PD-1 binding molecules and uses thereof

Abstract

The present invention provides PD-1 binding molecules, including anti-PD-1 single domain antibodies, whose complementarity determining regions (CDRs) comprise CDR1 as set forth in SEQ ID NO:1, CDR2 as set forth in SEQ ID NO:2, and CDR3 as set forth in SEQ ID NO:3.

Description

[Technical field]

[0001] The present invention relates to the field of biomedical or biopharmaceutical technology, more specifically to PD-1 and its uses. [Background technology]

[0002] Programmed death receptor 1 protein, also called PD-1 (programmed death1), is a transmembrane protein that is expressed on the surface of T cells and exerts an immunosuppressive effect. PD-1 has two ligand molecules, PD-L1 and PD-L2, respectively, which are expressed at relatively high levels on antigen-presenting cells. When PD-L1 and PD-L2 bind to PD-1, they act to negatively regulate the functional activity of T cells, and tumor cells can generally achieve "immune evasion" by highly expressing PD-L1 or PD-L2 (Lee L et al., J Clin Pharmacol. 2016 Feb;56(2):157-69). Therefore, PD-1 drugs achieve tumor killing through a positive regulatory effect on the immune system. Currently, PD-1 is also a synonym for immune checkpoint inhibitor therapy.

[0003] Due to their excellent efficacy in treating melanoma, two PD-1 monoclonal antibodies, Pembrolizumab (Keytruda) and Nivolumab (Opdivo), were approved by the FDA in 2014 and 2015, and their indications currently cover nearly 20 solid tumors (Prasad V et al., Semin Oncol. 2017 Apr;44(2):132-135.). Currently, there are already four PD-1 monoclonal antibody drugs on the market in China, namely, Hengrui Pharmaceutical's Camrelizumab, Baekje Shenzhou's Tislelizumab, Innovent's Sintilimab, and Kimitsu Bio's Toripalimab.

[0004] Research has shown that traditional scfv antibodies have low expression levels in T cells, making it difficult to fully exert the effect of PD-1 inhibitors, mainly due to the properties of scfv antibodies themselves, such as easy aggregation, mismatching due to folding, and low thermal stability (Martin N et al., Macromol Biosci. 2017 Feb;17(2)). On the other hand, nanobodies have the natural advantages of being easy to express, high stability, and high affinity, and due to the advantages of nanobodies themselves and the biological mechanism of PD-1, the development of PD-1 nanobodies has a very wide range of prospects for use. The development of novel anti-PD-1 single domain antibodies with excellent specificity, blocking activity, and clinical efficacy, as well as easy production, low cost, and reduced drug burden, has become an urgent problem to be solved. Summary of the Invention [Problem to be solved by the invention]

[0005] It is an object of the present invention to provide PD-1 binding molecules and uses thereof. [Means for solving the problem]

[0006] A first aspect of the invention provides a PD-1 binding molecule comprising an anti-PD-1 single domain antibody, the complementarity determining regions (CDRs) of said single domain antibody comprising CDR1, CDR2 and CDR3, wherein CDR1 comprises the sequence set forth in SEQ ID NO:1, CDR2 comprises the sequence set forth in SEQ ID NO:2 and CDR3 comprises the sequence set forth in SEQ ID NO:3. In one or more embodiments, SEQ ID NO:1 is GX1X2X3X4X5X6X7, where X1 is D, F, G, H, L or R, X2 is P, S or T, X3 is A, F, I, L, N, R, S or V, X4 is D, F, G, L, M, N or S, X5 is A, D, F, G, I, N, R, S or T, X6 is D, F, H, I, L, S, V, W or Y, and X7 is A, D, E, G, N, P, S or T. Exemplarily, CDR1 comprises a sequence set forth in any one of SEQ ID NOs: 4-39, 320. Preferably, SEQ ID NO:1 is GX1X2X3X4X5X6X7, where X1 is D, F, G, H, L or X is R, X2 is P, S or T, X3 is F or S, X4 is F or S, X5 is G, I or T, X6 is S or Y, and X7 is A or D. Exemplarily, CDR1 has SEQ ID Contains any one of the sequences shown in NO:16, 19, 36-39, 320. More preferably, SEQ ID NO:1 is GX1X2X3X4IX6X7, where X1 is D or R, X2 is P or T, X3 is S or F, X4 is F or S, X6 is S or Y, and X7 is A or D. Exemplarily, CDR1 comprises the sequence shown in SEQ ID NO:16 or 19. Or, more preferably, SEQ ID NO:1 is GX1X2FSX5YX7, where X1 is G, F, H, L or R, X2 is P, S or T, X5 is G, I or T, and X7 is A or D. Exemplarily, CDR1 comprises a sequence set forth in any one of SEQ ID NOs:19, 36-39, 320. In one or more embodiments, SEQ ID NO:2 is X1X2X3X4X5X6X7X8X9, where X1 is I, L, S, T or V, X2 is A, N, S or T, X3 is F, G, I, K, L, M, N, Q, R, S, T, W or Y, X4 is A, D, G, H, N, R, S or T, X5 is A, D, G, N, R, S or none, X6 is G or R, S or T, X7 is D, E, I, L, M, N, R, S, T or V, X8 is A, K, M, Q or T, and X9 is A or none. Exemplary, CDR2 comprises a sequence set forth in any one of SEQ ID NOs:40-75. Preferably, SEQ ID NO:2 is X1X2X3X4X5GX7TX9, where X1 is I or V, X2 is N, S or T, X3 is F, L or N, X4 is A, G, S or T, X5 is R or none, X7 is D, N, I or T, and X9 is none. Exemplary, CDR2 comprises a sequence set forth in any one of SEQ ID NOs:52, 53, 55, 72-75. More preferably, SEQ ID NO:2 is IX2X3X4X5GX7TX9, where X2 is N, S or T, X3 is L or N, X4 is A, S or T, X5 is R or none, X7 is D, I or N, and X9 is none. Exemplary, CDR2 comprises a sequence as set forth in any one of SEQ ID NOs:52, 53, 55, 72, 73. Or, more preferably, SEQ ID NO:2 is X1X2X3X4RGX7TX9, where X1 is I or V, X2 is N, S or T, X3 is F or L, X4 is A, G or S, X7 is D, N or T, and X9 is none. Or, CDR2 comprises SEQ ID NO:55 or a variant thereof, wherein the variant comprises one or more amino acid changes selected from: X1 I to V mutation, X2 N to S or T mutation, X3 L to F mutation, X4 S to A or G mutation, X7 D to N or T mutation. Exemplarily, CDR2 comprises a sequence as set forth in any one of SEQ ID NOs: 53, 55, 72-75. In one or more embodiments, SEQ ID NO:3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 where X1 is A, E, G, N, R, S, T or V, X2 is A, G, I, K, L, P, R, T or V, X3 is A, D, E, G, K, N, P, R, S, V or Y, X4 is A, C, D, E, G, I, K, L, R, S, T, V or Y, and X5 is A, C, D, F, G, H, I, K, L, N, P, Q, R, S, X6 is A, C, D, E, G, I, K, L, M, P, Q, R, S or Y, X7 is A, C, D, F, G, H, I, N, P, R, S, T, V or Y, X8 is A, C, D, E, G, I, R, S, T, V, W, Y or none, X9 is A, D, E, F, G, I, L, P, R, S, V, W, Y or none, X 10 is C, D, F, G, K, L, N, P, R, S, T, V, W, Y or None, X 11 is D, F, G, H, I, K, L, N, P, S, T, V, Y or None, X 12 is A, D, G, H, I, L, M, P, R, S, T, V, Y or None, X 13 is C, D, E, H, P, R, S, T, V, Y or None, X 14 is A, D, E, F, H, I, L, P, R, T, Y or None, X 15 is A, D, E, G, N, Q, R, S, T, V, Y or None, X 16 is A, D, E, F, G, H, M, P, S, V, Y or None, X 17 is A, D, E, H, N, Q, R, T, Y or None, X 18 is D, E, R, S, Y or none, and X 19 is N, S, Y or None, X 20is D, E, Y or none, X 21 is E, N, Y or None, X 22 is Y or absent. Exemplarily, the CDR3 comprises a sequence set forth in any one of SEQ ID NOs: 76-183. Preferably, SEQ ID NO:3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 where X1 is E, G, N or V, X2 is A, G, I, L or V, X3 is A, D, E, G, N, V ​​or Y, X4 is A, G, I, K, R or S, and X5 is C, I, L, P, Q , R or W, X6 is E, K, P, Q or R, X7 is C, D, H, N, P or Y, X8 is E, G, R, V or W, X9 is F, G, L, S, V or W, and X 10 is C, D, G, L, R, S or V, and X 11 is F, G, I, L, N, S, T or V, and X 12 is H, L, P, R, S, T or Y, and X 13 is D, H, P, S, T or V, and X 14 is E, F, H, I, L, P or R, and X 15 is A, S or V, and X 16 is A, D, E, G, H or V, and X 17 is H, N, Q, R or Y, and X 18 -X 22 Exemplary, CDR3 comprises a sequence set forth in any one of SEQ ID NOs: 76, 87, 108-183. More preferably, SEQ ID NO:3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 where X1 is E, G or V, X2 is A, G, I, L or V, X3 is A, D, E, G, N, V ​​or Y, X4 is G, I, K, R or S, X5 is C, I, L, Q, R or W, X6 is E, K, P, Q or R, X7 is C, D, H, N or Y, X8 is E, G, R, V or W, X9 is F, L, S, V or W, and X 10 is C, D, G, R, S or V, and X 11 is F, I, L, N, S, T or V, and X 12 is H, L, P, R, S or T, and X 13 is H, P, S, T or V, and X 14 is F, H, I, L, P or R, and X 15 is A, S or V, and X 16 is A, D, E, G, H or V, and X 17 is H, N, Q, R or Y, and X 18 -X 22 or CDR3 comprises a sequence as set forth in SEQ ID NO:87 or a variant thereof, the variant being an X1 G to E, G or V mutation, an X2 V to A, G, I or V mutation, an X3 D to A, E, G, N, V ​​or Y mutation, an X4 R to G, I, K or S mutation, an X5 R to C, I, L, Q or W mutation, an X6 Q to E, K, P or R mutation, an X7 Y to C, D, H or N mutation, an X8 G to E, R, V or W mutation, an X9 L to F, S, V or W mutation, an X10 L to F, S, V or W mutation, an X11 L to F, S, V or W mutation, an X12 L to F, S, V or W mutation, an X13 L to F, S, V or W mutation, an X14 L to F, S, V or W mutation, an X15 L to F, S, V or W mutation, an X16 L to F, S, V or W mutation, an X17 L to F, S, V or W mutation, an X18 L to F, S, V or W mutation, an X19 ...0 L to F, S, V or W mutation, an X11 L to F, S, V or W mutation, an X12 L to F, S, V or W mutation, an X13 L to F, S, V or W mutation, an X14 L to F, S, V or W mutation, an X15 L to F, S, V or W mutation, an X16 L to F, S, V or W mutation, an X17 L to F, S, V or W mutation, an X18 L to F, S, V or W mutation, an X19 L to F, S, V or W mutation, an X19 L to F, S, 10 mutation of G to C, D, R, S or V, X 11 mutation of I to F, L, N, S, T or V, X 12 mutation of P to H, L, R, S or T, X 13 mutation of P to H, S, T or V, X 14mutation of L to F, H, I, P or R, X 15 A to S or V mutations in X 16 D to A, E, G, H or V mutations in X 17 H to N, Q, R or Y. Exemplarily, the CDR3 comprises a sequence set forth in any one of SEQ ID NOs: 87, 108-183. In one or more embodiments, CDR1 comprises a sequence set forth in any one of SEQ ID NOs: 4-39, 320, CDR2 comprises a sequence set forth in any one of SEQ ID NOs: 40-75, and CDR3 comprises a sequence set forth in any one of SEQ ID NOs: 40-76. Comprising a sequence shown in any one of NOs: 76-183. In one or more embodiments, CDR1 comprises a sequence set forth in any one of SEQ ID NOs: 16, 19, 36-39, 320, CDR2 comprises a sequence set forth in any one of SEQ ID NOs: 52, 53, 55, 72-75, and CDR3 comprises a sequence set forth in any one of SEQ ID NOs: 76, 87, 108-183. In one or more embodiments, CDR1 comprises the sequence set forth in SEQ ID NO: 16 or 19, CDR2 comprises the sequence set forth in any one of SEQ ID NO: 52, 53, 55, 72, 73, and CDR3 comprises the sequence set forth in SEQ Includes any one of the sequences shown in ID NOs: 87, 108-111, 113-134, 136-146, 148-154, 156-163, 165-168, 172, 173, 177-183. In one or more embodiments, CDR1 comprises a sequence set forth in any one of SEQ ID NOs: 19, 36-39, 320, CDR2 comprises a sequence set forth in any one of SEQ ID NOs: 53, 55, 72-75, and CDR3 comprises a sequence set forth in any one of SEQ ID NOs: 87, 108-183. In one or more embodiments, CDR1 comprises a sequence set forth in any one of SEQ ID NOs: 5, 7, 10, 14-16, 19, 26, 27, 29, 30, 33; CDR2 comprises a sequence set forth in any one of SEQ ID NOs: 41, 47, 50-52, 55, 56, 61-66; and CDR3 comprises a sequence set forth in any one of SEQ ID NOs: 76, 77, 85-87, 93, 94, 97, 99-101, 104. In one or more embodiments, the single domain antibody comprises a CDR1, a CDR2 and a CDR3 as set forth in any one of the following groups a1 to a136: [Table 1] TIFF2024502091000002.tif24683TIFF2024502091000003.tif24782TIFF2024502091000004.tif1483In one or more embodiments, FR1 of the single domain antibody VHH is selected from FR1 of the VHH of each antibody number in Table 1, FR2 of the VHH is selected from FR2 of the VHH of each antibody number in Table 1, FR3 of the VHH is selected from FR3 of the VHH of each antibody number in Table 1, and FR4 of the VHH is selected from FR4 of the VHH of each antibody number in Table 1. In one or more embodiments, the FR region of the single domain antibody is a FR region of any one of VHH selected from SEQ ID NOs: 184-319. In one or more embodiments, the single domain antibody VHH is set forth in any one of SEQ ID NOs: 184-319. Preferably, the single domain antibody is set forth in any one of SEQ ID NOs: 197, 200, 223-319. In one or more embodiments, the PD-1 binding molecule is a monovalent or multivalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody or antigen-binding fragment thereof, or an antibody or antigen-binding fragment thereof, comprising one, two or more of the anti-PD-1 single domain antibodies described herein. In one or more embodiments, the multivalent or multispecific single domain antibody is linked to multiple single domain antibodies by a linker, the linker consisting of 1-15 amino acids selected from G and S. In one or more embodiments, the antigen-binding fragment of a heavy chain antibody is a single-chain heavy chain antibody. In one or more embodiments, the heavy chain antibody is a camelid heavy chain antibody or a cartilaginous fish heavy chain antibody. In one or more embodiments, the heavy chain antibody further comprises a heavy chain constant region. In one or more embodiments, the heavy chain constant region is a camelid heavy chain antibody constant region and comprises a CH2 and a CH3. In one or more embodiments, the CH2 and CH3 are human IgG Fc CH2 and CH3, such as IgG4 CH2 and CH3. Preferably, the heavy chain constant region is set forth in SEQ ID NO:321. In one or more embodiments, the heavy chain constant region is a chondrichthyan heavy chain antibody constant region and includes CH1, CH2, CH3, CH4 and CH5. In one or more embodiments, the antibody comprises an anti-PD-1 single domain antibody as the heavy chain variable domain of the antibody. In one or more embodiments, the antibody further comprises a light chain variable domain, a heavy chain constant domain, and a light chain constant domain. In one or more embodiments, the antigen-binding fragment of the antibody is selected from a Fab, F(ab')2, Fv, or scFv. In one or more embodiments, the binding molecule according to any one of the embodiments of the invention is a chimeric antibody or a fully human antibody, preferably a fully human antibody. The present invention further provides a polynucleotide comprising: (1) a coding sequence for a single domain antibody described in any of the embodiments herein or an antibody or antigen-binding fragment thereof described herein; (2) The complementary sequence of (1); (3) A 5-50 bp fragment of either (1) or (2) Selected from. In one or more embodiments, the fragment is a primer. In one or more embodiments, the sequence of the polynucleotide is set forth in SEQ ID NO:322 or 323. The present invention further provides a nucleic acid construct comprising a polynucleotide described herein. In one or more embodiments, the nucleic acid construct is a recombinant vector or an expression vector. The invention also provides phage of a PD-1 binding molecule described in any of the embodiments herein. In one or more embodiments, the PD-1 binding molecule is displayed on the surface of the phage. The present invention further provides a host cell, (1) expressing and / or secreting a PD-1 binding molecule described in any of the embodiments herein; (2) comprising a polynucleotide described herein; and / or (3) It is selected because it comprises a nucleic acid construct described herein. The invention also provides a method of producing a PD-1 binding molecule, the method comprising culturing a host cell as described herein under conditions suitable for production of a PD-1 binding molecule (e.g., a monovalent or multivalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody, an antibody or antigen-binding fragment thereof) and, optionally, purifying the PD-1 binding molecule from the culture. The invention further provides a pharmaceutical composition, comprising a PD-1 binding molecule, polynucleotide, nucleic acid construct, phage or host cell described in any of the embodiments herein, and a pharma- ceutically acceptable adjuvant. In one or more embodiments, the pharmaceutical composition is used to treat cancer. In one or more embodiments, the cancer is a PD-1 associated cancer. Preferably, the cancer is selected from melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, non-Hodgkin's lymphoma, and the like. The invention further provides the use of a PD-1 binding molecule described in any of the embodiments herein in the manufacture of a medicament for preventing or treating cancer. In one or more embodiments, the cancer is a PD-1 associated cancer. Preferably, the cancer is selected from melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, non-Hodgkin's lymphoma, and the like. The invention also provides a method for treating or preventing cancer, said method comprising administering to a patient in need thereof a therapeutically effective amount of a PD-1-binding molecule according to any one of the embodiments of the invention, or a pharmaceutical composition comprising a PD-1-binding molecule according to any one of the embodiments of the invention. In one or more embodiments, the cancer is a PD-1 associated cancer. Preferably, the cancer is selected from melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, non-Hodgkin's lymphoma, and the like. The present invention also provides a PD-1 detection kit for use in evaluating the efficacy of drug therapy or diagnosing cancer, the kit comprising a PD-1-binding molecule, polynucleotide, nucleic acid construct, phage, or host cell described in any of the embodiments herein. In one or more embodiments, the kit further comprises a reagent for detecting binding of PD-1 to the single domain antibody, antibody, or antigen-binding fragment thereof, e.g., by enzyme immunoassay. In one or more embodiments, the binding detection reagent is a detectable label that can be bound to the PD-1-binding molecule, e.g., biotin, either bound to the PD-1-binding molecule or separately present in the kit. The present invention also provides a non-diagnostic method for detecting the presence of PD-1 in a sample, comprising incubating a PD-1-binding molecule as described in any of the embodiments herein with the sample and detecting binding of PD-1 to the single domain antibody, antibody or antigen-binding fragment thereof, thereby determining the presence of PD-1 in the sample, wherein said detection is by enzyme immunoassay.

[0007] The invention further provides the use of a PD-1 binding molecule as described in any of the embodiments herein in the detection of PD-1 in a sample, in assessing the efficacy of drug treatment, or in the preparation of a kit for diagnosing cancer. [Brief description of the drawings]

[0008] [Figure 1] FIG. 1 shows titer detection of alpaca antiserum against PD-1 protein. [Diagram 2] FIG. 2 shows the titer detection of alpaca antisera against PD-1-overexpressing cell lines. [Diagram 3] Figure 3 shows the effect of anti-PD-1 antibodies on the activation of the luciferase reporter gene. The amino acid sequence of the isotype control (negative control) is shown in SEQ ID NO.:2 set forth in CN106046152A. [Figure 4] Figure 4 shows the effect of PD-1 antibodies on IFN-γ secretion in a mixed lymphocyte reaction (MLR). Isotype controls are the same as in Figure 3. [Diagram 5] Figure 5 shows the effect of PD-1 antibodies on IL-2 secretion in a mixed lymphocyte reaction (MLR). Isotype controls are the same as in Figure 3. [Figure 6] FIG. 6 shows the results of cross-reaction of NB182 antibody with 5,300 types of membrane proteins. [Figure 7] FIG. 7 shows the results of cross-reaction of NB194 antibody with 5,300 types of membrane proteins. [Figure 8] Figure 8 shows that the NB194 mutants also have improved affinity and functional activity. EC50 is in nM. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0009] The present inventors have made extensive research and through extensive screening, and have found PD-1 binding molecules, including anti-PD-1 single domain antibodies, and experimental results show that the binding molecules of the present invention can specifically recognize PD-1, bind to PD-1 with high affinity, have good functional activity, promote cytokine secretion by T cells, and do not cause tissue cross-reaction. The single domain antibodies of the present invention are easy to prepare.

[0010] Specifically, the present invention uses human-derived PD-1 to immunize alpacas to obtain a high-quality immune single-domain antibody gene library. Then, PD-1 protein is bound to an ELISA plate, and the immune single-domain antibody gene library is screened by phage display technology to obtain a PD-1-specific single-domain antibody gene. Then, this gene is introduced into mammalian cells to obtain a single-domain antibody strain that can be highly expressed in mammalian cells and has high specificity. Then, single-domain antibodies with high affinity, high specificity, high functional activity, and low tissue cross-reactivity are identified by methods such as ELISA, flow cytometry, membrane protein cross-reaction, and epitope competition test.

[0011] antibody As used herein, a "PD-1 binding molecule" is a protein that specifically binds to PD-1, including, but not limited to, antibodies, antigen-binding fragments of antibodies, heavy chain antibodies, nanobodies, minibodies, affibodies, target binding domains of receptors, cell adhesion molecules, ligands, enzymes, cytokines, and chemokines.

[0012] As used herein, the term "antibody" includes monoclonal antibodies (including full-length antibodies having an immunoglobulin Fc region), antibody compositions with multi-epitope specificity, multispecific antibodies (e.g., bispecific antibodies), diabodies, single-chain molecules, and antibody fragments (particularly antigen-binding fragments, such as Fab, F(ab')2, and Fv). As used herein, the terms "immunoglobulin" (Ig) and "antibody" are interchangeable.

[0013] The basic four-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light chains (L) and two identical heavy chains (H). IgM antibodies consist of five basic heterotetrameric units and another polypeptide called the J chain, and contain 10 antigen-binding sites. IgA antibodies contain 2-5 basic four-chain units, which can polymerize with J chains to form multivalent aggregates. In the case of IgG, the four-chain unit is usually about 150,000 daltons. Each light chain is linked to a heavy chain by one covalent disulfide bond, and the two heavy chains are linked to each other by one or more disulfide bonds, with the number of disulfide bonds determined by the heavy chain isotype. Each heavy chain and light chain further have regularly spaced interchain disulfide bridges. Each heavy chain has a variable length at the N-terminus. Each light chain has a variable domain (VH) and three (CH1, CH2 and CH3 for each α and γ chain) and four (CH1, CH2, CH3 and CH4 for μ and ε isotypes) constant domains (CH), and a hinge region (Hinge) between the CH1 and CH2 domains. Each light chain has a variable domain (VL) at the N-terminus and a constant domain (CL) at its other end. The VL is aligned with the VH, and the CL is aligned with the first constant domain (CH1) of the heavy chain. Certain amino acid residues are believed to form an interface between the light chain and the heavy chain variable domains. The paired VH and VL together form an antigen-binding site. For the structure and properties of the different classes of antibodies, see Basic and Clinical Immunology, 8th Edition, Daniel P. Sties, Abba I. Terr and Tristram G. Parsolw, eds., Appleton & Lange, Norwalk, CT, 1994, p. 71 and chapter 6. Light chains from any vertebrate species can be assigned to one of two different types, called kappa and lambda, depending on the amino acid sequence of their constant domains. Immunoglobulins can be assigned to different classes or isotypes depending on the amino acid sequence of their heavy chain constant domains (CH). There are five types of immunoglobulins, IgA, IgD, IgE, IgG, and IgM, with heavy chains called alpha, delta, epsilon, gamma, and mu, respectively. The gamma and alpha classes are further divided into subclasses, e.g., IgG1, IgG2A, IgG2B, IgG3, IgG4, IgA1, and IgA2, expressed in humans, depending on the relatively minor differences in CH sequence and function.

[0014] A "heavy chain antibody" as described herein is an antibody derived from a camelid or elasmobranch organism. Compared to the above four-chain antibodies, a heavy chain antibody lacks a light chain and a heavy chain constant region 1 (CH1) and contains only two heavy chains consisting of a variable region (VHH) and another constant region, the variable region being linked to the constant region by a structure similar to a hinge region structure. Each heavy chain of a camelid heavy chain antibody contains one variable region (VHH) and two constant regions (CH2 and CH3), while each heavy chain of an elasmobranch heavy chain antibody contains one variable region and five constant regions (CH1-CH5). Antigen-binding fragments of heavy chain antibodies include VHH and single-chain heavy chain antibodies. A heavy chain antibody can have the CH2 and CH3 of human IgG Fc by fusion with the constant region of human IgG Fc.

[0015] As used herein, the terms "single domain antibody", "anti-PD-1 single domain antibody", "heavy chain variable region domain of a heavy chain antibody", "VHH", and "nanobody" are used interchangeably and all refer to a single domain antibody that specifically recognizes and binds to PD-1. A single domain antibody is a variable region of a heavy chain antibody. Typically, a single domain antibody comprises three CDRs and four FRs. Preferably, a single domain antibody of the present invention comprises CDR1 as shown in SEQ ID NO:1, CDR2 as shown in SEQ ID NO:2, and CDR3 as shown in SEQ ID NO:3. A single domain antibody is the smallest functional antigen-binding fragment. Typically, an antibody that naturally lacks a light chain and heavy chain constant region 1 (CH1) is obtained, and then the variable region of the antibody heavy chain is cloned to construct a single domain antibody consisting of only one heavy chain variable region.

[0016] A binding molecule comprising two or more single domain antibodies is a multivalent single domain antibody; a binding molecule comprising two or more different specificity single domain antibodies is a multispecific single domain antibody. A multivalent single domain antibody or a multispecific single domain antibody is a linker that links the multiple single domain antibodies. The linker is usually selected from G and S and consists of 1-15 amino acids.

[0017] As used herein, heavy chain antibody and antibody are intended to distinguish between different combinations of antibodies. Due to structural similarities, the structural description of antibodies below applies to heavy chain antibodies, except for those related to light chains.

[0018] The "variable region" or "variable domain" of an antibody is the amino-terminal domain of either the heavy or light chain of an antibody. The heavy and light chain variable domains are designated "VH" and "VL", respectively. These domains are typically the most variable parts of an antibody (relative to other antibodies of the same type) and contain the antigen-binding site.

[0019] The term "variable" means that certain segments in the variable domains differ extensively in sequence among antibodies. The variable domains mediate antigen binding and define the specificity of a particular antibody for its particular antigen. However, the variability is not uniformly distributed over the entire amino acid span of the variable domain. Instead, it is concentrated in three segments (in both light and heavy chain variable domains) called hypervariable regions (HVRs), namely, HCDR1, HCDR2, HCDR3 in the heavy chain variable region and LCDR1, LCDR2, LCDR3 in the light chain variable region (which may be abbreviated as CDR1, CDR2, CDR3 in heavy chain antibodies). The more highly conserved parts of the variable domains are called framework regions (FRs). Natural heavy and light chain variable domains each contain four FR regions (FR1, FR2, FR3, and FR4), which usually adopt a β-pleated sheet structure, but are connected by three HVRs that form a cyclic link and sometimes form part of the β-pleated sheet structure. The HVRs in each chain are held in close proximity by the FR regions and, together with the HVRs in the other chain, promote the formation of the antigen-binding site of the antibody. Usually, the structure of the light chain variable region is FR1-LCDR1-FR2-LCDR2-FR3-LCDR3-FR4, and the structure of the heavy chain variable region is FR1-HCDR1-FR2-HCDR2-FR3-HCDR3-FR4. The constant domains are not directly involved in binding the antibody to the antigen, but exhibit various effector functions, such as the participation of the antibody in antibody-dependent cell-mediated cytotoxicity.

[0020] "Fc region" (fragment crystallizable region) or "Fc domain" or "Fc" refers to the C-terminal region of an antibody heavy chain, which mediates the binding of the immunoglobulin to host tissues or factors, including binding to Fc receptors located on various cells of the immune system (e.g., effector cells) or to the first component (C1q) of the classical complement system. In IgG, IgA and IgD antibody isotypes, the Fc region is composed of two identical protein fragments derived from the CH2 and CH3 domains of the two heavy chains of the antibody; the Fc region of IgM and IgE contains three heavy chain constant domains (CH domains 2-4) in each polypeptide chain. Although the boundaries of the Fc region of an immunoglobulin heavy chain may vary, the Fc region of a human IgG heavy chain is generally defined as the sequence segment from an amino acid residue at position C226 or P230 of the heavy chain to the carboxyl terminus, e.g., as in Kabat, with numbering according to the EU index. As used herein, the Fc region may be a native sequence Fc or a variant Fc.

[0021] An "antibody fragment" comprises a portion of an intact antibody, preferably the antigen-binding and / or variable regions of the intact antibody. The antibody fragment is preferably an antigen-binding fragment of an antibody. Examples of antibody fragments include Fab, Fab', F(ab')2 and Fv fragments, diabodies, linear antibodies, single-chain antibody molecules, scFv-Fc fragments, multispecific antibodies formed by antibody fragments, and any fragment whose half-life can be increased by chemical modification or incorporation into liposomes. Papain digestion of an antibody produces two identical antigen-binding fragments called "Fab" fragments, and one remaining "Fc" fragment, a name reflecting the ability to crystallize readily. Fab fragments are composed of complete light and heavy chain variable domains (VH) and one heavy chain first constant domain (CH1). Each Fab fragment is monovalent with respect to antigen binding, i.e., it has a single antigen-binding site. Pepsin treatment of antibodies produces one large F(ab')2 fragment, roughly equivalent to two Fab fragments linked by disulfide bonds, with different antigen-binding activity and still capable of cross-linking antigen. Fab' fragments differ from Fab fragments by the addition of several other residues at the carboxy terminus of the CH1 domain, including one or more cysteines from the antibody hinge region. F(ab')2 antibody fragments are naturally produced as paired Fab' fragments, with hinge cysteines between the Fab' fragments. Other chemical couplings of antibody fragments are already known. Fc fragments contain the carboxy terminal portions of two heavy chains held together by disulfide bonds. The effector functions of antibodies are determined by sequences in the Fc region, which is also the region recognized by Fc receptors (FcR) found on several types of cells.

[0022] "Fv" is the minimum antibody fragment that contains a complete antigen recognition and binding site. This fragment is tight, It consists of a dimer of one heavy and one light chain variable region domain non-covalently associated. The folding of these two domains results in six hypervariable loops (three loops each from the heavy and light chain) that contribute amino acid residues for antigen binding and confer antigen specificity to the antibody. However, even a single variable domain (or half of an Fv containing only three CDRs specific for an antigen) has the ability to recognize and bind antigen, albeit with lower affinity than the complete binding site. "Single-chain Fv", abbreviated as "sFv" or "scFv", is an antibody fragment that contains antibody VH and VL domains and is linked into a single polypeptide chain. Preferably, the sFv polypeptide further comprises a polypeptide linker between the VH and VL domains to allow the sFv to form the desired antigen-binding structure.

[0023] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., each antibody in the population is similar except for possible naturally occurring mutations and / or post-translational modifications (e.g., isomerization, amidation) that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. In contrast to polyclonal antibody preparations (which typically contain different antibodies directed against different determinants (epitopes)), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, monoclonal antibodies have the advantage that they are synthesized by hybridoma culture and are therefore uncontaminated by other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody obtained from a population of substantially homogeneous antibodies and is not to be construed as requiring production of the antibody by any particular method. For example, monoclonal antibodies for use in accordance with the present invention may be produced by a variety of techniques including, for example, hybridoma methods, phage display methods, recombinant DNA methods, and techniques for producing human or human-like antibodies from animals having partial or entire human immunoglobulin loci or genes encoding human immunoglobulin sequences, single cell sequencing methods.

[0024] As used herein, monoclonal antibodies include "chimeric" antibodies, in which a portion of the heavy and / or light chains are identical or homologous to corresponding sequences in antibodies from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chains are identical or homologous to corresponding sequences in antibodies from another species or belonging to another antibody class or subclass, so long as the desired biological activity is exhibited, as well as fragments of such antibodies.

[0025] "Humanized" forms of non-human (e.g., murine) antibodies are chimeric antibodies that contain minimal sequences derived from non-human immunoglobulins. Thus, a "humanized antibody" is typically a non-human antibody in which the variable domain framework regions have been replaced with sequences found in a human antibody. Typically, in a humanized antibody, the entire antibody (except for the CDRs) is encoded by a polynucleotide of human origin or is identical to such an antibody (except for the CDRs). CDRs (partially or entirely encoded by nucleic acids derived from a non-human organism) are grafted onto the β-pleated sheet framework of a human antibody variable region to produce an antibody whose specificity is determined by the grafted CDRs. Methods for producing such antibodies are well known in the art, for example, by using mice with genetically engineered immune systems. In the present invention, all of the antibodies, single domain antibodies, heavy chain antibodies, etc., include humanized variants of the respective antibodies.

[0026] A "human antibody" is an antibody having an amino acid sequence which corresponds to that of an antibody produced from a human and / or which is produced using any technique disclosed herein for producing human antibodies. This definition of a human antibody expressly excludes humanized antibodies which contain non-human antigen-binding residues. Human antibodies may be produced using a variety of techniques known in the art, including phage display libraries.

[0027] In some embodiments, the present invention also relates to any of the anti-PD-1 single domain antibodies of the present invention. Provided are single domain antibodies, heavy chain antibodies, antibodies, or antigen-binding fragments thereof that bind to the same human PD-1 epitope, i.e., single domain antibodies, heavy chain antibodies, antibodies, or antigen-binding fragments thereof that can cross-compete for binding to PD-1 with any of the single domain antibodies of the invention.

[0028] In the present invention, the CDR1 of the anti-PD-1 single domain antibody comprises the sequence set forth in SEQ ID NO:1, which is GX1X2X3X4X5X6X7, where X1 is D, F, G, H, L or R, X2 is P, S or T, X3 is A, F, I, L, N, R, S or V, X4 is D, F, G, L, M, N or S, X5 is A, D, F, G, I, N, R, S or T, X6 is D, F, H, I, L, S, V, W or Y, and X7 is A, D, E, G, N, P, S or T. Exemplarily, the CDR1 comprises a sequence set forth in any one of SEQ ID NOs:4-39, 320.

[0029] The CDR2 of the anti-PD-1 single domain antibody comprises the sequence set forth in SEQ ID NO:2, which is X1X2X3X4X5X6X7X8X9, where X1 is I, L, S, T or V, X2 is A, N, S or T, X3 is F, G, I, K, L, M, N, Q, R, S, T, W or Y, X4 is A, D, G, H, N, R, S or T, X5 is A, D, G, N, R, S or none, X6 is G or R, S or T, X7 is D, E, I, L, M, N, R, S, T or V, X8 is A, K, M, Q or T, and X9 is A or none. Exemplary CDR2 comprises a sequence set forth in any one of SEQ ID NOs:40-75.

[0030] The CDR3 of the anti-PD-1 single domain antibody comprises the sequence shown in SEQ ID NO:3, where SEQ ID NO:3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X16 X 17 X 18 X 19 X 20 X 21 X 22 where X1 is A, E, G, N, R, S, T or V, X2 is A, G, I, K, L, P, R, T or V, X3 is A, D, E, G, K, N, P, R, S, V or Y, X4 is A, C, D, E, G, I, K, L, R, S, T, V or Y, and X5 is A, C, D, F, G, H, I, K, L, N, P, Q, R, S, X6 is A, C, D, E, G, I, K, L, M, P, Q, R, S or Y, X7 is A, C, D, F, G, H, I, N, P, R, S, T, V or Y, X8 is A, C, D, E, G, I, R, S, T, V, W, Y or none, X9 is A, D, E, F, G, I, L, P, R, S, V, W, Y or none, X 10 is C, D, F, G, K, L, N, P, R, S, T, V, W, Y or None, X 11 is D, F, G, H, I, K, L, N, P, S, T, V, Y or None, X 12 is A, D, G, H, I, L, M, P, R, S, T, V, Y or None, X 13 is C, D, E, H, P, R, S, T, V, Y or None, X 14 is A, D, E, F, H, I, L, P, R, T, Y or None, X 15 is A, D, E, G, N, Q, R, S, T, V, Y or None, X 16 is A, D, E, F, G, H, M, P, S, V, Y or None, X 17 is A, D, E, H, N, Q, R, T, Y or None, X 18 is D, E, R, S, Y or none, and X 19 is N, S, Y or None, X 20 is D, E, Y or none, X 21 is E, N, Y or None, X 22 is Y or absent. Exemplarily, the CDR3 comprises a sequence set forth in any one of SEQ ID NOs: 76-183.

[0031] In one or more embodiments, the single domain antibody is NB182, NB194 or a variant thereof, wherein the CDR1 comprises a sequence set forth in any one of SEQ ID NOs: 16, 19, 36-39, 320, the CDR2 comprises a sequence set forth in any one of SEQ ID NOs: 52, 53, 55, 72-75, and the CDR3 comprises a sequence set forth in any one of SEQ ID NOs: 76, 87, 108-183. Alternatively, CDR1 comprises the sequence shown in SEQ ID NO: 16 or 19, CDR2 comprises the sequence shown in SEQ ID NO: 52, 53, 55, 72, 73, and CDR3 comprises the sequence shown in any one of SEQ ID NO: 87, 108-111, 113-134, 136-146, 148-154, 156-163, 165-168, 172, 173, 177-183. Alternatively, CDR1 comprises the sequence shown in any one of SEQ ID NO: 19, 36-39, 320, CDR2 comprises the sequence shown in any one of SEQ ID NO: 53, 55, 72-75, and CDR3 comprises the sequence shown in any one of SEQ ID NO: 87, 108-183.

[0032] In one or more embodiments, the single domain antibody comprises a CDR1, CDR2 and CDR3 as set forth in any one of groups a1-a136 of Table 1: [Table 2] TIFF2024502091000006.tif245118TIFF2024502091000007.tif245119TIFF2024502091000008.tif245120TIFF2024502091000009.tif178121

[0033] Preferably, it comprises CDR1, CDR2 and CDR3 shown in any one of the groups selected from a14, a17, a40-a136, or preferably, it comprises CDR1, CDR2 and CDR3 shown in any one of the groups selected from a14, a40-a44, or preferably, it comprises CDR1, CDR2 and CDR3 shown in any one of the groups selected from a17, a45-a136.

[0034] In one or more embodiments, FR1 of the single domain antibody VHH is selected from FR1 of the VHH of each antibody number in Table 1, FR2 of the VHH is selected from FR2 of the VHH of each antibody number in Table 1, FR3 of the VHH is selected from FR3 of the VHH of each antibody number in Table 1, and FR4 of the VHH is selected from FR4 of the VHH of each antibody number in Table 1.

[0035] In a preferred embodiment, the FR region of the single domain antibody is a FR region of any one of the VHHs selected from SEQ ID NOs: 184-319. More preferably, the CDRs of such an antibody are selected from the CDRs set forth in any one of the groups a1-a136. In one or more embodiments, the single domain antibody VHH is set forth in any one of SEQ ID NOs: 184-319. Preferably, the single domain antibody is set forth in any one of SEQ ID NOs: 197, 200, 223-319. do.

[0036] The PD-1 binding molecules described herein can be monovalent or polyvalent single domain antibodies, multispecific single domain antibodies, heavy chain antibodies or antigen-binding fragments thereof, or antibodies or antigen-binding fragments thereof, including one, two or more of the anti-PD-1 single domain antibodies described herein. The heavy chain antibodies further comprise a heavy chain constant region, such as a camelid heavy chain antibody or a cartilaginous fish heavy chain antibody constant region. Preferably, the heavy chain constant region is set forth in SEQ ID NO:321.

[0037] The present invention further includes the antibody derivatives and analogs. The terms "derivative" and "analog" refer to proteins that essentially retain a biological function or activity that is homologous to the antibody of the present invention. The derivative or analog of the present invention may be (i) a polypeptide having a substitution at one or more amino acid residues, or (ii) a polypeptide formed by fusing the mature polypeptide to another compound (e.g., a compound that extends the half-life of the polypeptide, such as polyethylene glycol), or (iii) a polypeptide formed by fusing an additional amino acid sequence to the polypeptide sequence (e.g., a leader sequence, a secretion sequence, a sequence for purifying the polypeptide, or a proteinogenic sequence, or a fusion protein formed with a 6His tag). As taught herein, these derivatives and analogs are within the knowledge of those skilled in the art.

[0038] A person skilled in the art can obtain a variant of the antibody or functional fragment thereof by modifying one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) amino acids in the sequence of the present invention, provided that the antibody activity is not substantially affected. These variants include, but are not limited to, those obtained by deleting, inserting, and / or substituting one or more (usually 1-50, preferably 1-30, more preferably 1-20, and most preferably 1-10) amino acids, and adding one or more (usually 20 or less, preferably 10 or less, and more preferably 5 or less) amino acids to the C-terminus and / or N-terminus. In the art, conservative substitution with amino acids having close or similar properties usually does not change the function of the protein. For example, amino acids having similar properties are substituted in the FR and / or CDR regions of the variable region. Amino acid residues that can be conservatively substituted are well known in the art. Such substituted amino acid residues may or may not be encoded by the genetic code. Furthermore, for example, the addition of one or more amino acids to the C-terminus and / or N-terminus does not usually alter the function of the protein and is considered to be within the scope of the present invention.

[0039] Variants of the antibodies described herein include homologous sequences, conservative variants, allelic variants, naturally occurring variants, induced variants, and proteins encoded by DNA capable of hybridizing to DNA encoding an antibody of the invention under high or low stringency conditions, and polypeptides or proteins obtained using antisera against an antibody of the invention.

[0040] In some embodiments, the sequence of a variant according to the invention may have at least 95%, 96%, 97%, 98% or 99% identity to the sequence from which it is derived. Sequence identity according to the invention can be measured using sequence analysis software, such as the computer program BLAST using default arguments, in particular BLASTP or TBLASTN. The invention further includes molecules having antibody heavy chain variable regions with CDRs, so long as those CDRs have greater than 90% homology (preferably greater than 95%, most preferably greater than 98%) with the CDRs identified herein.

[0041] Antibodies of the invention may be produced by methods routine in the art, such as, for example, hybridoma techniques well known in the art. Heavy chain antibodies of the invention may be produced by methods routine in the art, such as, for example, phage display techniques well known in the art. Alternatively, antibodies or heavy chain antibodies of the invention may be expressed in other cell systems. Sequences encoding the antibodies of the invention Suitable mammalian host cells may be transformed with the polynucleotide. Transformation may be by any known method, including, for example, packaging the polynucleotide into a virus (or viral vector) and transducing the host cell with the virus (or vector). The transformation process used will depend on the host being transformed. Methods for introducing heteropolynucleotides into mammalian cells are well known in the art and include dextran-mediated transfection, calcium phosphate precipitation, polybrene-mediated transfection, protoplast fusion, electroporation, encapsulation of polynucleotides in liposomes, and direct microinjection of DNA into the cell nucleus. Mammalian cell lines available as hosts for expression are well known in the art and include, but are not limited to, various immortalized cell lines available from the American Type Culture Collection (ATCC), including, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., HepG2), and the like. Particularly preferred cell lines are selected by identifying cell lines that have high expression levels and produce antibodies with basic PD-1 binding properties.

[0042] nucleic acid The present invention further provides a polynucleotide encoding the antibody or a fragment thereof. The present specification provides polynucleotides encoding the heavy chain variable region, the light chain variable region, the heavy chain, the light chain, and each CDR. The polynucleotide of the present invention may be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand.

[0043] As will be appreciated by those skilled in the art, the degeneracy of the genetic code allows for the production of a large number of nucleic acids, all of which encode the antibody or antigen-binding fragment thereof of the present invention. Thus, once a particular amino acid sequence has been identified, one skilled in the art can produce any number of different nucleic acids by simply modifying one or more codons in a manner that does not alter the amino acid sequence that encodes the protein. Thus, the present invention also relates to polynucleotides that hybridize with the above polynucleotide sequences and have at least 50%, preferably at least 70%, more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that can hybridize under stringent conditions with the polynucleotides of the present invention. In the present invention, "stringent conditions" refers to (1) hybridization and elution at low ionic strength and high temperature, e.g., 0.2xSSC, 0.1% SDS, 60°C; or (2) hybridization with a denaturing agent, e.g., 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C; or (3) hybridization occurs only if the identity between the two sequences is at least 90% or more, more preferably 95% or more. Furthermore, the polypeptides encoded by the hybridizable polynucleotides have the same biological functions and activities as the mature polypeptides.

[0044] The full length nucleotide sequence of the antibody of the present invention or fragments thereof can usually be obtained by PCR amplification, recombinant techniques or artificial synthesis. The relevant sequences can be synthesized by artificial synthesis, especially when the fragments are short in length. Usually, several small fragments are synthesized and then joined to obtain a fragment of a long sequence. In addition, the coding sequence of the heavy chain can be fused to an expression tag (such as 6His) to form a fusion protein.

[0045] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant techniques. It is usually cloned into a vector, introduced into a cell and then isolated from the host cells grown by conventional methods to obtain the relevant sequence. The biomolecules (nucleic acids, proteins, etc.) according to the present invention also include biomolecules that exist in isolated form. Currently, it is only possible to obtain DNA sequences encoding the proteins of the present invention (or fragments or derivatives thereof) by chemical synthesis. The DNA sequence can then be introduced into a variety of existing DNA molecules (e.g., vectors) and cells known in the art. Mutations may also be introduced into the protein sequences of the invention by chemical synthesis.

[0046] Thus, the present invention further relates to nucleic acid constructs, such as expression vectors and recombinant vectors, that contain the appropriate DNA sequences described above and appropriate promoter or control sequences. These vectors can be used to transform appropriate host cells to express proteins. Vectors typically contain sequences used for plasmid maintenance and cloning and expression of exogenous nucleotide sequences. The sequences (collectively referred to in some embodiments as "flanking sequences") typically contain one or more of the following nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcription termination sequence, a complete intron sequence including donor and acceptor splice sites, a sequence encoding a leader sequence used for polypeptide secretion, a ribosome binding site, a polyadenylation sequence, a multiconnexon region for inserting nucleic acid encoding an antibody to be expressed, and any tagging elements. Exemplary vectors are referenced in CN105154473A and CN111206043A, which are incorporated herein by reference in their entirety.

[0047] The host cell may be a prokaryotic cell such as a bacterial cell, a lower eukaryotic cell such as a yeast cell, or a higher eukaryotic cell such as a mammalian cell. Representative examples include bacterial cells such as E. coli, Streptomyces, Salmonella typhimurium, fungal cells such as yeast, insect cells such as fruit fly S2 or Sf9, and animal cells such as CHO, COS7, and 293 cells.

[0048] In some embodiments, the host cell may be a variety of functional cells known in the art, such as, for example, a variety of killer cells, including, but not limited to, cytokine-induced killer cells (CIK), dendritic cell-stimulated cytokine-induced killer cells (DC-CIK), cytotoxic T lymphocytes (CTL), gamma delta T cells, natural killer cells (NK), tumor-infiltrating lymphocytes (TIL), lymphokine-activated killer cells (LAK), CD3AK cells (anti-CD3 monoclonal antibody killer cells), and CAR-T / TCR-T cells. In some embodiments, the killer cells are T cells or NK cells. Exemplary NK cells include, but are not limited to, primary NK cells, NK cell lines (e.g., NK92), and NKT cells. In some embodiments, the NK cells are primary NK cells. Exemplary T cells include, but are not limited to, T cells of mixed cell populations such as peripheral blood T lymphocytes, cytotoxic killer T cells (CTLs), helper T cells, suppressor / regulatory T cells, γδ T cells, cytokine-induced killer cells (CIKs), tumor infiltrating lymphocytes (TILs), etc. In some embodiments, the T cells are T cells derived from peripheral blood T lymphocytes and TILs.

[0049] In some embodiments, the host cell comprises a coding sequence that expresses a chimeric antigen receptor (CAR) and / or expresses a chimeric antigen receptor.

[0050] Transformation of host cells with recombinant DNA can be performed by conventional techniques well known to those skilled in the art. If the host is a prokaryotic organism such as E. coli, competent cells capable of incorporating DNA can be harvested after exponential growth phase and treated with CaCl2 using procedures well known in the art. Another method is to utilize MgCl2. If necessary, transformation can also be performed by electroporation. If the host is a eukaryotic organism, DNA transfection methods such as calcium phosphate co-precipitation, microinjection, electroporation, liposome packaging, and other conventional mechanical methods can be used. The obtained transformant can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used for the culture may be selected from various conventional media depending on the host cells used. The culture is performed under conditions suitable for the growth of the host cells. After the host cells have grown to an appropriate cell density, the selected promoter is induced by an appropriate method (such as temperature change or chemical induction), and the cells are further cultured for a certain period of time.

[0051] The polypeptide in the above method is expressed intracellularly or in the cell membrane, or secreted extracellularly. If necessary, the recombinant protein may be separated and purified by various separation methods utilizing its physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to, conventional renaturation, treatment with protein precipitants (salting out method), centrifugation, osmotic sterilization, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques, as well as combinations of these methods.

[0052] Therapeutic Uses and Pharmaceutical Compositions By constructing a library of nanobodies, the inventors discovered, expressed and purified 126 nanobodies and their variants that can bind to PD-1. The binding ability and drug safety of these antibodies to antigens and cells were verified by protein-level affinity detection, cell-level affinity detection, tumor cell PD-1 binding detection, epitope competition experiments and tissue cross-reactivity.

[0053] All of the antibody forms described herein can be used to manufacture a medicament for preventing or treating various conditions and diseases described herein, particularly conditions that are diseases or conditions associated with cells expressing PD-1. In some embodiments, the disease or condition is cancer, including but not limited to melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, non-Hodgkin's lymphoma, and the like.

[0054] The pharmaceutical compositions described herein comprise a binding molecule described herein and a pharma- ceutically acceptable auxiliary, including, but not limited to, a diluent, vector, solubilizer, emulsifier, preservative, and / or adjuvant. The auxiliary is preferably non-toxic to the recipient at the dosage and concentration employed. Such auxiliary includes, but is not limited to, saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. In some embodiments, the pharmaceutical composition may include substances to improve, maintain, or retain, for example, the pH value, osmolarity, viscosity, clarity, color, isotonicity, odor, sterility, stability, dissolution or release rate, absorption or penetration of the composition. These substances are well known in the art. The optimal pharmaceutical composition is determined by the desired route of administration, delivery mode, and required dosage.

[0055] Pharmaceutical compositions for in vivo administration are usually provided in the form of a sterile formulation. Sterilization is achieved by filtration through a sterile filtration membrane. If the composition is lyophilized, sterilization is performed by this method before or after lyophilization and reconstitution. The pharmaceutical composition of the present invention may be used for parenteral delivery. Compositions utilized for parenteral administration can be stored in lyophilized form or in solution. They can be prepared by conventional methods using, for example, aqueous solutions containing saline, glucose and other additives. Parenteral compositions are usually placed into a container having a sterile access port, for example, an intravenous solution bag having a stopper pierceable by a hypodermic injection needle, or a vial. Alternatively, the composition may be used for inhalation or gastrointestinal (e.g., oral) delivery. The pharmaceutically acceptable composition is prepared by techniques in the art. Other pharmaceutical compositions will be apparent to those skilled in the art, including preparations in which the antibody is included in a sustained or controlled release delivery formulation. Several other techniques for providing sustained or controllable delivery modes (e.g., liposomal vectors, biodegradable microparticles or porous beads, and depot injections) are also well known to those skilled in the art.

[0056] Once prepared, the pharmaceutical compositions are stored in sterile vials in the form of a solution, suspension, gel, emulsion, solid, crystal, or dehydrated or lyophilized powder. The protein can be stored either in a dried form or in a form (e.g., lyophilized) that is reconstituted immediately prior to administration. The present invention further provides a reagent kit for producing a single-dose administration unit. The reagent kit of the present invention includes a first container having a dried protein and a second container having an aqueous preparation, respectively. In some embodiments of the present invention, a reagent kit is provided that includes single-chamber and multi-chamber pre-filled syringes (e.g., liquid syringes and lyophilized syringes).

[0057] The present invention provides a method for treating a patient (particularly a patient with a PD-1-related disease) by administering a binding molecule or a pharmaceutical composition thereof according to any one of the embodiments of the present invention. As used herein, the terms "patient", "subject", "individual" and "subject" are used interchangeably and include any living organism, preferably an animal, more preferably a mammal (e.g., rat, mouse, dog, cat, rabbit, etc.), and most preferably a human. "Treatment" refers to administering a therapeutic regimen described herein to a subject to obtain at least one positive therapeutic effect (e.g., a reduction in the number of cancer cells, a reduction in tumor volume, a reduction in the rate of cancer cell invasion into surrounding organs, or a reduction in the rate of tumor metastasis or tumor growth). The therapeutic regimen that effectively treats a patient will vary depending on various factors (e.g., the patient's disease state, age, weight, and the ability of the therapy to activate the subject's anti-cancer response).

[0058] The therapeutically effective amount of the pharmaceutical composition comprising the binding molecule of the present invention to be employed is determined, for example, by the extent and goal of the treatment. As will be understood by those skilled in the art, the appropriate dosage level used for treatment varies in part depending on the molecule to be delivered, the indication, the route of administration, and the size (weight, body surface or organ size) and / or condition (age and general health condition) of the patient. In some embodiments, the dosage may be set by the clinician and the route of administration may be modified to obtain optimal therapeutic effect. For example, about 10 μg / kg body weight to about 50 μg / kg body weight per day.

[0059] The frequency of administration depends on the pharmacokinetic parameters of the binding molecule in the preparation used.Typically, the clinician administers the composition to a dosage that achieves the desired effect.Thus, the composition may be administered as a single dose, or as two or more doses (which may or may not contain the same amount of the required molecule) over time, or as a continuous infusion via an implantation device or catheter.

[0060] The route of administration of the pharmaceutical compositions follows known methods, for example, via injection via oral, intravenous, intraperitoneal, intracerebral (intracerebral), intraventricular, intramuscular, intraocular, intraarterial, portal or intralesional routes, by sustained release systems or by implantation devices.

[0061] Diagnostic, Detection and Reagent Kits The binding molecules of the invention, due to their high affinity for PD-1, can be used in assays, for example in conjunction with assays to detect and / or quantitate PD-1 expressed in tissues or cells. Binding molecules, such as single domain antibodies, can be used to further study the role of PD-1 in disease. Methods for detecting PD-1 generally involve: obtaining a cell and / or tissue sample; detecting the level of PD-1 in the sample.

[0062] The PD-1 of the present invention can be used for diagnostic purposes to detect, diagnose or monitor diseases and / or conditions associated with PD-1. The present invention provides for detecting the presence of PD-1 in a sample by representative immunohistological methods well known to those skilled in the art. PD-1 can be detected in vivo or in vitro. Examples of suitable methods for detecting the presence of PD-1 include ELISA, FACS, RIA, and the like.

[0063] For diagnostic uses, the binding molecule, such as a single domain antibody, is typically labeled with a detectable labeling group. Suitable labeling groups include the following: radioisotopes or radionuclides (e.g., 3H, 14C, 15N, 35S, 90Y, 99Tc, 111In, 125I, 131I), fluorophores (e.g., FITC, rhodamine, lanthanide phosphorescent agents), enzymes (e.g., horseradish peroxidase, β- The labeling of proteins includes, but is not limited to, a predetermined polypeptide epitope recognized by a secondary reporter (e.g., leucine zipper sequences, binding sites utilized for secondary antibodies, metal binding domains, epitope tags), galactosidase, luciferase, alkaline phosphatase), chemiluminescent groups, biotin groups, or secondary reporters (e.g., leucine zipper sequences, binding sites utilized for secondary antibodies, metal binding domains, epitope tags), MRI (magnetic resonance imaging) or CT (computed tomography) imaging agents. Methods for labeling proteins are well known in the art and can be used in the practice of the present invention.

[0064] Another aspect of the invention provides a method for detecting the presence of a test molecule that binds competitively with PD-1 relative to an antibody of the invention. The illustrative measurement involves detecting the amount of free antibody in a solution containing a given amount of PD-1 in the presence or absence of the test molecule. An increase in the amount of free antibody (i.e., antibody that is not bound to PD-1) indicates that the test molecule is capable of competitively binding to PD-1 relative to the antibody. In one embodiment, the antibody is labeled with a labeling group. Alternatively, the test molecule is labeled and the amount of free test molecule is monitored in the presence or absence of the antibody.

[0065] The present invention also provides a detection kit for detecting the level of PD-1, which includes an antibody that recognizes PD-1, a dissolution medium for dissolving a sample, general reagents and buffers required for detection, such as various buffers, a detection label, a detection substrate, etc. The detection kit may be an in vitro diagnostic device.

[0066] The present invention specifically includes any of the following embodiments. 1. A PD-1 binding molecule comprising an anti-PD-1 single domain antibody having complementarity determining regions (CDRs) including CDR1, CDR2 and CDR3, wherein CDR1 comprises the sequence set forth in SEQ ID NO:1, CDR2 comprises the sequence set forth in SEQ ID NO:2 and CDR3 comprises the sequence set forth in SEQ ID NO:3; SEQ ID NO:1 is GX1X2X3X4X5X6X7, wherein X1 is D, F, G, H, L or R, X2 is P, S or T, X3 is A, F, I, L, N, R, S or V, X4 is D, F, G, L, M, N or S, X5 is A, D, F, G, I, N, R, S or T, X6 is D, F, H, I, L, S, V, W or Y, and X7 is A, D, E, G, N, P, S or T; preferably, SEQ ID NO:1 is GX1X2X3X4X5X6X7, wherein X1 is D, F, G, H, L or R, X2 is P, S or T, X3 is A, F, I, L, N, R, S or V, X4 is D, F, G, L, M, N or S, X5 is A, D, F, G, I, N, R, S or T, X6 is D, F, H, I, L, S, V, W or Y, and X7 is A, D, E, G, N, P, S or T. NO:1 is GX1X2X3X4X5X6X7, where X1 is D, F, G, H, L or R, X2 is P, S or T, X3 is F or S, X4 is F or S, X5 is G, I or T, X6 is S or Y, and X7 is A or D; SEQ ID NO:2 is X1X2X3X4X5X6X7X8X9, wherein X1 is I, L, S, T or V, X2 is A, N, S or T, X3 is F, G, I, K, L, M, N, Q, R, S, T, W or Y, X4 is A, D, G, H, N, R, S or T, X5 is A, D, G, N, R, S or none, X6 is G or R, S or T, X7 is D, E, I, L, M, N, R, S, T or V, X8 is A, K, M, Q or T, and X9 is A or none; preferably, SEQ ID NO:2 is X1X2X3X4X5X6X7X8X9, wherein X1 is I, L, S, T or V, X2 is A, N, S or T, X3 is F, G, I, K, L, M, N, Q, R, S, T, W or Y, X4 is A, D, G, H, N, R, S or T, X5 is A, D, G, N, R, S or none, X6 is G or R, S or T, X7 is D, E, I, L, M, N, R, S, T or V, X8 is A, K, M, Q or T, and X9 is A or none; NO:2 is X1X2X3X4X5GX7TX9, where X1 is I or V, X2 is N, S or T, X3 is F, L or N, X4 is A, G, S or T, X5 is R or none, X7 is D, N, I or T, and X9 is none; SEQ ID NO:3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X16 X 17 X 18 X 19 X 20 X 21 X 22 where X1 is A, E, G, N, R, S, T or V, X2 is A, G, I, K, L, P, R, T or V, X3 is A, D, E, G, K, N, P, R, S, V or Y, X4 is A, C, D, E, G, I, K, L, R, S, T, V or Y, and X5 is A, C, D, F, G, H, I, K, L, N, P, Q, R, S, X6 is A, C, D, E, G, I, K, L, M, P, Q, R, S or Y, X7 is A, C, D, F, G, H, I, N, P, R, S, T, V or Y, X8 is A, C, D, E, G, I, R, S, T, V, W, Y or none, X9 is A, D, E, F, G, I, L, P, R, S, V, W, Y or none, X 10 is C, D, F, G, K, L, N, P, R, S, T, V, W, Y or None, X 11 is D, F, G, H, I, K, L, N, P, S, T, V, Y or None, X 12 is A, D, G, H, I, L, M, P, R, S, T, V, Y or None, X 13 is C, D, E, H, P, R, S, T, V, Y or None, X 14 is A, D, E, F, H, I, L, P, R, T, Y or None, X 15 is A, D, E, G, N, Q, R, S, T, V, Y or None, X 16 is A, D, E, F, G, H, M, P, S, V, Y or None, X 17 is A, D, E, H, N, Q, R, T, Y or None, X 18 is D, E, R, S, Y or none, and X 19 is N, S, Y or None, X 20 is D, E, Y or none, X 21 is E, N, Y or None, X 22 is Y or nothing; preferably, SEQ ID NO:3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 where X1 is E, G, N or V, X2 is A, G, I, L or V, X3 is A, D, E, G, N, V ​​or Y, X4 is A, G, I, K, R or S, X5 is C, I, L, P, Q, R or W, X6 is E, K, P, Q or R, X7 is C, D, H, N, P or Y, X8 is E, G, R, V or W, X9 is F, G, L, S, V or W, and X 10 is C, D, G, L, R, S or V, and X 11 is F, G, I, L, N, S, T or V, and X 12 is H, L, P, R, S, T or Y, and X 13 is D, H, P, S, T or V, and X 14 is E, F, H, I, L, P or R, and X 15 is A, S or V, and X 16 is A, D, E, G, H or V, and X 17 is H, N, Q, R or Y, and X 18 -X 22 There is no PD-1 binding molecule.

[0067] 2. The PD-1 binding molecule of claim 1, wherein the CDR1 of the single domain antibody comprises a sequence as set forth in any one of SEQ ID NOs: 4-39, 320, the CDR2 comprises a sequence as set forth in any one of SEQ ID NOs: 40-75, and the CDR3 comprises a sequence as set forth in any one of SEQ ID NOs: 76-183; Preferably, the single domain antibody is a PD-1 binding molecule comprising CDR1, CDR2 and CDR3 as shown in any of Groups a1-a136 of Table 1.

[0068] 3. The PD-1-binding molecule according to item 1 or 2, The FR region of the single domain antibody comprises the FR region of any one of VHHs selected from SEQ ID NOs: 184-319; and / or said single domain antibody VHH is depicted in any one of SEQ ID NOs: 184-319; and / or The PD-1-binding molecule is a monovalent or polyvalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody or antigen-binding fragment thereof, or an antibody or antigen-binding fragment thereof, comprising one, two or more of the single domain antibodies.

[0069] 4. The PD-1-binding molecule of claim 3, wherein the PD-1-binding molecule is a heavy chain antibody, and the heavy chain antibody further comprises a heavy chain constant region; Preferably, the heavy chain constant region comprises the sequence shown in SEQ ID NO: 321.

[0070] 5. A polynucleotide, comprising: (1) a coding sequence for the PD-1 binding molecule of any one of items 1-4; (2) The complementary sequence of (1); (3) A 5-50 bp fragment of either (1) or (2) A polynucleotide selected from the group consisting of:

[0071] 6. A nucleic acid construct, comprising the polynucleotide according to item 5; Preferably, said nucleic acid construct is characterized in that it is a recombinant vector or an expression vector.

[0072] 7. A phage comprising the PD-1-binding molecule of any one of items 1-4, Preferably, the PD-1 binding molecule is displayed on the surface of the phage.

[0073] 8. A host cell, comprising: (1) expressing and / or secreting the PD-1-binding molecule of any one of items 1-4; and / or (2) comprising the polynucleotide according to item 5; and / or (3) A host cell, comprising the nucleic acid construct according to item 6.

[0074] 9. A method for producing a PD-1 binding molecule, comprising culturing the host cell of item 8 under conditions suitable for production of the PD-1 binding molecule, and optionally purifying the PD-1 binding molecule from the culture.

[0075] 10. A pharmaceutical composition comprising the PD-1-binding molecule of any one of items 1-4, the polynucleotide of item 5, the nucleic acid construct of item 6, the phage of item 7 or the host cell of item 8, and a pharma- ceutically acceptable auxiliary; Preferably, the pharmaceutical composition is utilized to treat cancer.

[0076] 11. Use of the PD-1 binding molecule according to any one of items 1 to 4 in the manufacture of a medicament for preventing or treating cancer.

[0077] 12. A PD-1 detection kit for use in evaluating the efficacy of drug therapy or diagnosing cancer, comprising the PD-1-binding molecule according to any one of items 1-4, the polynucleotide according to item 5, the nucleic acid construct according to item 6, and the phage according to item 7 or the host cell according to item 8; Preferably, the kit further comprises a reagent for detecting binding of PD-1 to the single domain antibody, antibody, or antigen-binding fragment thereof; More preferably, the reagent is a reagent for detecting the binding by enzyme immunoassay.

[0078] 13. A non-diagnostic method for detecting the presence of PD-1 in a sample, the method comprising incubating a PD-1-binding molecule of any one of paragraphs 1-4 with the sample and detecting binding of PD-1 to the single domain antibody, antibody or antigen-binding fragment thereof, thereby determining the presence of PD-1 in the sample.

[0079] 14. Use of the PD-1-binding molecule according to any one of items 1 to 4 in the detection of PD-1 in a sample, in the evaluation of the effect of drug treatment, or in the preparation of a kit for cancer diagnosis.

[0080] The present invention will be described below with reference to specific examples. These examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The methods and materials used in the examples are well known in the art unless otherwise specified. EXAMPLES

[0081] Example 1, Alpaca Immunization 1.1 Immunogen preparation: The PD-1 sequence was examined at NCBI, fused with the human IgGFc fragment sequence, and synthesis was outsourced to GenScript Co., Ltd. (Nanjing). A eukaryotic expression vector of pCDNA3.4 (Thermo) plasmid was constructed, and the synthesized plasmid was stored in ExpiCHO. TM (Thermo Fisher) expression system, and after expression, further affinity purification was performed using a 5 mL Protein A prepacked column (GE). The purified sample was replaced with, for example, PBS buffer, and the purity was identified by SDS-PAGE electrophoresis gel and HPLC, and the activity was identified by ELISA. After that, it was aliquoted and frozen and stored in a -80°C refrigerator for subsequent immunization.

[0082] 1.2 Alpaca immunity: The amount of the first immunization antigen (PD-1.hFc) was 400μg, which was mixed uniformly with the adjuvant (GERBU FAMA) and injected subcutaneously into four selected sites on the back of the alpaca, with the immunization volume at each site being 1mL. From the second to the seventh immunization: the amount of the immunization antigen was 200μg, which was injected subcutaneously into four selected sites on the back of the alpaca, with the immunization volume at each site being 1mL. The interval between each immunization was one week.

[0083] 1.3 Immune serum titer detection: 1.3.1 Protein level titer detection After coating the PD-1.His antigen overnight at 4 degrees, blocking and washing, the gradient diluted serum was added to the ELISA plate and incubated, and further incubated with anti-llama (anti-alpaca) IgG HRP (Abcam) antibody, washed, TMB color development solution was added to develop color, and the reaction was terminated with 2M HCl, and the absorbance value at OD450nm was detected with a microplate reader. The experimental results are shown in Figure 1, and after seven immunizations, the titer of alpaca reached a relatively high level (>81000).

[0084] 1.3.2 Cell-level titer detection PD-1-transfected CHO-K1 cells were plated in a 96-well plate, and the amount of cells was 3 × 10 5 The cells were then incubated with 3-fold gradient diluted serum. After incubation and washing, anti-llama IgG PE (Jackson) antibody was added and incubated, and after washing, the cells were resuspended in PBS and the fluorescence intensity (MFI) was detected by a flow cytometer (Beckman). After seven immunizations, the titer of the alpaca cell level reached 9000. The results are shown in Figure 2.

[0085] Example 2. Construction and screening of a nanobody immune library against PD-1 (1) After seven immunizations, 100 mL of peripheral blood lymphocytes were extracted from the camel, and total RNA was extracted. RNA extraction was performed according to the instructions for use with the RNAiso reagent from Takara. (2) Using RNA as a template and oligo dT as a primer, the first strand of cDNA was synthesized according to the instructions for reverse transcriptase manufactured by Takara. (3) Using PrimeSTAR high fidelity DNA polymerase, genes encoding the variable regions of heavy chain antibodies were obtained by nested PCR. Amplification of variable region fragments of heavy chain antibodies by nested PCR:

[0086] 1st PCR: Upstream primer: GTCCTGGCTGCTCTTCTACAAGGC Downstream primer: GGTACGTGCTGTTGAACTGTTCC The fragment between the heavy chain antibody guide peptide and antibody CH2 was amplified, annealed at 55° C., and cycled for 30 cycles; a DNA fragment of approximately 600 bp was recovered and used as a template for the second PCR.

[0087] Second PCR: Upstream primer: GATGTGCAGCTGCAGGAGTCTGGRGGAGG Downstream primer: GGACTAGTGCGGCCGCTGGAGACGGTGACCTGGGT Fragments between the heavy chain antibody FR1 region and the long and short hinge regions (long and short fragments) were amplified, annealed at 55°C, and cycled for 30 cycles to recover the targeted fragment, which had a size of approximately 500 bp, i.e., the electrophoretic band of the nanobody gene was approximately 500 bp.

[0088] (4) The phagemid pME207 and the PCR amplified product were double-enzymatically cleaved (NEB) with Sfi I and Not I, respectively, recovered and quantified, and then the two fragments were ligated with T4 DNA ligase (TaKaRa) at a molar ratio of 1:3 and ligated overnight at 16°C.

[0089] (5) The ligation product was precipitated with ethanol, dissolved in 100 μL of sterile water, and electroporation was performed 10 times to transform E. coli TG1. After electric shock, 100 μL of the cultured bacterial liquid was taken, diluted several-fold, and spread on an ampicillin LB culture plate to calculate the library volume. The remainder was spread on an ampicillin 2xYT culture plate and inverted cultured at 37°C for 13 to 16 hours. The bacterial lawn on the culture plate was rubbed and washed with 10 mL of 2xYT medium, and then glycerol was added to a final concentration of 25%, divided into small portions, and stored at -80°C. The library volume was 4.3×10 9 To detect the insertion rate of the library, 48 clones were randomly selected and subjected to colony PCR, which revealed an insertion rate of over 90%.

[0090] (6) Based on the calculated library volume, viable cells of 10 times the library volume were inoculated into 200 mL of 2xYT (containing 2% glucose and 100 μg / mL ampicillin) and cultured at 37°C and 200 rpm until the OD600 reached 0.5. Helper phage was then added at a multiplicity of infection of 20:1, and the mixture was incubated at 37°C for 30 min and then at 37°C for 30 min at 200 rpm. The culture was centrifuged, resuspended and precipitated in 200mL of 2xYT (containing 100μg / mL ampicillin and 50μg / mL kanamycin), incubated overnight at 37℃ and 250r / min, centrifuged at 8000rpm, the supernatant was collected, 5xPEG / NaCl solution was added, the mixture was left on ice for 60min, centrifuged at 8000rpm for 30min, and resuspended in 5mL of PBS to obtain an anti-PD-1 single domain heavy chain antibody (VHH) immune library, 10μL was taken for titer measurement, and the rest was aliquoted and stored at -80℃.

[0091] (7) PD-1 protein was coated on an ELISA plate at 5 μg / mL, 100 μL / well, and left at 4°C overnight. A negative control was set up at the same time. On the second day, 200 μL of 3% BSA was added to each of the five wells and blocked at room temperature for 2 hours. After 2 hours, the plate was washed three times with PBST (PBS containing 0.05% Tween 20). After washing the plate, first, phages (2-3 × 10) that had been previously blocked with 5% skim milk were added to each well. 11 100μL of tfu-immunized camel nanobody phage display library was added to each negative selection well and incubated at room temperature for 1.5 hours. The supernatant after negative selection was transferred to the target antigen-coated well and incubated at room temperature for 1.5 hours. The unbound phages were washed 12 times with PBST (PBS containing 0.05% Tween 20) to wash away the unbound phages. Glycine (SIGMA) was used to dissociate the phages that specifically bind to PD-1, and the eluted phages were neutralized with Tris (Invitrogen, 1M, PH8.0), then infected with TG1 in the logarithmic phase and amplified before the next round of "adsorption-elution". Finally, the eluted phages were infected with TG1, and TG1 was induced to express nanobody using IPTG (Thermo), and the supernatant of TG1 expression was taken and used for ELISA binding detection and blocking of PD-L1.hFc detection. The secondary antibody used for ELISA binding detection was anti-c-myc Antibody HRP (Bethyl), and the secondary antibody used to block PD-L1 binding detection was Goat anti-Human IgG-Fc Fragment Antibody HRP (Bethyl).

[0092] (8) Sequence analysis yielded a total of 39 nanobodies capable of binding to PD-1 protein, as shown in the table below.

[0093] [Table 3]

[0094] Example 3. Expression and purification of candidate antibodies Nanobodies were constructed in pCDNA3.4-IgG4 vector and expressed in EXpiCHO TM The protein was expressed for one week using the Thermo Fisher Scientific expression system, and then the supernatant was purified using Protein A (GE). The protein mass was then detected using Nanodrop, and the protein purity was detected using HPLC. The purity and yield of the obtained protein met the needs of subsequent experiments. Keytruda and Opdivo were expressed using the ht IgG4 antibodies were prepared according to the sequences provided at: http: / / www.drugbank.ca / .

[0095] Example 4. Characterization of candidate antibodies Protein-level affinity detection: Surface plasmon resonance (SPR) was used to detect the binding kinetics and affinity of the antibody to human PD-1.Fc antigen. The purified antibody was flowed onto a sensor chip pre-immobilized with protein A, and the antibody was captured by protein A. Then, five different concentrations of PD-1.Fc protein were used as the mobile phase, and the binding time and dissociation time were 30 min and 60 min, respectively. The binding rate (ka), dissociation rate (kd) and equilibrium constant (KD) were analyzed by Biacore Evaluation Software 2.0 (GE). Keytruda and Opdivo, which are commercially available PD-1 antibody drugs, were selected as controls. The results are shown in the table below.

[0096] [Table 4]

[0097] Example 5: PD-1 binding in different species PD-1 proteins from different species (human, cynomolgus monkey, mouse) (ACROBiosystems) were coated onto ELISA plates at a concentration of 1 μg / mL each, and incubated overnight at 4°C. After blocking and washing, diluted antibodies were added to the ELISA plates, respectively, and incubated at room temperature for 2 hours. After washing, Goat anti-Human IgG-Fc Fragment Antibody HRP (Bethyl) secondary antibody was added and incubated at room temperature for 1 hour. After washing, TMB color development solution was added to develop the color, and the reaction was terminated with 2M HCl, and the OD450 value was read using a microplate reader.

[0098] The experimental results, as shown in the table below, showed that the candidate antibodies, Keytruda and Opdivo, both bound to human and cynomolgus monkey PD-1, but did not bind to the mouse PD-1 protein.

[0099] [Table 5]

[0100] Example 6: CD28 family protein binding assay CD28 family proteins (CD28, CTLA-4, ICOS and PD-1) (ACROBiosystems) were coated on ELISA plates at a concentration of 1 μg / mL and incubated overnight at 4°C. After blocking and washing, diluted antibodies were added to the ELISA plates and incubated at room temperature for 2 hours. After washing, goat anti-human IgG-Fcc fragment antibody HRP (Bethyl) secondary antibody was added and incubated at room temperature for 1 hour. After washing, TMB color development solution was added to develop the color, and the reaction was terminated with 2M HCl, and the OD450 value was read on a microplate reader.

[0101] The results, shown in the table below, showed that both candidate antibodies, Keytruda and Opdivo, bound only to the PD-1 protein and not to other proteins in the CD28 family.

[0102] [Table 6]

[0103] Example 7: Epitope competition experiments The Biacore T200 (GE) was used, and the detection temperature was 25°C, and the buffer was 1x HBS-EP+ (10 mM HEPES, The buffer was 150 mM NaCl, 3 mM EDTA and 0.05% v / v Surfactant P20, GE) and the flow rate was 30ul / min. PD-1-His was dissolved in acetate buffer at pH 4.0 (Biacore Amine Coupling Kit, GE) to a final concentration of 10ug / ml, and PD-1-His was immobilized on channel 2 (FC-2) of a CM5 chip (GE) according to the instructions of the amino coupling kit product, with approximately 21RU. Channel 1 (FC-1) was used as a blank control. The antibodies were each diluted to the target concentration with 1xHBS-EP+, and one antibody was injected at a saturating level on the above chips FC-1 and FC-2 where PD-1 immobilization was completed, followed by the injection of the other antibody at a saturating level to evaluate the competitive relationship between the two antibodies. After the second antibody injection was completed, the complex was allowed to dissociate for 400s. Finally, 50mM NaOH was injected for 15s to regenerate the chip surface. Data processing was performed using the Biacore Evaluation Software 2.0 (GE) was used, and double reference subtraction was used for sensorgrams, and FC2-1 signals were recorded.

[0104] The experimental results are shown in the table below, where the epitopes bound by the NB194 and NB182 antibodies overlap with those of Keytruda and Opdivo. The results for the remaining antibodies were similar to those of the NB194 and NB182 antibodies, and both partially competed with Keytruda and Opdivo for epitopes. [Table 7]

[0105] Example 8: Antibody Functional Activity Test 1) Reporter gene experiment. First, GS / C2-PDL1 (GenScript) target cells were cultured in antibiotic-free medium at a density of 5*10 5 The antibody was diluted with RMPI1640 + 10% FBS buffer and incubated at a density of 2*10 cells / mL in 384-well plates. 6 The concentration of each antibody was adjusted to 100 / mL; the old medium in the 384-well plate was removed, and 20 μL of antibody and 20 μL of GS-J2 / PD1 effector cells were added to each well and incubated for 6 h. Finally, 40 μL One-Glo substrate was added to each well and incubated for 10 min before detection by a microplate reader. As shown in Figure 3, the antibodies showed good functional activity in the Reporter Gene Assay functional detection method, with the EC50 of NB182 and NB194 being 16.3 nM and 7.0 nM, and the EC50 of Keytruda and Opdivo being 3.3 nM and 7.3 nM. The EC50 of the remaining antibodies ranged from 1.7 to 75 nM.

[0106] 2) Mixed lymphocyte reaction. 100 milliliters of peripheral blood from healthy subjects were extracted and used to isolate PBMCs, and the obtained PBMCs were further used to isolate monocytes, and the obtained monocytes were induced into mature dendritic cells (DCs) in 9 days. On the 9th day, the DCs were quality detected by flow cytometry, and after meeting the criteria for maturation induction, 100 milliliters of human peripheral blood was extracted again and used to isolate PBMCs, CD4+ T cells were isolated from the PBMCs, and the effector cells and stimulator cells were incubated at an E:T ratio of 5:1, and the test samples were added at 8 concentrations, 3 duplicate wells, 10-fold dilution, and initial concentrations of 10-50 μg / ml. Incubated for 3 days. The supernatant of the cell culture was collected and the release of IL-2 and IFN-γ was detected.

[0107] The detection results are shown in Figures 4 and 5. NB182 and NB194 can promote the secretion of IL-2 and IFN-γ by T cells in a dose-dependent manner within a certain range, and showed the same functional effect as Keytruda and Opdivo. The results of the remaining antibodies were similar to NB182 and NB194, all of which could promote the secretion of IL-2 and IFN-γ by T cells in a dose-dependent manner, with the EC50 of IL-2 ranging from 0.115nM to 3.278nM and the EC50 of IFN-γ ranging from 0.078nM to 1.102nM.

[0108] Example 9: Antibody specificity validation 1) Membrane protein cross-reactivity Membrane protein cross-reaction was performed using the Membrane Proteome Array (MPA) screening platform developed by Integral Molecular Company in the United States. 5,300 different human membrane proteins were presented on the cell surface by transfecting HEK293 cells, and the binding signals of antibodies against these proteins were detected by FACS. This was used to evaluate the specificity of the antibodies to be detected. The results of the MPA screening (Figures 6 and 7) show that the NB182 and NB194 antibodies bind only to human PD-1 protein, and do not bind to any of the other more than 5,000 proteins. Except for the NB171 antibody, the remaining antibodies also bind only to human PD-1 protein.

[0109] 2) Tissue cross-reactivity Thirty-four tissues were selected, frozen, dried at room temperature, and fixed with acetone. They were blocked using reagents A and B of an endogenous biotin blocking kit (Sangon, E674001), incubated with biotin-labeled antibody samples for 30 min, washed, and then horseradish peroxidase-labeled streptavidin (Abcam, ab7403) was added and incubated for 15 min. After color reaction with DAB and counterstaining with hematoxylin, the sections were mounted with neutral plastic and air-dried for microscopic examination. The positive control was an anti-PD-1 antibody (abcam), and the negative control was an IgG4 isotype control.

[0110] The NB182 and NB194 antibodies specifically bind to normal human lymphocytes in lymph nodes, spleen, thymus, etc. Except for the NB171 antibody, the remaining antibodies also specifically bind to normal human lymphocytes. [Table 8]

[0111] Example 10: Humanization of antibodies NB182 and NB194 were humanized using the CDR region transplantation method, referring to the method of humanizing nanobodies (J. Biol. Chem. 2009; 284: 3273-3284). The IgBLAST (http: / / www.ncbi.nlm.nih.gov / igblast / ) database was screened using germlines with high homology to NB182 and NB194 as templates. Biacore was used to detect the affinity of the antibodies before and after humanization. The purified antibodies were passed through a sensor chip pre-immobilized with protein A, and the protein A was detected by the Biacore. The antibody was captured by A, and then five different concentrations of PD-1.His protein were used as the mobile phase, with association and dissociation times of 30 and 60 min, respectively. The binding rate (ka), dissociation rate (kd) and equilibrium constant (KD) were analyzed using GE Software 2.0. The two humanized molecules, NB182-z1 and NB182-z2, have the same affinity as NB182, and the binding rate (kd) and equilibrium constant (KD) were analyzed using GE Software 2.0. NB182-z3, NB182-z4, and NB182-z5 have similar affinities to NB182. Two humanized molecules, NB194-z4 and NB194-z5, have affinity matching with NB194, and NB194-z1, NB194-z2, and NB194-z3 have affinity similar to NB194. [Table 9]

[0112] Example 11: Mutant antibodies Random point mutations were introduced into the NB194 antibody using the GeneMorph II kit (Agilent, 200550), and a phage antibody library was constructed and screened to obtain 77 mutant antibodies (NB194-P1 to NB194-P77). Verification showed that the affinity and antibody functional activity of these antibodies are similar to those of the NB194 antibody. As shown in the table below and Figure 8, the affinity of the NB194-P29 mutation is the highest, which is 5-fold improved compared to NB194, and the functional activity is also improved. [Table 10]

[0113] Example 12: Humanization of NB194-P29 The NB194-P29 antibody was humanized using the humanization strategy described in Example 10, resulting in 10 humanized molecules, all of which have similar affinity to NB194-P29. [Table 11]

Claims

1. PD-1 binding molecule comprising an anti-PD-1 single domain antibody having complementarity determining regions (CDRs) comprising CDR1, CDR2 and CDR3, CDR1 comprises the sequence shown in SEQ ID NO: 1, CDR2 comprises the sequence shown in SEQ ID NO: 2, and CDR3 comprises the sequence shown in SEQ ID NO: 3; CDR1 comprises the sequence shown in SEQ ID NO: 19, CDR2 comprises the sequence shown in SEQ ID NO: 73, and CDR3 comprises the sequence shown in SEQ ID NO: 87; CDR1 comprises the sequence shown in SEQ ID NO: 37, CDR2 comprises the sequence shown in SEQ ID NO: 75, and CDR3 comprises the sequence shown in SEQ ID NO: 135; CDR1 comprises the sequence shown in SEQ ID NO: 320, CDR2 comprises the sequence shown in SEQ ID NO: 75, and CDR3 comprises the sequence shown in SEQ ID NO: 135; CDR1 comprises the sequence shown in SEQ ID NO: 19, CDR2 comprises the sequence shown in SEQ ID NO: 55, and CDR3 comprises the sequence shown in SEQ ID NO: 87; CDR1 comprises the sequence set forth in SEQ ID NO: 19, CDR2 comprises the sequence set forth in SEQ ID NO: 72, and CDR3 comprises the sequence set forth in SEQ ID NO: 87; or A PD-1 binding molecule, wherein CDR1 comprises the sequence set forth in SEQ ID NO: 19, CDR2 comprises the sequence set forth in SEQ ID NO: 53, and CDR3 comprises the sequence set forth in SEQ ID NO:

87.

2. The FR region of the single domain antibody comprises a FR region of any one of VHHs selected from SEQ ID NOs: 231, 261, 310-317, 319, 318, 200, 228-230, 232, and 233; and / or The single domain antibody VHH is selected from the group consisting of SEQ ID NOs: 231, 261, 310-317, 319, 318, 200, 228-230, 232, and 233, and / or The PD-1-binding molecule of claim 1, wherein the PD-1-binding molecule is a monovalent or polyvalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody or antigen-binding fragment thereof, or an antibody or antigen-binding fragment thereof, comprising one, two or more of the single domain antibodies.

3. the PD-1 binding molecule is a heavy chain antibody, the heavy chain antibody further comprising a heavy chain constant region; Preferably, the heavy chain constant region comprises the sequence shown in SEQ ID NO:

321. The PD-1 binding molecule of claim 2.

4. A polynucleotide, the polynucleotide comprising: (1) A coding sequence for the PD-1-binding molecule of any one of claims 1 to 3; (2) Complementary sequence of (1) A polynucleotide selected from the group consisting of:

5. A nucleic acid construct comprising the polynucleotide of claim 4, Preferably, said nucleic acid construct is characterized in that it is a recombinant vector or an expression vector.

6. A phage comprising a PD-1-binding molecule according to any one of claims 1 to 3, Preferably, the PD-1 binding molecule is displayed on the surface of the phage.

7. A host cell, the host cell comprising: (1) expressing and / or secreting a PD-1-binding molecule according to any one of claims 1 to 3; and / or (2) comprising the polynucleotide of claim 4; and / or (3) The nucleic acid construct according to claim 5. A host cell characterized in that

8. 10. A method of producing a PD-1 binding molecule, comprising culturing a host cell of claim 7 under conditions suitable for production of the PD-1 binding molecule, and optionally purifying the PD-1 binding molecule from the culture.

9. A pharmaceutical composition comprising a PD-1-binding molecule according to any one of claims 1 to 3, a polynucleotide according to claim 4, a nucleic acid construct according to claim 6, a phage according to claim 6 or a host cell according to claim 7, and a pharma- ceutically acceptable excipient, Preferably, the pharmaceutical composition is utilized to treat cancer.

10. 4. Use of the PD-1 binding molecule of any one of claims 1 to 3 in the manufacture of a medicament for preventing or treating cancer.

11. A PD-1 detection kit for use in evaluating the efficacy of drug therapy or diagnosing cancer, the kit comprising the PD-1-binding molecule of any one of claims 1 to 3, the polynucleotide of claim 4, the nucleic acid construct of claim 5, the phage of claim 6, or the host cell of claim 7; Preferably, the kit further comprises a reagent for detecting binding of PD-1 to the single domain antibody, antibody, or antigen-binding fragment thereof; More preferably, the reagent is a reagent for detecting the binding by enzyme immunoassay.

12. 11. A non-diagnostic method for detecting the presence of PD-1 in a sample, the method comprising incubating a PD-1-binding molecule of any one of claims 1 to 3 with the sample and detecting binding of PD-1 to the single domain antibody, antibody or antigen-binding fragment thereof, thereby determining the presence of PD-1 in the sample.

13. 4. Use of a PD-1 binding molecule according to any one of claims 1 to 3 in the preparation of a kit for detecting PD-1 in a sample, for assessing the effect of drug treatment, or for diagnosing cancer.

Images