheat, oats and rice, legumes such as soybeans and peas, corn, grasses such as alfalfa and cotton. The modified retron can be introduced into a single cell or a population of cells of interest. Cells from tissues, organs and biopsies as well as recombinant cells, genetically modified cells, cells from in vitro cultured cell lines and artificial cells (e.g., nanoparticles, liposomes, polymersomes or microcapsules encapsulating nucleic acids) can all be transfected with the modified retrons. The subject methods are also applicable to cell fragments, cellular components or organelles (e.g., mitochondria in animal and plant cells, plastids (e.g., chloroplasts) in plant cells and algae). Cells can be cultured or expanded after transfection with the modified retron construct.

[0084] Methods for introducing nucleic acid into host cells are well known in the art. Commonly used methods include chemically induced transformation, typically using divalent cations (e.g., CaCl2), dextran-mediated transfection, polybrene-mediated transfection, lipofectamine and LT-1-mediated transfection, electroporation, protoplast fusion, encapsulation of nucleic acid in liposomes, and direct microinjection of nucleic acid containing modified retrons into nuclei. See, e.g., Sambrook et al., 2001, Molecular Cloning, a laboratory manual, 3rd ed., Cold Spring Harbor Laboratories, New York; Davis et al., 1995, Basic Methods in Molecular Biology, 2nd ed., McGraw-Hill; and Chu et al., 1981, Gene 13:197 (incorporated herein by reference in their entireties).

[0085] Vector system containing modified retrons In certain embodiments, the retron msr, msd and ret genes are expressed in vivo from a vector in a cell. A "vector" is a composition that can be used to deliver a nucleic acid of interest inside a cell. The retron msr, msd and ret genes can be introduced into a cell in a single vector or multiple separate vectors to produce msDNA in a host subject. The vector typically contains a control element operably linked to the retron sequence, which allows for the production of msDNA in vivo in the subject species. For example, the retron msr, msd and ret genes can be operably linked to a promoter to allow for the expression of retron reverse transcriptase and the msDNA product. In some embodiments, a heterologous sequence encoding a desired product of interest (e.g., a polynucleotide encoding a polypeptide or regulatory RNA, a donor polynucleotide for gene editing or a protospacer DNA for molecular recording) can be inserted into the msr or msd gene. Any eukaryotic, archaeal or prokaryotic cell capable of transfecting a vector containing a modified retron sequence can be used to produce msDNA. The ability of the construct to produce msDNA along with other retron-encoded products can be determined experimentally.

[0086] In some embodiments, the modified retron is produced by a vector system comprising one or more vectors. In the vector system, the msr, msd and ret genes can be provided by the same vector (i.e., all such retron elements are in cis configuration), and the vector comprises a promoter operably linked to the msr and msd genes. In some embodiments, this promoter is further operably linked to the ret gene. In other embodiments, the vector further comprises a second promoter operably linked to the ret gene. Alternatively, the ret gene can be provided by a second vector that does not include the msr and msd genes (i.e., msr-msd and ret are in trans configuration). In yet other embodiments, the msr, msd and ret genes are each provided by a different vector (i.e., all retron elements are in trans configuration). Many vectors are available, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphipathic compounds, plasmids and viruses. Thus, the term "vector" includes an autonomously replicating plasmid or virus. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, etc. An expression construct can replicate in a living cell, or it can be made synthetically. For purposes of this application, the terms "expression construct", "expression vector" and "vector" are used interchangeably in a generalized, illustrative sense to demonstrate the application of the invention and are not intended to limit the invention.

[0087] In certain embodiments, the nucleic acid comprising the modified retron sequence is under the transcriptional control of a promoter. "Promoter" refers to a DNA sequence recognized by the synthetic machinery of a cell or introduced synthetic machinery, which is necessary for the initiation of specific transcription of a gene. The term promoter will be used here to refer to a group of transcriptional control modules clustered around the initiation site of RNA polymerase I, II or III. Typical promoters for mammalian cell expression include, among others, the SV40 early promoter, CMV promoters such as the CMV immediate early promoter (see U.S. Pat. Nos. 5,168,062 and 5,385,839, which are incorporated herein by reference in their entirety), mouse mammary tumor virus LTR promoter, adenovirus major late promoter (Ad MLP) and herpes simplex virus promoter. Other non-viral promoters will also find use in mammalian expression, such as the promoter derived from the mouse metallothionein gene. These and other promoters can be obtained from commercially available plasmids using techniques well known in the art. See, e.g., Sambrook et al., supra. Enhancer elements can be used in conjunction with a promoter to increase the level of expression of the construct. Examples include the SV40 early gene enhancer as described in Dijkema et al., EMBO J. 4:761 (1985), the enhancer / promoter from the long terminal repeat (LTR) of Rous sarcoma virus as described in Gorman et al., Proc. Natl. Acad. Sci. USA 79:6777 (1982b), and elements from human CMV as described in Boshart et al., Cell 41:521 (1985), such as elements contained in the CMV intron A sequence.

[0088] In one embodiment, an expression vector for expressing a modified retron comprising the msr, msd and ret genes comprises a promoter "operably linked" to a polynucleotide encoding the msr, msd and ret genes. The phrases "operably linked" or "under transcriptional control" as used herein mean that the promoter is in the correct position and orientation relative to the polynucleotide to control initiation of transcription by RNA polymerase and expression of the msr, msd and ret genes.

[0089] Typically, a transcription terminator / polyadenylation signal will also be present in the expression construct. Examples of such sequences include, but are not limited to, those derived from SV40 as described in Sambrook et al., supra, as well as the bovine growth hormone terminator sequence (see, e.g., U.S. Pat. No. 5,122,458). In addition, a 5'-UTR sequence may be placed adjacent to the coding sequence to enhance its expression. Such sequences may include a UTR that contains an internal ribosome entry site (IRES).

[0090] The inclusion of an IRES allows for the translation of one or more open reading frames from the vector. IRES elements attract the eukaryotic ribosomal translation initiation complex and facilitate translation initiation. See, for example, Kaufman et al., Nucleic Acids Research, vol. 13, no. 1, pp. 1171-1175, 2002. Res., 1991, vol. 19, pp. 4485-4490; Gurtu et al., Biochem. Biophys. Res. Comm., 1996, vol. 229, pp. 295-298; Rees et al., BioTechniques, 1996, vol. 20, pp. 102-110; Kobayashi et al., BioTechniques, 1996, vol. 21, pp. 399-402; and Mosser et al., BioTechniques, 1997, vol. 22, pp. 150-161. Numerous IRES sequences are known, including those from picornavirus leader sequences such as the encephalomyocarditis virus (EMCV) UTR (Jang et al., J. Virol. 63:1651-1660, 1989), the polyo leader sequence, the hepatitis A virus leader, the hepatitis C virus IRES, and the human rhinovirus type 2 IRES (Dobrikova et al., Proc. Natl. Acad. Sci. 100:25:15125-15130, 2003), and the IRES element from foot-and-mouth disease virus (Ramesh et al., Nucl. Acids Research 1999:1021-1033). Res., 1996, vol. 24, pp. 2697-2700), and the Giardia virus IRES (Garlapati et al., J. Biol. Chem., 2004, vol. 279, no. 5, pp. 3389-3397).Various non-viral IRES sequences can also be used, including but not limited to yeast IRES sequences and the human angiotensin II type 1 receptor IRES (Martin et al., Mol. Cell Endocrinol. 2003, 212, 51-61), fibroblast growth factor IRES (FGF-1 IRES and FGF-2 IRES). IRES (Martineau et al., 2004, Mol. Cell. Biol. 24(17):7622-7635), vascular endothelial growth factor IRES (Baranick et al., 2008, Proc. Natl. Acad. Sci. USA 105(12):4733-4738; Stein et al., 1998, Mol. Cell. Biol. 18(6):3112-3119; Bert et al., 2006, RNA 12(6):1074-1083) and insulin-like growth factor 2 (IRES) Including IRES (Pedersen et al., 2002, Biochem. J. 363, no. 1, pp. 37-44) may find use herein. These elements are readily commercially available in plasmids sold, for example, by Clontech (Mountain View, CA), Invivogen (San Diego, CA), Addgene (Cambridge, MA) and GeneCopoeia (Rockville, MD). See also IRESite: a database of experimentally validated IRES structures (iresite.org).Inclusion of an IRES sequence in a vector allows the expression of, for example, multiple bacteriophage recombination proteins for recombineering or an RNA-guided nuclease (e.g., Cas9) for HDR in combination with a retroviral reverse transcriptase from an expression cassette.

[0091] Alternatively, the use of a polynucleotide encoding a viral T2A peptide allows for the production of multiple protein products (e.g., Cas9, bacteriophage recombination proteins, retroviral reverse transcriptase) from a single vector. One or more 2A linker peptides can be inserted between the coding sequences of the polycistronic construct. The 2A peptide, being self-cleaving, allows for the production of equimolar levels of co-expressed proteins from the polycistronic construct. 2A peptides from a variety of viruses can be used, including but not limited to 2A peptides from foot and mouth disease virus, equine rhinitis A virus, Thosea asigna virus, and porcine teschovirus-1. See, e.g., Kim et al., 2011, PLoS One, vol. 6, no. 4, p. e18556; Trichas et al., 2008, BMC Biol., vol. 6, p. 40; Provost et al., 2007, Genesis, vol. 45, no. 10, pp. 625-629; Furler et al., 2001, Gene Ther., vol. 8, no. 11, pp. 864-873 (incorporated herein by reference in their entireties).

[0092] In certain embodiments, the expression construct comprises a plasmid suitable for transformation of a bacterial host. Many bacterial expression vectors are known to those of skill in the art, and the selection of an appropriate vector is a matter of preference. Bacterial expression vectors include, but are not limited to, pACYC177, pASK75, pBAD, pBADM, pBAT, pCal, pET, pETM, pGAT, pGEX, pHAT, pKK223, pMal, pProEx, pQE, and pZA31. The bacterial plasmid may contain an antibiotic selection marker (e.g., ampicillin, kanamycin, erythromycin, carbenicillin, streptomycin, or tetracycline resistance), a lacZ gene (β-galactosidase produces a blue pigment from the x-gal substrate), a fluorescent marker (e.g., GFP, mCherry), or other markers for selection of transformed bacteria. See, e.g., Sambrook et al., supra.

[0093] In other embodiments, the expression construct comprises a plasmid suitable for transformation of yeast cells. Yeast expression plasmids typically contain a yeast-specific origin of replication (ORI) and may contain a nutritional selection marker (e.g., HIS3, URA3, LYS2, LEU2, TRP1, MET15, ura4+, leu1+, ade6+), an antibiotic selection marker (e.g., kanamycin resistance), a fluorescent marker (e.g., mCherry) or other marker for selection of transformed yeast cells. Yeast plasmids may further contain components that allow for shuttle transport between a bacterial host (e.g., E. coli) and the yeast cell. Many different types of yeast plasmids are available, including yeast integrating plasmids (YIp), which lack an ORI and integrate into the host chromosome by homologous recombination; yeast replicating plasmids (YRp), which contain an autonomously replicating sequence (ARS) and can replicate independently; yeast centromere plasmids (YCp), which are low-copy vectors that contain part of the ARS and part of the centromere sequence (CEN); and yeast episomal plasmids (YEp), which are high-copy-number plasmids that contain a fragment from the 2 micron circle (a native yeast plasmid) that allows stable growth of more than 50 copies per cell.

[0094] In other embodiments, the expression construct comprises a viral construct or an engineered construct derived from a viral genome.Several viral-based systems have been developed for gene transfer into mammalian cells. These include adenoviruses, retroviruses (gamma-retroviruses and lentiviruses), poxviruses, adeno-associated viruses, baculoviruses, and herpes simplex viruses (see, e.g., Warnock et al., 2011, Methods Mol. Biol. 737:1-25; Walther et al., 2000, Drugs 60:2:249-271; and Lundstrom, 2003, Trends Biotechnol. 21:3:117-122, which are incorporated by reference in their entireties). Certain viruses have become attractive candidates for the transfer of foreign genes into mammalian cells due to their ability to enter cells by receptor-mediated endocytosis, integrate into the host cell genome, and express viral genes stably and efficiently.

[0095] For example, retroviruses provide a convenient platform for gene delivery systems. A sequence of choice can be inserted into a vector and packaged into retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to cells of a subject either in vivo or ex vivo. A number of retroviral systems have been described (U.S. Pat. No. 5,219,740; Miller and Rosman, 1989, BioTechniques 7:980-990; Miller, AD, 1990, Human Gene Therapy 1:131-135). Therapy, 1, 5-14; Scarpa et al., 1991, Virology, 180, 849-852; Burns et al., 1993, Proc. Natl. Acad. Sci. USA, 90, 8033-8037; Boris-Lawrie and Temin, 1994, Virology, 180, 849-852. (Temin, 1993, Cur. Opin. Genet. Develop., 3:102-109; and Ferry et al., 2011, Curr. Pharm. Des., 17:24:2516-2527). Lentiviruses are a particularly useful class of retroviruses for delivering polynucleotides to mammalian cells because they are capable of infecting both dividing and non-dividing cells (see, e.g., Lois et al., 2002, Science 295:868-872; Durand et al., 2011, Viruses 3:2:132-159, herein incorporated by reference).

[0096] A number of adenoviral vectors have also been described. Unlike retroviruses, which integrate into the host genome, adenoviruses remain extrachromosomal, thus minimizing the risks associated with insertional mutagenesis (Haj-Ahmad and Graham, J. Virol. 57:267-274 (1986); Bett et al., J. Virol. 67:5911-5921 (1993); Mittereder et al., Human Gene Therapy 1997:101-102 (1997)). Therapy, 5:717-729 (1994); Seth et al., J. Virol. 68:933-940 (1994); Barr et al., Gene Therapy, 1:51-58 (1994); Berkner, KL, BioTechniques, 6:616-629 (1988); and Rich et al., Human Gene Therapy, 4:461-476 (1993). In addition, various adeno-associated virus (AAV) vector systems have been developed for gene delivery. AAV vectors can be readily constructed using techniques well known in the art.See, e.g., U.S. Pat. Nos. 5,173,414 and 5,139,941; WO 92 / 01070 (published Jan. 23, 1992) and WO 93 / 03769 (published Mar. 4, 1993); Lebkowski et al., Molecular and Cellular Biology, Vol. 8, pp. 3988-3996, 1988; Vincent et al., Vaccines 90, Cold Spring Harbor Laboratory Press, 1990; Carter, BJ, Current Opinion in Biotechnology, vol. 1, pp. 1111-1115, 1992; Biotechnology, 3, 533-539, 1992; Muzyczka, N., Current Topics in Microbiol. and Immunol., 158, 97-129, 1992; Kotin, RM, Human Gene Therapy, 5, 793-801, 1994; Shelling and Smith, Gene Therapy, 1995; Therapy, 1994, vol. 1, pp. 165-169; and Zhou et al., J. Exp. Med., 1994, vol. 179, pp. 1867-1875.

[0097] Another vector system useful for delivery of nucleic acids encoding modified retrons is the enterally administered recombinant poxvirus vaccine described by Small, Jr., PA et al. (U.S. Patent No. 5,676,950, issued October 14, 1997, incorporated herein by reference).

[0098] Other viral vectors that may find use in delivering nucleic acid molecules of interest include those derived from the poxvirus family, including vaccinia virus and avian poxvirus. By way of example, vaccinia virus recombinants expressing a nucleic acid molecule of interest (e.g., a modified retron) can be constructed as follows: First, DNA encoding a particular nucleic acid sequence is inserted into an appropriate vector so that it is adjacent to a vaccinia promoter and flanking vaccinia DNA sequences, such as sequences encoding thymidine kinase (TK). This vector is then used to transfect cells, which are simultaneously infected with vaccinia. Homologous recombination serves to insert the vaccinia promoter plus the gene encoding the sequence of interest into the viral genome. The resulting TK recombinants can be selected by culturing cells in the presence of 5-bromodeoxyuridine and picking viral plaques that are resistant to it.

[0099] Alternatively, avipox viruses, such as fowlpox and canarypox viruses, can also be used to deliver the nucleic acid molecule of interest. The use of avipox vectors is particularly desirable in humans and other mammalian species, since members of the avipox genus can only productively replicate in susceptible avian species and therefore are not infectious in mammalian cells. Methods for producing recombinant avipox viruses are known in the art and use genetic recombination, as described above for the production of vaccinia viruses. See, for example, WO 91 / 12882; WO 89 / 03429; and WO 92 / 03545.

[0100] Molecular conjugate vectors can also be used for gene delivery, such as the adenovirus chimeric vectors described by Michael et al., J. Biol. Chem., 1993, vol. 268, pp. 6866-6869 and Wagner et al., Proc. Natl. Acad. Sci. USA, 1992, vol. 89, pp. 6099-6103.

[0101] Members of the Alphavirus genus, including, but not limited to, vectors derived from Sindbis virus (SIN), Semliki Forest virus (SFV), and Venezuelan equine encephalitis virus (VEE), may also find use as viral vectors for delivery of the polynucleotides of the invention. For a description of Sindbis virus-derived vectors useful in practicing the present methods, see Dubensky et al., 1996, J. Virol. 70:508-519; and WO 95 / 07995 and WO 96 / 17072; as well as Dubensky, Jr., TW et al., U.S. Patent No. 5,843,723, issued Dec. 1, 1998, and Dubensky, Jr., TW, U.S. Patent No. 5,789,245, issued Aug. 4, 1998, both of which are incorporated herein by reference. Particularly preferred are chimeric alphavirus vectors that include sequences derived from Sindbis virus and Venezuelan equine encephalitis virus. See, e.g., Perri et al., 2003, J. Virol. 77:10394-10403, and WO 02 / 099035, WO 02 / 080982, WO 01 / 81609, and WO 00 / 61772, which are incorporated by reference in their entireties.

[0102] Advantageously, a vaccinia-based infection / transfection system can be used to provide inducible, transient expression of a nucleic acid of interest (e.g., a modified retron) in a host cell. In this system, cells are first infected in vitro with a vaccinia virus recombinant that encodes bacteriophage T7 RNA polymerase. This polymerase exhibits exquisite specificity in that it only transcribes templates carrying the T7 promoter. After infection, the nucleic acid of interest driven by the T7 promoter is transfected into the cell. The polymerase expressed from the vaccinia virus recombinant in the cytoplasm transcribes the transfected DNA into RNA. This method provides high levels of transient, abundant RNA production in the cytoplasm. See, e.g., Elroy-Stein and Moss, Proc. Natl. Acad. Sci. USA, 1990, vol. 87, pp. 6743-6747; Fuerst et al., Proc. Natl. Acad. Sci. USA, 1986, vol. 83, pp. 8122-8126.

[0103] As an alternative to infecting vaccinia or avipox virus recombinants or using other viral vectors to deliver nucleic acids, an amplification system can be used that will lead to high expression after introduction into the host cell. Specifically, the T7 RNA polymerase promoter in front of the coding region of T7 RNA polymerase can be modified. When the RNA derived from this template is translated, T7 RNA polymerase will be generated, which will then transcribe more templates. Concomitantly, there will be a cDNA whose expression is under the control of the T7 promoter. Thus, some of the T7 RNA polymerase generated by translation of the amplified template RNA will lead to transcription of the desired gene. Since some T7 RNA polymerase is required to initiate amplification, T7 RNA polymerase can be introduced into the cell along with one or more templates that prime the transcription reaction. The polymerase can be introduced as a protein or on a plasmid that encodes the RNA polymerase. For further discussion of the T7 system and its use in transforming cells, see, e.g., WO 94 / 26911; Studier and Moffatt, J. Mol. Biol. 189:113-130 (1986); Deng and Wolff, Gene 143:245-249 (1994); Gao et al., Biochem. Biophys. Res. Commun. 200:1201-1206 (1994); Gao and Huang, Nuc. Acids Research. Res., 1993, 21:2867-2872; Chen et al., Nuc. Acids Res., 1994, 22:2114-2120; and U.S. Pat. No. 5,135,855.

[0104] Insect cell expression systems such as the baculovirus system can also be used and are known to those of skill in the art and are described, for example, in "Baculovirus and Insect Cell Expression Protocols" (Methods in Molecular Biology, edited by DW Muhammer, Humana Press, 2nd ed., 2007) and "The Baculovirus Expression System: A laboratory guide" by L. King (Springer, 1992). Materials and methods for baculovirus / insect cell expression systems are commercially available in kit form from, inter alia, Thermo Fisher Scientific (Waltham, MA) and Clontech (Mountain View, CA).

[0105] Plant expression systems can also be used to transform plant cells. Typically, such systems use virus-based vectors to transfect plant cells with heterologous genes. For a description of such systems, see, for example, Porta et al., Mol. Biotech. 5:209-221 (1996); and Hackland et al., Arch. Virol. 139:1-22 (1994).

[0106] In order to cause expression of the modified retron construct, the expression construct must be delivered into the cell. This delivery can be accomplished in vitro, as in laboratory procedures when transforming cell lines, or in vivo or ex vivo, as in the treatment of certain disease conditions. One delivery mechanism is by viral infection, where the expression construct is packaged into an infectious viral particle.

[0107] Several non-viral methods for transferring expression constructs into cultured cells are also contemplated, including the use of calcium phosphate precipitation, DEAE-dextran, electroporation, direct microinjection, DNA-loaded liposomes, lipofectamine-DNA complexes, cell sonication, gene guns using high-velocity microprojectiles, and receptor-mediated transfection (e.g., Graham and Van Der Eb, 1973, Virology 52:456-467; Chen and Okayama, 1987, Mol. Cell Biol. 7:2745-2752; Rippe et al., 1990, Mol. Cell Biol. 1990:111-112; and van der Eb, 1993, Virology 52:456-467). Biol., 10, 689-695; Gopal, 1985, Mol. Cell Biol., 5, 1188-1190; Tur-Kaspa et al., 1986, Mol. Cell Biol., 6, 716-718; Potter et al., 1984, Proc. Natl. Acad. Sci. USA, 81, 7161-7165; Harland and Weintraub, 1985, J. Cell Biology. Biol., 101, 1094-1099; Nicolau and Sene, 1982, Biochim. Biophys. Acta, 721, 185-190; Fraley et al., 1979, Proc. Natl. Acad. Sci. USA, 76, 3348-3352; Fechheimer et al., 1987, Proc. Natl. Acad. Sci. USA, 84, 104-105;8463-8467; Yang et al., 1990, Proc. Natl. Acad. Sci. USA 87:9568-9572; Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432; Wu and Wu, 1988, Biochemistry 27:887-892 (herein incorporated by reference). Some of these techniques can be easily adapted for in vivo or ex vivo applications.

[0108] Once the expression construct is delivered into the cell, the nucleic acid containing the modified retron sequence can be located and expressed at various sites. In certain embodiments, the nucleic acid containing the modified retron sequence can be stably integrated into the genome of the cell. This integration can be in a cognate location and orientation for homologous recombination (gene replacement), or it can be integrated in a random, non-specific location (gene augmentation). In yet another embodiment, the nucleic acid can be stably maintained in the cell as a separate episomal segment of DNA. Such a nucleic acid segment or "episome" encodes sufficient sequences to allow maintenance and replication independent of or in synchrony with the host cell cycle. How the expression construct is delivered to the cell and where in the cell the nucleic acid remains depends on the type of expression construct utilized.

[0109] In yet another embodiment, the expression construct may simply consist of naked recombinant DNA or a plasmid containing the modified retron. The transfer of the construct may be performed by any of the above-mentioned methods of physically or chemically permeabilizing the cell membrane. This is particularly applicable to transfer in vitro, but it may be applied to in vivo use as well. Dubensky et al. (Proc. Natl. Acad. Sci. USA, 1984, vol. 81, pp. 7529-7533) successfully injected polyomavirus DNA in the form of calcium phosphate precipitates into the liver and spleen of adult and neonatal mice exhibiting active viral replication and acute infection. Benvenisty and Neshif (Proc. Natl. Acad. Sci. USA 83:9551-9555, 1986) also demonstrated that direct intraperitoneal injection of calcium phosphate precipitated plasmids resulted in expression of the transfected genes. It is envisioned that DNA encoding a modified retron of interest may also be transferred in vivo in a similar manner to result in expression of the retron product.

[0110] In yet another embodiment, naked DNA expression constructs can be transferred into cells by particle bombardment. This method relies on the ability of DNA-coated microprojectiles to accelerate to high velocities, allowing them to penetrate cell membranes and enter cells without killing them (Klein et al., 1987, Nature 327:70-73). Several devices have been developed to accelerate small particles. One such device relies on a high-voltage discharge to generate an electric current, which in turn provides the motive force (Yang et al., 1990, Proc. Natl. Acad. Sci. USA 87:9568-9572). Microprojectiles can be made of biologically inert materials, such as tungsten or gold beads.

[0111] In further embodiments, liposomes may be used to deliver expression constructs. Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an internal aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement to form a closed structure, encapsulating water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991, Liver Diseases, Targeted Diagnosis and Therapy Using Specific Receptors and Ligands, Wu et al., eds., Marcel Dekker, NY, pp. 87-104). The use of lipofectamine-DNA complexes is also contemplated.

[0112] In certain embodiments, the liposomes may be complexed with Sendai virus (HVJ), which has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al., 1989, Science 243:375-378). In other embodiments, the liposomes may be complexed or used in conjunction with nuclear non-histone chromosomal proteins (HMG-I) (Kato et al., 1991, J. Biol. Chem. 266:6:3361-3364). In yet other embodiments, the liposomes may be complexed or used in conjunction with both HVJ and HMG-I. To the extent that such expression constructs have been successfully used to transfer and express nucleic acids in vitro and in vivo, they are therefore applicable to the present invention. Where a bacterial promoter is utilized in the DNA construct, it may also be desirable to include an appropriate bacterial polymerase within the liposome.

[0113] Other expression constructs that can be used to deliver nucleic acids into cells are receptor-mediated delivery vehicles, which take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis in almost all eukaryotic cells. Due to the cell type-specific distribution of various receptors, delivery can be highly specific (Wu and Wu, 1993, Adv. Drug Delivery Rev. 12, 159-167).

[0114] Receptor-mediated gene targeting vehicles generally consist of two components: cell receptor-specific ligands and DNA conjugates. Several ligands have been used for receptor-mediated gene transfer. The most well-characterized ligands are asialoorosomucoid (ASOR) and transferrin (see, for example, Wu and Wu, 1987, supra; Wagner et al., 1990, Proc. Natl. Acad. Sci. USA, vol. 87, no. 9, pp. 3410-3414). Synthetic neoglycoproteins that recognize the same receptor as ASOR have been used as gene delivery vehicles (Ferkol et al., 1993, FASEB J. 7:1081-1091; Perales et al., 1994, Proc. Natl. Acad. Sci. USA 91:9:4086-4090), and epidermal growth factor (EGF) has also been used to deliver genes to squamous cell carcinoma cells (Myers, EP 0273085).

[0115] In other embodiments, the delivery vehicle may include a ligand and a liposome. For example, Nicolau et al. (Methods Enzymol. 1987, vol. 149, pp. 157-176) observed increased uptake of the insulin gene by hepatocytes using liposomes incorporating lactosylceramide, a galactose-terminal asialoganglioside. It is therefore feasible that nucleic acids encoding specific genes may also be specifically delivered to cells with or without liposomes by any number of receptor-ligand systems. Antibodies against surface antigens on cells may also be used as targeting moieties.

[0116] In a detailed example, recombinant polynucleotides containing modified retrons can be administered in combination with cationic lipids. Examples of cationic lipids include, but are not limited to, lipofectin, DOTMA, DOPE and DOTAP. WO 00 / 71096 (which is specifically incorporated by reference) describes various formulations, such as DOTAP:cholesterol or cholesterol derivative formulations, that can be effectively used in gene therapy. Other disclosures also discuss various lipid or liposomal formulations, including nanoparticles and methods of administration; these include, but are not limited to, US Patent Publication Nos. 20030203865, 20020150626, 20030032615 and 20040048787 (which are specifically incorporated by reference to the extent that they disclose formulations and other related aspects of nucleic acid administration and delivery). Methods used to form the particles are also disclosed in U.S. Pat. Nos. 5,844,107, 5,877,302, 6,008,336, 6,077,835, 5,972,901, 6,200,801 and 5,972,900, which are incorporated by reference for embodiments thereof.

[0117] In certain embodiments, gene transfer may be easier to carry out under ex vivo conditions.Ex vivo gene therapy refers to isolating cells from a subject, delivering nucleic acid to the cells in vitro, and then returning the modified cells to the subject.This may involve taking a biological sample that contains cells from a subject.For example, blood can be obtained by venipuncture, and solid tissue sample can be obtained by surgical techniques, according to methods well known in the art.

[0118] Usually, but not always, the subject receiving the cells (i.e., the recipient) is also the subject from which the cells are collected or obtained, which provides the advantage that the donated cells are autologous. However, the cells can also be obtained from another subject (i.e., the donor), a culture of cells from a donor, or an established cell culture line. The cells can be obtained from the same or different species as the subject to be treated, but preferably cells of the same species and more preferably of the same immunological profile as the subject. Such cells can be obtained, for example, from a biological sample containing cells from a related relative or a matched donor, and then transfected with a nucleic acid (e.g., containing a modified retron) and administered to a subject in need of genome modification, for example, for the treatment of a disease or condition.

[0119] kit Also provided is a kit comprising the modified retron construct as described herein. In some embodiments, the kit provides a modified retron construct or a vector system comprising such a retron construct. In some embodiments, the modified retron construct included in the kit comprises a nucleic acid encoding a protein or regulatory RNA of interest, a cellular barcode, a donor polynucleotide suitable for use in gene editing by homology-directed repair (HDR) or recombination-mediated gene modification (recombineering), or a heterologous sequence capable of providing a cell with a CRISPR protospacer DNA sequence for molecular recording. The kit may also include other agents, such as transfection agents, host cells, media suitable for culturing cells, buffers, etc.

[0120] In the context of the kit, the agents may be provided in liquid or solid form in any convenient packaging (e.g., stick packs, dose packs, etc.). The agents of the kit may be in the same or separate containers. The agents may also be in the same container. In addition to the above components, the subject kits may further include (in certain embodiments) instructions for carrying out the subject methods. These instructions may be present in the subject kits in a variety of forms, one or more of which may be present in the kit. One form in which the instructions may be present is as information printed on a suitable medium or substrate, such as on the kit packaging, insert, etc., such as one or more sheets of paper on which the information is printed. Yet another form in which the instructions may be present is a computer readable medium, such as a diskette, compact disk (CD), flash drive, etc., on which the information is recorded. Yet another form in which the instructions may be present is a website address that may be used via the Internet to access the information from a remote location.

[0121] usefulness Retrons can be modified with heterologous sequences for use in various applications. For example, heterologous sequences can be added to retron constructs to provide cells with heterologous nucleic acids encoding proteins or regulatory RNAs of interest, cellular barcodes, donor polynucleotides suitable for use in gene editing by homology-directed repair (HDR) or recombination-mediated gene modification (recombineering), or CRISPR protospacer DNA sequences used for molecular recording, as discussed further below. Such heterologous sequences can be inserted, for example, into msr or msd genes so that the heterologous sequences are transcribed as part of the msDNA product by retron reverse transcriptase.

[0122] Protein or RNA production For example, the single-stranded DNA generated by the modified retron can be used to produce a desired product of interest in cells. In some embodiments, the retron is modified with a heterologous sequence that encodes a polypeptide of interest, so that the polypeptide can be produced from the retron msDNA generated in cells. The polypeptide of interest can be any kind of protein / peptide, including, without limitation, enzymes, extracellular matrix proteins, receptors, transporters, ion channels or other membrane proteins, hormones, neuropeptides, antibodies or cytoskeletal proteins; or fragments thereof or biologically active domains of interest. In some embodiments, the protein is a therapeutic protein or therapeutic antibody used to treat disease.

[0123] In other embodiments, the retron is modified with a heterologous sequence encoding an RNA of interest so as to allow the production of RNA from the retron in cells. The RNA of interest can be any type of RNA, including, without limitation, RNA interference (RNAi) nucleic acid or regulatory RNA, such as, but not limited to, microRNA (miRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), small nuclear RNA (snRNA), long non-coding RNA (lncRNA), antisense nucleic acid, etc.

[0124] Gene editing In some embodiments, the retron is modified with a heterologous sequence encoding a donor polynucleotide suitable for use in a CRISPR / Cas genome editing system. The donor polynucleotide comprises a sequence containing the intended genome edit flanked by a pair of homology arms involved in targeting the donor polynucleotide to the target locus to be edited in a cell. The donor polynucleotide typically comprises a 5' homology arm that hybridizes to the 5' genome target sequence and a 3' homology arm that hybridizes to the 3' genome target sequence. The homology arms are referred to herein as 5' and 3' (i.e., upstream and downstream) homology arms, which refer to the relative position of the homology arms to the nucleotide sequence containing the intended edit in the donor polynucleotide. The 5' and 3' homology arms hybridize to regions within the target locus of the genomic DNA to be modified, referred to herein as the "5' target sequence" and the "3' target sequence", respectively.

[0125] The homology arms must be sufficiently complementary to hybridize to the target sequence to mediate homologous recombination between the donor polynucleotide and the genomic DNA of the target locus. For example, the homology arms can include a nucleotide sequence having at least about 80-100% sequence identity with the corresponding genomic target sequence, including any percent identity within this range, such as at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity therewith, where the nucleotide sequence containing the edit contemplated herein can be integrated into the genomic DNA by HDR at the genomic target locus recognized (i.e., having sufficient complementarity for hybridization) by the 5' and 3' homology arms.

[0126] In certain embodiments, the corresponding homologous nucleotide sequences in the genome target sequence (i.e., the "5' target sequence" and the "3' target sequence") are adjacent to the specific site for cleavage and / or adjacent to the specific site for the introduction of the intended edit. The distance between the specific cleavage site and the homologous nucleotide sequence (e.g., each homology arm) can be several hundred nucleotides. In some embodiments, the distance between the homology arm and the cleavage site is 200 nucleotides or less (e.g., 0, 10, 20, 30, 50, 75, 100, 125, 150, 175 and 200 nucleotides). In most cases, the shorter the distance, the higher the gene targeting rate can be. In a preferred embodiment, the donor polynucleotide is substantially identical to the target genome sequence over its entire length, except for the sequence changes that are introduced into the portion of the genome that encompasses both the specific cleavage site and the portion of the genome target sequence that is changed.

[0127] The homology arms can be any length, such as 10 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 50 nucleotides or more, 100 nucleotides or more, 250 nucleotides or more, 300 nucleotides or more, 350 nucleotides or more, 400 nucleotides or more, 450 nucleotides or more, 500 nucleotides or more, 1000 nucleotides (1 kb) or more, 5000 nucleotides (5 kb) or more, 10000 nucleotides (10 kb) or more, etc. In some cases, the 5' and 3' homology arms are substantially equal in length to each other. However, in some cases, the 5' and 3' homology arms are not necessarily equal in length to each other. For example, one homology arm may be 30% or less shorter than the other homology arm, 20% or less shorter than the other homology arm, 10% or less shorter than the other homology arm, 5% or less shorter than the other homology arm, 2% or less shorter than the other homology arm, or only a few nucleotides shorter than the other homology arm. In other cases, the 5' and 3' homology arms may be substantially different lengths from each other, for example one may be 40% or more shorter, 50% or more shorter, sometimes 60% or more shorter, 70% or more shorter, 80% or more shorter, 90% or more shorter, or 95% or more shorter than the other homology arm.

[0128] The donor polynucleotide is used in combination with an RNA-guided nuclease that is targeted to a specific genomic sequence (i.e., the genomic target sequence to be modified) by the guide RNA. The target-specific guide RNA comprises a nucleotide sequence complementary to the genomic target sequence, thus mediating the binding of the nuclease-gRNA complex at the target site by hybridization. For example, the gRNA can be designed to comprise a sequence complementary to the sequence of the minor allele to target the nuclease-gRNA complex to the mutation site. The mutation can include an insertion, deletion, or substitution. For example, the mutation can include a single base change, gene fusion, translocation, inversion, duplication, frameshift, missense, nonsense, or other mutation associated with the phenotype or disease of interest. The targeted minor allele can be a common genetic variation or a rare genetic variation. In certain embodiments, the gRNA is designed to discriminate between single base pairs and selectively bind to the minor allele, for example, allowing the nuclease-gRNA complex to bind to a single nucleotide polymorphism (SNP). In particular, the gRNA can be designed to target a disease-associated mutation of interest for genome editing to remove the mutation from a gene. Alternatively, the gRNA can be designed to include a sequence complementary to the sequence of a major or wild-type allele, such that the nuclease-gRNA complex is targeted to that allele for genome editing to introduce a mutation, such as an insertion, deletion, or substitution, into a gene in the genomic DNA of a cell. Such genetically modified cells can be used, for example, to alter phenotypes, confer novel properties, or to generate disease models for drug screening.

[0129] In certain embodiments, the RNA-guided nuclease used for genome modification is a clustered regularly interspaced short palindromic repeats (CRISPR) system Cas nuclease. Any RNA-guided Cas nuclease that can catalyze the site-specific cleavage of DNA, allowing the integration of donor polynucleotides by HDR mechanism, can be used in genome editing, including CRISPR system type I, type II or type III Cas nuclease. Examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (Cas E), Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 and Cu1966 and homologs or modified versions thereof.

[0130] In certain embodiments, type II CRISPR system Cas9 endonuclease is used. Any species of Cas9 nuclease or its biologically active fragment, mutant analog or derivative that retains Cas9 endonuclease activity (i.e. catalyzes site-specific cleavage of DNA to generate double-strand breaks) can be used to perform genome modification as described herein. Cas9 does not have to be physically derived from an organism, and can be synthetically or recombinantly produced. Cas9 sequences of several bacterial species are known in the art and are listed in the National Center for Biotechnology Information (NCBI) database. See, for example, the following NCBI entries for Cas9: Streptococcus pyogenes (WP_002989955, WP_038434062, WP_011528583); Campylobacter jejuni (WP_022552435, YP_002344900), Campylobacter coli (WP_060786116); Campylobacter fetus (WP_059434633); Corynebacterium ulcerans (NC_015683, NC_017317); Corynebacterium diphtheriae (NC_016161, NC_016162, NC_016163, NC_016164, NC_016165, NC_016 ... diphtheria (NC_016782, NC_016786);Enterococcus faecalis (WP_033919308);Spiroplasma syrphidicola (NC_021284);Prevotella intermedia (NC_017861);Spiroplasma taiwanense (NC_021846);Streptococcus iniae (NC_021314);Belliella baltica (NC_018010);Psychroflexus torquis I (NC_018721);Streptococcus thermophilus (YP_820832), Streptococcus mutans (WP_061046374, WP_024786433); Listeria innocua (NP_472073); Listeria monocytogenes (WP_061665472); Legionella pneumophila (WP_062726656); Staphylococcus aureus (WP_001573634); Francisella tularensis (WP_032729892, WP_014548420), Enterococcus faecalis (WP_032729892, WP_014548420), faecalis (WP_033919308); Lactobacillus rhamnosus (WP_048482595, WP_032965177); and Neisseria meningitidis (WP_061704949, YP_002342100), all of which sequences (as registered as of the filing date of this application) are incorporated herein by reference in their entirety. Any of these sequences or variants thereof, including sequences having at least about 70-100% sequence identity thereto, including any percent identity within this range, such as 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, can be used for genome editing as described herein. For a discussion of sequence comparisons and genetic diversity and phylogenetic analysis of Cas9, see Fonfara et al., 2014, Nucleic Acids Res., 42(4):2577-90;See also Kapitonov et al., 2015, J. Bacteriol., vol. 198, no. 5, pp. 797-807; Shmakov et al., 2015, Mol. Cell., vol. 60, no. 3, pp. 385-397; and Chylinski et al., 2014, Nucleic Acids Res., vol. 42, no. 10, pp. 6091-6105;

[0131] CRISPR-Cas systems naturally occur in bacteria and archaea, where they play a role in RNA-mediated adaptive immunity against foreign DNA. Bacterial type II CRISPR systems use an endonuclease, Cas9, that complexes with a guide RNA (gRNA) that specifically hybridizes to a complementary genomic target sequence, where the Cas9 endonuclease catalyzes cleavage to generate a double-stranded break. Cas9 targeting typically further depends on the presence of a 5' protospacer adjacent motif (PAM) in the DNA at or near the gRNA binding site.

[0132] The genomic target site will typically include a nucleotide sequence complementary to the gRNA and may further include a protospacer adjacent motif (PAM). In certain embodiments, the target site includes 20-30 base pairs in addition to the 3 base pair PAM. Typically, the first nucleotide of the PAM can be any nucleotide, while the other two nucleotides will depend on the specific Cas9 protein selected. Exemplary PAM sequences are known to those of skill in the art and include, without limitation, NNG, NGN, NAG, and NGG, where N represents any nucleotide. In certain embodiments, the allele targeted by the gRNA includes a mutation that creates a PAM in the allele, where the PAM facilitates binding to the allele by the Cas9-gRNA complex.

[0133] In certain embodiments, the gRNA is 5-50 nucleotides long, 10-30 nucleotides long, 15-25 nucleotides long, 18-22 nucleotides long, or 19-21 nucleotides long, or any length between the recited ranges, including, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleotides long. The guide RNA can be a single guide RNA that includes the crRNA and tracrRNA sequences in a single RNA molecule, or the guide RNA can include two RNA molecules where the crRNA and tracrRNA sequences are present in separate RNA molecules.

[0134] In another embodiment, CRISPR nuclease 1 (Cpf1) from Prevotella and Francisella is used. Cpf1 is another class II CRISPR / Cas system RNA-guided nuclease that has similarity to Cas9 and can be used similarly. Unlike Cas9, Cpf1 does not require tracrRNA and only relies on crRNA in its guide RNA, which provides the advantage that Cpf1 can use shorter guide RNAs for targeting than Cas9. Cpf1 has the ability to cleave either DNA or RNA. The PAM site recognized by Cpf1 has the sequence 5'-YTN-3' (wherein "Y" is pyrimidine and "N" is any nucleobase) or 5'-TTN-3', in contrast to the G-rich PAM site recognized by Cas9. DNA cleavage by Cpf1 generates double-stranded breaks with sticky-ends that have 4- or 5-nucleotide overhangs. Discussions of Cpf1 are described, for example, in Ledford et al., 2015, Nature, Vol. 526, No. 7571, pp. 17-17; Zetsche et al., 2015, Cell, Vol. 163, No. 3, pp. 759-771; Murovec et al., 2017, Plant Biotechnol. J., Vol. 15, No. 8, pp. 917-926; Zhang et al., 2017, Frontiers in Plant Science, Vol. 8, p. 177; and Fernandes et al., 2016, Postepy Biochemi. Biochem., Vol. 62, No. 3, pp. 315-326, herein incorporated by reference.

[0135] C2c1 is another class II CRISPR / Cas system RNA-guided nuclease that can be used. Like Cas9, C2c1 relies on both crRNA and tracrRNA for guidance to the target site. For a description of C2c1, see, e.g., Shmakov et al., 2015, Mol Cell. 60:3:385-397; Zhang et al., 2017, Front Plant Sci. 8:177 (herein incorporated by reference).

[0136] In yet another embodiment, modified RNA-guided FokI nuclease can be used, which comprises a fusion of inactive Cas9 (dCas9) and FokI endonuclease (FokI-dCas9), where the dCas9 portion confers guide RNA-dependent targeting to FokI. For descriptions of engineered RNA-guided FokI nucleases, see, e.g., Havlicek et al., 2017, Mol. Ther. 25:2:342-355; Pan et al., 2016, Sci. Rep. 6:35794; Tsai et al., 2014, Nat. Biotechnol. 32:6:569-576, herein incorporated by reference.

[0137] The RNA-guided nuclease may be provided in the form of a protein; optionally, the nuclease is complexed with a gRNA or provided by a nucleic acid encoding the RNA-guided nuclease, such as RNA (e.g., messenger RNA) or DNA (expression vector). In some embodiments, the RNA-guided nuclease and the gRNA are both provided by a vector. Both may be expressed by a single vector or may be expressed separately on different vectors. The vector or vectors encoding the RNA-guided nuclease and the gRNA may be included in a vector system that includes modified retron msr, msd and ret gene sequences.

[0138] Codon usage can be optimized to improve the production of RNA-guided nuclease and / or retron reverse transcriptase in a particular cell or organism. For example, the nucleic acid encoding the RNA-guided nuclease or reverse transcriptase can be modified to substitute codons that are more frequently used in yeast cells, bacterial cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, or any other host cell of interest, when compared to the naturally occurring polynucleotide sequence. When the nucleic acid encoding the RNA-guided nuclease or reverse transcriptase is introduced into a cell, the protein can be expressed in the cell transiently, conditionally, or constitutively.

[0139] Recombineering Recombineering (recombination-mediated genetic modification) can be used to modify chromosomes and episomal replicons in cells, for example to create gene replacements, gene knockouts, deletions, insertions, inversions, or point mutations. Recombineering can also be used to modify plasmids or bacterial artificial chromosomes (BACs), for example to clone genes or insert markers or tags. The modified retrons described herein can be used in recombineering applications to provide linear single-stranded or double-stranded DNA for recombination. Homologous recombination is mediated by bacteriophage proteins, such as RecE / RecT of Rac prophage or Redαβδ of bacteriophage λ. The linear DNA must have sufficient homology at the 5' and 3' ends with the target DNA molecule present in the cell (e.g., plasmid, BAC, or chromosome) to allow recombination.

[0140] The linear double- or single-stranded DNA molecule used for recombineering (i.e., the donor polynucleotide) contains a sequence bearing the intended edit to be inserted, flanked by two homology arms that target the linear DNA molecule to a target site for homologous recombination. The recombineering homology arms are typically in the range of 13-300 nucleotides or 20-200 nucleotides in length, including any length within this range, such as 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195 or 200 nucleotides in length. In some embodiments, the homology arms are at least 15, at least 20, at least 30, at least 40, or at least 50 nucleotides long or more. Homology arms in the range of 40-50 nucleotides long generally exhibit sufficient targeting efficiency for recombination. However, longer homology arms in the range of 150-200 bases or more may further improve targeting efficiency. In some embodiments, the 5' and 3' homology arms are different lengths. For example, a linear DNA may have about 50 bases at the 5' end and about 20 bases at the 3' end that are homologous to the region to be targeted.

[0141] The bacteriophage homologous recombination proteins can be provided to the cell as proteins or by one or more vectors encoding the recombinant proteins. In some embodiments, the one or more vectors encoding the bacteriophage recombination proteins are included in a vector system that includes modified retron msr, msd and ret gene sequences.

[0142] Additionally, recombineering may include, without limitation, DY380, which contains a defective λ prophage carrying the recombination proteins exo, bet, and gam; EL250, which is derived from DY380 and contains, in addition to the recombination genes found in DY380, a tightly regulated, arabinose-inducible flpe gene (flpe mediates recombination between two identical frt sites); and EL250, which is also derived from DY380 and contains, in addition to the recombination genes found in DY380, a tightly regulated, arabinose-inducible cre gene (cre mediates recombination between two identical loxP sites). A number of bacterial strains containing prophage recombination systems are available, including: L350; derived from DY380 and designed for BAC recombineering using galK positive / negative selection; SW102; derived from EL250 and can also be used for galK positive / negative selection, but like EL250, contains an ara-inducible Flpe gene; and SW106; derived from EL350 and can also be used for galK positive / negative selection, but like EL350, contains an ara-inducible Cre gene. Recombineering can be performed by transfecting bacterial cells of such strains with an engineered retron that contains a heterologous sequence encoding a linear DNA suitable for recombineering. For a discussion of recombineering systems and protocols, see, e.g., Sharan et al., 2009, Nat Protoc. 4:2:206-223; Zhang et al., 1998, Nature Genetics 20:123-128; Muyrers et al., 1999, Nucleic Acids Res. 27:1555-1557; and Yu et al., 2000, Proc. Natl. Acad. Sci USA 97:11:5978-5983, which are incorporated herein by reference.

[0143] Molecular Recording In some embodiments, the heterologous sequence in the modified retron construct comprises a synthetic CRISPR protospacer DNA sequence that allows molecular recording. Endogenous CRISPR Casl-Cas2 systems are typically used by bacteria and archaea to track exogenous DNA sequences derived from viral infections by storing short sequences (i.e., protospacers) that confer sequence-specific resistance to invading viral nucleic acids in genome-based arrays. These arrays not only maintain spacer sequences, but also record the order in which sequences are acquired, creating a temporal record of acquisition events.

[0144] This system can be applied to record any DNA sequence in a genomic CRISPR array in the form of a "synthetic protospacer" that is introduced into cells using a modified retron. The synthetic CRISPR protospacer sequence can be incorporated into a specific genomic locus by utilizing the CRISPR system Casl-Cas2 complex using a modified retron carrying the protospacer sequence. Molecular recording can be used to track certain biological events by producing a stable genetic memory tracking code. See, for example, Shipman et al., 2016, Science, vol. 353, no. 6298, aaf1175 and WO 2018 / 191525 (incorporated herein by reference in its entirety).

[0145] In some embodiments, the CRISPR-Cas system is utilized to record specific and arbitrary DNA sequences into bacterial genomes. The DNA sequence can be produced by modified retrons in cells. For example, modified retrons can be used to produce protospacers in cells, which are inserted into CRISPR arrays in cells. Cells can be modified to contain one or more modified retrons (or vector systems encoding them) that can produce one or more synthetic protospacers in cells, where the synthetic protospacers are added to CRISPR arrays. Records of defined sequences can be generated that are recorded in multiple modalities over the course of days.

[0146] In some embodiments, the modified retron comprises an msd protospacer nucleic acid region or an msr protospacer nucleic acid region. In the case of the msr protospacer nucleic acid region, the protospacer sequence is first incorporated into the msr RNA, which is then reverse transcribed into a protospacer DNA. When two complementary protospacer DNA sequences with complementary sequences hybridize or a double-stranded structure (such as a hairpin) is formed in the single-stranded protospacer DNA (e.g., a single msDNA can form a suitable hairpin structure to provide a double-stranded DNA protospacer), a double-stranded protospacer DNA is produced.

[0147] In some embodiments, the single-stranded DNA produced in vivo from a first modified retron can hybridize with a complementary single-stranded DNA produced in vivo from the same retron or a second modified retron, or form a hairpin structure, which can then be used as a protospacer sequence and inserted into a CRISPR array as a spacer sequence. One or more modified retrons must provide sufficient levels of protospacer sequences in the cell for incorporation into the CRISPR array. Using protospacers generated in the cell expands the in vivo molecular recording system from only capturing information known to the user to capturing biological or environmental information that may previously be unknown to the user. For example, the msDNA protospacer sequence in the modified retron construct can be driven by a promoter downstream of a sensor pathway for a biological event or environmental toxin. The capture and storage of the protospacer sequence in the CRISPR array records the event. If multiple msDNA protospacers are driven by different promoters, the activity of those promoters (along with anything that may be upstream of the promoter) and also the relative order of promoter activity (based on the relative position of the spacer sequence in the CRISPR array) are recorded. At any time after the recording is made, the CRISPR array can be sequenced to determine whether a given biological or environmental event has occurred, and the order of multiple events given by the presence and relative position of the msDNA-derived spacers in the CRISPR array.

[0148] In some embodiments, the synthetic protospacer further comprises an AAG PAM sequence at its 5' end. Protospacers containing a 5'AAG PAM are acquired by CRISPR arrays with higher efficiency than those that do not contain a PAM sequence.

[0149] In some embodiments, Cas1 and Cas2 are provided by a vector that expresses Cas1 and Cas2 at sufficient levels to allow the synthetic protospacer sequences produced by the engineered retrons to be captured by the CRISPR array in cells. The use of such a vector system may allow molecular recording in cells that lack endogenous Cas proteins.

[0150] Exemplary Non-Limiting Aspects of the Disclosure Aspects, including embodiments of the subject matter described above, may be useful alone or in combination with one or more other aspects or embodiments. Without limiting the foregoing, certain non-limiting aspects of the present disclosure, numbered 1-60, are provided below. As would be apparent to one of skill in the art upon reading this disclosure, each of the individual numbered aspects may be used or combined with any of the preceding or succeeding individual numbered aspects. This is intended to provide support for all such combinations of aspects, and is not limited to the combinations of aspects explicitly provided below.

[0151] 1. A modified retron comprising: a) msr presequence; b) msr genes, which code for multicopy single-stranded RNA (msRNA); c) the msd gene, which encodes multicopy single-stranded DNA (msDNA); d) a post-msd sequence comprising a self-complementary region having sequence complementarity with the pre-msr sequence, the self-complementary region having a length at least 1-50 nucleotides longer than the wild-type self-complementary region, whereby the modified retron is capable of enhanced production of msDNA; and e) the ret gene, which encodes reverse transcriptase A modified retron comprising:

[0152] 2. A modified retron, wherein the self-complementary region has a length that is at least 5, at least 10, at least 15, at least 20, at least 25, or at least 30 nucleotides longer than the wild-type self-complementary region.

[0153] 3. The modified retron of embodiment 1 or 2, wherein the msr and msd genes are provided in trans or cis configuration. 4. The modified retron of embodiment 3, wherein the ret gene is provided in trans configuration to the msr and msd genes.

[0154] 5. The modified retron according to any one of Aspects 1 to 4, wherein the msr gene, the msd gene and the ret gene are derived from a myxobacterial retron, an Escherichia coli retron or a Vibrio cholerae retron.

[0155] 6. The modified retron of aspect 5, wherein the Escherichia coli retron is EC83 or EC86. 7. The modified retron of any of embodiments 1 to 6, further comprising a heterologous sequence of interest.

[0156] 8. The modified retron of embodiment 7, wherein the heterologous sequence is inserted into the msr gene or the msd gene. 9. The modified retron of any one of embodiments 1 to 7 or 8, wherein the heterologous nucleic acid segment is inserted 9 to 20 bases from the base of the region of complementarity.

[0157] 10. The modified retron of embodiment 7, 8 or 9, wherein the heterologous sequence is within the msd, after the msd or within the hairpin loop of the msDNA. 11. The modified retron of any of embodiments 1 to 8 or 9, wherein the heterologous nucleic acid segment is inserted at the msd or at positions 20 to 60 after the msd.

[0158] 12. The modified retron of any of aspects 7-10 or 11, wherein the heterologous sequence encodes a donor polynucleotide comprising a 5' homology arm that hybridizes to the 5' target sequence and a 3' homology arm that hybridizes to the 3' target sequence, which are adjacent to a nucleotide sequence containing the intended edit to be integrated into the target locus by homology directed repair (HDR) or recombineering.

[0159] 13. The modified retron of any of aspects 7 to 11 or 12, wherein the heterologous sequence comprises a CRISPR protospacer DNA sequence. 14. The modified retron of embodiment 13, wherein the CRISPR protospacer DNA sequence comprises a modified AAG protospacer adjacent motif (PAM).

[0160] 15. The modified retron of any one of embodiments 1 to 14, further comprising a barcode sequence. 16. The modified retron of embodiment 15, wherein the barcode sequence is located in a hairpin loop of msDNA.

[0161] 17. A vector system comprising one or more vectors containing the modified retron of any of embodiments 1 to 16. 18. The vector system of embodiment 17, wherein the msr gene and the msd gene are provided by the same vector or by different vectors.

[0162] 19. The vector system of embodiment 17 or 18, wherein the msr gene, the msd gene and the ret gene are provided by the same vector. 20. The vector system of embodiment 17, 18 or 19, wherein the vector comprises a promoter operably linked to the msr gene and the msd gene.

[0163] 21. The vector system of embodiment 20, wherein the promoter is further operably linked to a ret gene. 22. The vector system of embodiment 20 or 21, further comprising a second promoter operably linked to the ret gene.

[0164] 23. The vector system of any one of aspects 17 to 21 or 22, wherein the msr gene, the msd gene and the ret gene are provided by different vectors. 24. The vector system of any of aspects 17 to 22 or 23, wherein the one or more vectors are viral or non-viral vectors.

[0165] 25. The vector system of embodiment 24, wherein the non-viral vector is a plasmid. 26. The vector system of any of aspects 17 to 25, wherein the modified retron comprises a donor polynucleotide comprising a 5' homology arm that hybridizes to the 5' target sequence and a 3' homology arm that hybridizes to the 3' target sequence, which are adjacent to a nucleotide sequence containing the intended edit to be integrated into the target locus by homology directed repair (HDR) or recombineering.

[0166] 27. The vector system of embodiment 26, further comprising a vector encoding an RNA-guided nuclease. 28. The vector system of embodiment 27, wherein the RNA-guided nuclease is a Cas nuclease or a modified RNA-guided FokI nuclease.

[0167] 29. The method of embodiment 28, wherein the Cas nuclease is Cas9 or Cpf1. 30. The vector system of any of aspects 17 to 29, wherein the modified retron comprises a CRISPR protospacer DNA sequence.

[0168] 31. The vector system of embodiment 30, further comprising a vector encoding a Cas1 or Cas2 protein. 32. The vector system of embodiment 30 or 31, further comprising a vector comprising a CRISPR array sequence.

[0169] 33. The vector system of any of aspects 29 to 31, further comprising a vector encoding a bacteriophage homologous recombination protein. 34. The vector system of embodiment 33, wherein the vector encoding the bacteriophage homologous recombination proteins is a replication-defective lambda prophage containing the exo, bet, and gam genes.

[0170] 35. An isolated host cell comprising a modified retron according to any one of embodiments 1 to 16 or a vector system according to any one of embodiments 17 to 34. 36. The host cell of embodiment 35, which is a prokaryotic, archaeal or eukaryotic host cell.

[0171] 37. The host cell of embodiment 36, wherein the eukaryotic host cell is a mammalian host cell. 38. The host cell of embodiment 37, wherein the mammalian host cell is a human host cell. 39. The host cell of embodiment 35, wherein the host cell is an artificial cell or a genetically modified cell.

[0172] 40. A kit comprising the modified retron of any one of aspects 1 to 16, the vector system of any one of aspects 17 to 34, or the host cell of any one of aspects 35 to 39. 41. The kit of embodiment 40, further comprising instructions for genetically modifying the cells with the engineered retron.

[0173] 42. A method for genetically modifying a cell, comprising: a) transfecting a cell with a modified retron of any one of embodiments 1 to 15 or 16 (e.g., embodiment 12); b) introducing or expressing an RNA-guided nuclease and a guide RNA into the cell, where the RNA-guided nuclease forms a complex with the guide RNA, the guide RNA guides the complex to the genomic target locus, where the RNA-guided nuclease creates a double-stranded break in the genomic DNA at the genomic target locus, and where the donor polynucleotide generated by the engineered retron is integrated by homology-directed repair (HDR) into the genomic target locus recognized by its 5' and 3' homology arms to produce a genetically modified cell. The method includes:

[0174] 43. The method of embodiment 42, wherein the RNA-guided nuclease is a Cas nuclease or a modified RNA-guided FokI nuclease. 44. The method of embodiment 43, wherein the Cas nuclease is Cas9 or Cpf1.

[0175] 45. The method of any one of embodiments 42 to 44, wherein the RNA-guided nuclease is provided by a vector or recombinant polynucleotide integrated into the genome of the cell. 46. ​​The method of embodiments 42 to 45, wherein the modified retron is provided by a vector.

[0176] 47. The method of embodiment 42 to 45 or 46, wherein the donor polynucleotide is used to create a gene replacement, a gene knockout, a deletion, an insertion, an inversion or a point mutation. 48. A method for genetically modifying a cell by recombineering, the method comprising: a) transfecting a cell with a modified retron of any one of embodiments 1 to 16 (e.g., embodiment 12); and b) introducing into the cell a bacteriophage recombination protein, which mediates homologous recombination at the target locus, whereby the donor polynucleotide generated by the engineered retron is integrated into the target locus recognized by its 5' and 3' homology arms to produce a genetically modified cell. The method includes:

[0177] 49. The method of embodiment 48, wherein the donor polynucleotide is used to modify a plasmid, a bacterial artificial chromosome (BAC) or a bacterial chromosome of a bacterial cell by recombineering.

[0178] 50. The method of embodiment 48 or 49, wherein the donor polynucleotide is used to create a gene replacement, gene knockout, deletion, insertion, inversion or point mutation. 51. The method of any of aspects 48-50, wherein introducing a bacteriophage recombinant protein into the cell comprises insertion of a replication-defective λ prophage into the bacterial genome.

[0179] 52. The method of embodiment 51, wherein the bacteriophage comprises exo, bet and gam genes. 53. A method for barcoding a cell, comprising transfecting the cell with a modified retron of embodiment 1 to 15 or 16 (e.g. embodiment 15 or 16).

[0180] 54. A method for making an in vivo molecular recording system, comprising: a) introducing the Casl or Cas2 protein of the CRISPR adaptation system into a host cell; b) introducing a CRISPR array nucleic acid sequence comprising a leader sequence and at least one repeat sequence into a host cell, wherein the CRISPR array nucleic acid sequence is integrated into genomic DNA or a vector in the host cell; and c) introducing into a host cell a plurality of modified retrons according to embodiments 1 to 16 (e.g., embodiment 13 or 14), each retron comprising a different protospacer DNA sequence that can be processed and inserted into a CRISPR array nucleic acid sequence. The method includes:

[0181] 55. The method of embodiment 54, wherein the Casl or Cas2 protein is provided by a vector. 56. The method of embodiment 54 or 55, wherein the modified retron is provided by a vector.

[0182] 57. The method of any of embodiments 54 to 56, wherein the multiple modified retrons comprise at least three different protospacer DNA sequences. 58. A modified cell comprising an in vivo molecular recording system, a) the Casl or Cas2 protein of the CRISPR adaptation system; b) a CRISPR array nucleic acid sequence comprising a leader sequence and at least one repeat sequence to a host cell, the CRISPR array nucleic acid sequence being integrated into genomic DNA or a vector in the modified cell; and c) A plurality of modified retrons according to embodiments 1 to 16 (or embodiments 13 or 14), each retron comprising a different protospacer DNA sequence that can be processed and inserted into a CRISPR array nucleic acid sequence. A modified cell comprising:

[0183] 59. The modified cell of embodiment 58, wherein the Casl protein or the Cas2 protein is provided by a vector. 60. The modified cell of embodiment 58 or 59, wherein the modified retron is provided by a vector.

[0184] 61. The modified cell of any of aspects 58-60, wherein the plurality of modified retrons comprises at least three different protospacer DNA sequences. 62. A kit comprising the modified cell of any of aspects 58-61 and instructions for in vivo molecular recording.

[0185] 63. A method for producing recombinant msDNA, comprising: a) transfecting a host cell with a modified retron according to any one of embodiments 1 to 16 or a vector system according to any one of embodiments 17 to 34; and b) culturing the host cell under suitable conditions, whereby msDNA is produced; The method includes: EXAMPLES

[0186] The following examples are presented to disclose and illustrate to one of ordinary skill in the art how to make and use the disclosed subject matter, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent that the following experiments are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.), but some experimental error and deviation must be accounted for. Unless otherwise indicated, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric pressure. Standard abbreviations may be used, such as bp, base pairs; kb, kilobases; pl, picoliters; s or sec, seconds; min, minutes; h or hr, hours; aa, amino acids; kb, kilobases; bp, base pairs; nt, nucleotides; im, intramuscular; ip, intraperitoneal; sc, subcutaneous, etc.

[0187] Example 1: Materials and Methods In this example, some of the materials and methods used in the development of the present invention are illustrated. Bacterial strains, plasmids and culture conditions Experiments were performed in BL21-AI E. coli (Thermo Fisher), which contains an integrated arabinose-inducible T7 polymerase, an endogenous CRISPR array, an endogenous retron, but no endogenous Cas1+2, or bMS.346, a mutant strain of MG1655 that contains an integrated arabinose-inducible T7 polymerase and no endogenous retron.

[0188] In the retron-based experiments shown in Figures 3B, 3C, 4D, 7B, 7C-2, 8B, 9B, and 10B-D, reverse transcriptase was expressed from a plasmid under an erythromycin-inducible promoter (mphR-ec86RT) (see Rogers et al., Nucleic Acids Res. 43(15):7648-60; Sep. 3, 2015; doi:10.1093 / nar / gkv616; online publication July 7, 2015, hereby incorporated by reference in its entirety). The msd and msr elements were expressed together (DUET-T7-msr / msd) or separately (DUET-T7-msr-T7-msd) from an inducible T7 promoter.

[0189] For the retron-generating protospacer experiments described in connection with Figures 11A-11B, cells were transformed with a plasmid encoding Cas1+2 and modified ec86 msr / msd (DUET-msr / msd-Cas1+2) prior to each experiment, both expressed by an inducible (T7 / lac) promoter. Cells containing the plasmid were maintained in colonies on plates at 4°C for up to 3 weeks. Cells were grown in LB medium at 34°C and induced with IPTG, L-arabinose and / or erythromycin for the indicated periods.

[0190] Electrophoretic analysis of msd To visualize the msds produced from the modified retrons, bacteria were grown for 4–16 h in LB containing all inducers necessary to express the msr-containing, msd-containing and reverse transcriptase-containing transcripts. Cultures in volumes of 5–25 ml were pelleted at 4°C and then prepared using the Plasmid Plus Midi Kit (Qiagen®) or Mini Kit. RNA was then digested using a combination of RNase A and RNase T1, and the resulting msds were purified using the ssDNA / RNA Clean&Concentrator kit (Zymo Research). The msds were visualized by running on Novex® TBE-Urea gels (Thermo Fisher) and post-staining with SYBR® Gold (Thermo Fisher).

[0191] Mutant library construction Retron ncRNA variant libraries were synthesized as oligo pools with multiple libraries per synthesis run by Agilent or Twist. Single libraries were amplified from these oligo pools and cloned into expression vectors using Golden Gate technology, using NEB5a cells as the cloning strain. These cloned libraries were purified from the cloning strain and transferred into expression strains (BL21-AI or bMS.346). All libraries were quantified by Illumina sequencing.

[0192] Sequencing and Analysis To analyze RT-DNA abundance in library experiments, after expression in cells containing libraries of retron mutants, reverse transcribed DNA was purified as described above. Cultures of 5-25 ml volumes were pelleted at 4°C and then prepared using the Plasmid Plus Midi Kit (Qiagen®) or Mini Kit. RNA was then digested using a combination of RNase A and RNase T1, and the resulting msd was purified using the ssDNA / RNA Clean&Concentrator kit (Zymo Research). For mutant libraries in which the modifications were outside the reverse transcription element (e.g., Figure 7C-2), the barcoded region in the loop of reverse transcribed DNA was amplified after expression and prepared for Illumina sequencing. For mutant libraries where the modification was inside the reverse transcription element (e.g., Figure 8B), the purified pool of reverse transcribed DNA was extended at the 3' end by a single nucleotide using terminal deoxynucleotidyl transferase (TdT), with the length of the added nucleotide controlled by the time of TdT incubation (Figure 6B). The second strand was then created using Klenow fragment (3'→5' exo-) using a reverse primer consisting of an adapter sequence, a stretch of nucleotides complementary to the nucleotides used for extension, and an anchoring nucleotide (of any base not complementary to the nucleotides used for extension), leaving an A overhang at the 5' end. This overhanging A was used for TA ligation to attach a double-stranded adapter with an amino modification at the opposite 5' end (Figure 6A). This pool of double-adapted nucleotides was then indexed and prepared for Illumina sequencing. In all mutant libraries, the pool of plasmids present in the cells was quantified by amplifying the variable regions and subjecting them to Illumina sequencing.The relative abundance of the various reverse-transcribed DNAs was then calculated by comparing the proportions of mutants in the reverse-transcribed DNA with the proportions of mutant plasmids normalized with the coexpressed wild-type retron.

[0193] To analyze spacer acquisition, bacteria were lysed by heating to 95°C for 5 min and then subjected to PCR of their genomic arrays using primers flanking the leader-repeat junctions and further containing Illumina-compatible adapters. Spacer sequences were bioinformatically extracted based on the presence of flanking repeat sequences and compared to existing spacer sequences to determine the percentage of the array that was extended as well as the location and sequence of the newly acquired spacers. New spacers were blasted (NCBI) against genome and plasmid sequences and further compared to the intended protospacer sequences to determine the origin of the protospacer. This analysis was performed using custom written scripts in Python.

[0194] Example 2: Bacterial retroelements (retrons) for enhanced DNA production in cells To rewrite the genome of living cells, new DNA is required. Currently, researchers synthesize this DNA exogenously and deliver it to cells, where it serves as a template for genome modification or as a barcode to mark cells or cellular events. However, it remains a great challenge to deliver exogenous DNA in sufficient abundance to overcome inefficiencies in the processes of homology-directed repair (HDR) and integration, especially in complex tissues. Furthermore, there is no means to gate delivery by cell type or cell state, allowing targeting of subpopulations of cells carrying specific DNA sequences.

[0195] The ability to generate large amounts of designed DNA sequences on demand inside cells of one's choice - as we do with RNA and proteins - would overcome the inefficiencies of HDR and unlock the ability to deliver different templates to different cells. Using these locally produced DNA templates, it would be possible to shift from editing genomes to writing them. DNA on demand would fuel a number of DNA-modifying proteins, including λ Redβ, which recodes bacterial genomes, Cas9, which writes therapeutic modifications into the human genome, and CRISPR integrase Cas1+2, which creates molecular devices that log the timing of molecular events in living cells.

[0196] As described herein, reverse transcriptase is a solution for producing abundant amounts of DNA, including various DNAs with various sequences.Not only can reverse transcriptase generate abundant DNA, but its activity can be controlled temporally and spatially in the same way that RNA and protein expression is currently controlled.Therefore, reverse transcriptase can be delivered widely to generate abundant template DNA in some targeted cell populations.

[0197] A particularly attractive class of reverse transcriptases is derived from bacteria and is called retrons (Inouye and Inouye, Annual review of microbiology 45:163-186, 1991) (see, e.g., Figure 1A). Retrons have been shown to be compact, modular, and orthogonal to eukaryotic cells, producing DNA accessible to other proteins, and to serve as template DNA for genome editing in both prokaryotic (Farzadfard and Lu, Science 346:1256-272, 2014) and eukaryotic (Sharon et al., Cell 175:544-557, 2018) cells (Figure 1B, 1C). However, much remains unknown about the biology of retrons, and this gap in knowledge impedes their use for the generation of perfectly designed DNA sequences inside cells.

[0198] Here, we directly address the limitations of retrons by further characterizing and modifying them to produce large amounts of any CRISPR-compatible DNA sequence in cells. Although the majority of modifications were performed in E. coli to achieve high throughput, the modified retrons and systems described herein can be used in eukaryotic cells (including humans) to provide improvements in the context of genome writing.

[0199] For example, in one case, retron-Eco1 was used as an exemplary retron. As shown in Figure 2A, this transcript is recognized by reverse transcriptase and partially reverse transcribed into RT-DNA. The sequence of the reverse transcribed retron-Eco1 DNA (RT-DNA) is shown below as SEQ ID NO: 14.

[0200] [ka]

[0201] Example 3: Screening of engineered retron mutants The present inventors expressed retron-Eco1 (also called ec86 or retron-Eco1 ncRNA) in Escherichia coli (E. coli). The sequence of this wild-type retron-Eco1 ncRNA is shown below as SEQ ID NO: 15.

[0202] [ka]

[0203] Quantitative PCR (qPCR) showed that expression of retron-Eco1 in E. coli generated approximately 800-1,000 copies of ssDNA per cell (Figure 3B). As illustrated in Figure 3C, the ssDNA thus produced can be visualized, quantified, and purified on a denaturing gel.

[0204] We also made constructs encoding various retron elements. For example, we separated the reverse transcriptase from the msr / msd (primer-template) so that msr and msd could be provided to the reverse transcriptase in trans (rather than the typical cis configuration) (Figure 4A, Figure 4B). This trans configuration eliminates potential termination signals for the reverse transcriptase. The sequence of the retron-Eco1 msr-only region is shown below as SEQ ID NO: 16.

[0205] [ka]

[0206] The sequence of the retron-Eco1 msd-only region is shown below as SEQ ID NO:17.

[0207] [ka]

[0208] Using low-throughput experiments, reverse transcriptase-tolerant modifications were made to the msd element. For example, two mutants, retron-Eco1 v32 ncRNA and retron-Eco1 v35 ncRNA, were produced. The sequence of retron-Eco1 v32 ncRNA is shown below as SEQ ID NO: 18.

[0209] [ka]

[0210] The sequence of retron-Eco1 v35 ncRNA is shown below as sequence number 19.

[0211] [ka]

[0212] The key portions of retron-Eco1 v32 ncRNA and retron-Eco1 v35 ncRNA are shown in Figure 3D. Many modifications were made to the retron-Eco1 ncRNA. However, not all of the modifications attempted were successful. In some cases, most of the modified versions did not produce ssDNA in cells.

[0213] To better understand the determinants of msd production from retrons, we took a library-based approach. We synthesized tens of thousands of retron mutants and systematically tested each structural parameter of the retron (Figure 5). We cloned these mutants using a Golden Gate-based cloning strategy (Engler et al., PLOS One (November 5, 2008) and then expressed a large pool of modified retrons together with reverse transcriptase in a multiplex experiment. By purifying all msds produced by these cells, sequencing them, and comparing their abundance in the expression strain with its original retron / plasmid, we quantified the influence of specific parameters of the retron as it relates to ssDNA production. The ec86 retron was used, as well as other retrons, including the ec83 retron with an internal branched structure.

[0214] Retron reverse transcriptase typically primes in a nonstandard manner to create a branched RNA-DNA hybrid in which msr RNA is linked at the 2' position to the 5' end of msd ssDNA by a phosphodiester bond (Inouye and Inouye, Annual review of microbiology 45:163-186, 1991). E. coli does not possess the enzyme to cleave this bond. Thus, the ec86 retron remains branched when in E. coli. However, ec83 has also been reported to be processed through an unknown mechanism specific to retrons, removing the 2'-5' linkage and releasing the ssDNA (Lim, Molecular microbiology 6:3531-3542, 1992). Such separation can be beneficial for a variety of applications in genome engineering.

[0215] Example 4: Sequencing of engineered retron mutants The purified ssDNA pool contains unknowns (e.g., different ends) by design, which introduces a great deal of complexity into sequencing retron-derived ssDNA as an experimental readout. These ssDNA cannot be prepared for multiplex sequencing using conventional pipelines. To address this challenge, we developed a custom sequencing pipeline that involves purifying ssDNA, treating ssDNA with RNAase, and debranching retron-derived ssDNA. The purified and debranched retron ssDNA was then tailed with a single polynucleotide sequence using template-independent polymerase (TdT). A reverse anchored primer containing an adapter was then used to generate the complementary strand of the ssDNA (Figure 6A, Figure 6B). A second adapter was ligated to this double-stranded DNA, and the adapter-linked double-stranded DNA was then indexed and subjected to multiplex sequencing.

[0216] The pipeline was validated using synthetic oligonucleotides, wild-type and modified ec86 and wild-type ec83, and the method reliably determined the correct sequence of the synthetic oligonucleotides.

[0217] Interestingly, using this multiplexed single molecule method, ssDNA derived from the ec86 retron typically terminates one base earlier than reported in the literature using older bulk methodologies (e.g., Maxam-Gilbert sequencing). Cleavage of ec83 and the expected endogenous exonuclease processing were also confirmed (Figure 6C-F). Because the retron-derived ssDNA is sequenced, modifications in the msd (template) portion of the retron can be read directly.

[0218] We also aim to understand the parameters of non-reverse transcribed ncRNAs. To read out these parameters, we linked mutants of the non-reverse transcribed region to a barcode inserted into the loop region of msd (Figure 7A). This approach revealed the effect of sequence mutations, for example, on ssDNA production, without directly sequencing the mutants.

[0219] Example 5: Modifications that increase DNA production in cells This example shows that separating the msr and msd transcripts can allow the production of longer RT-DNA and that modifying the length of the self-complementary non-coding RNA region of a retron can increase the abundance of reverse-transcribed DNA generated by the retron.

[0220] As described in Example 3, expression of a transconstruct encoding the retron-Eco1 msr and msd elements eliminated potential termination signals for reverse transcriptase, allowing the production of longer ssDNA (Figures 4C, 4D).

[0221] An example of an extended transretron-Eco1 msd sequence is called retron-Eco1 msd +50 and is shown below as SEQ ID NO:20.

[0222] [ka]

[0223] As shown in Figure 7, extending the self-complementary regions at the 5' and 3' ends of the retron-Eco1 ncRNA leads to a significant increase in the abundance of RT-DNA produced by the retron in cells. An example of an extended retron-Eco1 ncRNA is shown below as SEQ ID NO: 21.

[0224] [ka]

[0225] Below is an example of an extended retron-Eco1 v35 ncRNA with a slightly different sequence (SEQ ID NO: 22).

[0226] [ka]

[0227] As illustrated in Figures 7B-C, extending the self-complementary regions at the 5' and 3' ends of the retron-Eco1 ncRNA leads to a large increase in the abundance of RT-DNA produced in cells by retrons. For example, increasing the length of the msd sequence self-complementary region can result in a 10-fold increase in the relative amount of ssDNA.

[0228] Conversely, when the ncRNA self-complementary base was reduced, the production of RT-DNA was greatly reduced. For example, the sequence of one of the retron-Eco1 ncRNAs with a short self-complementary sequence is shown below as SEQ ID NO: 23.

[0229] [ka]

[0230] As shown in Figure 7C, decreasing the number of these complementary bases greatly reduced the production of RT-DNA. Therefore, extending the pre-msr / post-msd self-complementary region can increase the pool of ssDNA. A larger pool of reverse transcribed ssDNA can be available for gene modification, which can increase genome editing efficiency in bacteria (recombineering), yeast (CRISPEY) and mammalian cells. For the purpose of producing large amounts of DNA in living cells, these mutants with extended self-complementary regions are preferred.

[0231] Example 6: The msd stem region tolerates some, but not all, modifications The msd stem region of the retron-Eco1 ncRNA region was modified to disrupt the stem secondary structure (double-stranded bonds). This example shows where modifications can be made to the msd stem without adversely affecting the abundance of reverse-transcribed ssDNA produced by the retron.

[0232] In Figures 8A-B and 9A-B the modification positions along the msd stem are indicated. The length of the msd stem structure can be modified to create shorter RT-DNA sequences. For example, one sequence for a short stem retron-Eco1 ncDNA (retron-Eco1 stem short OK, see FIG. 8B) that still provides wild-type levels of ssDNA is shown below as SEQ ID NO: 24.

[0233] [ka]

[0234] However, when the msd stem length is reduced below 14 bases, the abundance of RT-DNA produced is adversely affected (Figure 8B). An example of a too short stem sequence retron-Eco1 ncDNA is shown below as SEQ ID NO: 25 (Figure 8B, stem too short).

[0235] [ka]

[0236] In contrast, when the stem region of a retron is disrupted and then repaired, the amount of ssDNA produced is the same as or slightly higher than that of the wild type. By "disrupted" we mean that the base pairing of the stem is impaired, for example, by the introduction of a non-complementary nucleotide. As shown by FIG. 9B, when the base end of the ncRNA stem is disrupted by a series of five base changes, the abundance of RT-DNA is dramatically reduced. The sequence of such a retron-Eco1 ncRNA with five mismatched bases (disrupted stem, FIG. 9B) is shown below as SEQ ID NO: 26.

[0237] [ka]

[0238] However, if these bases are compensated for by complementary changes on the other side of the stem such that the stem secondary structure is maintained, the RT-DNA abundance is maintained (e.g., fixed stem, see FIG. 9B). The sequence of the "fixed stem" retron-Eco1 ncRNA shown in FIG. 9B is shown below as SEQ ID NO: 27.

[0239] [ka]

[0240] Modifications to the stem in the region of 9 to 20 bases from the base end of the stem are tolerated even if they disrupt the stem structure (see FIG. 9B, tolerable broken stem). Such a tolerable broken stem has a modification (mismatch) in the center of the stem. An example of the sequence of retron-Eco1 ncRNA having the tolerable broken stem of FIG. 9B is shown below as SEQ ID NO: 28.

[0241] [ka]

[0242] Therefore, for the purpose of producing DNA in living cells, the sequence of the ncRNA can be modified as long as the proximal end of the stem structure is maintained. Modifications to the middle of the msd stem, approximately 9-20 bases from the proximal end of the stem, are tolerated and do not adversely affect reverse transcription of ssDNA.

[0243] Example 7: The center of the ncRNA msd stem region is more tolerant of modifications Small modifications were made at various positions within the region of the retron-Eco1 ncRNA region (msd) that is reverse transcribed, and the effect of these modifications was measured on the amount of ssDNA reverse transcribed from the different ncRNA variants.

[0244] The tolerance to small modifications throughout the reverse transcribed region of ncRNA is variable, as illustrated in FIG. 10. FIG. 10B shows the effect of deleting 3 bases from various positions along the msd complementary (stem) region. As illustrated, deletion of 3 bases from the middle of the msd stem had no deleterious effect and still led to high levels of ssDNA production (FIG. 10B). However, when 3 base deletions were made near the base of the complementary (stem) region or in the region adjacent to the stem, lower levels of ssDNA production were observed (FIG. 10B). Similar effects were observed for 3 base insertions (FIG. 10C) and single base changes (FIG. 10D) in the middle and adjacent parts of the msd region. The middle of the msd stem region tolerated insertions and / or deletions of several nucleotides (e.g., less than 5 nucleotides) and no large reduction in ssDNA production was observed, whereas such modifications to the adjacent sequence at the base of the msd stem were not tolerated. Modifications of the proximal and adjacent regions of the msd stem led to reduced reverse transcription of ssDNA.

[0245] Figure 10E graphically illustrates the modification fitness scores for positions within the msd stem region calculated based on the data in Figures 10B-10D. For the purpose of producing higher levels of DNA in living cells, the sequence of the ncRNA should be modified in regions with high modification fitness scores and modifications in regions with low modification fitness scores should be avoided.

[0246] Example 8: Application of modified retrons By producing DNA on demand in cells with engineered retrons, a shift from genome editing to genome writing in living cells is possible. This shift allows cells to be modified for therapy without being limited by previously existing sequences. Currently, new DNA HDR templates are always delivered as a bolus, but the bolus decays over time. The inefficiency of this bolus delivery means that it cannot be written in situ, but instead must be written in vitro, followed by selection and expansion. Only a few therapeutics, not all experiments, are compatible with this strategy.

[0247] To fully realize the potential of CRISPR-based therapeutics, we provide a DNA sequence designed to rewrite the genome exactly when and where it is needed. This designed sequence can be provided as shown in Figure 11A. The efficiency of modification can be increased by extending the self-complementary regions at the 5' and 3' ends of the ncRNA, which can recruit retron reverse transcriptase and then produce the desired ssDNA in large quantities.

[0248] The on-demand production of DNA also enables novel genome modification applications that are not directly aimed at therapeutics, but rather at understanding the biology of disease. This is the field of molecular recording, where modifications to the genome of cells are used to write data in biological systems. For a description of this technique, which uses CRISPR integrase Cas1+2 to capture short DNA sequences on CRISPR arrays, logging their order over time to store a record of events, see, e.g., Shipman et al., 2017, Nature 547:7663:345-349 and Shipman et al., 2016, Science 353:6298:aaf1175 (incorporated herein by reference in their entirety). This technique can be used as the final step in a cellular data collection device. However, this requires a prior step of generating DNA barcodes in cells, driven by biological events such as transcription. Retron-derived DNA makes these types of techniques possible, allowing us to gain a level of understanding of complex biological processes never before achieved.

[0249] Finally, the practical application of retrons will expand the repertoire of molecular biotechnologies aimed at genome modification: retrons can be designed with modular building blocks to produce any DNA sequence on demand in living cells, and are expected to have broad deployment for scientists interested in gene therapy, cell control, and cell modification.

[0250] References 1 Inouye, M. and Inouye, S., "msDNA and bacterial reverse transcriptase," Annual review of microbiology, Vol. 45, pp. 163-186, doi:10.1146 / annurev.mi.45.100191.001115, 1991.

[0251] 2 Farzadfard, F. and Lu, TK, Synthetic biology, "Genomically encoded analog memory with precise in vivo DNA writing in living cell populations", Science, 346, 1256272, doi:10.1126 / science.1256272, 2014.

[0252] 3 Sharon, E. et al., "Functional Genetic Variants Revealed by Massively Parallel Precise Genome Editing," Cell, 175, pp. 544-557, e516, doi:10.1016 / j.cell.2018.08.057, 2018.

[0253] 4 Dhundale, AR, Furuichi, T., Inouye, S. and Inouye, M., "Distribution of multicopy single-stranded DNA among myxobacteria and related species", Journal of bacteriology, Vol. 164, pp. 914-917, 1985.

[0254] 5 Lampson, BC et al., "Reverse transcriptase in a clinical strain of Escherichia coli: production of branched RNA-linked msDNA," Science, vol. 243, pp. 1033-1038, 1989.

[0255] 6 Inouye, K., Tanimoto, S., Kamimoto, M., Shimamoto, T. and Shimamoto, T., "Two novel retron elements are replaced with retron-Vc95 in Vibrio cholerae," Microbiology and Immunology, vol. 55, pp. 510-513, doi:10.1111 / j.1348-0421.2011.00342.x, 2011.

[0256] 7 Lim, D., Structure and biosynthesis of unbranched multicopy single-stranded DNA by reverse transcriptase in a clinical Escherichia coli isolate, Vol. 6, pp. 3531-3542, 1992.

[0257] 8 Shipman, SL, Nivala, J., Macklis, J.D. and Church, G., "CRISPR-Cas encoding of a digital movie into the genomes of a population of living bacteria", Nature, doi:10.1038 / nature23017, 2017.

[0258] 9 Shipman, SL, Nivala, J., Macklis, JD, and Church, GM, "Molecular recordings by directed CRISPR spacer acquisition", Science, doi:10.1126 / science.aaf1175, 2016.

[0259] Although the present disclosure has been described in connection with its specific embodiments, it should be understood by those skilled in the art that various modifications may be made and equivalents may be substituted without departing from the true spirit and scope of the present disclosure. In addition, many modifications may be made to adapt a particular situation, material, composition, method, method step or steps to the objective, spirit and scope of the present disclosure. All such modifications are intended to be within the scope of the appended claims.

[0260] The technical ideas that can be understood from the above-described embodiment will be described below as supplementary notes. [Appendix 1] A modified retron comprising: a) msr presequence; b) msr genes, which code for multicopy single-stranded RNA (msRNA); c) the msd gene, which encodes multicopy single-stranded DNA (msDNA); d) a post-msd sequence comprising a self-complementary region having sequence complementarity with the pre-msr sequence, the self-complementary region having a length of 1-12 nucleotides longer than the wild-type complementary region, whereby the modified retron is capable of enhanced production of the msDNA; and e) the ret gene, which encodes reverse transcriptase A modified retron comprising:

[0261] [Appendix 2] The modified retron of appendix 1, further comprising a heterologous sequence of interest. [Appendix 3] 3. The modified retron of claim 2, wherein the heterologous sequence is inserted into the msr gene or the msd gene.

[0262] [Appendix 4] The modified retron of claim 1, wherein the single-stranded DNA (msDNA) encoded by the msd gene comprises an msd stem loop, the loop comprising a heterologous sequence of interest.

[0263] [Appendix 5] The modified retron of Appendix 2, wherein the heterologous sequence encodes a donor polynucleotide comprising a 5' homology arm that hybridizes to the 5' target sequence and a 3' homology arm that hybridizes to the 3' target sequence, adjacent to a nucleotide sequence containing the intended edit to be integrated into the target locus by homology directed repair (HDR) or recombineering.

[0264] [Appendix 6] The modified retron of claim 2, wherein the heterologous sequence comprises a CRISPR protospacer DNA sequence.

[0265] [Appendix 7] The modified retron of claim 6, wherein the CRISPR protospacer DNA sequence comprises a modified AAG protospacer adjacent motif (PAM).

[0266] [Appendix 8] The modified retron of claim 1, further comprising a barcode sequence. [Appendix 9] The modified retron of claim 8, wherein the barcode sequence is located in a hairpin loop of the msDNA.

[0267] [Appendix 10] The modified retron of claim 4, wherein the msd stem is at least 14 nucleotides (base pairs) in length.

[0268] [Appendix 11] The modified retron of Appendix 4, wherein the msd stem may contain one or more mismatched nucleotides.

[0269] [Appendix 12] The modified retron of claim 4, wherein the msd stem has less than 5 or 6 consecutive mismatched nucleotides.

[0270] [Appendix 13] The modified retron of Appendix 4, wherein the msd stem does not have any mismatches or insertions in the sequence adjacent to the proximal end of the msd stem.

[0271] [Appendix 14] The modified retron of appendix 4, wherein any msd stem mismatches or sequence changes relative to the wild-type msd sequence are within the center of the msd stem.

[0272] [Appendix 15] The modified retron of appendix 1, wherein the msr gene and the msd gene are provided in trans or cis configuration.

[0273] [Appendix 16] 2. The modified retron of claim 1, wherein the ret gene is provided in trans to the msr and msd genes.

[0274] [Appendix 17] The modified retron of claim 1, wherein the msr, msd and ret genes are modified bacterial retrons msr, msd and ret genes.

[0275] [Appendix 18] The modified retron of claim 1, wherein the msr gene, the msd gene and the ret gene are independently a modified myxobacterial retron, a modified Escherichia coli retron, a modified Salmonella enterica retron or a modified Vibrio cholerae retron.

[0276] [Appendix 19] The modified retron of claim 18, wherein the modified Escherichia coli retron is a modified EC83 or a modified EC86.

[0277] [Appendix 20] A vector system comprising one or more vectors containing the modified retron described in appendix 1. [Appendix 21] 21. The vector system of claim 20, wherein the msr gene and the msd gene are provided by the same vector or different vectors.

[0278] [Appendix 22] 21. The vector system of claim 20, wherein the msr gene, the msd gene and the ret gene are provided by the same vector.

[0279] [Appendix 23] 23. The vector system of claim 22, wherein the same vector comprises a promoter operably linked to the msr gene and the msd gene.

[0280] [Appendix 24] 24. The vector system of claim 23, wherein the promoter is further operably linked to the ret gene.

[0281] [Appendix 25] 24. The vector system of claim 23, further comprising a second promoter operably linked to the ret gene.

[0282] [Appendix 26] 21. The vector system of claim 20, wherein the msr gene, the msd gene and the ret gene are provided by different vectors.

[0283] [Appendix 27] 21. The vector system of claim 20, wherein the one or more vectors are viral or non-viral vectors.

[0284] [Appendix 28] 28. The vector system of claim 27, wherein the non-viral vector is a plasmid. [Appendix 29] The vector system of claim 20, wherein the modified retron comprises a donor polynucleotide comprising a 5' homology arm that hybridizes to a 5' target sequence and a 3' homology arm that hybridizes to a 3' target sequence, adjacent to a nucleotide sequence containing the intended edit to be integrated into the target locus by homology directed repair (HDR) or recombineering.

[0285] [Appendix 30] 30. The vector system of claim 29, further comprising a vector encoding an RNA-guided nuclease.

[0286] [Appendix 31] 31. The vector system of claim 30, wherein the RNA-guided nuclease is a Cas nuclease or a modified RNA-guided FokI nuclease.

[0287] [Appendix 32] 32. The vector system of claim 31, wherein the Cas nuclease is Cas9 or Cpf1.

[0288] [Appendix 33] 21. The vector system of claim 20, wherein the modified retron comprises a CRISPR protospacer DNA sequence.

[0289] [Appendix 34] 34. The vector system of claim 33, further comprising a vector encoding Cas1 and / or Cas2 proteins.

[0290] [Appendix 35] 35. The vector system of claim 34, further comprising a vector comprising a CRISPR array sequence.

[0291] [Appendix 36] 21. The vector system of claim 20, further comprising a vector encoding a bacteriophage homologous recombination protein.

[0292] [Appendix 37] 37. The vector system of claim 36, wherein the vector encoding the bacteriophage homologous recombination protein is a replication-defective λ prophage containing exo, bet and gam genes.

[0293] [Appendix 38] 21. An isolated host cell comprising a modified retron according to claim 1 or a vector system according to claim 20.

[0294] [Appendix 39] 39. The host cell of claim 38, wherein the host cell is a prokaryotic, archaeal or eukaryotic host cell. [Appendix 40] 40. The host cell of claim 39, wherein the eukaryotic host cell is a mammalian host cell.

[0295] [Appendix 41] 41. The host cell of claim 40, wherein the mammalian host cell is a human host cell. [Appendix 42] 39. The host cell of claim 38, wherein the host cell is an artificial cell or a genetically modified cell.

[0296] [Appendix 43] A kit comprising a modified retron according to claim 1, a vector system according to claim 20, or a host cell according to claim 38.

[0297] [Appendix 44] 44. The kit of claim 43, further comprising instructions for genetically modifying a cell with the engineered retron.

[0298] [Appendix 45] 1. A modified cell comprising an in vivo molecular recording system, a) the Casl or Cas2 protein of the CRISPR adaptation system; b) a CRISPR array nucleic acid sequence comprising a leader sequence and at least one repeat sequence into a host cell, the CRISPR array nucleic acid sequence being integrated into genomic DNA or a vector within the modified cell; and c) A plurality of modified retrons according to appendix 6, each retron comprising a different protospacer DNA sequence that can be processed and inserted into the CRISPR array nucleic acid sequence. A modified cell comprising:

[0299] [Note 46] 46. ​​The modified cell of claim 45, wherein the Casl protein or the Cas2 protein is provided by a vector.

[0300] [Appendix 47] 46. ​​The modified cell of claim 45, wherein the modified retron is provided by a vector. [Appendix 48] 46. ​​The modified cell of claim 45, wherein the plurality of modified retrons comprises at least three different protospacer DNA sequences.

[0301] [Appendix 49] A kit comprising the modified cells of claim 45 and instructions for in vivo molecular recording.

[0302] [Appendix 50] 2. The modified retron of claim 1, wherein the self-complementary region is 1 to 5 nucleotides longer than the wild-type complementary region.

Claims

1. A modified retron, the modified retron comprising: a) msr presequence; b) msr genes, which encode multicopy single-stranded RNA (msRNA); c) the msd gene, which encodes multicopy single-stranded DNA (msDNA); d) a post-msd sequence that includes a self-complementary region having sequence complementarity with the pre-msr sequence; e) the ret gene, which encodes reverse transcriptase; Including, The msr gene and the msd gene are provided in trans configuration, or the ret gene is in trans configuration relative to the msr gene or the msd gene; the msd gene or the msr gene comprises a heterologous sequence, The heterologous sequence encodes a modified retron that encodes a donor polynucleotide comprising a 5' homology arm that hybridizes to the 5' target sequence and a 3' homology arm that hybridizes to the 3' target sequence, flanking the nucleotide sequence containing the intended edit to be integrated into the target locus by homology directed repair (HDR) or recombineering.

2. The modified retron described in claim 1, wherein the ret gene is in trans with respect to the msr gene and the msd gene.

3. The modified retron described in claim 1, wherein the msr gene and the msd gene are in cis with respect to each other and in trans with respect to the ret gene.

4. The modified retron described in claim 1, wherein the encoded stop signal is removed from the ret gene.

5. A vector system comprising one or more vectors containing the modified retron described in claim 1.

6. The vector system described in claim 5, wherein the msr gene and the msd gene are provided by the same vector or different vectors.

7. The vector system described in claim 5, wherein the ret gene is provided by a vector different from the msr gene and the msd gene.

8. The vector system described in claim 6, wherein the same vector comprises a promoter operably linked to the msr gene and the msd gene.

9. The vector system described in claim 8, further comprising a second promoter operably linked to the ret gene.

10. The vector system described in claim 5, wherein the one or more vectors are viral vectors or non-viral vectors.

11. The vector system described in claim 10, wherein the non-viral vector is a plasmid.

12. The vector system of claim 5, further comprising a vector encoding an RNA-guided nuclease.

13. The vector system described in claim 12, wherein the RNA-guided nuclease is a Cas nuclease or a modified RNA-guided FokI nuclease.

14. The vector system of claim 13, wherein the Cas nuclease is Cas9 or Cpf1.

15. An isolated host cell comprising the modified retron described in claim 1 or the vector system described in claim 5.

16. The host cell described in claim 15, wherein the host cell is a prokaryotic, archaeal or eukaryotic host cell.

17. A kit comprising the modified retron described in claim 1, the vector system described in claim 5, or the host cell described in claim 16.

18. A method for genetically modifying a cell, the method comprising: a) transfecting a cell with the modified retron of claim 1; b) introducing into the cell an RNA-guided nuclease and a guide RNA, wherein the RNA-guided nuclease forms a complex with the guide RNA, the guide RNA guides the complex to a genomic target locus, the RNA-guided nuclease creates a double-stranded break in genomic DNA at the genomic target locus, and the donor polynucleotide generated by the engineered retron is integrated by homology directed repair (HDR) into the genomic target locus recognized by its 5' and 3' homology arms to produce a genetically modified cell; The method includes:

19. A method for making a recombinant msDNA, the method comprising: a) transfecting a host cell with a modified retron according to claim 1 or a vector system according to claim 5; and b) culturing said host cells under suitable conditions, wherein said msDNA is produced; The method includes:

Images