Recombinant influenza viruses with stabilized ha for replication in eggs

Abstract

To provide influenza mutations that inhibit the acquisition of antigenicity-compromising mutations in a hemagglutinin (HA) segment of influenza virus during growth in eggs.SOLUTION: Modified influenza virus neuraminidases are described herein that improve viral replication, thus improving the yield of vaccine viruses. Expression of such modified neuraminidases by influenza virus may also stabilize co-expressed hemagglutinins so that the hemagglutinins do not undergo mutation.SELECTED DRAWING: Figure 12

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of the filing dates of U.S. Application No. 62 / 577,049, filed October 25, 2017, and U.S. Application No. 62 / 633,400, filed February 21, 2018, which are incorporated herein by reference.

[0002] Declaration of government funds This invention was made with Government support under HHSO100201500033C awarded by the National Institutes of Health. The Government has certain rights in this invention. [Background technology]

[0003] Research background Influenza is a major respiratory disease in some mammals, including horses, and is responsible for significant morbidity and economic losses each year. In addition, influenza virus infection can cause severe systemic disease and death in some avian species. The segmented nature of the influenza virus genome allows for reassortment of segments during viral replication in cells infected with two or more influenza viruses. Segment reassortment, in combination with genetic mutation and genetic drift, can give rise to a myriad of diverse influenza virus lineages over time. New lineages exhibit antigenic variation in the hemagglutinin (HA) and / or neuraminidase (NA) proteins, with the gene encoding the HA protein in particular experiencing a high rate of variation. The primary current practice for the prevention of influenza is vaccination. Most commonly, inactivated virus vaccines are used. Influenza HA proteins are the primary target antigens of the host's immune defense response against the virus and are highly diverse, making the isolation of influenza viruses and the identification and characterization of HA antigens of viruses associated with recent epidemics important for the manufacture of vaccines. Based on prevalence and predictions, vaccines are designed to stimulate a protective immune response against dominant and expected influenza virus lineages.

[0004] There are four general types of influenza viruses: A, B, C, and D, which are defined by the lack of serological cross-reactivity between internal proteins. Influenza A viruses are further classified into subtypes based on antigenic and genetic differences in their glycoproteins, HA, and NA proteins. All known HA and NA subtypes (H1-H18 and N1-N11) have been isolated from waterfowl, which are thought to act as natural reservoirs for influenza.

[0005] Most influenza vaccines are produced in embryonated chicken eggs. However, WHO-recommended influenza vaccine strains often do not replicate efficiently in embryonated chicken eggs, necessitating serial passage in eggs for virus adaptation. During egg adaptation and amplification, influenza vaccine hemagglutinin (HA) proteins often acquire egg-adaptation mutations. These egg-adaptation mutations in HA often alter the antigenicity of the virus, resulting in a vaccine virus that is no longer optimal for the circulating virus strain. Summary of the Invention

[0006] As described herein, influenza viruses were passaged seven times in eggs (in triplicate) to study the mutations that occurred in six non-immunogenic viral segments during adaptation. Surprisingly, the viruses did not acquire HA mutations, but instead had mutations in the NA, PB2, NP and M1 proteins. The NA mutations were identical in all three experiments, and included a deletion and four amino acid mutations. The NA mutations were tested alone and found to be responsible for the effect of allowing efficient growth in eggs without HA mutations, for example alone or in various combinations.

[0007] Thus, the present disclosure relates to influenza mutations that prevent the acquisition of antigenic-impairing mutations in the hemagglutinin (HA) segment of influenza viruses during growth in eggs. Mutations in the neuraminidase (NA) protein of human influenza viruses have been found to "stabilize" HA during egg passage, e.g., when mutations are present in NA, the HA protein does not acquire egg-adaptive mutations. These NA mutations may also increase the yield of vaccine viruses.

[0008] The disclosure provides isolated recombinant, e.g., reassortant, influenza viruses having selected amino acid residues or deletions at specific positions in the NA. In one embodiment, the NA is selected not to encode a threonine at residue 32. In one embodiment, the NA is selected not to encode an aspartic acid at position 147. In one embodiment, the NA is selected not to encode an asparagine at position 329. In one embodiment, the NA is selected not to encode a threonine at residue 329. In one embodiment, the NA is selected not to encode a glycine at residue 346. In one embodiment, the NA is selected not to encode a histidine at residue 347. In one embodiment, the NA is selected not to encode an arginine or asparagine at residue 347. In one embodiment, the NA is selected not to encode an NA having a threonine at position 148. In one embodiment, the NA is selected not to encode an NA having an aspartic acid at position 151. In one embodiment, the NA is selected not to encode an NA having an asparagine at position 245. In one embodiment, the NA is selected not to encode an NA with a glycine at position 346. In one embodiment, the NA is selected to have one or more deletions of residues 46-50. The numbering of the NA is based on N2. In one embodiment, the disclosure provides an isolated recombinant reassortant influenza virus having a vaccine influenza virus, e.g., PR8UW, an NA viral segment with a specific residue or deletion of a specific residue at one or more specific positions, or any combination thereof, and an HA viral segment, e.g., six "internal" viral segments derived from any of H1-H18 from a circulating influenza virus. Pharmaceutical compositions, such as compositions, vaccines, etc., comprising the recombinant influenza virus are also provided.

[0009] Thus, for vaccine viruses that are grown or passaged in cells, e.g. in eggs, substitutions at residues 32, 147, 329, 347, or deletions of one or more of residues 46-50, or any combination thereof, in the NA, for example by mutation, or such that the NA does not encode a threonine at residue 32, does not encode an aspartic acid at position 147, does not encode an asparagine at position 329, does not encode a histidine at position 347, or has a deletion of one or more of residues 46-50, or any combination thereof, may result in stabilization of the HA and / or higher virus titers, where the above numbering is based on N2. In one embodiment, for vaccine viruses grown or passaged in cells, e.g., in eggs, substitution of residues at positions 148, 151, 245, 346, or any combination thereof, in the NA, e.g., by mutation, or selected NA viral segments such that the NA does not encode a threonine at residue 148, does not encode an aspartic acid at position 151, does not encode an asparagine at residue 245, does not encode a glycine at residue 346, or any combination thereof, may result in stabilization of the HA and / or higher viral titers, where the above numbering is based on N2.

[0010] In one embodiment, the disclosure provides an isolated recombinant influenza virus comprising PA, PB1, PB2, NP, NS, M and HA viral segments and an NA encoding an NA selected from: no threonine at residue 32, no aspartic acid at position 147, no asparagine at residue 329, no histidine at residue 347, or no deletion of one or more of residues 46-50, or any combination thereof, wherein said numbering is based on N2, wherein the recombinant influenza virus has enhanced replication ability in avian eggs or has reduced HA mutations when grown in avian eggs compared to a corresponding influenza virus having an NA encoding a threonine at residue 32, no deletion of residues 46-50, an aspartic acid at position 147, an asparagine at residue 329, a histidine at residue 347, or any combination thereof. In one embodiment, the disclosure provides an isolated recombinant influenza virus comprising PA, PB1, PB2, NP, NS, M and HA viral segments and a selected NA viral segment that does not encode a threonine at residue 148, does not encode an aspartic acid at position 151, does not encode an asparagine at residue 245, does not encode a glycine at residue 346, or any combination thereof, where the numbering is based on N2, and the recombinant influenza virus has enhanced replication ability in avian eggs or has reduced HA mutations when grown in avian eggs compared to a corresponding influenza virus having an NA that encodes a threonine at residue 148, encodes an aspartic acid at position 151, encodes an asparagine at residue 245, encodes a glycine at residue 346, or any combination thereof. In one embodiment, the isolated recombinant influenza virus is a reassortant. In one embodiment, the NA viral segment encodes an NA having at least 80%, 85%, 90%, 95%, or 99% amino acid sequence identity to any one of SEQ ID NOs: 1-3, 30-38, 48-50, or 54.In one embodiment, the NA viral segment encodes an NA having less than 100% amino acid sequence identity to SEQ ID NO:2 or SEQ ID NO:3. In one embodiment, the NA viral segment encodes N2, N3, N7, or N9, and the positions of N3, N7, or N9 having particular residues correspond to particular positions of N2. In one embodiment, the NA viral segment encodes N1, N4, N5, N6, N8, N10, or N11, and the positions of N1, N4, N5, N6, N8, N10, or N11 having particular residues correspond to particular positions of N2. In one embodiment, the residue at position 32 is A, I, G, or L. In one embodiment, the deletion is a deletion of residues 46-50. In one embodiment, the residue at position 147 is N or Q. In one embodiment, the residue at position 329 is D or E. In one embodiment, the residue at position 347 is Q, N, S, T, Y, C, or W. In one embodiment, HA is H1, H3, H7, or H9. In one embodiment, the virus is an influenza A virus. In one embodiment, the PA, PB1, PB2, NP, M, and NS viral segments have at least 85% nucleic acid sequence identity to SEQ ID NOs: 24-29, or encode polypeptides having at least 80%, 85%, 90%, 95%, or 99% amino acid sequence identity to a polypeptide encoded by SEQ ID NOs: 24-29 or 39-44. In one embodiment, PB2 has an I, A, L, or G at residue 147. In one embodiment, the virus is an influenza B virus. In one embodiment, the selected NA viral segment does not have an aspartic acid at position 147, does not have an asparagine at residue 329, and does not have an arginine or histidine at residue 347. In one embodiment, the selected NA viral segment has no threonine at position 148, no aspartic acid at position 151, and no asparagine at position 245. In one embodiment, the selected NA viral segment has at least two of: an N or Q at position 147, a D or E at residue 329, or a Q or G at residue 347.In one embodiment, the selected NA viral segment has at least two of: K, R or H at position 148, E or Q at position 151, or S, I, T, V or G at position 245. In one embodiment, the selected NA viral segment has N or Q at position 147, D or E at residue 329, and Q or G at residue 347. In one embodiment, the selected NA viral segment has N or Q at position 147, D or E at residue 329, and V, S, I or L at residue 346. In one embodiment, the selected NA viral segment has K, R or H at position 148, E or Q at position 151, and S, I, T, V or G at position 245.

[0011] Further provided is an isolated recombinant nucleic acid, e.g., a vector, such as a viral vector, that does not encode a threonine at residue 32, has one or more deletions of residues 46-50, does not encode an aspartic acid at position 147, does not encode an asparagine at residue 329, does not encode an asparagine at residue 347, or any combination thereof, wherein the numbering is based on N2. In one embodiment, the isolated recombinant nucleic acid does not encode a threonine at residue 148, does not encode an aspartic acid at position 151, does not encode an asparagine at residue 245, does not encode a glycine at residue 346, or any combination thereof. In one embodiment, the NA has at least 95% amino acid sequence identity to SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:48, or SEQ ID NO:49. In one embodiment, the NA has less than 100% amino acid sequence identity to SEQ ID NO:2 or SEQ ID NO:3. In one embodiment, the NA is N2, N3, N7, or N9. In one embodiment, NA is N1, N4, N5, N6, N8, N10 or N11. In one embodiment, the residue at position 32 is A, I, G, or L. In one embodiment, the deletion is a deletion of residues 46-50. In one embodiment, the residue at position 147 is N or Q. In one embodiment, the residue at position 329 is D or E. In one embodiment, the residue at position 347 is Q, N, S, T, Y, C, or W. In one embodiment, the residue at position 148 is K, R, or H. In one embodiment, the residue at position 151 is E, N, or Q. In one embodiment, the residue at position 245 is S, T, I, L, A, N, or V.

[0012] Methods of treating influenza virus are also provided, comprising contacting a cell with the following vectors in an amount effective to produce infectious influenza virus: a vector for producing vRNA comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, a vector for producing vRNA comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, a vector for producing vRNA comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, a vector for producing vRNA comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, a vector for producing vRNA comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, a vector for producing vRNA comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, a vector for producing vRNA comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and an influenza virus NS DNA linked to a transcription termination sequence. a vector for vRNA production comprising a promoter operably linked to DNA, wherein the PB1, PB2, PA, NP, NS, and M DNA in the vector for vRNA production are from one or more influenza vaccine virus isolates, and the NA DNA of the vector for vRNA production encodes an NA selected from: no threonine at residue 32, no aspartic acid at position 147, no asparagine at residue 329, no histidine at residue 347, no threonine at residue 148, no aspartic acid at position 151, no asparagine at residue 245, no glycine at residue 346, or having one or more deletions of residues 46-50, or any combination thereof, wherein the numbering of the NA residues is N2 numbering; and a vector for producing mRNA comprising a promoter operably linked to a DNA segment encoding influenza virus PA, a vector for producing mRNA comprising a promoter operably linked to a DNA segment encoding influenza virus PB1, a vector for producing mRNA comprising a promoter operably linked to a DNA segment encoding influenza virus PB2, and a vector for producing mRNA comprising a promoter operably linked to a DNA segment encoding influenza virus NP, and optionally a vector for producing mRNA comprising a promoter operably linked to a DNA segment encoding influenza virus HA, a vector for producing mRNA comprising a promoter operably linked to a DNA segment encoding influenza virus NA, a vector for producing mRNA comprising a promoter operably linked to a DNA segment encoding influenza virus M1, a vector for producing mRNA comprising a promoter operably linked to a DNA segment encoding influenza virus M2, a vector for producing mRNA comprising a promoter operably linked to a DNA segment encoding influenza virus NS1, or a vector for producing mRNA comprising a promoter operably linked to a DNA segment encoding influenza virus NS2. In one embodiment, NA has at least 80%, 85%, 90%, 95%, or 99% amino acid sequence identity to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:48, or SEQ ID NO:49. In one embodiment, NA has less than 100% amino acid sequence identity to SEQ ID NO:2 or SEQ ID NO:3. In one embodiment, NA is N2, N3, N7, or N9. In one embodiment, NA is N1, N4, N5, N6, N8, N10, or N11. In one embodiment, the residue at position 32 is A, I, G, or L. In one embodiment, the deletion is a deletion of residues 46-50. In one embodiment, the residue at position 147 is N or Q. In one embodiment, the residue at position 329 is D or E. In one embodiment, the residue at position 347 is Q, N, S, T, Y, C, or W.In one embodiment, the residue at position 148 is K, R or H. In one embodiment, the residue at position 151 is E, N or Q. In one embodiment, the residue at position 245 is S, T, I, L, A, N, or V.

[0013] In one embodiment, HA is H1, H3, H5, H7, or H9. In one embodiment, the virus is an influenza A virus. In one embodiment, the PA, PB1, PB2, NP, M, and NS viral segments have at least 85%, 85%, 90%, 95%, or 99% nucleic acid sequence identity to SEQ ID NOs: 24-29 or 39-44, or encode polypeptides having at least 80%, 85%, 90%, 95%, or 99% amino acid sequence identity to a polypeptide encoded by SEQ ID NOs: 24-29 or 39-44. In one embodiment, PB2 has an I, A, L, or G at residue 147. In one embodiment, HA is H2, H4, H5, H6, H8, or any of H10-H18. In one embodiment, the virus is an influenza B virus.

[0014] Further provided is a method of immunizing an avian or mammalian animal with a composition having an effective amount of a virus as described herein. In one embodiment, the composition comprises at least one other distinct influenza virus. In one embodiment, the mammal is a human. In one embodiment, the composition is administered intranasally or by injection.

[0015] Thus, the present invention provides a method for selecting influenza viruses with enhanced replication capacity in cell culture, e.g., in embryonated eggs. The method includes providing cells suitable for the production of influenza vaccines; serially culturing one or more influenza virus isolates in eggs; and isolating the serially cultured viruses with enhanced growth compared to the one or more isolates before serial culture. Also provided is a method for identifying NA that stabilizes HA and / or results in altered growth of recombinant influenza viruses, e.g., in eggs. The method includes introducing one or more substitutions or deletions as described herein into the NA viral segment to obtain a mutant NA viral segment; and optionally identifying whether the mutant NA viral segment enhances the replication capacity of the recombinant influenza virus in eggs when a replication-competent recombinant influenza virus is present, and optionally inhibits HA mutations compared to a corresponding replication-competent influenza virus without one or more substitutions and / or deletions in NA.

[0016] In one embodiment, the present disclosure provides an isolated influenza A virus having a hallmark residue and / or deletion, or combination thereof, in the NA described herein. In one embodiment, the isolated influenza A virus having the hallmark residue and / or deletion, or combination thereof, has an NA amino acid sequence having at least 80%, e.g., 90%, 92%, 95%, 97% or 99% (including any integer between 80 and 99) contiguous amino acid sequence identity to a polypeptide encoded by any one of SEQ ID NOs: 1, 2, 3, or 30-38. In one embodiment, the isolated influenza A virus of the present invention having the hallmark residue and / or deletion, or combination thereof, has an HA from any one of HA subtypes 1-18. In one embodiment, the hallmark residue is a conservative substitution, for example, compared to SEQ ID NO: 2 or SEQ ID NO: 3. A conservative amino acid substitution refers to the interchangeability of residues having similar side chains. For example, the group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; the group of amino acids having aliphatic hydroxyl side chains is serine and threonine; the group of amino acids having amide-containing side chains is asparagine and glutamine; the group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; the group of amino acids having basic side chains is lysine, arginine, and histidine; and the group of amino acids having sulfur-containing side chains is cysteine ​​and methionine. In one embodiment, the conservative amino acid substitution groups are as follows: threonine-valine-leucine-isoleucine-alanine; phenylalanine-tyrosine; lysine-arginine; alanine-valine; glutamic acid-aspartic acid; and asparagine-glutamine.

[0017] In one embodiment, mutations are introduced into the NA viral segment of an influenza isolate, for example, via recombinant DNA techniques including site-directed mutagenesis, or by replacing a portion of the NA coding sequence with a portion containing the characteristic residues or deletions. In one embodiment, the NA viral segment having the characteristic residues and / or deletions described herein is combined with the HA segment and an internal viral segment of an influenza vaccine virus.

[0018] The present disclosure provides multiple influenza virus vectors of the invention that are useful for preparing reassortant viruses, including, for example, 6:1:1 reassortants, 6:2 reassortants, and 7:1 reassortants. A 6:1:1 reassortant is an influenza virus having six internal viral segments from a vaccine virus as described herein, an HA viral segment from a different (second) viral isolate from the vaccine virus, and an NA viral segment with a distinctive residue and / or deletion, or a combination thereof, and the HA segment and the vaccine virus are from a different viral source; a 6:2 reassortant is an influenza virus having six internal viral segments from a vaccine virus, an HA viral segment from a different (second) viral isolate from the vaccine virus, and an NA viral segment with a distinctive residue and / or deletion, or a combination thereof, where the segments are from the same source as the HA segment and have an HA viral segment from a different viral isolate from the vaccine virus; and a 7:1 reassortant, in one embodiment, is an influenza virus having six internal viral segments and an HA segment from a vaccine virus, and an NA segment modified to include a distinctive residue and / or deletion, or a combination thereof, where the NA segment is from a different viral source from the vaccine virus.

[0019] In one embodiment of the invention, the plurality includes a vector for producing vRNA selected from a vector comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and a vector comprising a promoter operably linked to influenza virus NS DNA linked to a transcription termination sequence. In one embodiment, DNA for vRNA production of PB1, PB2, PA, NP, M, and NS has sequences derived from influenza viruses that replicate at high titers in cultured mammalian cells, such as MDCK cells, Vero cells, PER.C6® cells, or embryonated eggs, and / or vaccine viruses, e.g., from viruses that do not cause significant disease in humans. DNA for vRNA production of NA can be any NA, e.g., any of N1-N9, and DNA for vRNA production of HA can be from any HA, e.g., H1-H18. In one embodiment, DNA for vRNA production can be for influenza B or C virus. For example, DNA for vRNA production includes PA, PB1, PB2, NP, NS, and M of influenza B virus, or PA, PB1, PB2, NP, NS, M, and NA of influenza B virus, where the vRNA for NA has NA with characteristic residues and / or deletions as described herein.The DNA for NA and HA vRNA production can be from different lineages or isolates (6:1:1 reassortants) or the same lineage or isolate (6:2 reassortants), or the NA or HA can be from the same lineage or isolate as the internal genes (7:1 reassortants). The plurality also includes a vector encoding influenza virus PA, a vector encoding influenza virus PB1, a vector encoding influenza virus PB2, and a vector encoding influenza virus NP, and optionally one or more vectors encoding NP, NS, M, e.g., M1 and M2, HA, or NA, etc. The vector encoding the viral proteins can further include a transcription termination sequence.

[0020] Viruses capable of providing the internal genes of reassortants within the scope of the present invention can be cultured at high titers, e.g., at least about 10 5 PFU / mL, e.g., at least 10 6 PFU / mL, 10 7 PFU / mL or 10 8 Titer in PFU / mL; high titer in embryonated eggs, e.g., at least about 10 7 EID50 / mL, e.g., at least 10 8 EID50 / mL, 10 9 EID50 / mL or 10 10 Titer of EID50 / mL; high titer in MDCK, e.g., at least about 10 7 PFU / mL, e.g., at least 10 8 The antibodies include viruses that have a titer in PFU / mL or a high titer in two or more of these host cells.

[0021] Other PR8 isolates or other reassortants carrying internal genes from the vaccine virus can be used in the recombinant reassortant viruses.

[0022] In one embodiment, the DNA of the internal genes of PB1, PB2, PA, NP, M and NS encodes a protein having substantially the same activity as the corresponding polypeptide encoded by one of SEQ ID NOs: 24-29 or 39-44. As used herein, "substantially the same activity" includes about 0.1%, 1%, 10%, 30%, 50%, 90%, e.g., up to 100% or more activity, or a detectable protein level that is about 80%, 90% or more, respectively, of the activity or protein level of the corresponding full-length polypeptide. In one embodiment, the nucleic acid is a sequence that encodes a polypeptide having substantially the same contiguous amino acid sequence identity, e.g., at least 80%, e.g., 90%, 92%, 95%, 97% or 99% (including any integer between 80 and 99), to a polypeptide encoded by one of SEQ ID NOs: 24-29 or 39-44. In one embodiment, the isolated and / or purified nucleic acid molecule has substantially the same or more contiguous nucleic acid sequence identity, for example, to a nucleic acid sequence having at least 50%, e.g., 60%, 70%, 80% or 90% (including any integer between 50-100) to one of SEQ ID NOs: 24-29 or 39-44, and in one embodiment also comprises a nucleic acid sequence encoding a polypeptide having at least 80%, e.g., 90%, 92%, 95%, 97% or 99% (including any integer between 80-99) contiguous amino acid sequence identity to a polypeptide encoded by one of SEQ ID NOs: 24-29 or 39-44. In one embodiment, the influenza virus polypeptide has one or more, e.g., 2, 5, 10, 15, 20 or more conservative amino acid substitutions, e.g., up to 10% or 20% conservative substitutions compared to a polypeptide encoded by one of SEQ ID NOs: 24-29 or 39-44. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains.For example, the group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine and isoleucine; the group of amino acids having aliphatic hydroxyl side chains is serine and threonine; the group of amino acids having amide-containing side chains is asparagine and glutamine; the group of amino acids having aromatic side chains is phenylalanine, tyrosine and tryptophan; the group of amino acids having basic side chains is lysine, arginine and histidine; the group of amino acids having sulfur-containing side chains is cysteine ​​and methionine. In one embodiment, the conservative amino acid substitution groups are as follows: valine-leucine-isoleucine; phenylalanine-tyrosine; lysine-arginine; alanine-valine; glutamic acid-aspartic acid; and asparagine-glutamine. In one embodiment, the influenza virus polypeptide has one or more, for example 2, 3, or 4, non-conservative amino acid substitutions compared to a polypeptide encoded by one of SEQ ID NOs:24-29.

[0023] In one embodiment, the nucleic acid is a sequence encoding a NA polypeptide that is substantially identical, e.g., at least 80%, e.g., 90%, 92%, 95%, 97% or 99% (including any integer between 80 and 99) to a contiguous amino acid sequence substantially identical to a polypeptide encoded by one of SEQ ID NOs: 1, 3, 30-35, 48-49, or one of Accession Nos. ACP41107.1 (N1) (SEQ ID NO: 36), AIK26357.1 (N7) (SEQ ID NO: 37), ALH21372.1 (N9) (SEQ ID NO: 45), or BAK86313.1 (N2) (SEQ ID NO: 50) (these sequences are incorporated herein by reference). In one embodiment, the isolated and / or purified nucleic acid molecule encodes a polypeptide having at least 80%, e.g., 90%, 92%, 95%, 97% or 99% (including any integer between 80 and 99) contiguous amino acid sequence identity to a polypeptide encoded by SEQ ID NO:1, 3, 30-35, 48-49, or a polypeptide encoded by one of Accession Nos. ACP41107.1 (N1), AIK26357.1 (N7), ALH21372.1 (N9), or BAK86313.1 (N2), the sequences of which are incorporated herein by reference. In one embodiment, the influenza virus polypeptide has one or more, e.g., 2, 5, 10, 15, 20, or more conservative amino acid substitutions, e.g., up to 10% or 20% conservative substitutions of residues, compared to a polypeptide encoded by one of SEQ ID NOs: 1, 3, 30-35, 48-49, or one of Accession Nos. ACP41107.1 (N1), AIK26357.1 (N7), ALH21372.1 (N9), or BAK86313.1 (N2), the sequences of which are incorporated herein by reference. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains.For example, the group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; the group of amino acids having aliphatic hydroxyl side chains is serine and threonine; the group of amino acids having amide-containing side chains is asparagine and glutamine; the group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; the group of amino acids having basic side chains is lysine, arginine, and histidine; and the group of amino acids having sulfur-containing side chains is cysteine ​​and methionine. In one embodiment, the conservative amino acid substitution groups are as follows: valine-leucine-isoleucine; phenylalanine-tyrosine; lysine-arginine; alanine-valine; glutamic acid-aspartic acid; and asparagine-glutamine. In one embodiment, the influenza virus polypeptide has one or more, e.g., two, three or four, non-conservative amino acid substitutions compared to a polypeptide encoded by one of SEQ ID NOs: 1, 3, 30-35, 48-49, or one of Accession Nos. ACP41107.1 (N1), AIK26357.1 (N7), ALH21372.1 (N9), or BAK86313.1 (N2), the sequences of which are incorporated herein by reference.

[0024] Thus, the invention includes the use of isolated and purified vectors or plasmids expressing or encoding influenza viral proteins or expressing or encoding influenza vRNA (both natural and recombinant vRNA). The vectors include influenza cDNA, e.g., influenza A (e.g., any influenza A gene including any of the 18 HA or 11 NA subtypes), influenza B or influenza C DNA (see Fields Virology (Fields et al. (eds.), Lippincott, Williams and Wickens (2013), which are specifically incorporated herein by reference). Any suitable promoter or transcription termination sequence can be used to express a protein or peptide, e.g., a viral protein or peptide, a protein or peptide of a non-viral pathogen, or a therapeutic protein or peptide.

[0025] The compositions or vectors of the invention may also contain a heterologous gene or open reading frame of interest, e.g., a foreign gene encoding an immunogenic peptide or protein useful as a vaccine or in gene replacement, e.g., an epitope useful in cancer therapy or vaccine, or a peptide or polypeptide useful in gene therapy. In preparing the virus, a vector or plasmid containing a gene or cDNA of interest may be substituted for or added to the influenza virus gene vector or plasmid. Thus, another embodiment of the invention is one of the vectors that is substituted for or further contains a desired nucleic acid sequence, e.g., a 5' influenza virus sequence optionally including a 5' influenza virus coding sequence or a portion thereof linked to a 3' influenza virus sequence including a 3' influenza virus coding sequence or a portion thereof linked to the desired cDNA. In one embodiment, the desired nucleic acid sequence, such as a cDNA, is in the antisense (antigenome) orientation. When such a vector is combined with the other vectors described above and introduced into a host cell permissive for influenza virus replication, a recombinant virus is generated that contains a vRNA corresponding to the heterologous sequence of the vector.

[0026] The promoter of the vector for vRNA production can be an RNA polymerase I promoter, an RNA polymerase II promoter, an RNA polymerase III promoter, a T7 promoter, or a T3 promoter, and optionally the vector can include a transcription termination sequence, such as an RNA polymerase I transcription termination sequence, an RNA polymerase II transcription termination sequence, an RNA polymerase III transcription termination sequence, or a ribozyme. Ribozymes within the scope of the present invention include, but are not limited to, Tetrahymena ribozyme, RNase P, hammerhead ribozyme, hairpin ribozyme, hepatitis ribozyme, and synthetic ribozymes. In one embodiment, the RNA polymerase I promoter is a human RNA polymerase I promoter.

[0027] The promoter or transcription termination sequence of the vRNA or viral protein expression vector may be the same or different compared to the promoter or any other vector. In one embodiment, the vector or plasmid expressing influenza virus vRNA contains a promoter suitable for expression in at least one particular host cell, e.g., a mammalian host cell such as an avian or canine, feline, equine, bovine, ovine, or primate cell, including a human cell, or in more than one host.

[0028] In one embodiment, at least one of the vectors for vRNA contains an RNA polymerase II promoter linked to a ribozyme sequence linked to a viral coding sequence linked to another ribozyme sequence, and optionally linked to an RNA polymerase II transcription termination sequence. In one embodiment, at least two, e.g., three, four, five, six, seven, or eight, vectors for vRNA production contain an RNA polymerase II promoter, a first ribozyme sequence that is 5' to a sequence corresponding to a viral sequence including a viral coding sequence, which is 5' to a transcription termination sequence. Each RNA polymerase II promoter of each vRNA vector may be the same or different from the RNA polymerase II promoter in any other vRNA vector. Similarly, each ribozyme sequence of each vRNA vector may be the same or different from the ribozyme sequence in any other vRNA vector. In one embodiment, the ribozyme sequences in a single vector are not the same.

[0029] In one embodiment, at least one vector comprises a corresponding sequence encoding PB1, PB2, PA, NP, M, or NS, or a portion thereof, having substantially the same activity as a sequence encoding a corresponding polypeptide encoded by one of SEQ ID NOs: 24-29 or 39-44, e.g., a polypeptide having at least 80%, e.g., 85%, 90%, 92%, 95%, 98%, 99% or 100% (including any integer between 80-100) amino acid identity to a polypeptide encoded by one of SEQ ID NOs: 24-29. Optionally, two vectors may be used instead of a vector comprising a promoter operably linked to an influenza virus M cDNA linked to a transcription termination sequence, e.g., a vector comprising a promoter operably linked to an influenza virus M1 cDNA linked to a transcription termination sequence, and a vector comprising a promoter operably linked to an influenza M2 cDNA linked to a transcription termination sequence.

[0030] The multiple vectors of the present invention may be physically linked, or each vector may be present on an individual plasmid or other, e.g., linear, nucleic acid delivery vehicle. In one embodiment, each vRNA production vector is on a separate plasmid. In one embodiment, each mRNA production vector is on a separate plasmid.

[0031] The invention also provides a method of preparing influenza virus. The method includes contacting a cell with a plurality of vectors of the invention, e.g., sequentially or simultaneously, in an amount effective to produce infectious influenza virus. The invention also includes isolating the virus from a cell contacted with a plurality of vectors. Thus, the invention further provides isolated viruses, as well as host cells contacted with a plurality of vectors or viruses of the invention. In one embodiment, the invention includes contacting a cell with one or more vectors, either vRNA or protein producing vectors, before the other vector, either vRNA or protein producing vector. In one embodiment, the promoter for the vRNA vector used in the method is an RNA polymerase I promoter, an RNA polymerase II promoter, an RNA polymerase III promoter, a T3 promoter, or a T7 promoter. In one embodiment, the RNA polymerase I promoter is a human RNA polymerase I promoter. In one embodiment, the vRNA vectors used in the method are on separate plasmids. In one embodiment, the vRNA vectors used in the method are on one plasmid or two or three different plasmids. In one embodiment, the mRNA vectors used in the method are on separate plasmids. In one embodiment, the PA, PB1, PB2, and NP mRNA vectors used in the method are on one plasmid or on two or three different plasmids.

[0032] The methods of producing the viruses described herein, which do not require helper virus infection, are useful in viral mutation studies, and in the manufacture of vaccines (e.g., for AIDS, influenza, hepatitis B, hepatitis C, rhinovirus, filovirus, malaria, herpes, and foot and mouth disease), and in the production of gene therapy vectors (e.g., for cancer, AIDS, adenosine deaminase, muscular dystrophy, ornithine transcarbamylase deficiency, and central nervous system tumors). Thus, viruses for use in medical treatments (e.g., vaccines or gene therapy) are provided.

[0033] The invention also provides isolated viral polypeptides, as well as methods of preparing and using the recombinant viruses of the invention. The methods include administering to a host organism, e.g., a mammal, an effective amount of an influenza virus of the invention, e.g., an inactivated virus preparation, optionally combined with an adjuvant and / or carrier, in an amount effective to prevent or ameliorate infection of the animal, e.g., a mammal, with the virus or an antigenically closely related virus. In one embodiment, the virus is administered intramuscularly, while in other embodiments, the virus is administered intranasally. In some administration protocols, all doses may be administered intramuscularly or intranasally, while in other administration protocols, a combination of intramuscular and intranasal administration is used. The vaccine may further include other isolates of influenza, including recombinant influenza viruses, additional biological agents, or microbial components, e.g., to form a multivalent vaccine. In one embodiment, intranasal vaccination with, e.g., inactivated influenza virus and a mucosal adjuvant, may induce virus-specific IgA and neutralizing antibodies in the nasopharynx and serum IgG.

[0034] The influenza viruses of the present invention can be used in conjunction with other antiviral agents, such as amantadine, rimantadine, and / or neuraminidase inhibitors, and can be administered, for example, in combination with the antiviral agent separately, for example before, during and / or after administration.

[0035] Thus, the modified neuraminidase comprises at least one, or at least two, or at least three modifications, wherein the modifications include one or more amino acids within positions 29-35, one or more amino acids within positions 44-52, one or more amino acids within positions 144-154, one or more amino acids within positions 240-250, one or more amino acids within positions 326-333, one or more amino acids within positions 344-350, one or more amino acids within positions 365-375, or a combination thereof, wherein the numbering is N2 numbering. In one embodiment, the NA comprises a deletion of at least one of proline, asparagine, glutamine, valine, or a combination of proline, one or more asparagine, glutamine, and valine within positions 44-52; a substitution of threonine within positions 29-35; a substitution of threonine or aspartic acid within positions 145-155; a substitution of histidine within positions 240-250 or 326-350; or a combination thereof. [Brief description of the drawings]

[0036] [Figure 1-1] Figures 1-1 to 1-12 show the nucleotide sequences of the viral segments of A / Yokohama / 2017 / 2003 (sequence numbers 4 to 11) and the amino acid sequence of NA of A / Yokohama / 2017 / 2003 (sequence number 3). [Figure 1-2] Figures 1-1 to 1-12 show the nucleotide sequences of the viral segments of A / Yokohama / 2017 / 2003 (sequence numbers 4 to 11) and the amino acid sequence of NA of A / Yokohama / 2017 / 2003 (sequence number 3). [Figure 1-3] Figures 1-1 to 1-12 show the nucleotide sequences of the viral segments of A / Yokohama / 2017 / 2003 (sequence numbers 4 to 11) and the amino acid sequence of NA of A / Yokohama / 2017 / 2003 (sequence number 3). [Figure 1-4]Figures 1-1 to 1-12 show the nucleotide sequences of the viral segments of A / Yokohama / 2017 / 2003 (sequence numbers 4 to 11) and the amino acid sequence of NA of A / Yokohama / 2017 / 2003 (sequence number 3). [Figure 1-5] Figures 1-1 to 1-12 show the nucleotide sequences of the viral segments of A / Yokohama / 2017 / 2003 (sequence numbers 4 to 11) and the amino acid sequence of NA of A / Yokohama / 2017 / 2003 (sequence number 3). [Figure 1-6] Figures 1-1 to 1-12 show the nucleotide sequences of the viral segments of A / Yokohama / 2017 / 2003 (sequence numbers 4 to 11) and the amino acid sequence of NA of A / Yokohama / 2017 / 2003 (sequence number 3). [Figure 1-7] Figures 1-1 to 1-12 show the nucleotide sequences of the viral segments of A / Yokohama / 2017 / 2003 (sequence numbers 4 to 11) and the amino acid sequence of NA of A / Yokohama / 2017 / 2003 (sequence number 3). [Figure 1-8] Figures 1-1 to 1-12 show the nucleotide sequences of the viral segments of A / Yokohama / 2017 / 2003 (sequence numbers 4 to 11) and the amino acid sequence of NA of A / Yokohama / 2017 / 2003 (sequence number 3). [Figure 1-9] Figures 1-1 to 1-12 show the nucleotide sequences of the viral segments of A / Yokohama / 2017 / 2003 (sequence numbers 4 to 11) and the amino acid sequence of NA of A / Yokohama / 2017 / 2003 (sequence number 3). [Figure 1-10] Figures 1-1 to 1-12 show the nucleotide sequences of the viral segments of A / Yokohama / 2017 / 2003 (sequence numbers 4 to 11) and the amino acid sequence of NA of A / Yokohama / 2017 / 2003 (sequence number 3). [Figure 1-11]Figures 1-1 to 1-12 show the nucleotide sequences of the viral segments of A / Yokohama / 2017 / 2003 (sequence numbers 4 to 11) and the amino acid sequence of NA of A / Yokohama / 2017 / 2003 (sequence number 3). [Figure 1-12] Figures 1-1 to 1-12 show the nucleotide sequences of the viral segments of A / Yokohama / 2017 / 2003 (sequence numbers 4 to 11) and the amino acid sequence of NA of A / Yokohama / 2017 / 2003 (sequence number 3). [Diagram 2] Amino acid sequence of NA of A / Saitama / 103 / 2014 (sequence number 2). [Figure 3-1] Figures 3-1 to 3-7 show the nucleotide sequence of the NA viral segment (sequence number 12) and the amino acid sequence of the NA of the A / Yokohama / 2017 / 2003 mutant (sequence number 1), as well as the nucleotide sequences of other viral segments of the mutant (sequence numbers 12 to 21). [Figure 3-2] Figures 3-1 to 3-7 show the nucleotide sequence of the NA viral segment (sequence number 12) and the amino acid sequence of the NA of the A / Yokohama / 2017 / 2003 mutant (sequence number 1), as well as the nucleotide sequences of other viral segments of the mutant (sequence numbers 12 to 21). [Figure 3-3] Figures 3-1 to 3-7 show the nucleotide sequence of the NA viral segment (sequence number 12) and the amino acid sequence of the NA of the A / Yokohama / 2017 / 2003 mutant (sequence number 1), as well as the nucleotide sequences of other viral segments of the mutant (sequence numbers 12 to 21). [Diagram 3-4] Figures 3-1 to 3-7 show the nucleotide sequence of the NA viral segment (sequence number 12) and the amino acid sequence of the NA of the A / Yokohama / 2017 / 2003 mutant (sequence number 1), as well as the nucleotide sequences of other viral segments of the mutant (sequence numbers 12 to 21). [Figure 3-5]Figures 3-1 to 3-7 show the nucleotide sequence of the NA viral segment (sequence number 12) and the amino acid sequence of the NA of the A / Yokohama / 2017 / 2003 mutant (sequence number 1), as well as the nucleotide sequences of other viral segments of the mutant (sequence numbers 12 to 21). [Diagram 3-6] Figures 3-1 to 3-7 show the nucleotide sequence of the NA viral segment (sequence number 12) and the amino acid sequence of the NA of the A / Yokohama / 2017 / 2003 mutant (sequence number 1), as well as the nucleotide sequences of other viral segments of the mutant (sequence numbers 12 to 21). [Diagram 3-7] Figures 3-1 to 3-7 show the nucleotide sequence of the NA viral segment (sequence number 12) and the amino acid sequence of the NA of the A / Yokohama / 2017 / 2003 mutant (sequence number 1), as well as the nucleotide sequences of other viral segments of the mutant (sequence numbers 12 to 21). [Figure 4] Graph showing titers in eggs of various reassortants harboring the PB2, M, NA and NP segments of mutant and wild type A / Yokohama / 2017 / 2003. Viral intake: 2x103 pfu / egg in allantoic fluid, 72 hours incubation at 37°C. [Diagram 5] Location of NA mutations on the 3D structure of N2 NA. [Figure 6] Graph showing titers in eggs of recombinant viruses carrying specific mutations found in mutants of A / Yokohama / 2017 / 2003 ("Y2017-M3L4"). Virus intake: 2 x 103 pfu / egg in allantoic fluid, 72 hours incubation at 37°C. [Figure 7]Graph of virus titers in eggs of reassortants with two complementary backbones (PA, PB1, PB2, NP, NS and M) and two different HA and NA combinations (PB2-I504V, PB1-M40L / G180W, PA-R401K, NP-I116L, NS1-A30P / R118K; and Y2017-M3L4 NA containing mutations; NA-T32A, D147N, N329D, H347Q and 46-50aa deletion). Virus intake: 2x103 pfu / egg in allantoic fluid, 72h incubation at 37°C. [Figure 8] Comparison of amino acid sequences of wild-type NA (sequence number 3) and Y2017-M3L4 (sequence number 1) of Yokohama / 2017 / 2003. [Figure 9-1] 9-1 to 9-2 show exemplary NA sequences of N3, N4, N6, N7, N8, and N9 (SEQ ID NOs: 30 to 35). [Figure 9-2] 9-1 to 9-2 show exemplary NA sequences of N3, N4, N6, N7, N8, and N9 (SEQ ID NOs: 30 to 35). [Figure 10-1] Figures 10-1 to 10-6 show exemplary sequences of internal viral segments of the master vaccine lineage (SEQ ID NOs: 39 to 44). [Figure 10-2] Figures 10-1 to 10-6 show exemplary sequences of internal viral segments of the master vaccine lineage (SEQ ID NOs: 39 to 44). [Figure 10-3] Figures 10-1 to 10-6 show exemplary sequences of internal viral segments of the master vaccine lineage (SEQ ID NOs: 39 to 44). [Figure 10-4] Figures 10-1 to 10-6 show exemplary sequences of internal viral segments of the master vaccine lineage (SEQ ID NOs: 39 to 44). [Figure 10-5] Figures 10-1 to 10-6 show exemplary sequences of internal viral segments of the master vaccine lineage (SEQ ID NOs: 39 to 44). [Figure 10-6] Figures 10-1 to 10-6 show exemplary sequences of internal viral segments of the master vaccine lineage (SEQ ID NOs: 39 to 44). [Figure 11-1] 11-1 to 11-2 show exemplary NA sequences (SEQ ID NOs: 51 to 54). [Figure 11-2] 11-1 to 11-2 show exemplary NA sequences (SEQ ID NOs: 51 to 54). [Figure 12] Titers of various NA mutants in eggs. [Figure 13] Time course analysis of titers of HK4801HA, Y2017-M3L4NA and HY-PR8 (PB2 C4U, I504V; PB1 C4U, M40L / G180W; PA C4U, R401K; NP I116L; NS A30P / R118K) and HA mutations in infected eggs. [Figure 14] FIG. 14 shows data for viruses passaged in eggs with specific NA mutations, but which did not result in replacement of the HA. [Figure 15] FIG. 15 is a schematic diagram of the positions of residues of certain NAs. [Figure 16] FIG. 16 is a schematic diagram of the positions of residues of certain NAs. [Figure 17] FIG. 17 shows that virus titers of egg-passaged isolates (HK4801NA (T148K, D151E, H347G, and T369K)) conferred efficient replication capacity to viruses carrying either HK4801HA or Singapore0019 (HY-PR8 backbone) in the allantoic cavity. [Figure 18] FIG. 18 shows egg titers of different combinations of selected residues at positions 153, 329, 347, 369 of NA. [Figure 19] FIG. 19 summarizes the time course of viral titers (HK4801HA, Y2017-M3L4NA and HY-PR8 (PB2 C4U, I504V; PB1 C4U, M40L / G180W; PA C4U, R401K; NP I116L; NS A30P / R118K) and HA status. [Figure 20] FIG. 20 is a summary of the viral titers and HA status of viruses with different NA. [Figure 21]FIG. 21 shows the inoculation and recovered virus titers in the allantoic cavity (HA-K189E / N158K / A212T mutant virus). [Figure 22] FIG. 22 shows detection of HA status after multiple passages. [Figure 23] Figures 23A and 23B show egg titers of viruses with different NA. [Figure 24] Figure 24 is a close-up of the NA active site. Most egg-adapted mutations are located in / around the active site of NA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0037] Detailed Description of the Invention definition As used herein, the term "isolated" refers to an in vitro preparation and / or isolation of a nucleic acid molecule, e.g., a vector or plasmid, a peptide or polypeptide (protein), or a virus of the invention, whereby it is free of association with in vivo materials or is substantially purified from in vitro materials. Isolated virus preparations are generally obtained by in vitro culture and propagation and / or by passage in eggs, and are substantially free of other infectious agents.

[0038] As used herein, "substantially purified" means that the species of interest is the predominant species, e.g., is more abundant than any other distinct species in the composition on a molar basis, preferably at least about 80% of the species present, and optionally 90% or more, e.g., 95%, 98%, 99% or more, of the species present in the composition.

[0039] As used herein, "substantially free" means below the limit of detection of a particular infectious agent using standard detection methods for that agent.

[0040] A "recombinant" virus is one that has been manipulated in vitro, for example using recombinant DNA techniques, to introduce changes into the viral genome. Reassortant viruses can be prepared by recombinant or non-recombinant techniques.

[0041] As used herein, the term "recombinant nucleic acid" or "recombinant DNA sequence or segment" refers to a nucleic acid, e.g., DNA, that is derived from or isolated from a source and can then be chemically altered in vitro so that its sequence corresponds to a naturally occurring sequence that does not occur in nature or is not located as it is located in a natural genome. An example of DNA "derived" from a source is a DNA sequence that has been identified as a useful fragment, which is then chemically synthesized in an essentially pure form. An example of such DNA that has been "isolated" from a source is a useful DNA sequence that has been excised or removed from said source by chemical means, e.g., by the use of restriction endonucleases, so that it can be further manipulated, e.g., amplified, for use in the present disclosure, by methods of genetic engineering.

[0042] As used herein, a "heterologous" influenza virus gene or viral segment is derived from an influenza source that is different from the majority of other influenza virus genes or viral segments in a recombinant, e.g., reassortant, influenza.

[0043] The terms "isolated polypeptide," "isolated peptide," or "isolated protein" include cDNA or recombinant RNA, including any one of synthetic origin, or some combination thereof.

[0044] As used herein, the term "recombinant protein" or "recombinant polypeptide" refers to a protein molecule that is expressed from a recombinant DNA molecule. In contrast, the term "native protein" is used to indicate a protein that is isolated from a naturally occurring (i.e., non-recombinant) source. Using molecular biology techniques, recombinant forms of proteins can be produced that have the same properties as compared to the native form of the protein.

[0045] Methods for aligning sequences for comparison are well known in the art. Thus, the determination of percent identity between any two sequences can be accomplished using a mathematical algorithm.

[0046] Computer implementations of these mathematical algorithms can be used to compare sequences to determine sequence identity. Alignments using these programs can be performed using default parameters. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ). The algorithm first identifies high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or meet a correct threshold score T when aligned with the same name word in a database sequence. T is called the neighborhood word score threshold. These initial neighborhood word hits act as starting points for initiating searches to find longer HSPs containing them. The hit words are then extended in both directions along each sequence as far as possible to increase the cumulative alignment score. For nucleotide sequences, the cumulative score is calculated using the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is ​​used to calculate the cumulative score. Extension of the word hits in each direction stops when the cumulative alignment score falls off by X amount from the maximum achieved, either due to the accumulation of one or more negatively scoring residue alignments, or when the end of either sequence is reached, causing the cumulative score to fall below zero.

[0047] In addition to calculating percent sequence identity, the BLAST algorithm can also perform statistical analysis of the similarity between two sequences. One measure of similarity provided by the BLAST algorithm can be the minimum sum probability (P(N)), which provides an indication of the probability that a match between two nucleotide or amino acid sequences would occur by chance. For example, if the minimum sum probability in the comparison of the test nucleic acid sequence with the reference nucleic acid sequence is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001, the test nucleic acid sequence is considered to be similar to the reference sequence.

[0048] The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix. See http: / / www.ncbi.n1m.nih.gov. Alignments can also be performed manually by inspection.

[0049] In sequence comparison, one sequence usually serves as a reference sequence to which a test sequence is compared. When using a sequence comparison algorithm, the test sequence and the reference sequence are input into a computer, subsequence coordinates are designated as necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence relative to the reference sequence based on the designated program parameters.

[0050] Structure and proliferation of influenza viruses Influenza A has a genome of eight single-stranded negative-sense viral RNAs (vRNAs) that code for at least ten proteins. The influenza virus life cycle begins with the binding of hemagglutinin (HA) to sialic acid-containing receptors on the surface of the host cell, followed by receptor-mediated endocytosis. The low pH of the late endosome induces a HA conformational change that exposes the N-terminus of the HA2 subunit (the so-called fusion peptide). The fusion peptide initiates the fusion of the virus with the endosomal membrane, and the matrix protein (M1) and the RNP complex are released into the cytoplasm. The RNP consists of the nucleoprotein (NP), which encapsidates the vRNA, and the viral polymerase complex, which is formed by the PA, PB1, and PB2 proteins. The RNP is transported to the nucleus where transcription and replication take place. The RNA polymerase complex catalyzes three different reactions: the synthesis of mRNA with a 5' cap and 3' polyA structure, full-length complementary RNA (cRNA), and genomic vRNA using the cRNA as a template. The newly synthesized vRNA, NP, and polymerase proteins are then assembled into RNPs, exported from the nucleus, and transported to the plasma membrane, where budding of progeny virus particles occurs. The neuraminidase (NA) protein plays a key role late in infection by removing sialic acid from sialyloligosaccharides, thus releasing newly assembled virions from the cell surface and preventing self-aggregation of virus particles. Virus assembly involves protein-protein and protein-vRNA interactions, but the nature of these interactions is poorly understood.

[0051] Influenza B virus and influenza C virus are structurally and functionally similar to influenza A virus, but have some differences.For example, influenza B virus does not have the M2 type protein with ion channel activity, but has BM2, and has viral segments with both NA and NB sequences.Influenza C virus has only 7 viral segments.

[0052] Cells that can be used for virus production Any cell, such as any avian or mammalian cell, such as avian eggs, human, such as 293T or PER.C6® cells, or canine, bovine, equine, feline, porcine, ovine, rodent, such as mink, such as MvLu1 cells, or hamster, such as CHO cells, or non-human primate, such as Vero cells, including mutant cells, which support efficient replication of influenza virus, can be used to isolate and / or grow influenza virus. The isolated virus can be used to prepare reassortant virus. In one embodiment, the host cell for vaccine production is a continuous mammalian cell line or cell line or a continuous avian cell line or cell line. A full characterization of the cells used can be included to allow appropriate testing of the purity of the final product to be performed. Data that can be used to characterize a cell include: (a) information about its origin, origin, and passage history; (b) information about its growth and morphological characteristics; (c) test results for adventitious agents; (d) distinctive features that allow the cell to be unambiguously recognized among other cell lineages, such as biochemical, immunological, and cytogenetic patterns; and (e) test results for tumorigenicity. In one embodiment, the passage level, or population doublings, of the host cells used is as low as possible.

[0053] In one embodiment, the cells are WHO certified or recognizable cell lines. Requirements for authenticating such cell lines include characterization for at least one of pedigree, growth characteristics, immunological markers, virus susceptibility tumorigenesis, and storage conditions, as well as animal, egg, and cell culture testing. Such characterization is used to ensure that the cells are free of detectable adventitious agents. In some countries, karyology may also be required. In addition, tumorigenesis can be tested on cells at the same passage level as those used for vaccine production. Viruses can be purified prior to vaccine production by processes that have been shown to give consistent results (see, e.g., World Health Organization, 1982).

[0054] Viruses produced by host cells can be highly purified before being made into vaccine or gene therapy preparations. Generally, purification procedures result in the extensive removal of cellular DNA and other cellular components, as well as adventitious agents. Procedures that significantly degrade or denature DNA can also be used.

[0055] Influenza vaccine The vaccine comprises an isolated recombinant influenza virus of the invention, and optionally one or more other isolated viruses, including other isolated influenza viruses, one or more other isolated viruses, including other isolated influenza viruses, one or more other isolated influenza viruses or one or more other pathogens, e.g., one or more immunogenic proteins from bacteria, non-influenza viruses, yeast or fungi, or one or more viral proteins (e.g., DNA vaccines) that include one or more immunogenic proteins of the isolated influenza virus of the invention. In one embodiment, the influenza virus of the invention can be a vaccine vector for influenza viruses or other pathogens.

[0056] Intact virion vaccines may be concentrated by ultrafiltration and then purified by zonal centrifugation or chromatography. Viruses other than those of the invention, such as those included in multivalent vaccines, may be inactivated before or after purification, for example using formalin or betapropiolactone.

[0057] Subunit vaccines contain purified glycoproteins. Such vaccines can be prepared as follows: surface antigens are purified, for example by ultracentrifugation, using a virus suspension fragmented by treatment with detergent. Subunit vaccines therefore contain mainly HA proteins and also NA. The detergent used can be, for example, a cationic detergent such as hexadecyltrimethylammonium bromide (Bachmeyer, 1975), an anionic detergent such as ammonium deoxycholate (Laver & Webster, 1976); or a non-ionic detergent commercialized under the name TRITON X100. Hemagglutinin can also be isolated after treatment of the virions with a protease such as bromelain, and then purified. Subunit vaccines can be combined with the attenuated viruses of the invention in multivalent vaccines.

[0058] Split vaccines contain virions that have been treated with agents that dissolve lipids. Split vaccines can be prepared as follows: an aqueous suspension of purified virus, inactivated or not, prepared as described above, is treated with a lipid solvent, such as ethyl ether or chloroform associated with a detergent, under stirring. Dissolution of the viral envelope lipids leads to fragmentation of the viral particles. The aqueous phase is regenerated by contacting with the split vaccine, which is mainly composed of hemagglutinin and neuraminidase, and the core or its degradation products, stripped of their original lipid environment. The remaining infectious particles are then inactivated, if this has not already been done. Split vaccines can be combined with the attenuated viruses of the invention in multivalent vaccines.

[0059] Inactivated vaccine. Inactivated influenza virus vaccines are provided by inactivating replicating virus using known methods such as, but not limited to, formalin or β-propiolactone treatment. Types of inactivated vaccines that can be used in the present invention can include whole virus (WV) vaccines or subvirion (SV) (split) vaccines. WV vaccines contain intact inactivated virus, while SV vaccines contain purified virus that has been disrupted with a detergent that solubilizes the lipid-containing viral envelope, followed by chemical destruction of residual virus.

[0060] In addition, vaccines that can be used include vaccines that contain isolated HA and NA surface proteins, referred to as surface antigen or subunit vaccines.

[0061] Live attenuated vaccine viruses Attenuated live vaccine viruses, such as those comprising the recombinant viruses of the present invention, can be used to prevent or treat influenza virus infection. Attenuation can be achieved in a single step by transferring attenuated genes from an attenuated donor virus to a cloned isolated or reassortant virus according to known methods. Since resistance to influenza A viruses is primarily mediated by the development of an immune response against the HA and / or NA glycoproteins, the genes encoding these surface antigens are derived from the reassortant virus or clinical isolate. The attenuated genes are derived from the attenuated parent. In this approach, the genes that confer attenuation generally do not code for the HA and NA glycoproteins.

[0062] Viruses that can reproducibly attenuate influenza viruses (donor influenza viruses) are available; for example, cold adapted (ca) donor viruses can be used to produce attenuated viruses. Attenuated live reassortant virus vaccines can be generated by mating ca donor viruses with pathogenic replicating viruses. Reassortant progeny are then selected at 25°C (where replication of pathogenic viruses is restricted) in the presence of appropriate antisera that inhibit replication of viruses bearing the surface antigens of the attenuated ca donor virus. Useful reassortants are: (a) infectious, (b) attenuated in seronegative non-adult mammals and immunologically primed adult mammals, (c) immunogenic, and (d) genetically stable. The immunogenicity of ca reassortants corresponds to the level of replication. Thus, the acquisition of the six transferable genes of the ca donor virus by new wild-type viruses reproducibly attenuated these viruses for use in vaccination of both adult and non-adult susceptible mammals.

[0063] Other attenuating mutations can be introduced into influenza virus genes by site-directed mutagenesis, restoring infectious viruses carrying these mutated genes. Attenuating mutations can be introduced into coding regions as well as non-coding regions of the genome. Such attenuating mutations can also be introduced into genes other than HA or NA, such as the PB2 polymerase gene. Thus, it is possible to generate novel donor viruses containing attenuating mutations introduced by site-directed mutagenesis, and such novel donor viruses can be used for attenuated live reassortant vaccine candidates in a similar manner as described above for ca donor viruses. Similarly, other known suitable attenuated donor lines can be reassorted to obtain attenuated vaccines suitable for use in mammalian vaccination.

[0064] In one embodiment, such attenuated viruses maintain genes from the virus that encode antigenic determinants substantially similar to those of the original clinical isolate, since the goal of an attenuated vaccine is to provide substantially the same antigenicity as the original clinical strain of the virus, while at the same time lacking pathogenicity to minimize the likelihood of the vaccine inducing severe disease symptoms in a vaccinated mammal.

[0065] Thus, the viruses in the multivalent vaccine can be attenuated or inactivated, formulated and administered as a vaccine to induce an immune response in an animal, e.g., a mammal, according to known methods. Methods for determining whether such attenuated or inactivated vaccines maintain similar antigenicity to clinical isolates or high growth strains derived therefrom are known in the art. Such known methods include the use of antisera or antibodies to eliminate viruses expressing antigenic determinants of the donor virus; chemical selection (e.g., amantadine or rimantidine); HA and NA activity and inhibition; and nucleic acid screening (e.g., probe hybridization or PCR) to confirm that donor genes (e.g., HA or NA genes) encoding antigenic determinants are not present in the attenuated virus.

[0066] Pharmaceutical Compositions The pharmaceutical compositions of the present invention suitable for ingestion, e.g., nasal, parenteral or oral administration, comprise one or more influenza virus isolates, e.g., one or more attenuated or inactivated influenza viruses, subunits thereof, isolated proteins thereof, and / or isolated nucleic acids encoding one or more proteins thereof, and optionally further comprise sterile aqueous or non-aqueous solutions, suspensions, and emulsions. The compositions may further comprise adjuvants or excipients, as known in the art. The compositions of the present invention are generally provided in the form of individual doses (unit doses).

[0067] Conventional vaccines generally contain about 0.1-200 μg of HA from each lineage included in their composition, for example 30-100 μg, 0.1-2 μg, 0.5-5 μg, 1-10 μg, 10-20 μg, 15 μg-30 μg, or 10-30 μg, etc. The vaccine forming the main component of the vaccine composition of the invention may comprise a single influenza virus, or a combination of influenza viruses, for example at least two or three influenza viruses including one or more reassortant forms.

[0068] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and / or emulsions, which may contain auxiliary agents or excipients known in the art. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Carriers or occlusive dressings can also be used to increase skin permeability and enhance antigen absorption. Liquid dosage forms for oral administration may generally include liposome solutions containing liquid dosage forms. Suitable forms for suspending liposomes include emulsions, suspensions, solutions, syrups, and elixirs that contain inert diluents commonly used in the art, such as purified water. In addition to inert diluents, such compositions may also include adjuvants, wetting agents, emulsifying and suspending agents, or sweetening, flavoring, or perfuming agents.

[0069] When the composition of the present invention is used for administration to an individual, it may further contain salts, buffers, adjuvants, or other substances that are desirable for improving the effectiveness of the composition. Vaccines may use adjuvants, substances that can enhance a specific immune response. Usually, the adjuvant and the composition are mixed before presentation to the immune system, or presented separately, but presented at the same site of the organism to be immunized.

[0070] Heterogeneity in a vaccine can be provided by mixing influenza viruses replicated by at least two influenza strains, such as 2-20 strains, or any range or value therein. Techniques known in the art can be used to provide a vaccine of variation within a single strain of influenza virus.

[0071] The pharmaceutical compositions of the present invention may further or additionally comprise at least one chemotherapeutic compound, for example for gene therapy agents, immunosuppressants, anti-inflammatory agents or immune enhancing agents, and chemotherapeutic agents including, but not limited to, gamma globulin, amantadine, guanidine, hydroxybenzimidazole, interferon alpha, interferon beta, interferon gamma, tumor necrosis factor alpha, thiosemicarbazone, methisazone, rifampin, ribavirin, pyrimidine analogs, purine analogs, foscarnet, phosphonoacetic acid, acyclovir, dideoxynucleosides, protease inhibitors, or ganciclovir for vaccines.

[0072] The compositions may also contain variable but small amounts of endotoxin-free formaldehyde, and preservatives known to be safe and have no undesirable effects in the organism to which the composition is administered.

[0073] Pharmaceutical purposes Administration of the composition (or the antisera it elicits) may be for either "prophylactic" or "therapeutic" purposes. When provided prophylactically, the compositions of the invention, which are vaccines, are provided before symptoms or clinical signs of pathogen infection become evident. Prophylactic administration of the composition serves to prevent or reduce any subsequent infection. When provided prophylactically, the gene therapy compositions of the invention are provided before symptoms or clinical signs of disease become evident. Prophylactic administration of the composition serves to prevent or reduce one or more symptoms or clinical signs associated with a disease.

[0074] When provided therapeutically, a viral vaccine is provided upon detection of a symptom or clinical sign of an actual infection. The therapeutic administration of a compound serves to alleviate either the actual infection. When provided therapeutically, a gene therapy composition is provided upon detection of a symptom or clinical sign of a disease. The therapeutic administration of a compound serves to alleviate either the symptom or clinical sign of the disease.

[0075] Thus, the vaccine compositions of the invention may be provided either prior to the onset of infection (to prevent or attenuate anticipated infection) or after the onset of actual infection. Similarly, in the case of gene therapy, the compositions may be provided prior to the appearance of any symptoms or clinical signs of a disorder or disease, or after one or more symptoms have been detected.

[0076] A composition is said to be "pharmacologically acceptable" if a recipient mammal can tolerate its administration. Such an agent is said to be administered in a "therapeutically effective amount" if the amount administered is physiologically significant. A composition of the invention is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient, for example, enhancing at least one primary or secondary humoral or cellular immune response to at least one strain of infectious influenza virus.

[0077] The "protection" provided need not be absolute, i.e., it need not completely prevent or eradicate influenza infection, provided there is a statistically significant improvement compared to a control population or set of mammals. Protection may be limited to a reduction in the severity or rapidity of onset of symptoms or clinical signs of influenza virus infection.

[0078] Pharmaceutical Administration The compositions of the invention can confer resistance to one or more pathogens, e.g., one or more influenza virus strains, by either passive or active immunization. In active immunization, the live attenuated vaccine composition is administered prophylactically to a host (e.g., a mammal) and the host's immune response to the administration protects against infection and / or disease. In the case of passive immunization, the induced antisera can be collected and administered to a recipient suspected of infection with at least one influenza virus strain. The gene therapy compositions of the invention can provide prophylactic or therapeutic levels of a desired gene product by active immunization.

[0079] In one embodiment, the vaccine is provided to a mammalian female (at or before pregnancy or birth) under conditions of a time and in an amount sufficient to elicit an immune response that serves to protect both the female and her fetus and newborn (through passive uptake of antibodies in the whole placenta or breast milk).

[0080] Thus, the present invention includes methods for preventing or alleviating a disorder or disease, such as infection by at least one strain of a pathogen. As used herein, a vaccine is said to prevent or alleviate a disease if its administration results in either a total or partial reduction (i.e., suppression) of clinical signs or symptoms of the disease, or a total or partial immunity of an individual against the disease. As used herein, a gene therapy composition is said to prevent or alleviate a disease if its administration results in either a total or partial reduction (i.e., suppression) of clinical signs or symptoms of the disease, or a total or partial immunity of an individual against the disease.

[0081] Compositions comprising at least one influenza virus of the present invention (attenuated viruses and other isolated viruses, one or more isolated viral proteins thereof, one or more isolated nucleic acids encoding one or more viral proteins thereof, or combinations thereof) may be administered by any means that achieves the intended purpose.

[0082] For example, administration of such compositions may be by various parenteral routes such as subcutaneous, intravenous, intradermal, intramuscular, intraperitoneal, intranasal, oral or transdermal routes. Parenteral administration may be accomplished by bolus injection or by gradual perfusion over time.

[0083] A typical regimen for preventing, suppressing, or treating influenza virus-associated conditions involves administration of an effective amount of the vaccine described herein, either as a single treatment, or as a booster or booster dose, repeated for a period of from one week to about 24 months, or any range or value therein.

[0084] According to the present invention, an "effective amount" of a composition is an amount sufficient to achieve a desired effect. It is understood that the effective dosage may depend on the species, age, sex, health, and weight of the recipient, the type of concurrent treatment, if any, the frequency of treatment, and the nature of the desired effect. The effective dosage ranges provided below are not intended to limit the invention, but rather indicate dosage ranges.

[0085] Administration of live attenuated or killed virus vaccines for animals, such as adult mammals, is approximately 10 2 ~10 20 , e.g., 10 3 ~10 12 , 10 2 ~10 10 , 10 5 ~10 11 , 10 6 ~10 15 , 10 2 ~10 10 , or 10 15 ~10 20 It may be plaque forming units (PFU) / kg, or any range or value therein. For example, a dose of a virus isolate vaccine in an inactivated vaccine may be about 0.1-1000, e.g., 0.1-10 μg, 1-20 μg, 30-100 μg, 10-50 μg, 50-200 μg, or 150-300 μg of HA protein. However, the dosage must be a safe and effective amount as determined by conventional methods using existing vaccines as a starting point.

[0086] The dosage of immunoreactive HA in each dose of replicated viral vaccine can be standardized to include an appropriate amount, e.g., 0.1 μg to 1 μg, 0.5 μg to 5 μg, 1 μg to 10 μg, 10 μg to 20 μg, 15 μg to 30 μg, or 30 μg to 100 μg, or any range or value therein, or an amount recommended by a government agency or recognized professional organization. The amount of NA can also be standardized, although this glycoprotein may be unstable during purification and storage.

[0087] The dosage of immunoreactive HA in each dose of replicated viral vaccine may be standardized to contain an appropriate amount, for example, 1-50 μg or any range or value thereof, or the amount recommended by the U.S. Public Health Service (PHS). This is usually 15 μg per component for children older than 3 years of age and 7.5 g per component for children under 3 years of age. The amount of NA may also be standardized, but this glycoprotein may be unstable during purification and storage in processors (Kendal et al., 1980; Kerr et al., 1975). Each 0.5 ml dose of vaccine may contain approximately 100-500 million virus particles, 5-2 billion virus particles, 1-10 billion virus particles, 20-40 billion virus particles, 1-5 billion virus particles, or 40-80 billion virus particles.

[0088] Examples of viruses Useful modifications of influenza neuraminidase (NA) proteins are described herein to stabilize hemagglutinin (HA) proteins during egg passaging of influenza viruses expressing those modified neuraminidase proteins. Modified amino acids encoding such modified neuraminidase proteins are also described. Modifications can include deletions, substitutions, and combinations thereof within the neuraminidase protein and nucleic acid sequences. Viruses expressing such modified neuraminidase proteins greatly reduce the acquisition of mutations that impair the antigenicity of hemagglutinin (HA) during influenza propagation in eggs.

[0089] For example, in some cases, the modified neuraminidase can have at least one, or at least two, or at least three modifications. Amino acid positions within the influenza neuraminidase protein that can be modified include, for example, based on the N2 numbering, one or more amino acids within positions 29-35, one or more amino acids within positions 44-52, one or more amino acids within positions 144-154, one or more amino acids within positions 240-250, one or more amino acids within positions 326-333, one or more amino acids within positions 344-350, one or more amino acids within positions 365-375, and combinations thereof. For example, the amino acid can be any amino acid within these positions, such as any of the amino acids listed in the table below.

[0090] [Table 1]

[0091] In some cases, selected amino acids within positions 29-35, 44-52, 144-154, 326-333, 344-350, and 365-375 can have conservative substitutions. However, in other cases, selected amino acids within positions 29-35, 44-52, 144-154, 326-333, 344-350, and 365-375 can have non-conservative amino acid substitutions.

[0092] For example, the modified neuraminidase can be deleted of at least one proline, asparagine, glutamine, valine, or a combination of proline, one or more asparagine, glutamine, and valine within positions 44-52 of the modified neuraminidase. The modified neuraminidase can have a threonine substitution within positions 29-35, where the replacement is any amino acid. The modified neuraminidase can have a threonine or aspartic acid substitution within positions 145-154 or 365-375, where the replacement is any amino acid. The modified neuraminidase can have an asparagine substitution within positions 326-333, where the replacement is any amino acid. The modified neuraminidase can have a histidine substitution within positions 345-350, where the substitution is any amino acid. Exemplary substitutions of various types of amino acids are shown in the table above.

[0093] An example of an influenza A virus (A / Yokohama / 2013 / 2003(H3N2)) neuraminidase protein sequence is shown below. [Table 2]

[0094] Amino acids that can be modified to improve the stability of co-expressed HA are highlighted in bold and underlined in the sequence above. A nucleic acid encoding such an influenza A virus (A / Yokohama / 2013 / 2003(H3N2)) neuraminidase protein sequence is shown below. [Table 3]

[0095] Modifications at specific positions in neuraminidase can enhance viral growth.

[0096] Another example of an influenza A virus (A / Yokohama / 2013 / 2003 (H3N2)) neuraminidase sequence is shown below, with the positions of modifications highlighted in bold and underlined. [Table 4]

[0097] Amino acids that can be modified to improve the stability of co-expressed HA are highlighted in bold and underlined in the sequence above.

[0098] In some cases, one or more modifications can be introduced into the HA, PA, PB1, PB2, NP, M1, M2, NS2, PB1-F2, PA-X, and / or NS1 proteins (and nucleic acids encoding such proteins).

[0099] Enhanced growth of the virus upon passaging in embryonated chicken eggs or cell culture is observed when the modified NA protein is expressed, and such expression results in significantly higher virus titers. Thus, the present invention provides a method for producing influenza viruses with enhanced replication in cell culture or in embryonated chicken eggs. The method includes providing cells suitable for influenza vaccine production; modifying a nucleic acid encoding neuraminidase; and isolating a virus lineage with enhanced growth compared to one or more unmodified virus isolates. In some cases, the method for producing influenza viruses with enhanced replication in cell culture includes continuously culturing one or more influenza virus isolates in embryonated chicken eggs; and isolating a continuously cultured virus with enhanced growth compared to the one or more isolates prior to the continuous culture. In some cases, the virus may be grown or passaged in cells in culture, such as MDCK or Vero cells.

[0100] The modified neuraminidase can be expressed in various influenza strains. For example, the A / Puerto Rico / 8 / 34 (H1N1), "PR8" virus often serves as the genetic backbone for generating inactivated influenza vaccines. Some vaccine strains based on PR8 can replicate at relatively low titers in eggs and cell culture, slowing vaccine production and resulting in vaccine shortages. However, expression of the modified neuraminidase described herein can improve replication of PR8 (and other) influenza strains.

[0101] In one embodiment of the invention, vectors for vRNA production can include a vector comprising a promoter operably linked to modified NA DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to PB1 DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to PB2 DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to HA DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to NP DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to NA DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to M DNA linked to a transcription termination sequence, and a vector comprising a promoter operably linked to NS DNA linked to a transcription termination sequence. In one embodiment, DNA for vRNA production of PB1, PB2, PA, NP, M, and NS has sequences from influenza viruses that replicate at high titers in cultured mammalian cells such as MDCK cells, Vero cells, or PER.C6® or in embryonated eggs, and / or from vaccine viruses that do not cause significant disease in humans, for example. DNA for vRNA production of NA can be from any NA, for example, any of N1-N11, and DNA for vRNA production of HA can be from any HA, for example, any of H1-H18. In one embodiment, DNA for vRNA production can be for influenza B or influenza C. DNA for vRNA production of NA and HA can be from different lineages or isolates (6:1:1 reassortants) or the same lineage or isolate (6:2), or NA can be from the same lineage or isolate as the internal genes (7:1 reassortants). Vectors for mRNA production can include a vector encoding a modified NA, a vector encoding influenza virus PA, a vector encoding influenza virus PB1, a vector encoding influenza virus PB2, and a vector encoding influenza virus NP, and optionally one or more vectors encoding NP, NS, M, e.g., M1 and M2, HA, or NA.Vectors encoding viral proteins may further include a transcription termination sequence.

[0102] Other reassortants with internal genes from other PR8 isolates or vaccine viruses can be used in the recombinant reassortant viruses of the invention. In particular, a 5:1:2 reassortant with UW-PR8 PB1, PB2, PA, NP, and M ("5") and PR8(Cam)NS ("1"); a 6:1:1 reassortant with UW-PR8(modified) NA, PB1, PB2, PA, NP, and M ("6") and PR8(Cam)NS ("1"); and a 7:1 reassortant with UW-PR8 PB1, PB2, PA, NP, and M, (modified) NA, and NS ("7").

[0103] A neuraminidase that may be modified may have a different sequence than those described herein. However, in some cases, a modified neuraminidase may have substantially the same activity as the corresponding polypeptide described by the sequence herein. As used herein, "substantially the same activity" includes detectable protein level activity that is about 0.1%, 1%, 10%, 30%, 50%, 90%, e.g., up to 100% or more activity, or about 80%, 90% or more protein level activity of the corresponding protein described herein. In one embodiment, a nucleic acid encodes a polypeptide that is substantially the same, e.g., has at least 80%, e.g., 90%, 92%, 95%, 97%, 98%, or 99% (including any integer between 80 and 99) contiguous amino acid sequence identity to a polypeptide encoded by one of the sequences described herein. In one embodiment, an isolated and / or purified nucleic acid molecule comprises a substantially identical nucleic acid sequence, e.g., at least 50%, e.g., at least 60%, 70%, 80% or 90% (including any integer between 50-100), or more contiguous nucleic acid sequence identity, to one of the nucleic acid sequences described herein. In one embodiment, the nucleic acid also encodes a polypeptide having at least 80%, e.g., 90%, 92%, 95%, 97%, 98%, or 99% (including any integer between 80-99), contiguous amino acid sequence identity to a polypeptide described herein.

[0104] In one embodiment, the modified influenza virus neuraminidase polypeptide has one or more, e.g., a combination of conservative and non-conservative amino acid substitutions, e.g., up to 10% or 20% conservative substitutions of the residues, or 2, 5, 10, 15, 20 or more conservative amino acid substitutions compared to a polypeptide having one of the sequences described herein, e.g., 2, 5, 10, 15, 20 or more up to 10% or 20% conservative amino acid substitutions.

[0105] Thus, the invention includes the use of isolated and purified vectors or plasmids that express or encode influenza viral proteins or that express or encode influenza vRNA (both natural and recombinant vRNA). The vectors contain influenza cDNA, e.g., influenza A (e.g., any influenza A gene, including any 18 HA or 11 NA subtype), B or C DNA (see Fields Virology (Fields et al. (eds.), Lippincott, Williams and Wickens (2006), which is specifically incorporated herein by reference). Any suitable promoter or transcription termination sequence can be used to express a protein or peptide, e.g., a viral protein or peptide, a protein or peptide of a non-viral pathogen, or a therapeutic protein or peptide.

[0106] The composition or vectors of the invention may also contain a heterologous gene or open reading frame of a gene of interest, e.g., a foreign gene encoding an immunogenic peptide or protein useful as a vaccine or in gene replacement, e.g., an epitope useful in cancer therapy or vaccine, or a peptide or polypeptide useful in gene therapy. When preparing a virus, the vector or plasmid containing the gene of interest or cDNA may be substituted for or added to the vector or plasmid of all influenza virus genes. Thus, other embodiments of the invention include the above compositions or vectors in which one of the vectors is replaced with or further comprises a desired nucleic acid sequence linked to a 3' influenza virus sequence, optionally including a 3' influenza virus coding sequence or a portion thereof, e.g., a 5' influenza virus sequence, optionally including a 5' influenza virus coding sequence or a portion thereof, linked to a desired cDNA. In one embodiment, the desired nucleic acid sequence, such as a cDNA, is in the antisense (antigenome) orientation. When such a vector is conjugated with the other vectors described above and introduced into a host cell permissive for influenza virus replication, a recombinant virus is generated that contains a vRNA corresponding to the heterologous sequence of the vector.

[0107] The promoter of the vector for vRNA production can be an RNA polymerase I promoter, an RNA polymerase II promoter, an RNA polymerase III promoter, a T7 promoter, or a T3 promoter, and optionally includes a transcription termination sequence, such as an RNA polymerase I transcription termination sequence, an RNA polymerase II transcription termination sequence, an RNA polymerase III transcription termination sequence, or a ribozyme. Ribozymes within the scope of the present invention include, but are not limited to, Tetrahymena ribozyme, RNase P, hammerhead ribozyme, hairpin ribozyme, hepatitis ribozyme, and synthetic ribozymes. In one embodiment, the RNA polymerase I promoter is a human RNA polymerase I promoter.

[0108] The promoter or transcription termination sequence of the vRNA or viral protein expression vector may be the same or different compared to the promoter or any other vector. In one embodiment, the vector or plasmid expressing influenza vRNA contains a promoter suitable for expression in at least one particular host cell, e.g., an avian cell or a primate cell, including a canine, feline, equine, bovine, ovine, or human cell, or for expression in more than one host.

[0109] In one embodiment, at least one vector for vRNA contains an RNA polymerase II promoter linked to another ribozyme sequence and optionally linked to an RNA polymerase II transcription termination sequence. In one embodiment, at least two, for example, 3, 4, 5, 6, 7 or 8 vectors for vRNA production contain an RNA polymerase II promoter, a first ribozyme sequence that is 5' of a sequence corresponding to a viral sequence including a viral coding sequence, 5' of a second ribozyme sequence, and 5' of a transcription termination sequence. Each RNA polymerase II promoter of each vRNA vector may be the same or different from the RNA polymerase II promoter of any other vRNA vector. Similarly, each ribozyme sequence of each vRNA vector may be the same or different from the ribozyme sequence of any other vRNA vector. In one embodiment, the ribozyme sequences in a single vector are not identical.

[0110] In one embodiment, the invention provides a vector for vRNA production comprising a promoter operably linked to a modified influenza virus NA DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus PA DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus PB1 DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus PB2 DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus HA DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus NP DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus NA DNA linked to a transcription termination sequence, a vector for vRNA production comprising a promoter operably linked to influenza virus M DNA linked to a transcription termination sequence, and a vector for vRNA production comprising a promoter operably linked to influenza virus NS DNA linked to a transcription termination sequence. and vectors for vRNA production comprising a promoter operably linked to DNA, wherein the modified NA, PB1, PB2, PA, NP, NS, and M DNA is derived from one or more influenza vaccine seed viruses and has two or more characteristic residues at specific positions; and vectors for mRNA production comprising a promoter operably linked to a DNA segment encoding the NA of an influenza virus, vectors for mRNA production comprising a promoter operably linked to a DNA segment encoding the PA of an influenza virus, vectors for mRNA production comprising a promoter operably linked to a DNA segment encoding the PB1 of an influenza virus, vectors for mRNA production comprising a promoter operably linked to a DNA segment encoding the PB2 of an influenza virus, vectors for mRNA production comprising a promoter operably linked to a DNA segment encoding the NP of an influenza virus, and optionallyA plurality of influenza virus vectors for reassortment is provided, including a vector for mRNA production comprising a promoter operably linked to a DNA segment encoding influenza virus HA, a vector for mRNA production comprising a promoter operably linked to a DNA segment encoding influenza virus NA, a vector for mRNA production comprising a promoter operably linked to a DNA segment encoding influenza virus M1, a vector for mRNA production comprising a promoter operably linked to a DNA segment encoding influenza virus M2, a vector for mRNA production comprising a promoter operably linked to a DNA segment encoding influenza virus NS1, or a vector for mRNA production comprising a promoter operably linked to a DNA segment encoding influenza virus NS2. In one embodiment, at least one vector comprises a sequence corresponding to a sequence encoding PB1, PB2, PA, NP, M, or NS, or a portion thereof, and has substantially the same activity as the corresponding polypeptide described herein or the corresponding polypeptide encoded by the nucleic acid described herein. Optionally, two vectors can be used instead, a vector containing a promoter operably linked to an influenza virus M cDNA linked to a transcription termination sequence, e.g., a vector containing a promoter operably linked to an influenza virus M1 cDNA linked to a transcription termination sequence and a vector containing a promoter operably linked to an influenza virus M2 cDNA linked to a transcription termination sequence.

[0111] The vectors of the present invention may be physically linked, or each vector may be present on an individual plasmid or other, e.g., linear, nucleic acid delivery vehicle. In one embodiment, each vRNA production vector is present on an individual plasmid. In one embodiment, each mRNA production vector is present on an individual plasmid.

[0112] The invention also provides a method of preparing influenza virus. The method includes contacting a cell with a plurality of vectors of the invention, e.g., sequentially or simultaneously, in an amount effective to produce infectious influenza virus. The invention also includes isolating the virus from a cell contacted with a plurality of vectors. Thus, the invention further provides isolated viruses as well as host cells contacted with a plurality of vectors or viruses of the invention. In other embodiments, the invention includes contacting a cell with one or more vectors, either a vRNA or a protein producing vector, prior to another vector, either a vRNA or a protein producing vector. In one embodiment, the promoter for the vRNA vector used in the method is an RNA polymerase I promoter, an RNA polymerase II promoter, an RNA polymerase III promoter, a T3 promoter, or a T7 promoter. In one embodiment, the RNA polymerase I promoter is a human RNA polymerase I promoter. In one embodiment, each vRNA vector used in the method is present on a separate plasmid. In one embodiment, each vRNA vector used in the method is present on one plasmid or on two or three different plasmids. In one embodiment, the mRNA vector used in the method is present on a separate plasmid. In one embodiment, the mRNA vectors for PA, PB1, PB2 and NP used in the method are present on one plasmid or on two or three different plasmids.

[0113] The invention will be understood from the following non-limiting examples. EXAMPLES

[0114] Example 1 Example of a viral sequence from the master vaccine lineage (PR8UW) HA

[0115] THAT

[0116] PA AGCGAAAGCA GGTACTGATC CAAAATGGAA GATTTTGTGC GACAATGCTT CAATCCGATG ATTGTCGAGC TTGCGGAAAA AACAATGAAA GAGTATGGGG AGGACCTGAA AATCGAAACA AACAAATTTG CAGCAATATG CACTATCACTTCTCG GAA TTCATCAATG AGCAAGGCGA GTCAATAATC GTAGAACTTG GTGATCCAAA TGCACTTTTG AAGCACAGAT TTGAAATAAT CGAGGGAAGA GATCGCACAA TGGCCTGGAC AGTAGTAAAC AGTATTTGCA ACACTACAGG GGCTGATTGATTGAAA TACCAAAGTT GATTCATCGA AATTGGAGTA ACAAGGAGAG AAGTTCACAT ATACTATCTG GAAAAGGCCA ATAAAATTAA ATCTGAGAAA ACACACATCC ACATTTTCTC GTTCACTGGG GAAGAAATGG CCACAAAGGC AGACTACACT CTCGATGAAGAC T AAGATTCAAGCCA ACAAGAAATG GCCAGCAGAG GCCTCTGGGA TTCCTTTCGT CAGTCCGAGA GAGGAGAAGA GACAATTGAA GAAAGGTTTG AAATCACAGG AACAATGCGC AAGCTTGCCG ACCAAAGTCT CCCGCCGAAC TTCTCCAGCC TTGAAAATCGAATT TAGAGCTACGATC GAGGGCAAGC TGTCTCAAAT GTCCAAAGAA GTAAATGCTA GAATTGAACC TTTTTTGAAA ACAACACCAC GACCACTTAG ACTTCCGAAT GGGCCTCCCT GTTCTCAGCG GTCCAAATTC CTGCTGATGG ATGCCTTAAA ATTAAGCATT GAGGACCCAAGTCATGAAGG AGAGGGAATA CCGCTATATG ATGCAATCAA ATGCATGAGA ACATTCTTTG GATGGAAGGA ACCCAATGTT GTTAAACCAC ACGAAAAGGG AATAAATCCA AATTATCTC TGTCATGGAA GCAAGTACTG GCAGAACTGC AGGACATTGA AGAATGAATCAAATCAAGAAATCAA TATGAAGAAA ACAAGTCAGC TAAAGTGGGC ACTTGGTGAG AACATGGCAC CAGAAAAGGT AGACTTTGAC GACTGTAAAG ATGTAGGTGA TTTGAAGCAA TATGATAGTG ATGAACCAGA ATTGAGGTCG CTTGCAAGTT GGATTCAGAA TGAGTTTAAC AGCATCAG AGCCAGAG ATTGACTGAG ATAGAGCTCG ATGAGATTGG AGAAGATGTG GCTCCAATTG AACACATTGC AAGCATGAGA AGGAATTATT TCACATCAGA GGTGTCTCAC TGCAGAGCCA CAGAATACAT AATGAAGGGA GTGTACATCA ATACTGCCTT GCTTAATGCA TCTTGTAG GCATTGA TTCCATTGA TAAGCAAGTG TAGAACTAAG GAGGGAAGGC GAAAGACCAA CTTGTATGGT TTCATCATAA AAGGAAGATC CCACTTAAGG AATGACACCG ACGTGGTAAA CTTTGTGAGC ATGGAGTTTT CTCTCACTGA CCCAAGACTT GAACCACATA AATGGGAGAGTAGTTGATTGATGATGTTG TATAAGAAGT GCCATAGGCC AGGTTTCAAG GCCCATGTTC TTGTATGTGA GAACAAATGG AACCTCAAAA ATTAAAATGA AATGGGGAAT GGAGATGAGG CGTTGCCTCC TCCAGTCACT TCAACAAATT GAGAGTATGA TTGAAGCTGAGTCCTCTGTC AAAGAGAAAG ACATGACCAA AGAGTTCTTT GAGAACAAAT CAGAAACATG GCCCATTGGA GAGTCCCCCA AAGGAGTGGA GGAAAGTTCC ATTGGGAAGG TCTGCAGGAC TTTATTAGCA AAGTCGGTAT TCAACAGCTT GTATGCATCT CCACAACTAG AAGGATTTTC AGCTGAATCA AGAAAACTGC TTCTTATCGT TCAGGCTCTT AGGGACAACC TGGAACCTGG GACCTTTGAT CTTGGGGGGC TATATGAAGC AATTGAGGAG TGCCTGATTA ATGATCCCTG GGTTTTGCTT AATGCTTCTT GGTTCAACTC CTTCCTTACA CATGCATTGA GTTAGTTGTG GCAGTGCTAC TATTTGCTAT CCATACTGTC CAAAAAAGTA CCTTGTTTCT ACT (SEQ ID NO: 24)

[0117] PB1

[0118] PB2 AGCGAAAGCA GGTCAATTAT ATTCAATG GAAAGAATAA AAGAACTACG AAATCTAATG TCGCAGTCTC GCACCCGCGA GATACTCACA AAAACCCCCG TGGCCATATC AAGAAGTACA CATCAGGAAG ACAGGAGAG AAGCCAGATGAATGATTAC ATCCAATTAC CHANGE AGGATACGG AAATGATTCC TGAGAGAAT CHANGE AGGATACGAC AAACTTTATG GAGTAAAATG AATGATGCCG GATCATTACG AGTGGTA TCACCTCTGG CTGTGACCATG GTGGACTAA ATTAACCATTACCAA TTTTGAAAGA GTCGAAAGGC TAAAGCATGG AACCTTTGGC CCTGTCCATT TTAGAAACCA AGTCAAAATA CGTCGGAGAG TTGACATAAA TCCTGGTCAT GCAGATCTCA GTGCCAAGGA GGCACAGGAT GTAATCATGG AAGTTGATGATTACTT GTGTAACATCA CCCTAACAT ASSISTANCE TAACCAAAGA GAGAAAAA GAACTCCAGG ATTGCAAAAT TTCTCCTTTG ATGGTTGCAT ACATGTTGGA GGAGAACTG GTCCGCAAAA CGAGATTCCT CCCAGTGGCT GGTGGAACAA GCAGTGTGTA ASSISTANCE GAACTAGGAGTAT CTCAGATGATTA CTCCAGGAGG GGAAGTGAGG AATGATGATG TTGATCAAAG CTTGATTATT GCTGCTAGGA ACATAGTGAG AAGAGCTGCA GTATCAGCAG ATCCACTAGC ATCTTTATTG GAGATGTGCC ACAGCACACA GATTGGTGGA ATTAGGATGGTAGACATCCT TAGGCAGAAC CCAACAGAAG AGCAAGCCGT GGATATATGC AAGGCTGCAA TGGGACTGAG AATTAGCTCA TCCTTCAGTT TTGGTGATT CACATTTAAG AGAACAAGCG GATCATCAGT CAAGAGAG GAAGAGGTGC TTACGGGCAA TCTTCAAAA TTGAAGATAA GAGTGCATGA GGGATATGAA GAGTTCACAA TGGTTGGGAG AAGAGCAACA GCCATACTCA GAAAAGCAAC CAGGAGATTG ATTCAGCTGA TAGTGAGTG GAGAGACGAA CAGTCGATTG CCGAAGCAAT AATTGTGGCC ATGGTATTTT CACAAGAGGA TTGTATGATA AAAGCAGTCA GAGGTGATCT GAATTTCGTC AATAGGGCGA ATCAACGATT GAATCCTATG CATCAACTTT TAAGACATTT TCAGAAGGAT GCGAAAGTGC TTTTTCAAAA TTGGGGAGTT GAACCTATCG ACAAATGTGAT GGGAATGATT GGGATATTGC CCGACATGAC TCCAAGCATC GAGATGTCAA TGAGAGGAGT GAGAATCAGC AAAATGGGTG TAGATGAGTA CTCCAGCACG GAGAGGGTAG TGGTGAGCAT TGACCGTTTT TTGAGAATCC GGGACCAACG AGGAAATGTA CTACTGTCTC CCGAGGAGGT CAGTGAAACA CAGGGAACAG AGAAACTGAC AATAACTTAC TCATCGTCAA TGATGTGGGA GATTAATGGT CCTGAATCAG TGTTGGTCAA TACCTATCAA TGGATCATCA GAAACTGGGA AACTGTTAAA ATTCAGTGGT CCCAGAACCC TACAATGCTA TACAATAAA TGGAATTTGA ACCATTTCAG TCTTTAGTAC CTAAGGCCAT TAGAGGCCAA TACAGTGGGT TTGTAAGAACTCTGTTCCAA CAAATGAGGG ATGTGCTTGG GACATTTGAT ACCGCACAGA TAATAAAACT TCTTCCCTTC GCAGCCGCTC CACCAAAGCA AAGTAGAATG CAGTTCTCCT CATTTACTGT GAATGTGAGG GGATCAGGAA TGAGAATACT TGTAAGGGGC AATTCTCCTG TATTCAACTA TAACAAGGCC ACGAAGAGAC TCACAGTTCT CGGAAAGGAT GCTGGCACTT TAACTGAAGA CCCAGATGAA GGCACAGCTG GAGTGGAGTC CGCTGTTCTG AGGGATTCC TCATTCTGGG CAAAGAAGAC AAGAGATATG GGCCAGCACT AAGCATCAAT GAACTGAGCA ACCTTGCGAA AGGAGAGAAG GCTAATGTGC TAATTGGGCA AGGAGACGTG GTGTTGGTAA TGAAACGGAA ACGGGACTCT AGCATACTTA CTGACAGCCA GACAGCGACC AAAAGAATTC GGATGGCCAT CAATTAGTGT CGAATAGTTT AAAAACGACC TTGTTTCTAC T (Chapter 26)

[0119] NP AGCAAAAAGCA GGGTAGATAA TCACTCACTG AGTGACATCA AAATCATGGC GTCTCAAGGC ACCAAACGAT CTTACGAACA GATGGAGACT GATGGAGAAC GCCAGAATGC CACTGAAATC AGAGCATCCG TCGGAAAAAT GATTGGTGGA ATTGCGACATCCGAT TCAGTGATTA TGAGGGACGG TTGATCCAAA ACAGCTTAAC AATAGAGAGA ATGGTGCTCT CTGCTTTTGA CGAAAGGAGA AATAAATACC TTGAAGAACA TCCCAGTGCG GGGAAAGATC CTAAGAAAAC TGGAGGACCT ATATGACTGACTGGA ATCAGATCGAACC CAAAGAAA ATAAGGCGAA TCTGGCGCCA AGCTAATAAT GGTGACGATG CAACGGCTGG TCTGACTCAC ATGATGATCT GGCATTCCAA TTTGAATGAT GCAACTTATC AGAGGACAAG AGCTCTTGTT CGCACCGGAA TGCTAGCTGACTAG GATGTCAACTGCTAG TCTGGAGCCG CAGGTGCTGC AGTCAAAGGA GTTGGAACAA TGGTGATGGA ATTGGTCAGA ATGATCAAAC GTGGGATCAA TGATCGGAAC TTCTGGAGGG GTGAGATGG ACGAAAAACA AGAATTGCTT ATGAAAGAAT GTTCAAGAACAATT ATCAATT TGGATCAAGT GAGAGAGAGC CGGAACCCAG GGAATGCTGA GTTCGAAGAT CTCACTTTTC TAGCACGGTC TGCACTCATA TTGAGAGGGT CGGTTGCTCA CAAGTCCTGC CTGCCTGCCT GTGTGTATGG ACCTGCCGTA GCCAGTGGGTACGACTTTGA AAGGGAGGGA TACTCTCTAG TCGGAATAGA CCCTTTCAGA CTGCTTCAAA ACAGCCAAGT GTACAGCCTA ATCAGACCAA ATGAGAATCC AGCACACAAG AGTCAACTGG TGTGGATGGC ATGCCATTCT GCCGCATTTG AAGATCTAAG AGTATTAAGC TTCATCAAAG GGACGAAGGT GCTCCCAAGA GGGAAGCTTT CCACTAGAGG AGTTCAAATT GCTTCCAATG AAAATATGGA GACTATGGAA TCAAGTACAC TTGAACTGAG AAGCAGGTAC TGGGCCATAA GGACCAGAAG TGGAGGAAAC ACCAATCAAC AGAGGGCATC TGCGGGCCAA ATCAGCATAC AACCTACGTT CTCAGTACAG AGAAATCTCC CTTTTGACAG AACAACCATT ATGGCAGCAT TCAATGGGAA TACAGAGGGG AGAACATCTG ACATGAGGAC CGAAATCATA AGGATGATGG AAAGTGCAAG ACCAGAAGAT GTGTCTTTCC AGGGGCGGGG AGTCTTCGAG CTCTCGGACG AAAAGGCAGC GAGCCCGATC GTGCCTTCCT TTGACATGAG TAATGAAGGA TCTTATTTCT TCGGAGACAA TGCAGAGGAG TACGACAATT AAAGAAAAAT ACCCTTGTTT CTACT (SEQ ID NO: 27)

[0120] M AGCAAAAGCA GGTAGATATT GAAAGATGAG TCTTCTAACC GAGGTCGAAA CGTACGTACT CTCTATCATC CCGTCAGGCC CCCTCAAAGC CGAGATCGCA CAGAGACTTG AAGATGTCTT TGCAGGGAAG AACACCGATC TTGAGGTTCT CATGGAATGG CTAAAGACAA GACCAATCCT GTCACCTCTG ACTAAGGGGA TTTTAGGATT TGTGTTCACG CTCACCGTGC CCAGTGAGCG AGGACTGCAG CGTAGACGCT TTGTCCAAAA TGCCCTTAAT GGGAACGGGG ATCCAAATAA CATGGACAAA GCAGTTAAAC TGTATAGGAA GCTCAAGAGG GAGATAACAT TCCATGGGGC CAAAGAAATC TCACTCAGTT ATTCTGCTGG TGCACTTGCC AGTTGTATGG GCCTCATATA CAACAGGATG GGGGCTGTGA CCACTGAAGT GGCATTTGGC CTGGTATGTG CAACCTGTGA ACAGATTGCT GACTCCCAGC ATCGGTCTCA TAGGCAAATG GTGACAACAA CCAATCCACT AATCAGACAT GAGAACAGAA TGGTTTTAGC CAGCACTACA GCTAAGGCTA TGGAGCAAAT GGCTGGATCG AGTGAGCAAG CAGCAGAGGC CATGGAGGTT GCTAGTCAGG CTAGACAAAT GGTGCAAGCG ATGAGAACCA TTGGGACTCA TCCTAGCTCC AGTGCTGGTC TGAAAAATGA TCTTCTTGAA AATTTGCAGG CCTATCAGAA ACGAATGGGG GTGCAGATGC AACGGTTCAA GTGATCCTCT CACTATTGCC GCAAATATCA TTGGGATCTT GCACTTGACA TTGTGGATTC TTGATCGTCT TTTTTTCAAA TGCATTTACC GTCGCTTTAA ATACGGACTG AAAGGAGGGC CTTCTACGGAAGGAGTGCCA AAGTCTATGA GGGAAGAATA TCGAAAGGAA CAGCAGAGTG CTGTGGATGC TGACGATGGT CATTTTGTCA GCATAGAGCT GGAGTAAAAA ACTACCTTGT TTCTACT (SEQ ID NO: 28)

[0121] NS AGCAAAAGCA GGGTGACAAA AACATAATGG ATCCAAACAC TGTGTCAAGC TTTCAGGTAG ATTGCTTTCT TTGGCATGTC CGCAAACGAG TTGCAGACCA AGAACTAGGC GATGCCCCAT TCCTTGATCG GCTTCGCCGA GATCAGAAAT CCCTAAGAGG AAGGGGCAGT ACTCTCGGTC TGGACATCAA GACAGCCACA CGTGCTGGAA AGCAGATAGT GGAGCGGATT CTGAAAGAAG AATCCGATGA GGCACTTAAA ATGACCATGG CCTCTGTACC TGCGTCGCGT TACCTAACTG ACATGACTCT TGAGGAAATG TCAAGGGACT GGTCCATGCT CATACCCAAG CAGAAAGTGG CAGGCCCTCT TTGTATCAGA ATGGACCAGG CGATCATGGA TAAGAACATC ATACTGAAAG CGAACTTCAG TGTGATTTTT GACCGGCTGG AGACTCTAAT ATTGCTAAGG GCTTTCACCG AAGAGGGAGC AATTGTTGGC GAAATTTCAC CATTGCCTTC TCTTCCAGGA CATACTGCTG AGGATGTCAA AAATGCAGTT GGAGTCCTCA TCGGAGGACT TGAATGGAAT GATAACACAG TTCGAGTCTC TGAAACTCTA CAGAGATTCG CTTGGAGAAG CAGTAATGAG AATGGGAGAC CTCCACTCAC TCCAAAACAG AAACGAGAAA TGGCGGGAAC AATTAGGTCA GAAGTTTGAA GAAATAAGAT GGTTGATTGA AGAAGTGAGA CACAAACTGA AGATAACAGA GAATAGTTTT GAGCAAATAA CATTTATGCA AGCCTTACAT CTATTGCTTG AAGTGGAGCA AGAGATAAGA ACTTTCTCGT TTCAGCTTAT TTAGTACTAA AAAACACCCT TGTTTCTACT (SEQ ID NO: 29)

[0122] Example 2 Neuraminidase modification material Virus: Y2017: A / Yokohama / 2017 / 2003 (H3N2) HK4801: A / Hong Kong / 4801 / 2014(H3N2) Y2017-M3L4: Y2017 passaged 7 times in eggs HY-PR8: high yield PR8 (H1N1)

[0123] result The Y2017 virus was passaged seven times in eggs (three times in the amniotic cavity and then four times in the allantoic cavity). The progeny virus, Y2017-M3L4, grew efficiently in the allantoic cavity but not in the allantoic cavity (10 7 ~about 10 8 PFU / mL), whereas the original Y2017 virus did not grow at all (<10 PFU / mL).

[0124] The mutations observed in the Y2017-M3L4 virus are as follows: [Table 5]

[0125] The growth ability of mutant Y2017 viruses generated by reverse genetics in allantoic fluid was compared, revealing that the NA mutation was responsible for the high growth of Y2017-M3L4 virus (Fig. 4). Plasmid viruses containing PB2-T147I were used for virus generation (PB2-T147I, V344L and PB2-T147I, V344L, E358K were not used in the analysis). No mutations were found in the HA gene of the viruses with the mutated NA segment and in other genes from wild-type Y2017 after replication in allantoic fluid (Fig. 4).

[0126] Figure 5 shows the location of the NA mutation in Y2017-M3L4 in the 3D model.

[0127] Comparing the growth ability of the Y2017 virus with the NA mutants revealed that NA-D147N, N329D, and H347Q commonly contributed to the increased growth ability in allantoic fluid (Fig. 6 ).

[0128] The Y2017-M3L4 NA allowed the virus carrying the HK4801HA to replicate efficiently in the allantoic cavity, and the HY-PR8 backbone further enhanced the growth of this virus (Fig. 7 ).

[0129] In summary, described herein are influenza virus mutations that inhibit (e.g., prevent) the acquisition of antigenic-impairing mutations in the influenza hemagglutinin (HA) protein during egg growth and / or allow for enhanced replication. In one embodiment, the mutations are in the neuraminidase (NA) viral segment of a human influenza virus, and the mutant NA protein stabilizes the HA protein during egg passage. Thus, in the presence of the mutant NA protein, the HA protein does not acquire egg-adaptive mutations. In some cases, the respective mutations in the NA can also increase the yield of the vaccine virus.

[0130] Example 3 Analysis of the growth ability of NA mutant viruses revealed that NA-D147N, N329D, and H347Q contributed to the increased growth ability of the virus in allantoic fluid (Fig. S12). After three passages in the allantoic cavity, no HA mutations were observed in viruses with HK4801HA, Y2017-M3L4NA, and HY-PR8 backbones (Fig. S3).

[0131] By passaging HY-PR8 backbone viruses carrying HK4801NA (T148K and saturation mutations N329X and H347X) and HK4801HA in eggs, a virus carrying HK4801NA emerged that replicated efficiently in the allantoic cavity (Figure 14; 4M = T148K, D151E, H347G, and T369K). No HA mutations were observed during egg passaging (once in the amniotic cavity, then five times in the allantoic cavity).

[0132] HK4801NA (T148K, D151E, H347G, and T369K) conferred efficient replication in the allantoic cavity to HY-PR8 backbone viruses carrying either HK4801NA or Singapore0019HA. Viral uptake: 2×10 in allantoic fluid. 3 pfu / egg, 37°C, 72 h incubation (Figure 16).

[0133] The HA-encoding nucleic acid sequence and the NA-encoding nucleic acid and amino acid sequences of Singapore0019 are shown below.

[0134] A / Singapore / INFINH-16-0019 / 2016(H3N2) HA

[0135] A / Singapore / INFINH-16-0019 / 2016(H3N2) NA This encodes the following M N P N Q K I I T I G S V S L T I S T I C F F M Q I A I L I T T V T L H F K Q Y E F N S P P N N Q V M L C E P T I I E R N I T E I V Y L T N T T I E K E I C P K P A E Y R N W S K P Q C G I T G F A P F S K D N S I R L S A G G D I W V T R E P Y V S C D P D K C Y Q F A L G Q G T T L N N V H S N N T V R D R T P Y R T L L M N E L G V P F H L G T K Q V C I A W S S S S C H D G K A W L H V C I T G D D K N A T A S F I Y N G R L I D S V V S W S K D I L R T Q E S E C V C I N G T C T V V M T D G N A T G K A D T K I L F I E E G K I V H T S K L S G S A Q H V E E C S C Y P R Y P G V R C V C R D N W K G S N R P I V D I N I K D H S I V S S Y V C S G L V G D T P R K N D S S S S S H C L N P N N E E G G H G V K G W A F D D G N D V W M G R T I N E T S R L G Y E T F K V V E G W S N P K S K L Q I N R Q V I V D R G D R S G Y S G I F S V E G K S C I N R C F Y V E L I R G R K E E T E V L W T S N S I V V F C G T S G T Y G T G S W P D G A D L N L M H I (SEQ ID NO: 48).

[0136] The NA mutations T153N, N329T, and T369K allowed A / Saitama / 102 / 2014 (H3N2) to replicate efficiently in the allantoic cavity (Kuwahara et al., 2018). Therefore, the effect of introducing NA-T153N, N329T (or D), T369K, and H347Q into HK4801NA (T148K) was examined. Figure 18 shows the viral titers of various combinations of NA residues identified in the screen. Figures 19 and 20 show the viral titers of viruses with different combinations of selected NA residues.

[0137] Example 4 Alaska / 232 / 2015_HY-PR8(H3N2)WT / mutant viruses were passaged in eggs and the HA and NA segments were sequenced. Alaska WT (recent H3N2 viruses, where WT was 245N before 2015, were 245S), HA-R142S, -K189E viruses did not develop mutations in HA even after 3 passages in amniotic membrane and 10 passages in allantois. HA-K189E / N158K / A212T mutant did not have mutations in HA but had some mutations in NA, which improved egg growth from p6 onwards (Figure 21). The difference in NA mutation between p4 (normal growth) (NA-N245S mutant, virus grows more than 1000 times more than NA-245N) and p6 (good growth) was G346V (Figure 22). Therefore, G346V may also contribute to egg adaptation.

[0138] The sequence of NA of A / Alaska / 232 / 2015 is shown below. [Table 6]

[0139] NA pHH21 plasmids were constructed: Alaska NA-T148K / D151E / N245S (found in E4); Alaska NA-G346V; and Alaska NA-T148K / D151E / N245S / G346V (found in E6). Mutant NAs were combined with WT Alaska HA or HY-PR8 backbones. Eggs were inoculated with equal doses of WT / mutant Alaska viruses and the recovered viruses were titrated (FIG. 23). The NA-T148K / D151E / N245S / G346V mutant virus had improved titers over the WT, while the single mutation G346V did not increase virus growth compared to the WT. These results suggest that the combination of G346V and one (or two or three) other mutations, such as T148K, D151E, and N245S, may be important for the efficient growth of Alaska virus in eggs. Recovered virus samples with high titers (>5Log10 PFT / mL) were sequenced, but had no additional mutations in the HA and NA.

[0140] References Avery's Drug Treatment: Principles and Practice of Clinical Pharmacology and Therapeutics , 3rd edition, ADIS Press, Ltd., Williams and Wilkins, Baltimore, MD (1987). Aymard-Henry et al. Virology: A Practical Approach , Oxford IRL Press, Oxford, 119-150 (1985). Bachmeyer, Intervirology , 5 :260 (1975). Berkow et al., eds. The Merck Manual , 16th edition, Merck & Co., Rahway, NJ (1992). Hatta et al. Science , 293 :1840 (2001). Horimoto et al. J. Virol. , 68:3120 (1994). Horimoto et al., Vaccine , 24 :3669 (2006). Keitel et al., in Textbook of Influenza, eds. Nickolson, K. G., Webster, R. G., and Hay, A. (Blackwell, Oxford), pp. 373-390 (1998). Kuwahara et al., Jpn. J. Infect. Dis. , 71 :234 (2018). Laver & Webster, Virology , 69 :511 (1976). Neumann et al., Adv. Virus Res. , 53 :265 (1999). Neumann et al., J. Gen. Virol. , 83 :2635 (2002). Neumann et al., J. Virol. , 71 :9690 (1997). Neumann et al., Proc. Natl. Acad. Sci. USA , 96 :9345 (1999). Neumann et al., Virology , 287 :243 (2001). Osol (ed.), Remington's Pharmaceutical Sciences , Mack Publishing Co., Easton, PA 1324-1341 (1980). Sugawara et al., Biological , 30 :303 (2002). Webby & Webster et al., Science , 302 :1519 (2003). Wood & Robertson, Nat. Rev. Microbiol. , 2:842 (2004). World Health Organization TSR No. 673 (1982). World Health Organization. Confirmed human cases of avian influenza A (H5N1). http: / / www.who.int / csr / disease / avian_influenza / country / en / index.html

[0141] All publications, patents and patent applications are incorporated herein by reference. In the foregoing specification, the invention has been described in connection with certain preferred embodiments thereof, and numerous details have been set forth for purposes of illustration. It will be apparent to those skilled in the art that the invention may be provided with additional embodiments, and that the specific details described herein may be varied considerably without departing from the underlying principles of the invention.

Claims

Claim 1: An isolated recombinant influenza virus comprising a selected neuraminidase (NA) viral segment encoding NA having 346V and at least one of 148K, 151E and 245S, wherein the numbering is based on SEQ ID NO:3, the NA viral segment has at least 90% amino acid sequence identity to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, and the recombinant influenza virus is cultured in avian eggs, and when the recombinant influenza virus is cultured in eggs, the recombinant influenza virus has increased growth ability and / or no HA mutations during egg passage compared to an influenza virus having an NA viral segment encoding an NA without 148K, 151E, 245S and 346V, or with 148K, 151E, 347G and 369K, or with 148K, 151E and 245S; or An isolated recombinant influenza virus, wherein the NA viral segment encodes an NA having at least 90% amino acid sequence identity to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, and when the recombinant influenza virus is cultured in eggs, the recombinant influenza virus has increased growth ability and / or no HA mutations during egg passaging compared to an influenza virus having an NA viral segment encoding an NA without 148K, 151E, 347G and 369K, or encoding an NA without 148K, 151E and 245S.

2. 2. The isolated recombinant influenza virus of claim 1, wherein the isolated recombinant influenza virus is a reassortant.

3. 3. The isolated recombinant influenza virus of claim 1 or 2, wherein the NA viral segment encodes an NA having at least 95% amino acid sequence identity to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:

3.

4. 3. The isolated recombinant influenza virus of claim 1 or 2, wherein the NA viral segment encodes N2, N3, N7, or N9.

5. 3. The isolated recombinant influenza virus of claim 1 or 2, wherein the NA viral segment encodes N1, N4, N5, N6, N8, N10 or N11.

6. 6. The isolated recombinant influenza virus of any one of claims 1 to 5, wherein the hemagglutinin (HA) is H1, H3, H7, or H9.

7. An isolated recombinant influenza virus described in any one of claims 1 to 6, wherein the virus is an influenza A virus.

8. An isolated recombinant nucleic acid comprising a nucleic acid sequence of an influenza NA virus segment encoding a neuraminidase (NA) having 346V and at least one of 148K, 151E and 245S, wherein said numbering is based on SEQ ID NO:3, the NA viral segment has at least 90% amino acid sequence identity to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, and the recombinant influenza virus is cultured in avian eggs, and when the recombinant influenza virus is cultured in eggs, the recombinant influenza virus has increased growth ability and / or no HA mutations during egg passage compared to an influenza virus having an NA viral segment encoding an NA without 148K, 151E, 245S and 346V, or with 148K, 151E, 347G and 369K, or with 148K, 151E and 245S; or The isolated recombinant nucleic acid, wherein the NA viral segment encodes an NA having at least 90% amino acid sequence identity to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, and when the recombinant influenza virus is cultured in eggs, the recombinant influenza virus has increased growth ability and / or no HA mutations during egg passaging compared to an influenza virus having an NA viral segment encoding an NA without 148K, 151E, 347G and 369K, or encoding an NA without 148K, 151E and 245S.

9. A method for preparing influenza virus, comprising: (1) A vRNA production vector comprising a promoter operably linked to the influenza virus PA DNA linked to a transcription termination sequence, a vRNA production vector comprising a promoter operably linked to the influenza virus PB1 DNA linked to a transcription termination sequence, a vRNA production vector comprising a promoter operably linked to the influenza virus PB2 DNA linked to a transcription termination sequence, a vRNA production vector comprising a promoter operably linked to the influenza virus HA DNA linked to a transcription termination sequence, a vRNA production vector comprising a promoter operably linked to the influenza virus NP DNA linked to a transcription termination sequence, a vRNA production vector comprising a promoter operably linked to the influenza virus NA DNA linked to a transcription termination sequence, a vRNA production vector comprising a promoter operably linked to the influenza virus M DNA linked to a transcription termination sequence, and / or a vRNA production vector comprising a promoter operably linked to the influenza virus NS DNA linked to a transcription termination sequence, wherein the PB1, PB2, PA, NP, NS, and M DNA in the vRNA production vector are derived from one or more influenza virus isolates, the NA DNA of the vRNA production vector encodes an NA having 346V and at least one of 148K, 151E, and 245S, or the NA DNA of the vRNA production vector encodes 148K, 151E, 347G, and 369K, or encodes 148K, 151E, and 245S, the numbering is based on SEQ ID NO:3, and the NA viral segment encodes an NA having at least 90% amino acid sequence identity to a sequence represented by SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3; and (2) A vector for producing an mRNA comprising a promoter operably linked to a DNA segment encoding influenza virus PA, a vector for producing an mRNA comprising a promoter operably linked to a DNA segment encoding influenza virus PB1, a vector for producing an mRNA comprising a promoter operably linked to a DNA segment encoding influenza virus PB2, and / or a vector for producing an mRNA comprising a promoter operably linked to a DNA segment encoding influenza virus NP, in an amount effective to produce infectious influenza virus; wherein, when the recombinant influenza virus encoding the NA is cultured in eggs, the recombinant influenza virus has a higher growth ability during passaging in eggs and / or does not have an HA mutation compared to an influenza virus having an NA viral segment that encodes an NA without 148K, 151E, 245S and 346V, or that encodes an NA without 148K, 151E, 347G and 369K, or that encodes an NA without 148K, 151E and 245S.

10. The method of claim 9, wherein the NA has at least 95% amino acid sequence identity to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:

3.

11. The method of claim 9 or 10, wherein the NA is N2, N3, N7, or N9.

12. The method according to any one of claims 9 to 11, wherein the HA is H1, H3, H7, or H9.

13. The method according to any one of claims 9 to 11, wherein the HA is H2, H4, H5, H6, H8, or any one of H10 to H18.

14. An isolated virus prepared by the method of any one of claims 9 to 13.

15. A pharmaceutical composition for immunizing a bird or a mammal, comprising an effective amount of a virus according to any one of claims 1 to 7 and 14.

16. 16. The composition of claim 15, wherein the composition comprises at least one other different influenza virus.

17. The composition of claim 15 or 16, wherein the mammal is a human.

18. The method of any one of claims 15 to 17, wherein the composition is administered intranasally or via injection.

19. A method comprising passaging a virus according to any one of claims 1 to 8 and 14 in an egg.

20. The method of claim 9, further comprising contacting the cells with an mRNA producing vector comprising a promoter operably linked to a DNA segment encoding influenza virus HA, an mRNA producing vector comprising a promoter operably linked to a DNA segment encoding influenza virus NA, an mRNA producing vector comprising a promoter operably linked to a DNA segment encoding influenza virus M1, an mRNA producing vector comprising a promoter operably linked to a DNA segment encoding influenza virus M2, and / or an mRNA producing vector comprising a promoter operably linked to a DNA segment encoding influenza virus NS2, in an amount effective to produce infectious influenza virus.