Genetically modified hepatocyte populations

Abstract

The present disclosure provides a population of genetically modified hepatocytes and / or hepatic progenitor cells and methods for producing the same. Methods of using the population of genetically modified hepatocytes and / or progenitor cells are also provided, including, but not limited to, methods for treating a subject or subjects for a condition or conditions. In some examples, the population of genetically modified hepatocytes and / or hepatic progenitor cells are hypoimmunogenic, and the methods include methods for generating hypoimmunogenic hepatocytes and / or their progenitors. Non-human mammals comprising transplanted populations of genetically modified hepatocytes and / or hepatic progenitor cells are also provided. Useful kits, systems, reagents, cells, and cell therapy doses are also provided.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 141,769, filed January 26, 2021, which is incorporated herein by reference in its entirety. [Background technology]

[0002] In the United States alone, there are over 100,000 patients with acute liver disease and over 500,000 with decompensated cirrhosis. Liver disease causes 62,000 deaths annually in the United States and approximately 2 million deaths worldwide, with 1.3 million deaths due to cirrhosis. As of 2019, cirrhosis was the 11th leading cause of death worldwide and the 12th leading cause of death in the United States. Approximately 2 billion people worldwide consume alcohol, an additional 2 billion adults are obese or overweight, and 400 million adults suffer from diabetes. Alcohol consumption, hepatic lipid deposition, and insulin resistance are all believed to be major risk factors in the development of fibrosis and ultimately cirrhosis. Furthermore, drug-induced liver injury continues to increase as a leading cause of acute hepatitis, while the global prevalence of viral hepatitis remains high.

[0003] In addition, in developed countries where deaths from infectious diseases are rare, genetic disorders, although individually rare, collectively represent a significant burden of childhood disease, disability, and death. Monogenic disorders are estimated to affect up to 6% of people at some point in their lives. Genetic disorders broadly include those caused by a single locus (i.e., "monogenic disorders," including monogenic diseases), as well as polygenic disorders caused by a collection of multiple genetic risk factors and / or in combination with specific environmental factors. Although the total burden of genetic disease is difficult to quantify, and many causative loci are known, genetic counseling has had minimal impact in reducing overall prevalence by perhaps 5% (although screening can be highly effective for certain conditions when applied diligently) (see, e.g., Blencowe et al. J Community Genet. 2018). Genetic diseases include many rare liver diseases such as phenylketonuria, ornithine transcarbamylase deficiency, arginase-1 deficiency, α1-antitrypsin deficiency, mucopolysaccharidoses, hemophilia A, and hemophilia B. The large collective burden of genetic diseases, combined with the low impact that genetic counseling has in reducing that burden, illustrates the substantial ongoing impact these diseases have on global health.

[0004] Liver transplantation, when available and successful, is a life-changing treatment that represents the second most common solid organ transplant.Liver transplantation is useful in both acquired and inherited liver disease.However, suitable livers are often not available in the required quantity or time for subjects with rapidly declining conditions, such as acute liver failure.Compared to the widespread disease prevalence described above, less than 9,000 liver transplants are performed in the United States each year.

[0005] Despite recent advances in immunosuppressants and treatment protocols using immunosuppressants, rejection remains a common complication of liver transplantation. By some measures, the incidence of acute allograft rejection ranges from 20% to 40% of liver transplants. Methods to predict liver transplant rejection, as well as post-transplant morbidity and mortality, are preliminary, and the predictive power of such methods is controversial. The incidence of acute and chronic rejection has decreased with improvements in immunosuppressive regimens in liver transplant recipients. While acute rejection usually responds well to improved regimens, chronic rejection is a more challenging situation as a significant proportion of patients do not respond to increased immunosuppression, often resulting in retransplantation or death. Also, despite advances with improved immunosuppressive regimens, many patients are unable to tolerate immunosuppressive drugs due to comorbidities or cannot safely administer immunosuppressive drugs due to existing contraindications. Summary of the Invention

[0006] The present disclosure provides a population of genetically modified hepatocytes and / or hepatic progenitor cells and methods for producing the same. Methods of using the population of genetically modified hepatocytes and / or progenitor cells are also provided, including, but not limited to, methods for treating a subject or subjects for a condition or conditions. In some examples, the population of genetically modified hepatocytes and / or hepatic progenitor cells are hypoimmunogenic, and the methods include methods for generating hypoimmunogenic hepatocytes and / or their progenitors. Non-human mammals comprising transplanted populations of genetically modified hepatocytes and / or hepatic progenitor cells are also provided. Useful kits, systems, reagents, cells, and cell therapy doses are also provided.

[0007] The invention is best understood from the following detailed description when read in conjunction with the accompanying drawings, in which: It is emphasized that, according to common practice, the various features of the drawings are not to scale. Conversely, dimensions of the various features have been arbitrarily expanded or reduced for clarity. The drawings include the following figures: [Brief description of the drawings]

[0008] [Figure 1] Graph showing target locus editing efficiency in hepatocyte cell populations contacted with editing compositions targeting either β2-microglobulin (B2M) exon 1 or control AAVS1, with or without B2M-HLA-E or CD47 transgene delivery reagents, as measured by indels (left y-axis, dotted bars) and knockout (KO) scores (left y-axis, hatched bars). Also provided is the percentage of cells with B2M KO ("%B2M-cells") as measured by flow cytometry (right y-axis, black dots) in the corresponding hepatocyte cell populations after the indicated genetic modifications.

[0009] [Diagram 2] Graph showing the percentage of live cells with only CD47 transgene genetic modification (%CD47), both B2M KO and CD47 transgene genetic modifications ("%B2M- / CD47+"), B2M-human leukocyte antigen E (HLA-E) fusion transgene genetic modification only ("%HLA-E"), and both B2M KO and B2M-HLA-E fusion transgene genetic modifications ("%B2M / HLA-E"), which were generated from hepatocyte populations contacted with editing compositions targeting B2M exon 1 or control AAV1 with or without B2M-HLA-E or CD47 transgene delivery reagents, as measured by flow cytometry. The percentage of cells in each test group with B2M KO ("%B2M-", dots) is also provided.

[0010] [Diagram 3]Figures 3A-D are a series of grafts showing the percentage of edited cells in the input and output populations with B2M KO as measured by DNA analysis (Figure 3A), B2M KO as measured by flow cytometric analysis (Figure 3B), HLA-E transgene expression as measured by flow cytometric analysis (Figure 3C), and dual modification (i.e., both B2M KO and transgene expression) as measured by flow cytometric analysis (Figure 3D). Samples from untreated control (NTC) animals (i.e., animals transplanted with unmodified PHH) were also evaluated in parallel.

[0011] [Figure 4] Matrix of bioluminescence images collected at three time points (days 57 or 60, 85, and 97) after transplantation of factor IX lentiviral vector-transduced (LV-F9) or luciferase lentiviral vector-transduced (LV-Luc) hepatocytes into recipient mice.

[0012] [Diagram 5] Quantification of bioluminescent signals detected in LV-F9 and LV-Luc mice shown in FIG. 4 at all time points is presented.

[0013] [Figure 6] FIG. 1 is a graph showing the levels of human albumin produced by transplanted engineered hepatocytes, measured in peripheral blood samples collected from LV-F9 and LV-Luc mice at days 14, 28, 47, and 98 post-transplant.

[0014] [Figure 7] 1 is a graph showing levels of human factor IX detected in peripheral blood samples collected from LV-F9 and LV-Luc mice at days 14, 28, 47, and 98 post-transplant. Reference levels showing the limit of detection (LOD), corresponding therapeutic levels of factor IX, and corresponding normal physiological levels of factor IX are provided for comparison.

[0015] [Figure 8] 1 is a plot of human factor IX levels measured in each animal versus the corresponding human albumin levels in each animal at day 47 post-transplant in LV-F9 and LV-Luc mice. Reference levels for 0.1%, 1%, and 5% engraftment, and for 5% and 100% of normal physiological human factor XI are shown as vertical and horizontal dotted lines, respectively.

[0016] [Figure 9] 1 is a plot of human factor IX levels measured in each animal versus the corresponding human albumin levels in each animal at 98 days post-transplant in LV-F9 and LV-Luc mice. Reference levels for 0.1%, 1%, and 5% engraftment, and for 5% and 100% of normal physiological human factor XI are shown as vertical and horizontal dotted lines, respectively. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0017] The present disclosure provides a population of genetically modified hepatocytes and / or hepatic progenitor cells and methods for producing the same. Methods of using the population of genetically modified hepatocytes and / or progenitor cells are also provided, including, but not limited to, methods for treating a subject or subjects for a condition or conditions. In some examples, the population of genetically modified hepatocytes and / or hepatic progenitor cells are hypoimmunogenic, and the methods include methods for generating hypoimmunogenic hepatocytes and / or their progenitors. Non-human mammals comprising transplanted populations of genetically modified hepatocytes and / or hepatic progenitor cells are also provided. Useful kits, systems, reagents, cells, and cell therapy doses are also provided.

[0018] Before describing the present invention in more detail, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0019] Where a range of values ​​is provided, unless the context clearly dictates otherwise, it is understood that each intervening value, to the tenth of the unit of the lower limit between the upper and lower limits of that range, and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may be independently included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0020] Certain ranges are described herein by numerical values ​​preceded by the term "about." The term "about" is used herein to provide literal support for the exact number it precedes, as well as a number that is close to or approximately the number it precedes. In determining whether a number is close to or approximately a specifically recited number, the near or approximate unrecited number may be a number that, in the context in which it is presented, provides the substantial equivalent of the specifically recited number.

[0021] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, representative exemplary methods and materials are described herein.

[0022] All publications and patents cited herein are incorporated by reference herein as if each individual publication or patent was specifically and individually indicated to be incorporated by reference, and are incorporated by reference herein to disclose and describe the methods and / or materials for which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.

[0023] It should be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. It should be further noted that the claims may be drafted to exclude any element. Thus, this statement is intended to serve as a predicate for the use of exclusive terminology, such as "solely," "only," or the use of a "negative" limitation in connection with the recitation of claim elements.

[0024] As will be apparent to one of ordinary skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has distinct components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the invention. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.

[0025] Although the apparatus and methods have been described for grammatical fluidity with functional descriptions, it is to be clearly understood that the claims should not be construed as necessarily limited by the construction of "means" or "step" limitations unless expressly formulated under 35 U.S.C. §112, but rather should be given the full scope of meaning and equivalents of the definitions provided by the claims under the legal theory of equivalents, and that if a claim is expressly formulated under 35 U.S.C. §112, the full legal equivalents under 35 U.S.C. §112 should be given.

[0026] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The following definitions are intended to include their various grammatical forms, where applicable. As used herein, the singular forms "a," "an," or "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a "cell" includes a plurality of such cells, reference to an "agent" includes reference to one or more agents known to those of ordinary skill in the art, and so forth.

[0027] The term "about" with respect to a reference numerical value can include a range of values ​​from that value plus or minus 10%. For example, the amount "about 10" includes values ​​from 9 to 11, including the values ​​9, 10, and 11. The term "about" with respect to a reference numerical value can also include a range of values ​​from that value plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%.

[0028] Before describing particular embodiments of the present disclosure, it will be useful to set forth definitions that will be used in describing the present disclosure.

[0029] The term "estimating" includes any form of measurement, including determining whether an element is present or not. The terms "determining," "measuring," "assessing," "estimating," and "assaying" are used interchangeably and include quantitative and qualitative determinations. Estimating can be relative or absolute.

[0030] The terms "control," "control assay," "control sample," and the like refer to a sample, test, or other part of an experimental or diagnostic procedure or experimental design in which the expected outcome is known with a high degree of certainty, for example, to indicate whether the results obtained from the associated experimental sample are reliable, to indicate the confidence that the associated experimental results indicate a true outcome, and / or to allow calibration of the experimental results. For example, in some instances, a control may be a "negative control" assay in which essential components of the assay are omitted so that the experimenter can have a high degree of certainty that the negative control assay will not produce a positive outcome. In some instances, a control may be a "positive control" assay in which all components of a particular assay are characterized and known to produce a particular outcome in the assay being performed when combined, so that the experimenter can have a high degree of certainty that the positive control assay will not produce a positive outcome. Controls may also include "blank" samples, "standard" samples (e.g., "gold standard" samples), validated samples, and the like.

[0031] The terms "recipient," "individual," "subject," "host," and "patient" are used interchangeably herein and refer to any mammalian subject, e.g., a human subject, for which diagnosis, treatment, or therapy is desired, indicated, or performed. "Mammal" for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, e.g., dogs, horses, cats, cows, sheep, goats, pigs, camels, and the like. In some embodiments, the mammal is a human. In some cases, the methods of the present disclosure are used in laboratory animals, in veterinary applications, and / or in the development of animal models, including, but not limited to, rodents, including mice, rats, and hamsters, rabbits, dogs, cats, non-human primates, and other animals.

[0032] As used herein, the terms "disease" and "condition" may be used interchangeably or may differ in that a particular disease or condition may not have a known causative agent (and thus the etiology has not yet been elucidated) and therefore is not yet recognized as a disease, but only as an undesirable state or syndrome in which a more or less specific set of symptoms has been identified by clinicians.

[0033] The terms "treatment", "treating", "treating" and the like are used herein generally to refer to obtaining a desired pharmacological and / or physiological effect. The effect may be preventative in that it completely or partially prevents the disease or its symptoms, and / or may be therapeutic in that it partially or completely stabilizes or cures the disease and / or the adverse effects caused by the disease. For example, preventative treatment, i.e., prophylactic treatment, may include treatment that effectively prevents a condition (e.g., a liver condition) or treatment that effectively prevents or controls the progression of a condition (e.g., a liver condition). In some instances, treatment may result in a therapeutic response, such as a complete or partial remission. The term "treatment" encompasses any treatment of a disease in a mammal, particularly a human, and includes (a) preventing the disease and / or symptoms from occurring in a subject who may be susceptible to the disease or symptoms but has not yet been diagnosed as suffering from the disease; (b) inhibiting the disease and / or symptoms, i.e., halting the development of the disease and / or associated symptoms; and (c) relieving the disease and associated symptoms, i.e., causing regression of the disease and / or symptoms.

[0034] Those in need of treatment can include those already affected (e.g., those with a condition, those with a liver condition (e.g., acute liver condition, chronic liver condition, etc.), those with cirrhosis, those with fibrosis, those with disease, those with monogenic disease, etc.), as well as those for whom prevention is desired (e.g., those with increased susceptibility to a condition (e.g., a liver condition); those suspected of having a condition (e.g., a liver condition); those at increased risk of developing a condition (e.g., a liver condition); those with increased environmental exposure to a medical treatment or agent that causes the condition (e.g., a liver condition); those suspected of having a genetic or behavioral predisposition to a condition (e.g., a liver condition); those with a condition (e.g., a liver condition); those with screening results indicating an increased risk for the condition (e.g., a liver condition); those who have tested positive for a condition (e.g., a liver condition); those who have tested positive for one or more biomarkers for a condition (e.g., a liver condition), etc.).

[0035] A therapeutic treatment is one in which the subject is afflicted prior to administration, and a prophylactic treatment is one in which the subject is not afflicted prior to administration. In some embodiments, the subject is likely to be afflicted or suspected of being likely to be afflicted (e.g., compared to the norm, e.g., compared to the average individual, e.g., the subject may have a family history indicating a genetic predisposition and / or increased risk for the condition), in which case the treatment may be a prophylactic treatment.

[0036] The term "recombinant," as used herein to describe a nucleic acid molecule, refers to a polynucleotide of genomic, cDNA, viral, semisynthetic, and / or synthetic origin, which is not related by its origin or manipulation to all or a portion of the polynucleotide sequence associated in nature. The term recombinant, as used with respect to a protein or polypeptide, refers to a polypeptide produced by expression from a recombinant polynucleotide. The term recombinant, as used with respect to a host cell or virus, refers to a host cell or virus into which a recombinant polynucleotide has been introduced. Recombinant is also used herein with respect to a material (e.g., a cell, nucleic acid, protein, or vector) to refer to the material being modified by the introduction of heterologous material (e.g., a cell, nucleic acid, protein, or vector). Recombinant nucleic acids, polynucleotides, cells, and the like, may be referred to herein as engineered nucleic acids, engineered polynucleotides, engineered cells, and the like.

[0037] The terms "nucleic acid" and "polynucleotide", used interchangeably herein, refer to polymeric forms of nucleotides of any length, either ribonucleotides or deoxyribonucleotides, including analogs thereof. These terms refer only to the primary structure of the molecule. Thus, the term includes double- and single-stranded DNA, triple-stranded DNA, and double- and single-stranded RNA. It also includes modified forms, for example, by methylation and / or capping, as well as unmodified forms of polynucleotides. The term is also intended to include molecules containing non-naturally occurring or synthetic nucleotides and nucleotide analogs. Non-limiting examples of nucleic acids and polynucleotides include linear and circular nucleic acids, messenger RNA (mRNA), cDNA, recombinant polynucleotides, vectors, probes, primers, single-, double-, or multiple-stranded DNA or RNA, genomic DNA, DNA-RNA hybrids, chemically or biochemically modified, non-natural, or derivatized nucleotide bases, oligonucleotides containing modified or non-natural nucleotide bases (e.g., locked nucleic acid (LNA) oligonucleotides), and interfering RNA. In some instances, the polynucleotide may be a contiguous open reading frame polynucleotide that excludes at least some non-coding sequences from the corresponding sequence present in the genome of the organism.

[0038] The term "polypeptide" is used interchangeably with the terms "polypeptide" and "protein" and refers to a polymer of amino acid residues. Polypeptides include functional protein fragments of essentially any length as well as full-length proteins. The term "peptide" as used herein generally refers to a polypeptide chain of 40 amino acids or less. A "peptide therapeutic" is a peptide with established therapeutic function. A "therapeutic polypeptide" is a polypeptide with established therapeutic function. In some embodiments, polypeptides and peptides, including therapeutic polypeptides and peptides, can be expressed from a transgene.

[0039] The term "transduction", as used herein, generally refers to the introduction of an exogenous nucleic acid into a cell using a viral vector, and the term "transfection", as used herein, generally refers to the process of introducing a nucleic acid into a cell by a non-viral method. However, in some instances throughout this disclosure that will be readily apparent to one of skill in the art, the terms "transduction" and "transfection" may be used interchangeably. In some instances, the use of the term transduction may exclude non-viral delivery of a nucleic acid. In some instances, the use of the term transfection may exclude viral delivery of a nucleic acid.

[0040] The terms "viral particle," "virus," and the like refer to infectious viral agents including, for example, baculovirus particles, lentivirus particles, adenovirus particles, etc. Viruses and viral particles may be naturally occurring, recombinant, engineered, or synthetic.

[0041] A "vector" is capable of introducing a gene sequence into a target cell. Typically, "vector construct", "expression vector", and "gene transfer vector" refer to any nucleic acid construct capable of inducing expression of a gene of interest or other desired expression product and capable of introducing a nucleic acid sequence into a target cell. Thus, the term includes cloning and expression vehicles, as well as integration vectors. A "vector" or "expression vector" may also refer to a replicon, such as a plasmid, phage, virus, or cosmid, to which another nucleic acid segment, or "insert", can be attached to effect expression and / or replication of the attached segment in a cell.

[0042] As used herein, the term "retrovirus" refers to an RNA virus that reverse transcribes its genomic RNA into a linear double-stranded DNA copy, and then covalently integrates its genomic DNA into the host genome. Retroviruses are a common tool for gene delivery. Exemplary retroviruses include, but are not limited to, Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV), mouse mammary tumor tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV), spumaretrovirus, Friend murine leukemia virus, murine stem cell virus (MSCV) and Rous sarcoma virus (RSV)) and lentivirus.

[0043] As used herein, the term "lentivirus" refers to a group (or genus) of complex retroviruses. Exemplary lentiviruses include, but are not limited to, HIV (human immunodeficiency virus; including HIV type 1 and HIV type 2); Visna-Maedi virus (VMV); Caprine arthritis-encephalitis virus (CAEV); Equine infectious anemia virus (EIAV); Feline immunodeficiency virus (FIV); Bovine immunodeficiency virus (BIV); and Simian immunodeficiency virus (SIV). In some embodiments, an HIV-based vector backbone (i.e., HIV cis-acting sequence elements) may be used.

[0044] Retroviral vectors, more specifically lentiviral vectors, can be used as described herein. The term "retrovirus" or "retroviral vector" used herein is meant to include "lentivirus" and "lentiviral vector", respectively. In addition, when a specific type of retrovirus or vector, such as a lentivirus or lentiviral vector, is referred to, those skilled in the art will easily understand that in some cases, other retroviruses and / or other retroviral vectors and / or retroviruses in general and / or retroviral vectors in general can be used instead of the specifically listed virus or vector.

[0045] The term "bioreactor" as used herein generally refers to an apparatus, machine, or system for the production under controlled conditions of living organisms or cells, or products synthesized and harvested therefrom. Bioreactors can be manufactured, such as single-use or reusable vessels made of steel, glass, plastic, or other materials, and configured to maintain a controlled, optionally homogenous, environment suitable for the desired biological activity. Manufactured bioreactors can include a variety of control mechanisms, including, but not limited to, temperature controllers, pH controllers, gas controllers and exchangers (e.g., for controlling oxygen, carbon dioxide, and / or other gas levels), which can include a combination of sensors and actuators that read specific signals and drive the signaled adjustments. Non-limiting examples of manufactured bioreactors include stirred tank, rocker, airlift, fixed bed, rotating wall, and perfusion bioreactors. Non-limiting examples of manufactured bioreactor components include agitators, impellers, spargers, probes, sterile seals, baffles, feed lines, exhaust lines, vents, heaters, coolers, and the like. Bioreactors can be used to grow non-adherent cells as well as adherent cells. Bioreactors can range in size from, for example, 15 mL or less to 2000 L or more, and in some examples, can range from a liter or several liters to 10, 20, 50, or 100 L or more. Further description of bioreactors, including examples of commercial suppliers, is provided by Stephenson et al. F1000Research (2018), the disclosure of which is incorporated herein by reference in its entirety. In addition to manufactured bioreactors, the term bioreactor also includes live animal or in vivo bioreactors.

[0046] The terms "living bioreactor," "animal bioreactor," and "in vivo bioreactor," as used herein, generally refer to a living non-human animal, such as a non-human mammal, into which exogenous cells, such as hepatocyte-producing cells (i.e., cells that produce hepatocytes, such as hepatocytes and / or hepatic progenitor cells), are introduced for engraftment and proliferation. The animal bioreactor may be used to generate an expanded population of desired cells, which may include the introduced cells and / or their progeny, such as an expanded population of hepatocytes generated from the introduced cells. The introduction of exogenous cells, such as hepatocyte-producing cells, into the bioreactor generally involves xenografting, and thus the transplanted exogenous cells may in some cases be referred to as xenografts, e.g., human-to-rodent xenografts, human-to-mouse xenografts, human-to-rat xenografts, human-to-pig xenografts, mouse-to-rat xenografts, rat-to-mouse xenografts, rodent-to-pig xenografts, etc. In some cases, allogeneic transplants can be performed in the bioreactor, such as, for example, rodent-to-rodent, pig-to-pig, etc. The bioreactor can be configured, for example, genetically and / or pharmacologically, to confer a selective advantage to the introduced exogenous cells, such as introduced exogenous hepatocyte-producing cells, to promote exogenous liver cell engraftment and / or proliferation. The bioreactor can be configured, in some cases, to prevent rejection of the introduced exogenous cells, for example, by means including, but not limited to, genetic and / or pharmacological immunosuppression. Thus, the in vivo bioreactor can be subject to external manipulation, for example, via adjustment of the animal's environment, diet, and / or administration of one or more drugs, for example, to promote engraftment, prevent rejection, prevent infection, maintain health, etc.

[0047] The term "ex vivo" is used to refer to manipulations, experiments, and / or measurements performed in or on a sample (such as, for example, tissues or cells) obtained from an organism, where the manipulations, experiments, and / or measurements are performed in an environment outside the organism. Thus, the term "ex vivo manipulation" when applied to cells refers to manipulations of cells (e.g., hepatocytes) outside the organism, including, but not limited to, culturing the cells, performing one or more genetic modifications on the cells, and / or exposing the cells to one or more agents. Thus, ex vivo manipulations may be used herein to refer to treatments of cells outside the animal, for example, after the cells are obtained from an animal or organ (e.g., liver) and before such cells are transplanted into an animal, such as an animal bioreactor or a subject requiring transplantation. In contrast to "ex vivo," the term "in vivo" as used herein may refer to, for example, cells (e.g., hepatocytes and / or hepatic progenitor cells) that are within a subject, or cells that are within an animal, or an organ of an animal, resulting from the generation of cells within a subject and / or transplantation of cells into a subject, such as the liver of a subject.

[0048] As used herein, the term "harvesting", e.g., when referring to expanded human hepatocytes, refers to the process of removing expanded hepatocytes from an animal (e.g., a non-human mammal, rodent, mouse, rat, or pig bioreactor) that has been injected or transplanted with isolated human hepatocytes, or other hepatocyte-producing cells, as described herein. In some cases, the non-human animal that receives the transplant of cells, e.g., genetically modified cells, may be referred to as a recipient animal. In some cases, the human subject that receives the transplant, e.g., transplant of expanded, genetically modified hepatocytes, may be referred to as a treatment subject, recipient, or the like. Harvesting optionally includes separating the cells, e.g., hepatocytes, from other cell types, including, but not limited to, non-hepatic cell types (e.g., blood cells, extrahepatic immune cells, vascular cells, etc.), non-hepatic liver cells (e.g., hepatic stellate cells, Kupffer cells, and liver sinusoidal endothelial cells).

[0049] As used herein, "cryopreservation" refers to cells (such as liver cells) or tissues that have been preserved or maintained by cooling to low freezing points, such as 77K or -196°C (the boiling point of liquid nitrogen). At these low temperatures, all biological activity, including biochemical reactions that lead to cell death, is effectively stopped. Useful methods of cryopreservation and thawing cryopreserved cells, as well as related processes and reagents, include, but are not limited to, those described in, for example, U.S. Patent Nos. 10,370,638, 10,159,244, 9,078,430, 7,604,929, 6,136,525, and 5,795,711, the disclosures of which are incorporated herein by reference in their entirety. In contrast, the term "fresh" as used herein with respect to cells may refer to cells that have not been cryopreserved and that have been obtained and / or used (e.g., transplanted, cultured, etc.) directly after collection, for example, from a subject or its organs.

[0050] The term "survival" is used to refer to cells that remain viable in vitro or in vivo after some event, such as, for example, transplantation into an animal, co-culture with immune cells, contact with a particular drug, etc. Cell survival can be assessed using a variety of methods, including direct assessment (e.g., qualitative or quantitative measurement of cell viability in a sample that contains or is expected to contain the cells of interest) and indirect assessment (e.g., qualitative or quantitative measurement of one or more functional effects of the presence of viable cells). Useful direct and indirect readouts of cell (e.g., hepatocyte) survival can include, but are not limited to, cell counting (e.g., by hemocytometer, immunohistochemistry, flow cytometry, etc.), measurement of secreted factors or biomarkers (e.g., by protein (e.g., albumin) ELISA, Western blot, etc.), assessing the health of the recipient (e.g., by measuring vitals, functional tests (e.g., liver function tests), etc.), and the like. The term "survival" is also used to refer to the length of time that a subject, e.g., a subject having a liver disease or an animal model thereof, remains alive after some treatment, intervention, and / or challenge, such as, for example, administration or transplantation of cells (e.g., hepatocytes) to the subject, administration of an agent that causes a disease (e.g., liver disease) to the subject, or withdrawal of an agent that inhibits, delays, avoids, or prevents the onset of a disease (e.g., liver disease). Survival, when referring to a subject, can also be expressed as the proportion (e.g., percentage) of a population (e.g., a control group or a treatment group) that survives for a certain period of time after some treatment, intervention, and / or challenge. Those skilled in the biomedical arts will readily recognize what survival refers to, e.g., cells or subjects, when survival is used herein.

[0051] The term "engraftment" refers to the transplantation of cells or tissues into an animal. As used herein, engraftment of human hepatocytes in a recipient animal refers to the process by which human hepatocytes are implanted (e.g., into the liver) into the recipient animal after administration (e.g., injection). Under certain conditions, the transplanted human hepatocytes can proliferate in the recipient animal. As used herein, the term "proliferate" with respect to human hepatocytes refers to a process that allows cell division to occur such that the number of human hepatocytes increases. The term "in vivo proliferation" refers to a process that allows cell division of exogenous cells to occur within a living host (e.g., a non-human animal bioreactor, such as a rodent (e.g., mouse or rat) bioreactor, a porcine bioreactor, a rat bioreactor, etc.) such that the number of exogenous cells increases within the living host. For example, human hepatocytes transplanted into a non-human animal bioreactor may be proliferated in vivo within the bioreactor such that the number of human hepatocytes within the bioreactor increases.

[0052] The term "hepatocyte" generally refers to a type of cell that constitutes 70-80% of the cytoplasmic mass of the liver. Hepatocytes are involved in protein synthesis, protein storage and carbohydrate conversion, synthesis of cholesterol, bile salts and phospholipids, as well as detoxification, modification and excretion of exogenous and endogenous substances. Hepatocytes also initiate the formation and secretion of bile. Hepatocytes manufacture serum albumin, fibrinogen and the prothrombin loop of clotting factors and are the major site of synthesis of lipoproteins, ceruloplasmin, transferrin, complement and glycoproteins. In addition, hepatocytes have the ability to metabolize, detoxify and inactivate exogenous compounds such as drugs and pesticides, and endogenous compounds such as steroids.

[0053] An "effective amount" or "amount effective to" refers to an amount of a compound and / or cells that, when administered (e.g., to a mammal, e.g., a human, or to a mammalian cell, e.g., a human cell), is sufficient to affect a desired outcome (e.g., engraftment, proliferation, treatment, etc.). For example, an "effective amount," such as a "therapeutically effective amount," refers to an amount of a compound and / or cells of the present disclosure that, when administered to a mammal, e.g., a human, is sufficient to effect treatment in the mammal, e.g., a human. The amount of a composition of the present disclosure that constitutes a "therapeutically effective amount" varies depending on the compound and / or cells, the condition and its severity, the method of administration, and the age of the mammal being treated, but can be routinely determined by one of skill in the art having regard to their own knowledge and this disclosure.

[0054] Methods, Compositions, Cell Populations, and Animals The present disclosure includes methods, compositions, cell populations, and animals that contain, generate, or are used in making or using genetically engineered hepatocytes or their precursor cells. The genetically modified hepatocytes of the present disclosure may contain an integrated transgene encoding a gene product and / or an edited endogenous locus, including, for example, a disruption or "knockout" of an endogenous locus or gene, or a portion of a gene (e.g., an exon) therein. As described in more detail herein, essentially any gene product may be encoded by a transgene and / or essentially any locus may be targeted for editing. The production of genetically modified hepatocytes and the characteristics of the hepatocytes ultimately produced, as well as the cell populations that contain the produced hepatocytes, are variable.

[0055] Until the work described herein, it was unclear whether genetically modified hepatocytes, such as those described herein, could be produced and expanded within the liver of a recipient in vivo bioreactor to generate therapeutic cell populations containing substantial numbers of hepatocytes with the desired genetic modifications, as required for cell therapy. It remained unclear whether such cells, modified, for example, to encode heterologous gene products and / or to contain the described genetic changes, would efficiently engraft and repopulate production bioreactors, such as rat and pig bioreactors, to facilitate the generation of useful expanded populations containing substantial numbers of genetically modified hepatocytes.

[0056] In the context of xenogeneic transplantation, xenogeneic hepatocytes generally have a survival disadvantage compared to endogenous hepatocytes. In addition, genetic modification by gene editing reagents may adversely affect the cells of the population that are actually edited, for example, at one or more endogenous loci that are otherwise normal and / or to include an integrated transgene, resulting in reduced proliferation, loss of cell phenotype, increased cell fragility, etc. These effects may reduce the representation of the desired genetically modified cells in cell populations, including, for example, cell populations that are generated or used for cell therapy or cell therapy production. These adverse effects may result in poor engraftment, proliferation, recovery, and / or loss of transplanted edited cells, either alone or in combination with other processes such as host immune response, due to endogenous cells outcompeting the introduced genetically modified cells when conventional techniques are used, even when host preconditioning is used to promote graft survival. Thus, as shown herein, it has been unexpectedly found that cell populations containing a substantial number of expanded hepatocytes carrying the desired genetic modification can be produced by using the methods described herein. Furthermore, the percentage of hepatocytes carrying the desired genetic modifications within the engineered cell population was surprisingly found to remain substantially constant before and after xenotransplantation and in vivo bioreactor expansion, indicating comparable compatibility of unmodified and modified cells within the host.

[0057] In some embodiments, genetically modified hepatocytes can be produced by contacting a cell population containing hepatocytes and / or hepatic progenitor cells with an integration vector that includes a transgene.The integration vector and the conditions under which the cells are contacted with the integration vector are generally configured to allow the transgene to be functionally integrated into the hepatocytes or hepatic progenitor cells of the cell population.In some embodiments, the transgene can be integrated by homology directed repair (HDR) or other DNA repair process, including, for example, when HDR or other repair process is facilitated by the use of nucleases, such as, but not limited to, zinc finger nucleases (ZFNs), TAL effector nucleases (TALENs), CRISPR-associated (Cas) proteins, etc.

[0058] To produce low immunogenic hepatocytes, hepatocytes and / or their progenitors are genetically modified to include a transgene encoding a natural killer (NK) cell decoy receptor. Thus, specific examples are provided herein that describe the functional incorporation of a transgene encoding a NK cell decoy receptor. However, the disclosure is not so limited, and those skilled in the art will readily understand that other sequences of any interest can be used to replace, modify, or add to the described transgene, for example, to provide the functional incorporation of any essentially suitable and appropriate encoded gene product. Thus, it is readily understood that the description herein of a particular transgene encoding a particular gene product, such as a NK decoy receptor, also generally provides a description of the use of a transgene encoding essentially any gene product.

[0059] For example, to produce engineered hepatocytes useful for treating a monogenic disease, hepatocytes and / or their progenitor cells are genetically modified to contain a transgene that encodes a functional version of a gene product that is disrupted in the monogenic disease. Non-limiting examples of transgenes useful for functionally incorporating into genetically modified hepatocytes and / or hepatic progenitor cells to treat monogenic diseases include those transgenes encoding full-length and / or modified and / or variant forms of Factor IX, Factor VIII, von Willebrand factor, carbamoyl phosphate synthase (CPS1), N-acetylglutamate synthase (NAGS), ornithine transcarbamylase (OTC), alpha-galactosidase A gene (GLA), phenylalanine hydroxylase enzyme (PAH), arginase-1, alpha-1-antitrypsin (AAT), fumarylacetoacetate hydrolase (FAH), and the like, and combinations thereof (including, for example, fusions and / or polycistronic or dicistronic versions).

[0060] "Functionally integrated" as used herein generally means that the transgene is integrated into the genome of the cell in such a manner that the encoded gene product is expressed. The expression of the encoded gene product may be controlled in whole or in part by endogenous components of the cell or exogenous (including heterologous) components contained in the transgene. For example, in some instances, the expression of the encoded gene product may be controlled by one or more endogenous regulatory elements, e.g., promoters, enhancers, etc., at or near the genomic locus where the transgene is inserted. In some instances, the expression of the encoded gene product may be controlled by one or more exogenous (including heterologous) regulatory elements, e.g., promoters, enhancers, etc., present in the transgene and operably linked to the encoded gene product prior to insertion. The integration of the transgene genetically modifies cells, such as hepatocytes or hepatic progenitor cells, to produce, for example, genetically modified hepatocytes or genetically modified hepatic progenitor cells.

[0061] Functional integration of the transgene can be achieved by a variety of means, including through the use of an integrating vector, including viral and non-viral vectors. In some instances, a retroviral vector, such as a lentiviral vector, can be used. In some instances, a non-retroviral integrating vector can be used. The integrating vector can be contacted with the target cells in a suitable transduction medium, at a suitable concentration (or multiplicity of infection), and for a suitable time for the vector to infect the target cells to promote functional integration of the transgene.

[0062] Suitable incubation and / or transduction (and / or transfection, if applicable) times, e.g., in suitable medium, can vary. In some examples, suitable incubation (or transduction and / or transfection) times can be 8 hours or less, less than 8 hours, 6 hours or less, less than 6 hours, 5 hours or less, less than 5 hours, 4 hours or less, less than 4 hours, 3 hours or less, less than 3 hours, 2 hours or less. In some examples, incubation (or transduction and / or transfection) can be performed with stirring. Various stirring methods can be used, including, but not limited to, rocking (e.g., horizontal rocking / shaking), nutation, and similar motions, performed at a suitable speed and transduction temperature (e.g., at or about 37°C). In some examples, incubation (or transduction and / or transfection) times of 8 hours or less, less than 8 hours, 6 hours or less, less than 6 hours, 5 hours or less, less than 5 hours, 4 hours or less, less than 4 hours, 3 hours or less, less than 3 hours, 2 hours or less may prevent, limit, or otherwise reduce deleterious effects on the treated cells, resulting in an increase in the number of desired genetically modified cells, for example, through enhanced transduction and / or transfection efficiency and / or improved viability (e.g., compared to longer times).

[0063] In some embodiments, useful methods for functional integration of transgenes and / or delivery of components of the editing compositions described herein may include viral vectors. Viral vectors may be integrating or non-integrating. Non-limiting examples of useful viral vectors include retroviral vectors, lentiviral vectors, adenoviral (Ad) vectors, adeno-associated viral (AAV) vectors, hybrid Ad-AAV vector systems, and the like. Viral vectors may, in some instances, be used in other aspects of the methods described herein, such as delivery of gene editing components (e.g., nucleic acids encoding nucleases (e.g., ZFN, TALEN, Cas proteins, etc.), nuclease (e.g., ZFN, TALEN, Cas, etc.) proteins, nucleic acids encoding Cas9, Cas9 proteins, guide RNAs (gRNAs), ribonucleoproteins (RNPs), etc.).

[0064] In some embodiments, useful methods for functional integration of transgenes and / or delivery of components of the editing compositions described herein may include non-viral vectors. Useful non-viral vectors are varied and generally refer to delivery means that do not use viral particles and may generally be considered to be classified into three categories: naked nucleic acid, particle-based (e.g., nanoparticles), or chemical-based. Non-limiting examples of non-viral vectors include lipoplexes (e.g., cationic lipid-based lipoplexes), emulsions (e.g., lipid nanoemulsions, etc.), lipid nanoparticles (LNPs), solid lipid nanoparticles, peptide-based vectors, polymer-based vectors (e.g., polymersomes, polyplexes, polyethyleneimine (PEI)-based vectors, chitosan-based vectors, poly(DL-lactide) (PLA) and poly(DL-lactide-co-glycoside) (PLGA)-based vectors, dendrimers, vinyl-based polymers (e.g., polymethacrylate-based vectors), etc.), inorganic nanoparticles, etc. Non-viral vectors may, in some instances, be used in other aspects of the methods described herein, such as for delivery of gene editing components (e.g., nucleic acids encoding nucleases (e.g., ZFN, TALEN, Cas proteins, etc.), nuclease (e.g., ZFN, TALEN, Cas, etc.) proteins, nucleic acids encoding Cas9, Cas9 proteins, gRNAs, RNPs, etc.).

[0065] The cell population of the present disclosure generally comprises hepatocytes and / or hepatic progenitor cells. In some examples, the cell population can be highly enriched for hepatocytes and / or hepatic progenitor cells. By "highly enriched" it is meant that the cell type of interest is 70% or more, 75% or more, 80% or more, 85% or more, 90% or more of the cell composition, for example, about 95% or more, or 98% or more of the cell composition. In other words, the population can be a substantially pure composition of the cell type of interest. In some examples, the cell population of interest can include a crude preparation. In some examples, the cell population can be prepared from dissociated tissue, filtered or unfiltered. Cell populations containing hepatocytes and / or hepatic progenitor cells may, for example, include or exclude various non-hepatic cell types, including, but not limited to, non-parenchymal hepatic cells (NPCs), non-hepatic liver-associated cells (e.g., stellate cells, Kupffer cells, endothelial cells, cholangiocytes, etc.), immune cells (e.g., WBCs), RBCs, etc., depending on the method of isolation and / or preparation. In some examples, the cell population may be a pure or essentially pure preparation of hepatocytes and / or hepatic progenitor cells.

[0066] In some examples, the cell population may be prepared from one or more mammalian livers, such as, for example, human liver, non-human mammalian liver, rodent liver, rat liver, mouse liver, pig liver, non-human primate (NHP) liver, etc. In some examples, the engineered cells, including all engineered cells of a cell population or a plurality of cell populations, or a population of a plurality of cell populations, may all be derived from or prepared from a single human liver, such as a single cadaveric donor liver. The cells of the cell population may all be of one species (e.g., human, mouse, rat, pig, NHP, etc.) or may be a mixture of two or more species (i.e., a heterogeneous mixture). Heterogeneous cell mixtures may include, but are not limited to, human cells mixed with non-human cells (e.g., human-rat mixtures, human-mouse mixtures, human-pig mixtures, human-NHP mixtures, rat-mouse mixtures, rat-pig mixtures, etc.). Sources of livers vary and may include, but are not limited to, excised liver tissue, cadaveric human livers, chimeric (e.g., humanized) livers, bioreactor livers, etc. The cell population may be prepared from the liver (including whole liver and liver portions) according to and / or including any convenient method, such as, for example, but not limited to, dissociation, perfusion, filtration, sorting, etc.

[0067] In some examples, all or essentially all of the cells of the cell population, including all or essentially all of the hepatocytes or human hepatocytes of the cell population, can be derived from a single donor liver or a portion of a single donor liver. In some examples, the cells of the cell population, including all or essentially all of the hepatocytes or human hepatocytes of the cell population, can be derived from multiple different donor livers or a portion of multiple different donor livers. In some examples, multiple cell populations can be derived from a single donor liver, including, for example, when primary human hepatocytes collected from a single human donor liver are expanded multiple times, including 2 times or more, 5 times or more, 10 times or more, 20 times or more, 50 times or more, 100 times or more, etc., to generate multiple cell populations, for example, useful for treating multiple subjects.

[0068] In some examples, the cell population may be prepared from cultured hepatocytes and / or cultured hepatic progenitor cells. In some examples, the cell population may be prepared from primary liver cell preparations, including cell populations prepared from human livers, including, for example, primary human hepatocytes (PHH). In certain embodiments, the cell population may include hepatocytes isolated using standard techniques for any source (e.g., from a human donor). In certain embodiments, the hepatocytes are PHHs isolated from screened cadaveric donors, including fresh PHHs or cryopreserved PHHs. In some examples, the PHHs of the cell population have not undergone any cell cycle / division since being isolated from the liver, or have undergone a minimal number of cell cycles / divisions, including, but not limited to, for example, 1 or less, 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less cycles / divisions.

[0069] In some instances, cell populations containing hepatocytes and / or hepatic progenitor cells can be prepared from cells that are not immortalized or otherwise perpetually propagating cell lines, e.g., cell populations that are hepatocytes and / or hepatic progenitor cells can be derived from primary liver cells and the progeny of primary liver cells, including, for example, non-immortalized progeny of primary liver cells.

[0070] In some examples, the cell population may include or specifically exclude hepatic progenitor cells. As used herein, the terms "hepatic progenitor cells" and "progenitor cells of hepatocytes" and the like generally refer to cells from which hepatocytes are derived and / or which differentiate into hepatocytes. In some examples, hepatic progenitor cells may be committed progenitor cells, meaning that the progenitor cells are essentially differentiated only into hepatocytes. In some examples, hepatic progenitor cells may have various potencies, for example, multipotent, multipotent, or totipotent progenitor cells. Hepatic progenitor cells may include or be derived from stem cells, induced pluripotent stem cells (iPSCs), embryonic stem (ES) cells, hepatocyte-like cells (HLCs), and the like. In some examples, hepatic progenitor cells may be derived from mature hepatocytes and / or other non-hepatic cells, for example, via dedifferentiation of hepatocytes and / or transdifferentiation of other hepatic or non-hepatic cell types.

[0071] The cells of the cell population or subpopulation (including expanded cell population of hepatocytes) of the present disclosure may be derived from or may be the progeny of multiple individual cells (e.g., including multiple individual hepatocytes obtained from a single donor or multiple individual hepatocytes obtained from multiple donors). When a population of primary cells is derived from a single donor, such multiple individual cells essentially share the same donor genome, but are not clonally derived, are not monoclonal, and in some examples may contain certain differences from each other (e.g., including different genetic mutations, different epigenetic mutations, different zonations in the donor liver, differences in gene expression, etc.). Thus, in contrast to clonally derived cell populations, cell populations expanded from multiple individual primary hepatocytes, including primary hepatocytes from a single donor or multiple donors, may be referred to as non-monoclonal, or in some examples, such expanded cells may be referred to as polyclonal or non-clonally expanded. In some examples, the genetic modifications of the present disclosure may be performed on a population of individual primary hepatocytes (or their progeny) to generate a non-monoclonal population of engineered hepatocytes, and such cells may be expanded to generate an expanded population of non-monoclonal engineered hepatocytes. In some examples, the population of hepatocytes may be expanded to generate an essentially polyclonal population, which is subsequently genetically modified to generate an expanded population of non-monoclonal engineered hepatocytes.

[0072] In some examples, the hepatocytes and / or hepatic progenitor cells and / or the liver, subject, and / or cell culture from which such hepatocytes and / or hepatic progenitor cells are derived may be healthy hepatocytes and / or hepatic progenitor cells. "Healthy hepatocytes and / or hepatic progenitor cells," as used herein, means that the cells exhibit a normal hepatocyte phenotype and / or genotype that is essentially free of functional and / or genetic defects or deficiencies in or that affect normal liver and / or hepatocyte-related functions. Hepatocyte-associated functions include functions performed primarily or exclusively by hepatocytes in the liver, such as, for example, liver metabolism (e.g., hepatocyte metabolism), ammonia metabolism, amino acid metabolism (including biosynthesis and / or catabolism), detoxification, liver protein (e.g., albumin, fibrinogen, prothrombin, clotting factors (e.g., Factor V, Factor VII, Factor IX, Factor X, Factor XI, and Factor XII), protein C, protein S, antithrombin, lipoproteins, ceruloplasmin, transferrin, complement proteins) synthesis. Hepatocytes and / or hepatic progenitor cells can be healthy before, during, and / or after genetic modification as described herein. For example, in some instances, hepatocytes and / or hepatic progenitor cells can be healthy cells before and after genetic modification of the cells, for example, to functionally incorporate a heterologous transgene and / or to modify one or more endogenous loci. In some instances, hepatocytes and / or hepatic progenitor cells are healthy after correction of a defective disease-associated allele or locus.

[0073] Healthy hepatocytes and / or hepatic progenitor cells generally exclude those harboring genetic abnormalities associated with liver-related monogenic diseases, including, but not limited to, genetic cholestatic disorders, Wilson's disease, hereditary hemochromatosis, tyrosinemia, alpha-1 antitrypsin deficiency, urea cycle disorders, Crigler-Najjar syndrome, familial amyloidotic polyneuropathy, primary hyperoxaluria type 1, atypical hemolytic uremic syndrome-1, and the like. Thus, healthy hepatocytes and / or hepatic progenitor cells may contain normal genes / alleles (i.e., contain non-disease-associated genes / alleles, i.e., do not contain disease-associated genes / alleles) at loci and / or genes corresponding to liver-associated monogenic diseases, such as, but not limited to, ABCB11 (BSEP), AGXT, ARG, ASL, ASS, ATP7B, ATP8B1 (aka FIC1), CFH, CPS, FAH, HAMP, HFE, JAG1, JH, MDR3 (ABCB4), NAGS, OTC, PI, SLC40A1, TFR2, TTR, UGT1A1, etc. Further examples and descriptions of genes corresponding to liver-associated monogenic diseases can be found in Fagiuoli et al. J Hepatol (2013) 59(3):595-612, the disclosure of which is incorporated herein by reference in its entirety. Cells that harbor one or more genetic abnormalities associated with a liver-related monogenic disease may be referred to herein as "disease," "diseased," "disease-related," "dysfunctional," or "defective" cells, etc.

[0074] Cell populations such as hepatocytes and / or hepatic progenitor cells can be manipulated in various ways outside of a living organism, i.e. ex vivo. Such manipulations can include freezing, thawing, culturing, filtering, enriching, purifying, isolating, transfecting, transducing, etc., or in some cases can specifically exclude them. In some examples, the cells are thawed if frozen and placed in any suitable container or culture vessel. In some examples, the cells are cultured in a suitable culture medium with or without additional components.

[0075] A variety of suitable culture media can be used. In certain embodiments, the culture medium comprises Hepatocyte Basal Medium, FBS and / or ROCK inhibitor, for example, a 1:1 mixture of Hepatocyte Basal Medium and Lonza HCM™ Single Quots™, 5% FBS and 10 μM Rho kinase (ROCK) inhibitor. For example, a variety of hepatocyte-compatible culture media are available, including, but not limited to, Liebovitz L-15, Minimum Essential Medium (MEM), DMEM / F-12, RPMI 1640, Waymouth's MB752 / 1 Williams Medium E, H1777, Hepatocyte Thawing Medium (HTM), Cryopreserved Hepatocyte Recovery Medium (CHRM®), Human Hepatocyte Culture Medium (Millipore Sigma), Human Hepatocyte Plating Medium (Millipore Sigma), Human Hepatocyte Thawing Medium (Millipore Sigma), Lonza HCM™, Lonza HBM™, HepatoZYME-SFM (Thermo Fisher Scientific), Cellartis Power Primary HEP Medium (Cellartis), and the like. Various culture supplements and / or substrates can be included or excluded from the desired media, including, but not limited to, for example, Lonza Single Quots™ supplement, HepExtend™ supplement, fetal bovine serum, ROCK inhibitor, dexamethasone, insulin, HEGF, hydrocortisone, L-glutamine, GlutaMAX™, buffers (e.g., HEPES, sodium bicarbonate buffer, etc.), transferrin, selenium complexes, BSA, linoleic acid, collagen, collagenase, Geltrex™, methylcellulose, dimethyl sulfoxide, hyaluronidase, ascorbic acid, antibiotics, etc. Hepatocyte-compatible media can be general use or specifically formulated for primary, secondary, or immortalized hepatocytes, and such media can be configured to contain serum or growth factors or be serum-free, growth factor-free, or composed of minimal / reduced growth factors.

[0076] In some examples, cell populations comprising hepatocytes and / or hepatic progenitor cells may be subjected to ex vivo manipulations, including but not limited to, those described, for example, in U.S. Patent Application No. 16 / 938,059 (U.S. Patent Application Publication No. 20210024885) and International Application No. PCT / US2020 / 043439 (WO 2021 / 021612(A1)), the disclosures of which are incorporated herein by reference in their entireties. Such ex vivo manipulations, if performed, may be used at various times in the methods described herein, such as, but not limited to, after isolation, prior to transplantation into a bioreactor, prior to administration to a subject (e.g., to treat the subject for a condition), etc.

[0077] In some examples, freshly prepared hepatocytes and / or hepatic progenitor cells, or cell populations containing hepatocytes and / or hepatic progenitor cells, may be contacted with various reagents, compositions, and / or vectors, including, for example, transgenes encoding gene products, editing compositions, etc. Such freshly prepared cells may include freshly thawed cells (e.g., if previously cryopreserved), cells freshly isolated from a living subject (e.g., human, rodent, pig, etc.), cells freshly isolated from a liver or portion thereof (e.g., a cadaveric liver or portion thereof, a liver (or portion thereof) obtained from an in vivo bioreactor, etc.), etc.

[0078] A cell population containing a plurality of genetically modified cells can be generated, including cases where such cells contain a single genetic modification or multiple modifications. For example, in some instances, a cell population can be generated that contains a plurality of hepatocytes and / or hepatic progenitor cells that are genetically modified to be less immunogenic, and thus the population can contain a plurality of less immunogenic hepatocytes and / or hepatic progenitor cells. The size of the plurality of cells relative to the total cell population can vary. For example, in some instances, the plurality can include less than all of the cells of the population, including, but not limited to, cases where the plurality comprises at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the cell population. In some instances, the plurality of cells may comprise all, i.e., 100%, of a particular cell population.

[0079] In some examples, the cell population can include a plurality of cells modified to be hypoimmune, e.g., relative to the total cell population, the plurality constitutes at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the cell population.

[0080] In some examples, a cell population can include a plurality of cells that have been modified to contain a particular transgene, e.g., where the plurality constitutes at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the cell population relative to the total cell population.

[0081] In some examples, the cell populations before and / or after expansion in a bioreactor may comprise at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the desired genetically modified hepatocytes. In some examples, the input and output cell populations before and after expansion in a bioreactor may each comprise a plurality of cells having the desired genetic modification, and these plurality in the input and output populations may comprise percentages of the overall input and output populations that are within 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less of each other.

[0082] Cell populations containing hepatocytes and / or hepatic progenitor cells, including genetically modified hepatocytes and / or hepatic progenitor cells, can be introduced or transplanted into subjects, including, for example, human or non-human subjects for therapeutic purposes, non-human subjects for expansion and / or research purposes, etc. If performed under sufficient conditions, the hepatocytes and / or hepatic progenitor cells introduced into a subject can engraft, including engrafting in the liver of the subject. In some instances, engraftment can be prevented, for example, by the use of encapsulation techniques. Non-engrafting therapeutic cells can be delivered via a variety of methods, including, for example, but not limited to, application of encapsulated hepatocytes to the intraperitoneal space, omental pouch, and / or other suitable locations.

[0083] Any suitable approach can be used to introduce hepatocytes and / or hepatic progenitor cells into the liver.In some embodiments, introducing hepatocytes and / or hepatic progenitor cells into the liver comprises delivering hepatocytes to the recipient's spleen.In one non-limiting example, hepatocytes and / or hepatic progenitor cells can be introduced into the liver via spleen injection (e.g., open spleen injection or percutaneous spleen injection).

[0084] The present disclosure also includes non-human animals comprising a transplanted population of hepatocytes and / or hepatic progenitor cells as described herein, including when such transplanted cells are present in the liver of the non-human animal.For example, in some instances, the non-human animal may comprise a transplanted population of genetically modified hepatocytes and / or hepatic progenitor cells, including when the transplanted cells can be genetically modified to be, for example, less immunogenic, to contain a therapeutic transgene, or both.Useful non-human animals include non-human mammals, such as, but not limited to, rodents, murines (e.g., rats, mice), lagomorphs (e.g., rabbits), non-human primates, dogs, cats, ungulates (e.g., horses, cows, sheep, pigs, goats), etc.

[0085] In some examples, non-human animals can function as in vivo bioreactors. Cell populations including hepatocytes and / or hepatic progenitor cells can be expanded by transplantation into an in vivo bioreactor and maintaining the bioreactor under suitable conditions for the proliferation of the transplanted cells. Suitable in vivo bioreactors include, but are not limited to, rodent bioreactors (such as, for example, mouse bioreactors and rat bioreactors), porcine bioreactors, and the like.

[0086] There are various animal bioreactors suitable for the growth of hepatocytes. In certain embodiments, the animal is genetically modified at one or more loci. Genetic modification can include knockout or knockdown to generate animals that are deficient in one or more loci or the activation of one or more target genes. Genetic modification can be performed at multiple loci in any combination (one or more inhibitory modifications and / or one or more activating modifications). Genetic modifications useful in in vivo bioreactors can include modifications of various genes, including immune genes (e.g., resulting in immune deficiency), liver function genes (e.g., resulting in liver dysfunction), metabolic genes (e.g., resulting in metabolic deficiencies), amino acid catabolism genes (e.g., resulting in insufficient amino acid catabolism), and the like.

[0087] In certain embodiments, useful genetically modified animals are fumarylacetoacetate hydrolase (fah)-deficient animals, such as those described in U.S. Pat. Nos. 8,569,573, 9,000,257, and U.S. Patent Publication No. 20160249591, the disclosures of which are incorporated herein by reference in their entirety. FAH is a metabolic enzyme that catalyzes the last step of tyrosine catabolism. Animals with homozygous deletion of the Fah gene exhibit altered hepatic mRNA expression and severe liver dysfunction. Point mutations in the Fah gene have also been shown to cause liver failure and postnatal lethality. Humans deficient in Fah develop the liver disease hereditary hypertyrosinemia type 1 (HT1) and develop liver failure. Fah deficiency causes the accumulation of fumarylacetoacetate, a powerful oxidant, which ultimately causes cell death of Fah-deficient hepatocytes. Thus, Fah-deficient animals can be repopulated with hepatocytes from other species, including humans, that contain a functional fah gene. Fah genomic, mRNA and protein sequences for several different species have been published, for example, in the GenBank database (see, e.g., Gene ID 29383 (rat Fah), Gene ID 14085 (mouse Fah), Gene ID 610140 (canine FAH), Gene ID 415482 (chicken FAH), Gene ID 100049804 (horse FAH), Gene ID 712716 (rhesus macaque FAH), Gene ID 100408895 (marmoset FAH), Gene ID 100589446 (gibbon FAH), Gene ID 467738 (chimpanzee FAH), and Gene ID 508721 (bovine FAH)), and fah genomic loci in other species are readily identifiable via bioinformatics. Fah-deficient animals can comprise a genetically modified fah locus, and can or can not comprise additional genetic modifications at other loci, including, for example, such animals (e.g., mice, pigs or rats) that are deficient in FAH, RAG-1 and / or RAG-2, and IL-2Rγ (sometimes referred to as "FRG" animals, such as FRG mice, FRG pigs, or FRG rats).

[0088] Useful genetic modifications include those that result in immune deficiency, for example, from a lack of a particular molecule or cellular component of the immune system, or the function of a particular molecule or cellular component of the immune system. In some cases, useful genetic changes include genetic changes in the recombination activating gene 1 (Rag1) gene. Rag1 is a gene involved in the activation of immunoglobulin V(D)J recombination. The RAG1 protein is involved in the recognition of DNA substrates, but RAG2 is also required for stable binding and cleavage activity. Rag-1 deficient animals have been shown to lack mature B and T lymphocytes. In some cases, useful genetic changes include genetic changes in the recombination activating gene 2 (Rag2) gene. Rag2 is a gene involved in the recombination of immunoglobulin and T cell receptor loci. Animals lacking the Rag2 gene are unable to undergo V(D)J recombination and have a complete loss of functional T and B cells (see, e.g., Shinkai et al. Cell 68:855-867, 1992). In some cases, useful genetic changes include genetic changes in the common gamma chain of the interleukin receptor (Il2rg). Il2rg is the gene encoding the common gamma chain of the interleukin receptor. Il2rg is a component of the receptor for multiple interleukins, including IL-2, IL-4, IL-7, and IL-15 (see, e.g., Di Santo et al. Proc. Natl. Acad. Sci. USA 92:377-381, 1995). Animals lacking Il2rg exhibit reduced B and T cells and lack natural killer cells. Il2rg may also be referred to as the interleukin 2 receptor gamma chain.

[0089] In some cases, the animal may be immunosuppressed, including, for example, when immunosuppression is achieved by administration of one or more immunosuppressants. Any suitable immunosuppressant(s) effective for achieving immunosuppression in the animal may be used. Examples of immunosuppressants include, but are not limited to, FK506, cyclosporin A, fludarabine, mycophenolate, prednisone, rapamycin, and azathioprine. A combination of immunosuppressants may also be administered. In some cases, an immunosuppressant is used in place of a genetic immunodeficiency. In some cases, an immunosuppressant is used in combination with a genetic immunodeficiency.

[0090] As summarized herein, a genetically modified animal may include one or more (i.e., a combination) genetic modifications. For example, such an animal may include a rag1 genetic modification, a rag2 genetic modification, an IL2rg genetic modification, or such an animal may include a rag1 or rag2 genetic modification and a genetic alteration in the Il2rg gene such that the genetic alteration results in the loss of expression of a corresponding functional RAG1 protein, RAG2 protein, IL-2rg protein, or RAG-1 / RAG-2 protein and IL-2rg protein. In one example, the one or more genetic alterations include a genetic alteration in the Rag2 gene and a genetic alteration in the Il2rg gene. In one example, the one or more genetic alterations include a genetic alteration in the Rag1 gene and a genetic alteration in the Il2rg gene. In some cases, useful genetic alterations include, for example, SCID, NOD, SIRPα, perforin, or nude. The altered locus may be a genetic null (i.e., knockout) or other alteration that results in a lack of a gene product at the corresponding locus. Specific cells of the immune system may also be depleted, such as macrophages and NK cells. Any convenient method of depleting a specific cell type can be used.

[0091] It will be appreciated that various models of liver injury that generate the advantage of selective growth of hepatocyte xenografts can be used in animal bioreactors (e.g., rats, mice, rabbits, pigs) to promote hepatocyte engraftment and proliferation, including, but not limited to, induced injury, selective embolism, transient ischemia, retrocytosis, monocrothrine, thioacetamide, gamma irradiation, carbon tetrachloride, and / or genetic modification (e.g., Fah disruption, uPA, TK-NOG (Washburn et al., Gastroenterology, 140(4):1334-44, 2011), albumin AFC8, albumin diphtheria toxin, Wilson's disease, etc.). A combination of liver injury techniques can also be used.

[0092] In some embodiments, animals are administered a vector (e.g., an Ad vector) encoding a urokinase gene (e.g., urokinase plasminogen activator (uPA)) prior to injection of the xenogeneic hepatocytes. Expression of uPA in hepatocytes causes liver injury, thus allowing selective growth of hepatocyte xenografts upon transplantation. In one embodiment, the urokinase gene is human urokinase, which may or may not be secreted. See, e.g., U.S. Pat. Nos. 8,569,573, 9,000,257, and U.S. Patent Publication No. 20160249591.

[0093] In some cases, the TK-NOG liver injury model (i.e., albumin thymidine kinase transgenic-NOD-SCID-interleukin common gamma chain knockout) can be used as an animal bioreactor as described herein. The TK-NOG animal contains a herpes simplex virus thymidine kinase hepatotoxic transgene that can be conditionally activated by administration of ganciclovir. The liver injury resulting from the activation of the transgene during administration of ganciclovir provides a selective advantage to hepatocyte xenografts, facilitating the use of such animals as in vivo bioreactors for the expansion of transplanted hepatocytes as described herein.

[0094] In some cases, the AFC8 liver injury model (characterized by having an FKBP-caspase 8 gene driven by the albumin promoter) can be used as an animal bioreactor as described herein. The AFC8 animals contain an FK508-caspase 8 fusion hepatotoxic transgene that can be conditionally activated by administration of AP20187. The liver injury resulting from activation of the transgene during administration of AP20187 provides a selective advantage to hepatocyte xenografts, facilitating the use of such animals as in vivo bioreactors for the expansion of transplanted hepatocytes as described herein.

[0095] In some cases, the NSG-PiZ liver injury model (characterized as having alpha-1 antitrypsin (AAT) deficiency combined with immune deficiency (NGS)) can be used as an animal bioreactor as described herein. NSG-PiZ animals have impaired secretion of AAT and accumulate misfolded PiZ mutant AAT protein, causing hepatocyte injury. Such liver injury provides a selective advantage to hepatocyte xenografts, facilitating the use of such animals as in vivo bioreactors for the expansion of transplanted hepatocytes as described herein. Immune deficiency allows the animals to host xenografts without significant rejection.

[0096] In some cases, animals can be preconditioned to improve the recipient's liver's ability to support transplanted cells. For example, various preconditioning regimes can be used, including but not limited to irradiation preconditioning (e.g., partial liver irradiation), embolization preconditioning, ischemic preconditioning, chemical / viral preconditioning (e.g., using uPA, cyclophosphamide, doxorubicin, nitric oxide, retrosine, monocrotaline, toxic bile salts, carbon tetrachloride, thioacetamide, etc.), liver resection preconditioning, etc. In some cases, hepatocyte-producing cells can be introduced without preconditioning, and / or the procedure specifically excludes one, all, or some combination of preconditioning regimens or specific reagents, including, for example, one or more of those described herein. In some cases, withdrawal of NTBC or induction of liver injury by administration of ganciclovir or AP20187 can be used for preconditioning. If used, preconditioning may be performed at some time, including hours, days, or weeks or more, prior to transplantation of the hepatocyte generating cells, including at least 6 hours, at least 12 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 60 hours, at least 72 hours, at least 4 days, at least 5 days, at least 6 days, at least 1 week, or at least 2 weeks prior to transplantation.

[0097] After optional preconditioning of the animal (e.g., with uPA) (e.g., 24 hours after preconditioning), the heterologous hepatocytes and / or hepatic progenitor cells can be delivered to the animal via any suitable method. In certain embodiments, the hepatocytes and / or hepatic progenitor cells described herein are administered directly to the liver (e.g., via portal vein injection) and / or via intrasplenic injection, where the hepatocytes and / or progenitor cells reach the liver through the vasculature. In certain embodiments, 1×10 5 ~1×10 9 pieces (e.g., 5×10 5 Pieces / mouse, 5-10x10 61.25×10 hepatocytes and / or hepatic progenitor cells (e.g., 1.25×10 9 The cells are preconditioned (e.g., 24 hours prior to administration) with 1x10 PFU / 25 grams of mouse body weight and then introduced into the animal (e.g., FRG animal). The number of hepatocytes and / or hepatic progenitor cells introduced into the bioreactor can vary, and can range from, for example, 1x10 to 1x10 depending on a variety of factors including the species and size of the animal receiving the cells. 5 ~1x10 9 , 1x10 6 ~1x10 9 , 1x10 7 ~1x10 9 , 1x10 8 ~1x10 9 , 1x10 5 ~1x10 6 , 1x10 5 ~1x10 7 , 1x10 5 ~1x10 8 , 1x10 6 ~1x10 7 , 1x10 7 ~1x10 8 , 1x10 6 ~1x10 8 Including but not limited to, 1×10 5 Below 1×10 9 In some examples, the number of cells administered can range from, for example, 0.5×10 9 Below, 1×10 8 Below, 0.5 x 10 8 Below, 1×10 7 Below, 0.5 x 10 7 Below, 1×10 6 Below, 0.5 x 10 6 Below, 1×10 5 Includes: 1 x 10 9 The hepatocytes and / or hepatic progenitor cells introduced into the bioreactor (or non-human animal in general) can be varied, and such cells can be allogeneic or xenogeneic to the bioreactor (or non-human animal in general).

[0098] In addition, optionally, immunosuppressive drugs can be given to the animal before, during, and / or after transplantation to eliminate host-versus-graft responses in the animal (e.g., mouse, pig, or rat) from xenografted xenogeneic hepatocytes. In some cases, by not cycling immunosuppressive drugs in the animal for a defined period of time, the liver cells become quiescent and the transplanted cells have a growth advantage that leads to the replacement of endogenous liver cells (e.g., mouse, pig, or rat hepatocytes) with xenogeneic liver cells (e.g., human hepatocytes). In the case of human hepatocytes, this produces a high level of liver humanization, i.e., animals with humanized livers. The repopulation level of xenogeneic liver cells can be determined by various measurements, including, but not limited to, quantifying human serum albumin levels, which are optionally correlated with immunohistochemistry of liver sections from transplanted animals.

[0099] In some embodiments, an agent that inhibits, delays, avoids or prevents the onset of liver disease is administered to the animal bioreactor during the period of expansion of the administered hepatocytes. Administration of such an agent avoids (or prevents) liver dysfunction and / or death of the animal bioreactor (e.g., mouse, rat, or pig bioreactor) prior to repopulation of the animal bioreactor (e.g., mouse, rat, or pig bioreactor) with healthy (e.g., FAH-expressing) heterologous hepatocytes. The agent can be any compound or composition that inhibits liver disease in a disease model associated with the bioreactor. One such agent is 2-(2-nitro-4-trifluoro-methyl-benzoyl)-1,3 cyclohexanedione (NTBC), although other pharmacological inhibitors of phenylpyruvate dioxygenase, such as methyl-NTBC, can also be used. NTBC is administered to modulate the onset of liver disease in Fah-deficient animals. In the Fah-deficient animal bioreactor, the dose, administration schedule, and administration method can be adjusted and / or cycled as necessary to promote the growth of hepatocyte xenografts while avoiding catastrophic liver dysfunction. In some embodiments, the Fah-deficient animal is administered NTBC for at least 2 days, at least 3 days, at least 4 days, at least 5 days, or at least 6 days after transplantation of hepatocytes, as described herein. In some embodiments, the Fah-deficient animal is further administered NTBC for at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, or at least about 6 months. In some embodiments, NTBC (or another compound having a hepatoprotective effect) is discontinued about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, or about 7 days after hepatocyte transplantation.

[0100] The dose of NTBC administered to Fah-deficient animals may vary. In some embodiments, the dose is about 0.5 mg / kg to about 30 mg / kg / day, e.g., about 1 mg / kg to about 25 mg / kg, about 10 mg / kg / day to about 20 mg / kg / day, or about 20 mg / kg / day. NTBC can be administered by any suitable means, including but not limited to, in drinking water, food, or by injection. In one embodiment, the concentration of NTBC administered in drinking water is about 1 to about 30 mg / L, e.g., about 10 to about 25 mg / L, about 15 to about 20 mg / L, or about 20 mg / L. In certain embodiments, NTBC administration is periodic from pre-transplant until 4 to 8 weeks or more after transplant.

[0101] Expanded hepatocytes derived from transplanted hepatocytes and / or hepatic progenitor cells can be harvested from the animal bioreactor after any period of time, including but not limited to, 7 to 180 days (or any day therebetween) or more after transplantation.

[0102] Upon harvesting, the liver of the animal bioreactor may be repopulated to various degrees with the introduced hepatocytes, hepatic progenitor cells, and / or their progeny (including, for example, genetically modified hepatocytes, hepatic progenitor cells, and / or their progeny). For example, in some instances, the repopulated animal liver may be at least 30% or more repopulated, including, but not limited to, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% repopulated. Thus, the repopulated animal liver may comprise at least 30% or more of the genetically modified hepatocytes described herein, including, but not limited to, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% genetically modified hepatocytes in some instances. Thus, the collected cell population may contain a similar percentage of genetically modified hepatocytes (including the introduced cells (e.g., genetically modified hepatocytes and / or hepatic progenitor cells) and / or their progeny), including, for example, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more genetically modified hepatocytes.

[0103] In certain embodiments, the expanded hepatocytes are harvested 28-56 days (or any day therebetween) after transplantation. In some cases, the hepatocytes are harvested 1 week, 2 weeks or less, 3 weeks or less, 4 weeks or less, 4 weeks or less, 5 weeks or less, 6 weeks or less, 7 weeks or less, 8 weeks or less, 8 weeks or less, 9 weeks or less, 10 weeks or less, 11 weeks or less, 12 weeks or less, 12 weeks or less, 13 weeks or less, 14 weeks or less.

[0104] Additionally, expanded hepatocytes can be harvested from the animal using any of several techniques. For example, hepatocytes can be harvested by enzymatic digestion of the animal's liver followed by gentle mincing, filtration, and centrifugation. Additionally, hepatocytes can be separated from other cell types, tissues, and / or debris using a variety of methods, such as using antibodies that specifically recognize the cell type of the transplanted hepatocyte type. Such antibodies include, but are not limited to, antibodies that specifically bind to class I major histocompatibility antigens, such as anti-human HLA-A, B, C (Markus et al. (1997) Cell Transplantation 6:455-462). Antibody-bound hepatocytes can then be separated by panning (utilizing monoclonal antibodies attached to a solid matrix), fluorescence-activated cell sorting (FACS), magnetic bead separation, and the like. Alternative methods of harvesting hepatocytes can also be used.

[0105] In some cases, the harvested hepatocytes may be serially transplanted one or more times into additional animal bioreactors. Serial transplants can be performed two, three, four, or more times in animals of the same or different species, for example, using rats, pigs, mice, or rabbits for all serial transplants, or using any combination of animal bioreactors suitable for serial transplants (e.g., one or more times in rats, one or more times in pigs, etc.).

[0106] Furthermore, after harvesting hepatocytes from the animal bioreactor, the hepatocytes can be subjected to various genetic manipulations as described herein. For example, the hepatocytes harvested from the bioreactor can be genetically modified, for example, by introducing a transgene and / or editing one or more loci, before administration to a subject. The harvested and optionally isolated expanded hepatocytes can be used fresh or cryopreserved before use.

[0107] In certain embodiments, hepatocytes and / or hepatic progenitor cells, including genetically modified hepatocytes and / or hepatic progenitor cells, can be encapsulated. Hepatocytes and / or their progenitor cells can be encapsulated using any method, typically prior to administration to a subject. See, for example, Jitraruch et al. (2014) PLOS One 9:10; Dhawan et al. (2020) J Hepatol. 72(5):877-884; Bochenek et al. (2018) Nature Biomedical Engineering 2:810-821. Cell encapsulation within semipermeable hydrogels represents a localized immunoisolation strategy for cell-based therapy that does not require systemic immunosuppression. Hydrogel spheres facilitate the diffusion of substrates, nutrients, and proteins required for cell function while excluding immune cells that would reject allogeneic cells. Alginate spheres are one of the most widely studied cell encapsulation materials, as this anionic polysaccharide forms a hydrogel in the presence of divalent cations under cell-friendly conditions. In some instances, the cells may be administered unencapsulated, e.g., due to genetic modifications that render the hepatocytes and / or hepatic progenitor cells less immunogenic, and thus the cells may be used unencapsulated or naked.

[0108] Also provided herein are decellularized livers, or other acellularized scaffolds (including natural and synthetic scaffolds), seeded and / or repopulated with a population of hepatocytes and / or hepatic progenitor cells produced by the methods described herein. For example, a cell population comprising genetically modified hepatocytes and / or their progenitors described herein can be introduced into a decellularized liver, or a portion thereof, or other acellularized scaffold (with or without other supporting cell types), and then maintained under conditions sufficient for repopulation of the decellularized liver or a portion thereof with hepatocytes of the cell population and / or hepatocytes generated from the cell population.

[0109] A liver, or a portion thereof, such as a human liver or a non-human mammalian liver, such as a pig, can be obtained and optionally surgically processed (e.g., to isolate one or more portions or lobes of the liver). The liver or portion thereof is then decellularized by any convenient and suitable means, including, for example, mechanical cell injury, freeze / thaw, cannulation, and retrograde profusion of one or more decellularization reagents (e.g., one or more proteases (e.g., trypsin), one or more nucleases (e.g., DNase), one or more detergents (e.g., sodium dodecyl sulfate, Triton X-100, etc.), one or more hypotonic reagents, one or more hypertonic reagents, combinations thereof, and the like. The decellularized liver, or portion thereof, may be stored and / or pre-soaked in hepatocyte-compatible medium. A cell suspension containing the ex vivo engineered hepatocyte-producing cells described herein can then be applied to the decellularized liver or portion thereof by any convenient mechanism, such as, for example, injection, perfusion, topical application (e.g., drop by drop), or combinations thereof. In some examples, the ex vivo engineered hepatocyte-producing cells are administered at a concentration of, for example, 1-2 x 10 per 50 μL. 6 cells, for example, 1 x 10 per 50 μL, but not limited to 5 Less than ~1×10 7The cells may be present in the cell suspension for seeding on the prepared scaffold at any convenient and suitable concentration, including a concentration of 100 or more cells. The seeded decellularized liver, part thereof, and / or other acellularized scaffold may be maintained under suitable conditions for engraftment / attachment and / or proliferation of the introduced cells, which may include suitable humidity, temperature, gas exchange, nutrients, etc. In some cases, the seeded liver, part thereof, and / or other acellularized scaffold may be maintained in a humid environment at or about 37° C. with 5% CO2 in a suitable culture medium. Following attachment and / or proliferation of the seeded and / or generated hepatocytes to or within the decellularized liver, part thereof, or other acellularized scaffold, the material may be used for various applications, including transplantation into a subject in need thereof, such as, for example, a human subject with reduced liver function and / or liver disease. Methods and reagents related to decellularization of the liver, including human liver, and generation of hepatocyte-receptive acellular scaffolds are described, for example, in Mazza et al. Sci Rep 5, 13079 (2015); Mango et al. Adv. Funct. Mater. 2000097 (2020); Shimoda et al. Sci Rep 9, 1543 (2019); Croce et al. Biomolecules. 2019, 9(12):813; and U.S. Pat. No. 10,688,221, the disclosures of which are incorporated herein by reference in their entireties.

[0110] The collected cell populations produced by the methods described herein, and therapeutic or pharmaceutical compositions thereof, may be present in any suitable container (e.g., culture vessels, tubes, flasks, vials, cryovials, cryobags, etc.) and may be used (e.g., administered to a subject) using any suitable delivery method and / or device. Such populations of hepatocytes and pharmaceutical compositions may be prepared and / or used fresh, or may be cryopreserved. In some cases, the populations of hepatocytes and pharmaceutical compositions thereof may be prepared in a "ready to use" format, including, for example, where the cells are present in a suitable diluent and / or at a desired delivery concentration (e.g., in a unit dosage form), or at a concentration that can be easily diluted (e.g., with a suitable diluent or medium) to a desired delivery concentration. The populations of hepatocytes and pharmaceutical compositions thereof may be prepared in a delivery device, or a device compatible with a desired delivery mechanism or a desired delivery route, such as, but not limited to, a syringe, an infusion bag, etc.

[0111] In some examples, the disclosure includes multiple cell therapy doses (e.g., each in a suitable container), including, for example, when the multiple doses of genetically modified hepatocytes are all derived (including expanded) from a hepatocyte population (e.g., a master cell bank) made from a single human donor liver. In some examples, the disclosure includes multiple cell therapy doses (e.g., each in a suitable container), including, for example, when the multiple doses of genetically modified hepatocytes are all derived (including expanded) from a single hepatocyte population (e.g., a master cell bank) made from multiple (e.g., 2, 2 or more, 3 or less, 3, 3 or more, 4 or less, 4, 4 or more, 5 or less, 5, 5 or more, 6 or less, 6, 6 or more, 7 or less, 7, 7 or more, 8 or less, 8, 8 or more, 9 or less, 9, 9 or more, 10 or less, 10 or more, etc.) human donor livers.

[0112] Multiple cell therapy doses can be produced by various methods. In some examples, human hepatocytes are genetically modified, and the genetically modified hepatocytes are grown in one or more in vivo bioreactors to produce a population of genetically modified human hepatocytes that are used in formulating multiple doses. In some examples, the grown human hepatocytes obtained from one or more in vivo bioreactors are genetically modified to produce a population of genetically modified human hepatocytes that are used in formulating multiple doses. Dividing the population of genetically modified human hepatocytes into multiple hepatocyte therapy doses can be performed by various means, resulting in a unit dose of various different total amounts containing various different numbers of hepatocytes. For example, in some instances, at least two doses may be generated, e.g., comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 500, 750, or 1000 unit doses, e.g., each such dose may comprise, e.g., at least 10 million, at least 25 million, at least 50 million, at least 75 million, at least 100 million, at least 250 million, at least 50 ... at least 750 million, at least 1 billion, at least 2 billion, at least 3 billion, at least 4 billion, at least 5 billion, at least 6 billion, at least 7 billion, at least 8 billion, at least 9 billion, at least 10 billion, at least 15 billion, at least 20 billion, at least 30 billion, at least 40 billion, at least 50 billion, at least 60 billion, at least 70 billion, at least 80 billion, at least 90 billion, or at least 100 billion hepatocytes.

[0113] The disclosed method may include treating multiple subjects with the cell therapy doses described herein, including cases where the hepatocytes contained in such doses are derived from, for example, a single human donor liver or multiple human donor livers. For example, in some cases, such methods may include treating 2, 3, 4, 5, 6, 7, 8, 9, or 10 separate subjects with at least 10 doses, e.g., where the multiple doses each include at least 10 doses of at least 1 billion (or at least 10 billion) hepatocytes. In some cases, such methods may include treating at least 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 separate subjects with at least 100 doses, e.g., where the multiple doses each include at least 100 doses of at least 1 billion (or at least 10 billion) hepatocytes. Such doses may be administered to subjects in need thereof, including multiple subjects with the same condition as well as multiple subjects with different conditions, to treat the condition of the subject. Thus, using the methods described herein, multiple subjects, and potentially large numbers of subjects, in need of treatment can be treated with genetically modified liver cells derived and expanded from a population of cells harvested from a single human donor liver.

[0114] As summarized above, genetic modification of hepatocytes and / or hepatic progenitor cells can include the functional integration of a transgene that codes for a gene product. Essentially any encoded gene product can be used. The encoded gene product can be a recombinant version of a protein, including, for example, a prokaryotic or eukaryotic protein, such as a mammalian (e.g., human, non-human primate, pig, rat, mouse, etc.) or non-mammalian protein, a protein fragment, a peptide, a synthetic protein, a fusion protein, etc., or a non-coding nucleic acid, etc.

[0115] In some examples, the hepatocytes and / or hepatic progenitor cells of the cell population may be genetically modified to express one or more immune inhibitory proteins, including, for example, T cell inhibitory proteins, NK cell inhibitory proteins, and the like. For example, in some examples, the hepatocytes and / or hepatic progenitor cells may be genetically modified to include a transgene that encodes a gene product that is an NK cell decoy receptor. The term "NK cell decoy receptor," as used herein, generally refers to a receptor that, when expressed on the surface of a cell, inhibits, for example, an NK inhibitory receptor (e.g., KIR, HLA-cl). I-specific receptors, NKG2 inhibitory receptors (e.g., CD94 / NKG2A heterodimer, NKG2B receptor), LIR-1, checkpoint receptors, SIRPα, PD-1 (CD279), Siglec-7 (CD328), IRP60 (CD300a), Tactile (CD96), IL1R8, TIGIT, TIM-3, NKG2A / KLRD1 (CD159a / CD94), KIR2DL1 (CD158a), KIR2DL NK cell inhibitory receptors refer to mammalian (e.g., human) protein receptors or portions thereof, recombinant or synthetic receptors or portions thereof, etc., that provide protection from killing by NK cells by serving as ligands for HLA-specific or non-HLA-specific polypeptides (e.g., KIR2DL5 (CD158f), KIR3DL1 (CD158e1), KIR3DL2 (CD158k), ILT2 / LIR-1 (CD85J), LAG-3 (CD223), etc.). NK cell inhibitory receptors can be HLA-specific or non-HLA-specific, and thus NK cell decoy receptors include both HLA-derived and non-HLA-derived polypeptides.

[0116] Non-limiting examples of useful NK cell decoy receptors include, for example, HLA class I proteins and fragments thereof (e.g., HLA class 1a proteins (e.g., HLA-A, -B, -C) and fragments thereof, HLA class 1b proteins (HLA-E, -F, -G, -H) and fragments thereof), synthetic HLA class I protein fusions (including, for example, HLA class 1a fusions, HLA class 1b fusions, HLA class 1a / 1b fusions, etc.), CD47, PD-L1 (CD274), PD-L2 (CD 273), PVR (CD155), IL-37, Gal-9, PtdSer, HMGB1, CEACAM1, HLA-E, HLA-G, HLA-C1, HLA-C2, HLA-A-Bw4, HLA-B-Bw4, HLA-A*03, HLA-A*11, MHC-I proteins, MHC-2 proteins, CD80 and CD86 (CTLA-4), LSECtin (LAG3), CD112 (TIGIT), CXADR (JAML / AMICA1), HVEM (BTLA), and the like. Useful HLA genes, alleles, and proteins thereof include, for example, those described in Marsh et al. (2010) Tissue Antigens 75:291-455, the disclosure of which is incorporated herein by reference in its entirety. In some examples, useful NK cell decoy receptors may include only a portion or fragment of, for example, an exemplary NK cell decoy receptor protein described herein, or may include a fusion of two or more proteins and / or protein fragments, for example a fusion of two or more exemplary NK cell decoy receptor proteins and / or fragments thereof described herein.

[0117] In some examples, a useful NK cell decoy receptor may include an HLA class 1b fusion protein that includes a β2-microglobulin (B2M) protein or a portion thereof fused directly or indirectly to one or more of HLA-E, HLA-F, HLA-G, or HLA-H, or one or more portions thereof. A useful HLA class 1b fusion protein may or may not include a peptide antigen, optionally a cleavable peptide antigen that can occupy a peptide binding cleft of the fusion protein upon cleavage. Useful portions of B2M and / or HLA class Ib proteins that may be included in an HLA class 1b fusion protein include, but are not necessarily limited to, for example, an extracellular domain, a transmembrane domain, a cytoplasmic domain, a signal peptide, a signal sequence, an α1 domain, an α2 domain, an α3 domain, an α chain, and the like. In some examples, the HLA class 1b fusion protein may include one or more non-HLA and / or non-B2M moieties (i.e., moieties not derived from an HLA protein and / or a B2M protein), such as, for example, one or more linker moieties (e.g., synthetic linkers (e.g., glycine linkers, glycine-serine linkers, etc.)).

[0118] The following are provided as non-limiting examples of proteins useful in whole or in part, alone or in combination, in various NK cell decoy receptors: An exemplary human B2M sequence (UniProtKB ID: P61769; NCBI RefSeq: NP_004039.1) is SEQ ID NO: 032.

[0119] An exemplary human HLA-E sequence (UniProtKB ID: P13747; NCBI RefSeq: NP_005507.3) is sequence number 033.

[0120] An exemplary human HLA-G sequence (UniProtKB ID: P17693; NCBI RefSeq: NP_002118.1) is sequence number 034.

[0121] In some examples, a useful B2M-HLA-E fusion comprises full-length or partial-length B2M fused to an HLA-E fragment, e.g., via a GS linker, optionally having, e.g., an HLA-G signal sequence (e.g., but not limited to, SEQ ID NO: 035).

[0122] In some examples, useful B2M-HLA-E fusions may include a signal sequence (e.g., optionally a B2M signal sequence), optionally having a cleavable HLA-G peptide linked via a linker to a full-length or partial-length B2M sequence linked via a linker to an HLA-E fragment, such as, but not limited to, SEQ ID NO: 036 (the coding sequence of which is also referred to herein as a "B2M-HLA-E fusion").

[0123] As will be readily apparent, other configurations of full-length or partial-length HLA class I protein sequences, as well as full-length or partial-length B2M sequences, with or without other or alternative components (e.g., linkers, signal sequences, peptide antigen sequences, etc.), may be made and used in HLA class I, class 1b, HLA-E-B2M, and HLA-E / G-B2M fusions, etc. In some examples, useful proteins, fusions, sequences, portions thereof, etc. may include those described in U.S. Patent Application Publication No. 20140134195(A1), the disclosure of which is incorporated herein by reference in its entirety.

[0124] An exemplary human CD47 (hCD47) sequence is SEQ ID NO:037.

[0125] An exemplary truncated hCD47 sequence is SEQ ID NO:038.

[0126] In some examples, as will be readily understood, useful sequences, including but not limited to amino acid and nucleic acid sequences, such as those described herein, may be used as described or may vary, for example, including one or more substitutions, deletions, insertions, and / or truncations, or other modifications. For example, an amino acid sequence, such as but not limited to the amino acid sequences described herein, may include at least one, one, at least two, two or less, at least three, three or less, at least four, four or less, at least five, five or less, at least six, six or less, at least seven, seven or less, at least eight, eight or less, at least nine, nine or less, at least ten, ten or less, or more than ten amino acid substitutions. In some examples, a nucleic acid sequence may have alternative sequences (e.g., codon-optimized sequences, etc.) that code for the same amino acid sequence. In some examples, one or more bases or one or more codons of a nucleic acid sequence can be modified to introduce one or more substitutions, such as, for example, at least one, one, at least two, two or less, at least three, three or less, at least four, four or less, at least five, five or less, at least six, six or less, at least seven, seven or less, at least eight, eight or less, at least nine, nine or less, at least ten, ten or less, or more than ten amino acid substitutions in the resulting encoded polypeptide. In some examples, useful sequences, including, but not limited to, amino acid and nucleic acid sequences such as those described herein, can share 100% sequence identity with the sequences described herein.In some examples, useful sequences, including but not limited to, amino acid sequences and nucleic acid sequences described herein, may have less than 100% sequence identity to the sequences described herein, for example, at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90%, at least 89%, at least 88%, at least 9 ... or at least 87%, at least 86%, at least 85%, at least 84%, at least 83%, at least 82%, at least 81%, at least 80%, at least 79%, at least 78%, at least 77%, at least 76%, at least 75%, at least 74%, at least 73%, at least 72%, at least 71%, at least 70%, at least 65%, at least 60%, at least 55%, at least 50%, at least 45%, at least 40%, at least 35%, or at least 30% sequence identity.

[0127] Useful nucleic acids encoding gene products present on a transgene can be varied and serve a variety of functions, including, for example, correcting a defective gene in a host cell or organism, encoding and / or expressing a heterologous gene product in a cell, encoding and / or expressing one or more additional copies of an endogenous gene product in a cell, inhibiting expression of a gene or gene product in a cell, etc. Useful nucleic acids include, but are not limited to, for example, expression cassettes, recombinant mRNA, recombinant vector genomes (e.g., recombinant viral genomes, etc.), recombinant plasmids, minicircle plasmids, minigenes, microgenes, artificial chromosomes, interfering nucleic acids (e.g., siRNA, shRNA, etc.), and the like.

[0128] For example, useful gene products of a functionally integrated transgene include, but are not limited to, non-coding nucleic acids, as well as nucleic acids encoding one or more proteins and / or peptides. In some embodiments, the gene products of the coding region of the transgene or vector may include nucleic acid sequences encoding enzymes, such as, for example, nucleases, DNA base editors, RNA editors, etc. In some embodiments, the sequences encoding gene products may include non-coding nucleic acids, such as, for example, microRNAs (i.e., miRNAs), shRNAs, siRNAs, piRNAs, snoRNAs, snRNAs, exRNAs, scaRNAs, lncRNAs, guide RNAs (gRNAs, sgRNAs, etc.), alone or in combination with other payload elements.

[0129] In some examples, cell populations including hepatocytes and / or hepatic progenitor cells can be edited at target loci. Essentially, any loci can be targeted, including but not limited to, for example, loci including liver-related genes and / or their regulatory elements, loci including immune-related genes and / or their regulatory elements, etc. The editing introduced into target loci can be various, and useful editing includes but is not limited to, for example, deletion, insertion, substitution, frameshift, etc.

[0130] Non-limiting examples of useful deletions include deletions of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more bases; deletions of one or more, two or more, or more functional domains of a gene and / or portions thereof; deletions of one or more, two or more, or more exons of a gene and / or portions thereof, deletions of all, all but one, all but two, or all but three exons of a gene and / or portions thereof; deletions of regulatory elements of a gene (e.g., promoters, enhancers, etc.); Non-limiting examples of useful insertions include the insertion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more bases; the insertion of one or more, two or more, or more functional domains of a gene and / or portions thereof; the insertion of one or more, two or more, or more exons of a gene and / or portions thereof, the insertion of all, all except one, all except two, or all except three exons and / or portions thereof; the insertion of regulatory elements of a gene (e.g., promoters, enhancers, etc.), and the like.The size of the deletion and / or insertion to be introduced varies and can range from 1 base to 500 bases or more, for example, 1 to 400 bases, 1 to 350 bases, 1 to 300 bases, 1 to 250 bases, 1 to 200 bases, 1 to 150 bases, 1 to 100 bases, 1 to 50 bases, 10 to 400 bases, 10 to 350 bases, 10 to 300 bases, 10 to 250 bases, 10 to 200 bases, 10 to 150 bases, 10 to 100 bases, 10 to 50 bases, 25 to 400 bases, 25 to 350 bases, 25 to 300 bases, 25 to 250 bases, 25 to 200 bases, 25 to 150 bases, 25 to 100 bases, 25 to 50 bases, 50 to 400 bases, 50 to 350 bases, 50 to 300 bases, 50 to 250 bases, 50 to The length includes, but is not limited to, 200 bases, 50 to 150 bases, 50 to 100 bases, 100 to 400 bases, 100 to 350 bases, 100 to 300 bases, 100 to 250 bases, 100 to 200 bases, 100 to 500 bases, 200 to 500 bases, 300 to 500 bases, 400 to 500 bases, at least 1 base, at least 2 bases, at least 10 bases, at least 25 bases, at least 50 bases, at least 75 bases, at least 100 bases, at least 150 bases, at least 200 bases, 500 bases or less, 400 bases or less, 350 bases or less, 300 bases or less, 250 bases or less, 200 bases or less, 150 bases or less, 100 bases or less, or 50 bases or less.

[0131] Non-limiting examples of useful substitutions include substitutions that introduce a premature stop codon, substitutions that destroy a stop codon, substitutions that result in an amino acid change, etc. One or more substitutions at the nucleic acid level (e.g., substitutions of one, two, or three bases) can be used to essentially introduce any amino acid-for-amino acid substitution at the polypeptide level, if desired.

[0132] In some instances, useful editing may disrupt or delete all or part of an endogenous gene, or otherwise render one or more endogenous genes, such as, but not limited to, one or more immune-related genes, or the encoded products of such genes, such as immune-related proteins, non-functional. Such deletion of a gene or a portion thereof that renders the gene and / or encoded product non-functional may be referred to as a knockout. In some instances, a gene or its gene product may be rendered non-functional, for example, by the introduction of an insertion that causes a frameshift or produces a misfolded or otherwise non-functional protein.

[0133] In some examples, the useful edits may correct dysfunctional genes, including, for example, dysfunctional genes of monogenic diseases. In some examples, the monogenic disease is a liver-associated monogenic disease (i.e., a monogenic disease resulting from a dysfunctional gene that is a liver-associated gene or a hepatocyte-associated gene). In some examples, the monogenic disease is a non-liver-associated monogenic disease (i.e., a monogenic disease resulting from a dysfunctional gene that is not a liver-associated gene or a hepatocyte-associated gene). In some examples, the edits are corrective edits of a defective endogenous locus. In some examples, the edits are not corrective edits of a defective endogenous locus.

[0134] In some examples, an edit can be introduced into a non-hepatocyte-associated and / or non-liver-associated locus, such that the edit is in a locus not associated with hepatocytes and / or liver function. As used herein, a "locus associated with hepatocyte function" or "hepatocyte locus" or similar terms refers to a locus that is involved in, for example, liver metabolism (e.g., hepatocyte metabolism), ammonia metabolism (including, for example, the urea cycle), amino acid metabolism, amino acid biosynthesis, amino acid catabolism, detoxification, liver (e.g., hepatocyte) proteins (e.g., albumin, fibrinogen, prothrombin, clotting factors (including, for example, Factor V, Factor VII, IX, Factor X, Factor XI, and Factor XII), protein C, protein S, antithrombin, lipoproteins, ceruloplasmin, transferrin, complement proteins, proteins of the hepatocyte proteome and / or secretome (e.g., see Franko et al., J. Med. Soc., 1999, 143:131-135, 2001). (e.g., those described in Hepatocyte Function and / or Functions Predominantly Performed in the Liver, such as ...

[0135] In some instances, multiple gene edits can be introduced into a single cell. For example, in some instances, a cell can contain two or more deletions, insertions, substitutions, or some combination thereof, including, for example, when a cell contains two, three, four, or five such edits. Any useful combination of edits can be introduced, including, for example, multiple edits in a single gene, edits in two or more polypeptides or chains of a single protein, edits in two or more different proteins of a family or pathway, edits in two or more functionally related proteins (e.g., two or more immune-related proteins, two or more liver-related proteins, etc.).

[0136] When multiple edits are introduced and / or cells are genetically modified in multiple ways (e.g., by introducing an edit at an endogenous locus and functional integration of a transgene, or by introducing multiple edits at multiple endogenous loci, or a combination thereof), such multiple edits / modifications can be performed simultaneously and / or in any convenient and suitable order. For example, in some examples, a cell population can be contacted with reagents simultaneously or essentially simultaneously to perform two different genetic modifications. In some examples, a cell population is contacted with a first reagent or set of reagents to perform a first modification, and then with a second reagent or set of reagents to perform a second modification. In some examples, when steps are performed sequentially, one or more intervention actions can be performed, including, but not limited to, isolation, purification, enrichment, cell culture, growth, analysis, cryopreservation, etc. In some examples, no intervention actions are performed, such as isolation, purification, enrichment, cell culture, growth, analysis, cryopreservation, etc.

[0137] A variety of convenient methods can be used to contact a cell population with one or more editing reagents, including, but not limited to, transfection of an editing reagent or a nucleic acid encoding such an agent, transduction of an editing reagent, nucleofection and / or electroporation of an editing reagent, etc. In some examples, a vector can be used, such as a viral vector or a non-viral vector. In some examples, the components of the vector can include a nucleic acid, a protein, or a combination thereof. Any convenient viral or non-viral vector can be used, including, but not limited to, a lipid nanoparticle (LNP) vector.

[0138] The vector may be configured to contain all or less than all of the components necessary to perform the desired editing. For example, in some instances, the vector may contain all components sufficient to perform editing at the target locus. In some instances, the vector may contain less than all of the components required to perform editing, and the remaining components may be delivered by other means, such as another different vector, transduction, transfection, etc. In some instances, the components of the targeting system, such as nucleic acid and protein components, may be pre-complexed prior to delivery, including where such components are pre-complexed within the delivery vector. For example, in some instances, the nucleic acid (e.g., gRNA, etc.) and protein (e.g., nuclease or base editing protein, etc.) editing reagents of the editing system may be complexed as a ribonucleoprotein (RNP) for delivery to a cell population for editing.

[0139] Any convenient and suitable gene editing system can be used to introduce one or more of the edits described herein. Methods of site-specific introduction of desired edits are various and can include, for example, by using one or more site-specific nucleases (e.g., CRISPR / Cas9 nucleases, TALEN nucleases, ZFNs, etc.) to introduce one or more site-specific cleavage events. Site-specific cleavage can include double-stranded and / or single-stranded cleavage, if applicable. In some examples, the site-specific cleavage is followed by a specific repair event at the site cleaved by the site-specific nuclease, for example, to introduce the desired edit (e.g., a substitution, an insertion, a deletion, etc.). Such methods of specific repair can include, for example, homologous recombination (including homology-directed repair (HDR)), for example, in the presence of a nucleic acid that includes a homology region to guide the repair. In some examples, site-specific cleavage can be used to introduce gene disruption and / or knockout without, for example, a specific repair event, for example, via a cellular process following the site-specific cleavage, such as non-homologous end joining (NHEJ). In some instances, site-specific introduction of the desired edit may use a base editing system that does not introduce a double-stranded break event, such as, but not limited to, a CRISPR protein-guided editing system, such as, for example, a dCas9-deaminase fusion protein system, including cytosine base editor (CBE) and adenine base editor (ABE) systems. In some instances, a useful base editing system introduces a single base change, for example, without cleavage of the phosphodiester nucleic acid backbone.

[0140] A variety of editing compositions may be used, and such compositions vary based on, for example, the editing system used, the type of editing desired, the sequence of the target locus or loci, etc. Useful editing compositions may include, for example, CRISPR / Cas9 editing compositions (e.g., including a Cas9 protein, or a nucleic acid encoding a Cas9 protein, and a gRNA or sgRNA, or a nucleic acid encoding a gRNA or sgRNA), TALEN editing compositions (e.g., including a TALEN nuclease, or a TALEN nuclease pair, or a nucleic acid encoding a TALEN nuclease, or a TALEN nuclease pair), ZFN editing compositions (e.g., including a ZFN nuclease, or a ZFN nuclease pair, or a nucleic acid encoding a ZFN nuclease, or a ZFN nuclease pair), base-editing editing compositions (e.g., including a CRISPR protein-guided base-editing protein, or a nucleic acid encoding a CRISPR protein-guided base-editing protein, and a gRNA or sgRNA, or a nucleic acid encoding a gRNA or sgRNA), etc.

[0141] CRISPR-Cas based editing compositions and methods of using CRISPR-Cas based editing compositions are described in more detail below, however, it will be readily understood that such description and compositions and methods are not so limited and that elements, targets, and / or concepts of such description may be adapted or applied for use with other editing systems, as appropriate.

[0142] In some examples, useful editing compositions include a CRISPR-Cas protein (e.g., a Cas9 protein, etc.) or a polynucleotide encoding a CRISPR-Cas protein, and a guide RNA (gRNA) or a polynucleotide encoding a gRNA. As used herein, the term "gRNA" generally encompasses both bicomponent guide systems (e.g., two gRNAs) as well as single guide RNA (sgRNA) systems, unless inappropriate and / or otherwise indicated. In some cases, a gRNA or multiple gRNAs can be configured and used to target a desired locus or one or more elements thereof (such as one of more exons of a gene present at the locus) as described herein. For example, in some examples, a gRNA or multiple gRNAs can be configured and used to target a B2M locus or one or more elements thereof (such as one or more exons of the B2M locus (e.g., one or more of exon 1, exon 2, or exon 3)).

[0143] In some examples, the editing methods may involve the use of Cas9 nucleases, including naturally occurring and engineered Cas9 nucleases, and nucleic acid sequences encoding same. Useful Cas9 nucleases include, but are not limited to, for example, Streptococcus pyogenes Cas9 and variants thereof, Staphylococcus aureus Cas9 and variants thereof, and Actinomyces naeslundii Cas9 and variants thereof, and also include those discussed in PCT Publication Nos. WO 2013 / 176772 and WO 2015 / 103153, as well as those reviewed in, for example, Makarova et al. (2011) Nature Reviews Microbiology 9:467-477, Makarova et al. (2011) Biology Direct 6:38, Haft et al. (2005) PLOS Computational Biology 1:e60, and Chylinski et al. (2013) RNA Biology 10:726-737, the disclosures of which are incorporated herein by reference in their entireties. In some instances, a non-Cas9 CRISPR nuclease (or an engineered variant thereof) may be used, including, for example, but not limited to, Cpf1 or a Cpf1 variant.

[0144] Cas9 nuclease is used in the CRISPR / Cas9 system of gene editing, and modified Cas9 proteins (e.g., Cas9 nickase and dCas9 proteins, with or without additional functionalities) can be used in various editing methodologies. In the CRISPR / Cas9 system, two separate guide components (i.e., crRNA and tracrRNA) or chimeric RNAs containing target sequences (i.e., "guide RNA" or "single guide RNA (sgRNA)" collectively containing crRNA and tracrRNA) guide the Cas9 nuclease to cleave DNA at a specific target sequence defined by the gRNA or sgRNA. When used, the specificity, efficiency and versatility of HDR targeting and replacement is greatly improved by the combined use of various homology-directed repair strategies and CRISPR nucleases (see, e.g., Gratz et al. (2014) Genetics. 196(4) 961-971; Chu et al. (2015) Nature. 33:543-548; Hisano et al. (2015) Scientific Reports 5:8841; Farboud & Meyer (2015) Genetics, 199:959-971; Merkert & Martin (2016) Stem Cell Research 16(2):377-386, the disclosures of which are incorporated herein by reference in their entireties).

[0145] The CRISPR system offers significant versatility in gene editing, due in part to the small size and high frequency of the required sequence targeting elements in the host genome. CRISPR-guided Cas9 nuclease requires the presence of a protospacer adjacent motif (PAM), the sequence of which depends on the bacterial species from which Cas9 is derived (e.g., for Streptococcus pyogenes, the PAM sequence is "NGG"), but such a sequence is common across a variety of target nucleic acids. The PAM sequence immediately downstream of the target sequence is not part of the guide RNA, but is essential to cleave the DNA strand. Synthetic Cas9 nucleases have been generated with novel PAM recognition, further increasing the versatility of targeting, and can be used in the methods described herein. Cas9 nickases that cleave only one strand of the target nucleic acid (e.g., Cas9(D10A) and the like) have also been developed, as well as endonuclease-deficient (i.e., "dead") dCas9 variants with additional enzymatic activity added by added fusion proteins.

[0146] In some embodiments, immune-related loci of hepatocytes and / or hepatic progenitor cells can be targeted for editing, for example, to render the edited hepatocytes and / or hepatic progenitor cells less immunogenic. For example, in some instances, one or more loci encoding HLA class I proteins or related proteins (e.g., HLA class 1a or related proteins), one or more loci encoding HLA class II proteins or related proteins (e.g., "HLA-D" proteins, transcription factors and / or coactivators that cause expression of HLA class II genes, etc.), or a combination thereof can be targeted. By introducing such disruptions in HLA class I and / or HLA class II proteins, hepatocytes and / or hepatic progenitor cells can be rendered less immunogenic, as shown herein. For example, such disruptions can result in reduced killing of edited hepatocytes by immune cells, such as, for example, lymphocytes (e.g., cytotoxic T lymphocytes (CTLs)). Useful loci for targeting include, but are not limited to, for example, HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, HLA-DR, B2M, CIITA, NLRC5, RFX5, RFXANK, RFXAP, etc. In some examples, the desired edits may disrupt all genes of a particular class, for example, by introducing one or more edits that result in HLA-A, -B, and -C disruption, and / or by introducing one or more edits of a component shared by HLA-A, -B, and -C, such as B2M. Similar strategies can be adapted and used for other targets and loci, such as, for example, HLA class II proteins. Useful HLA genes, alleles, loci, and their proteins include, for example, those described in Marsh et al. (2010) Tissue Antigens 75:291-455, the disclosure of which is incorporated herein by reference in its entirety.

[0147] In some examples, useful CRISPR Cas9-based B2M targeting sequences and corresponding PAM sequences that can be used to edit the B2M locus described herein include, for example, the B2M exon 1 targeting sequence "B2M_Ex1_7" (PAM, CGG) having the sequence GGCCACGGAGCGAGACATCT (SEQ ID NO: 039), the B2M exon 1 targeting sequence "B2M_Ex1_3" (PAM, CGG) having the sequence CGCGAGCACAGCTAAGGCCA (SEQ ID NO: 040), the B2M exon 2 targeting sequence "B2M_Ex2_4" (PAM, TGG) having the sequence AAGTCAACTTCAATGTCGGA (SEQ ID NO: 041), and the like.

[0148] In some examples, the editing composition may be an HLA class I targeting composition and / or an HLA class II targeting composition that results in the disruption of the production and / or function of one or more HLA class I proteins, one or more HLA class II proteins, and / or one or more associated proteins (e.g., but not limited to, B2M, transcription factors that cause expression of HLA class I and / or II genes or proteins, and / or coactivators that cause expression of HLA class I and / or II genes or proteins).

[0149] Such editing compositions can be contacted with the cell population under conditions sufficient to produce the desired edits, including, for example, when such conditions are sufficient for the introduction, delivery, transfection, transduction, targeting, enzymatic activity, and / or repair (if applicable), as well as survival and necessary biological activity of the cells. Conditions sufficient to produce the desired edits can include, but are not limited to, suitable culture conditions, including, for example, maintaining suitable environmental conditions (e.g., temperature, gas exchange, etc.) in a suitable culture medium conducive to the editing reaction. In addition, the editing reaction can be carried out for a sufficient time for the editing reaction to occur and reach a desired level of completion, and such sufficient time can vary. Also, in some instances, the exposure time to the editing reagent can be minimized, for example, when the editing reaction or its components can have one or more deleterious effects on the cell population (e.g., reduced cell viability, increased cell fragility, etc.).

[0150] In some examples, gene editing methods may include the use of zinc finger nucleases (ZFNs). ZFNs consist of sequence-independent Fokl nuclease domains fused to zinc finger proteins (ZFPs). ZFPs can be modified to change their sequence specificity. Targeted dsDNA cleavage involves the binding of two ZFNs (referred to as left and right) to adjacent half-sites on opposite strands with correct orientation and spacing, thus forming a Fokl dimer. Dimerization significantly increases ZFN specificity. Three- or four-finger ZFPs target approximately 9 or 12 bases per ZFN, or approximately 18 or 24 bases for a ZFN pair. The specificity, efficiency and versatility of homologous recombination targeting and replacement are greatly improved by the combined use of various homology-directed repair strategies and ZFNs (see, e.g., Urnov et al. (2005) Nature. 435(7042):646-5; Beumer et al. (2006) Genetics. 172(4):2391-2403; Meng et al. (2008) Nat Biotechnol. 26(6):695-701; Perez et al. (2008) Nat Biotechnol. 26(7):808-816; Hockemeyer et al. (2009) Nat Biotechnol. 27(9):851-7, the disclosures of which are incorporated herein by reference in their entirety). In general, one ZFN site can be found every 125-500 bp of random genomic sequence, depending on the assembly method. Methods for identifying suitable ZFN targeting sites include, for example, computer-mediated methods, such as those described in Cradick et al. (2011) BMC Bioinformatics. 12:152, the disclosure of which is incorporated by reference in its entirety.

[0151] In some examples, the method of gene editing may include the use of transcription activator-like effector nucleases (TALENs). Although similar in principle to ZFN nucleases, TALENs utilize a sequence-independent Fokl nuclease domain fused to a transcription activator-like effector (TALE) protein that, unlike ZNFs, individually recognizes single nucleotides. TALEs generally contain a characteristic central domain of DNA-binding tandem repeats, a nuclear localization signal, and a C-terminal transcription activation domain. A typical repeat is 33-35 amino acids long and contains two hypervariable amino acid residues at positions 12 and 13, known as "repeat variable dipairs" (RVDs). The RVDs can recognize one specific DNA base pair, and consecutive repeats match consecutive DNA sequences. Target DNA specificity is based on a simple code for the RVDs, thus allowing prediction of the target DNA sequence. Depending on the desired targeting, native TALEs or engineered / modified TALEs can be used for TALENs. TALENs can be designed for almost any sequence stretch. Only the presence of a thymine at each 5' end of the DNA recognition site is required. The specificity, efficiency and versatility of homologous recombination targeting and replacement have been demonstrated using a variety of homology-directed repair strategies and TALENs (e.g., Zu et al. (2013) Nature Methods. 10:329-331, Cui et al. (2015) Scientific Reports 5:10482, Liu et al. (2012) J. Genet. Genomics. 39:209-215, Bedell et al. (2012) Nature. 491:114-118, Wang et al. (2013) Nat. Biotechnol. 31:530-532, Ding et al. (2013) Cell Stem Cell. 12:238-251, Wefers ... al. (2013) Proc. Natl. Acad. Sci. USA, 110:3782-3787, the disclosures of which are incorporated herein by reference in their entireties).

[0152] In some examples, gene editing methods may include the use of base editor systems, including but not limited to base editor systems using, for example, fusion proteins, nucleic acid base editors, and gRNAs, including programmable DNA binding proteins. Base editing generally does not rely on HDR and / or NHEJ, and generally does not result in or require the cleavage of phosphodiester bonds on both backbones of dsDNA. Thus, base editing may in some examples use RNA-guided (i.e., "programmable") DNA binding proteins, such as Cas nucleases, that do not cause double-strand breaks (e.g., nuclease-deficient or nuclease-defective Cas proteins, such as dCas9 or Cas9 nickase). Useful examples of base editors and base editing systems (including nucleic acids encoding base editors) include BE1, BE2, BE3 (Komor et al., 2016); Target-AID (Nishida et al., 2016); SaBE3, BE3 PAM variants, BE3 editing window variants (Kim et al., 2017); HF-BE3 (Rees et al., 2017); BE4 and BE4-Gam; AID, CDA1 and APOBEC3G BE3 variants (Komor et al., 2017); BE4max, ArcBe4max, ABEmax (Koblan et al., 2018); adenine base editor (ABE7.10) (Gaudelli et al., 2017); ABE8 (Richter et al., 2020); ABE8e (Gaudelli et al., 2020); A&C-BEmax (Zhang et al., 2018); al., 2020); SPACE (Grunewald et al., 2020), and the above references are incorporated by reference in their entireties.

[0153] Non-limiting examples of useful base editor systems and components thereof are described, for example, in PCT International Publication Nos. 2020236936(A1), 2020231863(A1), 2020168135(A1), 2020168122(A1), 2020168088(A1), 2020168132(A9), 2020168133(A1), 2020168075(A9), 2020168051(A9), 2020160514(A1), 2020160515(A1), 2020160516(A1), 2020160517(A1), 2020160518(A1), 2020160519 ... Nos. 20160517(A1), 2020150534(A9), 2020051562(A3), 2020051562(A3), 2020028823(A1), 2019217941(A1), 2019217942(A1), and 2019217943(A1), and U.S. Patent Application Publication No. 20200399626(A1), the disclosures of which are incorporated herein by reference in their entireties.

[0154] In some examples, the presence of the desired edit may be verified, for example, by assays to test for the presence of an edit (or the absence of a desired deletion) at the targeted locus, for the absence of a gene product encoded at the locus targeted for disruption, for the presence of a gene product encoded by an introduced sequence, etc. Useful methods for performing such assays include, but are not limited to, methods based on PCR (e.g., PCR, qPCR, rt-PCR, etc.) of the locus and / or RNA encoded at the locus, methods based on Western blots of cell lysates probed with antibodies against proteins encoded at the locus, flow cytometry-based methods, sequencing (e.g., single cell sequencing), and the like.

[0155] Other useful components, e.g., of transgenes, expression cassettes, editing compositions, vectors, etc., may include promoter sequences (e.g., constitutive, tissue-specific, etc.), signal peptide sequences, poly(A) sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, origins of replication, matrix attachment sites, and / or locus control regions. Additionally, multiple gene products may be expressed from one nucleic acid by linking the individual components (transgenes) in one open reading frame separated, e.g., by a self-cleaving 2A peptide or an IRES sequence.

[0156] Examples of useful promoters include, for example, viral Simian Virus 40 (SV40) (e.g., early or late), Cytomegalovirus (CMV) (e.g., immediate early), Moloney Murine Leukemia Virus (MoMLV), MND (myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer binding site substitution), Rous Sarcoma Virus (RSV), Herpes Simplex Virus (HSV), Spleen Focus Forming Virus (SFFV) promoters, and the like. In certain embodiments, the promoter may be inducible, such that transcription of all or part of the viral genome occurs only in the presence of one or more inducers. Inducers include, but are not limited to, one or more compounds or physiological conditions under which the host cells are cultured, such as temperature or pH. In some examples, the promoter may be constitutive. In some examples, the promoter may cause preferential expression in a desired cell type or tissue, e.g., the promoter may be cell type specific or tissue specific.

[0157] In some instances, transgenes, expression cassettes, vectors, etc. may contain sequences encoding signal peptides. Signal peptides are short peptides located at the N-terminus of proteins. Signal peptides function in protein localization and are useful for directing associated proteins to the secretory pathway and promoting the secretion of proteins.

[0158] Vectors, including retroviral vectors, e.g., lentiviral vectors, may include (or optionally exclude) a variety of elements, including cis-acting elements such as promoters, long terminal repeats (LTRs) and / or elements thereof, including 5'LTR and 3'LTR and elements thereof, central polypurine tract (cPPT) elements, DNA flap (FLAP) elements, export elements (e.g., rev response element (RRE), Hepatitis B virus post-transcriptional regulatory element (HPRE), etc.), post-transcriptional regulatory elements (e.g., Woodchuck Hepatitis Virus Post-transcriptional Regulatory Element (WPRE), Hepatitis B virus Regulatory Element (HPRE), etc.), polyadenylation sites, transcription termination signals, insulator elements (e.g., the β-globin insulator, e.g., chicken HS4), and the like. Other elements that may or may not be present in various vectors include, but are not limited to, enhancers, untranslated regions (UTRs), Kozak sequences, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, internal ribosome entry sites (IRES), recombinase recognition sites (e.g., LoxP, FRT, and Att sites), stop codons, transcription termination signals, and polynucleotides encoding self-cleaving polypeptides, epitope tags, regions of homology useful in homology directed repair (HDR), and the like.

[0159] Useful LTRs include, but are not limited to, LTRs that include, for example, U3, R and / or U5 regions and portions thereof. LTRs provide functions for retroviral gene expression (e.g., promoting, initiating and polyadenylation of gene transcripts) and viral replication. LTRs can include multiple regulatory signals, including transcriptional control elements, polyadenylation signals, and sequences required for viral genome replication and integration. U3 regions can include enhancer and promoter elements. U5 regions can include polyadenylation sequences. R (repeat) regions are generally adjacent to U3 and U5 regions. LTRs composed of U3, R and U5 regions can appear at both the 5' and 3' ends of the viral genome. Viral genomes can include sequences adjacent to the 5'LTR that function in reverse transcription of the genome, such as for efficient packaging of viral RNA into particles (e.g., Psi site).

[0160] Useful LTRs include modified 5'LTR and / or 3'LTR. Modification of 3'LTR is often performed to improve the safety of lentiviral or retroviral systems by making the virus replication-deficient. As used herein, the term "replication-deficient" refers to a virus that cannot replicate completely and effectively, such that infectious virions are not produced (e.g., replication-deficient lentiviral progeny). The term "replication-competent" refers to a wild-type or mutant virus that can replicate, such that viral replication of the virus can produce infectious virions (e.g., replication-competent lentiviral progeny).

[0161] In some embodiments, useful vectors may be self-inactivating. The term "self-inactivating" (SIN) with respect to vectors refers to replication-deficient vectors, e.g., retroviral or lentiviral vectors, in which the right (3') LTR enhancer-promoter region, including the U3 region, has been modified (e.g., by deletion and / or substitution) to prevent viral transcription beyond the first round of viral replication. In further embodiments, the 3'LTR may be modified such that the U5 region is replaced with, e.g., a heterologous or synthetic poly(A) sequence, one or more insulator elements, and / or an inducible promoter. It is readily apparent to one of skill in the art that reference to an LTR, e.g., a 3'LTR or a 5'LTR, may include modified LTRs or modifications to LTRs, e.g., modifications to the 3'LTR, 5'LTR, or both the 3'LTR and the 5'LTR.

[0162] In some embodiments, the viral vector may contain a TAR element. The term "TAR" refers to the "transactivation response" genetic element located in the R region of lentivirus (e.g., HIV) LTR. This element interacts with the lentivirus transactivator (tat) genetic element to enhance viral replication. In some embodiments, the vector may not contain a TAR element, including, for example, when the U3 region of the 5'LTR is replaced by a heterologous promoter.

[0163] In some instances, the vector may be a pseudotyped vector. The term "pseudotype" or "pseudotyping" as used herein refers to a virus having one or more viral envelope proteins replaced with an envelope protein of another virus having preferred characteristics. For example, HIV can be pseudotyped with vesicular stomatitis virus G protein (VSV-G) envelope protein. In some embodiments, lentivirus envelope protein is pseudotyped with VSV-G. In some embodiments, packaging cells can be used to produce recombinant retroviruses, e.g., lentiviruses, pseudotyped with VSV-G envelope glycoprotein.

[0164] Vectors (both viral and non-viral) may contain structural and / or genetic elements, or portions thereof, from viruses. Retroviral vectors may contain structural and / or genetic elements, or portions thereof, from retroviruses. Lentiviral vectors may contain structural and functional genetic elements, or portions thereof, including LTRs, primarily from lentiviruses. In some instances, hybrid vectors may be used, including, for example, where the hybrid vector contains LTRs or other nucleic acids that contain both retroviral, e.g., lentiviral, and non-retroviral, e.g., non-lentiviral, viral sequences. In some embodiments, the hybrid vector may contain vectors that contain retroviral, e.g., lentiviral, sequences for reverse transcription, replication, integration, and / or packaging.

[0165] The cell populations, and / or hepatocytes and / or hepatic progenitor cells thereof, can be used to treat a subject for a condition in which administration of an effective amount of the cells has a desired therapeutic effect. In some examples, the desired therapeutic effect is the result of one or more intrinsic functions of the administered hepatocytes (e.g., intrinsic functions of healthy hepatocytes, intrinsic functions of hypoimmunogenic hepatocytes, etc.), including, but not limited to, hepatocyte metabolism, detoxification, synthesis of hepatocyte proteins (e.g., albumin, fibrinogen, prothrombin, clotting factors (e.g., Factor V, Factor VII, Factor IX, Factor X, Factor XI, and Factor XII), protein C, protein S, antithrombin, lipoproteins, ceruloplasmin, transferrin, complement proteins, proteins of the hepatocyte proteome and / or secretome (e.g., such as those described in Franko et al. Nutrients. (2019) 11(8):1795, the disclosure of which is incorporated herein by reference in its entirety), etc. In some examples, the desired therapeutic effect is the result of one or more heterologous functions of the administered hepatocytes (e.g., a heterologous function of a gene product encoded by a functionally integrated transgene). In some examples, when the subject's condition is hemophilia (e.g., hemophilia A or hemophilia B) and the method includes administering to the subject an effective amount of genetically modified human hepatocytes that include a transgene encoding a gene product (e.g., factor VIII, factor IX, etc.) for treating hemophilia, the method can further include modulating coagulation in the subject, for example, by administering to the subject an anticoagulant (e.g., warfarin, rivaroxaban, dabigatran, apixaban, edoxaban, etc.) in an amount effective to modulate coagulation in the subject.

[0166] The cell populations comprising hepatocytes and / or their progenitors described herein can be used to treat and / or prevent any liver disease or liver injury. For example, reconstitution of a patient's liver tissue by introduction of hepatocytes is a potential therapeutic option for patients with any liver condition (e.g., acute liver failure, chronic liver disease, and / or metabolic or monogenic disease), including as a permanent treatment of these conditions by repopulating the subject's liver with cells genetically modified as described herein. Reconstitution of hepatocytes can be used, for example, to introduce genetically modified hepatocytes for gene therapy, or to replace hepatocytes lost as a result of disease, physical or chemical injury, or malignancy. In addition, expanded human hepatocytes can be used to fill artificial liver assist devices.

[0167] Disclosed herein are methods of producing, including expanding, hepatocytes for various purposes. In some cases, the methods of the present invention provide for the production and / or expansion of human hepatocytes suitable for transplantation into a subject in need of hepatocytes, including human hepatocytes suitable for transplantation (including, for example, orthotopic liver transplantation). Hepatocytes, including human hepatocytes produced according to the methods described herein, can be purified, cryopreserved, and / or extensively characterized prior to transplantation or injection. Among other uses, hepatocytes produced according to the methods described herein can provide on-demand therapy to patients with one or more severe liver diseases.

[0168] In some instances, the desired therapeutic effect is the result of one or more heterologous functions of the administered hepatocytes that are provided by the gene product encoded by the incorporated transgene.Therefore, essentially any condition that can be treated through the delivery of a heterologous gene product, such as a secreted heterologous gene product, can be treated using the genetically modified hepatocytes produced as described herein.For example, a single gene disease that results in a protein deficiency can be treated through the administration of an effective amount of hepatocytes that are genetically modified to contain an incorporated transgene that codes for the protein, thereby reducing the protein deficiency.

[0169] Transgenes useful for treating monogenic conditions include, for example, copper transporting ATPase 2 (ATP7B), hereditary hemochromatosis protein (HFE), hemojuvelin, hepcidin (HAMP), transferrin receptor protein 2 (TFR2), solute carrier family 40 member 1 (SLC40A1), factor IX, factor VIII, von Willebrand factor, carbamoyl phosphate synthase (CPS1), N-acetylglutamate synthase (NAGS), ornithine transcarbamylase (OTC), alpha-galactosidase A gene (GLA), phenylalanine hydroxylase enzyme, and the like. Transgenes encoding full-length and modified forms of phosphoinositide (PAH), arginase (ARG, including ARG1), alpha 1-antitrypsin (AAT), fumarylacetoacetate hydrolase (FAH), argininosuccinate lyase (ASL), argininosuccinate synthase (ASS, including ASS1), ornithine translocase (ORNT1), citrine, UDP-glucuronosyltransferase 1A1 (UGT1A1), transthyretin (TTR), serine-pyruvate aminotransferase (AGXT), complement factor H (CFH), and the like, and combinations thereof.

[0170] In some examples, the disease being treated is a liver disease and / or a liver-associated monogenic disease, including, for example, when the gene product of the transgene is a liver-associated protein. In some examples, the disease being treated is a liver disease and / or a liver-associated monogenic disease, including, for example, when the gene product of the transgene is not a liver-associated protein. In some examples, the monogenic disease being treated is not a liver-associated monogenic disease, including, for example, when the gene product of the integrated transgene is not a liver-associated protein. In some examples, the disease being treated is not a liver disease, including, for example, when the gene product of the integrated transgene is not a liver-associated protein.

[0171] The cell populations comprising hepatocytes and / or hepatic progenitor cells as described herein and compositions comprising such cells as described herein can be administered to a subject by any suitable means, and to any part, organ, or tissue of a subject. Non-limiting examples of administration means include portal vein injection, umbilical vein injection, direct splenic capsule injection, splenic artery injection, injection into the omental bursa, and / or intraperitoneal injection (injection, implantation). In certain embodiments, the composition comprises encapsulated hepatocytes that are implanted by injection into the intraperitoneal space and / or omental bursa. In certain embodiments, the composition comprises an acellular / decellularized scaffold, including, for example, synthetic scaffolds, decellularized liver, etc., to be seeded and / or repopulated with hepatocytes as described herein and surgically implanted into a subject in need thereof.

[0172] In addition to or as an alternative to administration (implantation) to a subject (patient), the hepatocytes described herein can also be used to provide hepatocytes to a device or composition useful for treating a subject with liver disease. Non-limiting examples of such devices or compositions in which the hepatocytes of the present disclosure can be used include bioartificial livers (BAL) (extracorporeal support devices for subjects suffering from acute liver failure) and / or decellularized livers (recellularized organ scaffolds to provide livers for subjects). See, for example, Shaheen et al. (2019) Nat Biomed Eng. doi:10.1038 / s41551-019-0460-x, Glorioso et al. (2015) J Hepatol 63(2):388-98.

[0173] In some examples, a subject undergoing a treatment described herein may not receive immunosuppressants, e.g., the subject may not be immunosuppressed and / or may be immunologically normal at the time of treatment, e.g., before, during, and / or after administration of the hepatocytes described herein. For example, such a subject may have one or more contraindications to immunosuppression, immunosuppressive drugs, and / or a particular immunosuppressive therapy, or may not receive immunosuppressive drugs for different reasons. In some examples, a subject who is not immunosuppressed and / or a subject who has contraindications to immunosuppression may receive a cell population in which a significant portion (including all or essentially all) of the population are low immunogenic hepatocytes.

[0174] Non-limiting examples of contraindications to immunosuppression include liver disease or condition, fibrosis, cirrhosis, kidney disease or condition, blood disease or condition, history of shingles and / or chickenpox, infection (e.g., tuberculosis, BK polyoma virus, herpes simplex, fungus, parasites (e.g., Ascaris strongyloides), Varicella zoster virus, measles, etc.), exposure to an infectious disease (e.g., measles, chickenpox, etc.), cancer, malignancy, diabetes, high cholesterol, high blood pressure, high blood triglycerides, hemolytic uremic syndrome, anemia, thrombocytopenia, low white blood cell count, pericardial effusion, thrombotic thrombocytopenic purpura, pulmonary effusion ... tumors, interstitial pneumonia, stomatitis, stomatitis, acute renal failure, renal artery occlusion (e.g., renal artery thrombosis), visible edema, ascites, proteinuria, wound healing disorders, pregnancy, lactation and breast-feeding, malignant lymphoma, thrombosis (e.g., thrombosis after liver transplantation), heart transplantation, endocrine disorders of hormone deficiency (e.g., thyroid hormone deficiency, hypothalamic insufficiency, pituitary insufficiency), low blood potassium, psychiatric disorders, myopathy, glaucoma, cataracts, ulcers, gastritis, diverticulitis, intestinal anastomosis, tendon rupture, osteoporosis, hypomineralization and low density of bone, seizures, argininosuccinate lyase deficiency, carbamoyl phosphate synthase deficiency deficiency, citrullinemia, ornithine carbamoyltransferase deficiency, arginase deficiency, elevated creatine kinase, fractures due to disease or illness, osteonecrosis, muscle wasting, hyperammonemia (e.g., as associated with N-acetylglutamate synthase deficiency), immunosuppressants (e.g., corticosteroids (e.g., prednisone, budesonide, prednisolone), Janus kinase inhibitors (e.g., tofacitinib), calcineurin inhibitors (e.g., cyclosporine, tacrolimus), mTOR inhibitors (e.g., sirolimus, everolimus), IMDH inhibitors (e.g., azathioprine, leflunomide, mycophenolate), immunosuppressant biologics (e.g., abatacept (Orencia), adalimumab (Humira), anakinra (Kineret), certolizumab (Cimzia), etanercept (Enbrel), golimumab (Simponi), infliximab (Remicade), ixekizumab (Taltz), natalizumab (Tysabri), rituximab (Rituxan), secukinumab (Cosentyx), tocilizumab (Actemra),Other contraindications (e.g., to certain immunosuppressants) may be readily ascertainable from label information, drug and drug interaction databases, drug manufacturers, and / or relevant regulatory agencies, such as the U.S. Food and Drug Administration (FDA).

[0175] In some examples, the administered cell population may be 80% or more hypoimmunogenic hepatocytes, including, for example, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more hypoimmunogenic hepatocytes. In some examples, a cell population having 80% or more hypoimmunogenic hepatocytes may be administered to a subject having one or more contraindications to treatment with one or more immunosuppressants, including, for example, when such hypoimmunogenic hepatocytes include one or more, e.g., two or more, e.g., at least three, genetic modifications as described herein.

[0176] Diseases and disorders in subjects with or without one or more contraindications to immunosuppression that can be treated using the methods and / or cell populations described herein include, but are not limited to, Crigler-Najjar syndrome type 1, familial hypercholesterolemia, factor VII deficiency, glycogen storage disease type I, infantile Refsum's disease, progressive familial intrahepatic cholestasis type 2, hereditary tyrosinemia type 1, and various urea cycle defects, acute liver failure (including juvenile and adult patients with drug-induced acute liver failure, viral-induced acute liver failure, spontaneous acute liver failure, mushroom poisoning-induced acute liver failure, post-operative acute liver failure, acute fatty liver of pregnancy-induced acute liver failure), chronic liver disease (including cirrhosis and / or fibrosis), acutely exacerbated liver disease caused by an acute event such as alcohol consumption, drug intake, and / or a hepatitis B flare. Thus, a patient may have one or more of these or other liver conditions.

[0177] In some cases, the diseases and disorders treated according to the methods described herein may involve hepatocyte-specific (hepatocyte-intrinsic) dysfunction. For example, the dysfunction and etiology of the disease and / or disorder may be due to or primarily due to dysfunction of endogenous hepatocytes present in the subject. In some cases, the hepatocyte-specific dysfunction may be genetic or inherited by the subject. In some cases, the etiology of the disease or disorder is substantially free of cell types other than hepatocytes. In some cases, the disease or disorder results in reduced liver function, liver disease (acute or chronic), or other deleterious conditions derived from endogenous hepatocytes. Thus, in some cases, for example, when the disease is intrinsic to the endogenous hepatocyte population, effective treatment may include replacement, supplementation, transplantation, or repopulation of hepatocytes as described herein. Without being bound by theory, in hepatocyte-intrinsic diseases / disorders, replacement and / or supplementation of endogenous hepatocytes can result in significant clinical improvement without the disease / disorder adversely affecting the transplanted hepatocytes. For example, if a subject has a genetic disorder that affects hepatocyte function (e.g., amino acid metabolism in hepatocytes, such as hypertyrosinemia), the allogeneic transplanted hepatocytes may be essentially unaffected by the presence of the disease / disorder in the subject. Thus, the transplanted hepatocytes may substantially engraft, survive, proliferate, and / or repopulate in the subject, resulting in a significant positive clinical outcome.

[0178] Diseases and disorders characterized by hepatocyte-specific dysfunction may be contrasted with diseases and disorders that have etiologies that are not hepatocyte-specific and involve hepatocyte-extrinsic factors. Examples of diseases that have factors and / or etiologies that are hepatocyte-extrinsic include, but are not limited to, alcoholic steatohepatitis, alcoholic liver disease (ALD), hepatic steatosis / non-alcoholic fatty liver disease (NAFLD), etc. Hepatocyte-extrinsic diseases include liver damage that is external or originates from outside of endogenous hepatocytes (alcohol, diet, infection, etc.). In some examples, diseases and disorders that are treated according to the methods described herein may include diseases and disorders that are not hepatocyte-specific dysfunction.

[0179] Examples of hepatocyte-specific and hepatocyte-associated diseases include liver-associated enzyme deficiencies, hepatocyte-associated transport diseases, and the like. Such liver-associated deficiencies can be acquired or inherited diseases and can include metabolic diseases (e.g., liver-based metabolic disorders, etc.). Inherited liver-based metabolic disorders can be referred to as "inherited metabolic diseases of the liver," such as, but not limited to, those diseases described in Ishak, Clin Liver Dis (2002) 6:455-479. Liver-associated deficiencies can result in acute and / or chronic liver disease in some instances, including, for example, when acute and / or chronic liver disease is the result of a deficiency when left untreated or inadequately treated. Non-limiting examples of inherited liver-related enzyme deficiencies, hepatocyte-related transport disorders, etc. include Crigler-Najjar syndrome type 1, familial hypercholesterolemia, factor VII deficiency, glycogen storage disease type I, infantile Refsum disease, progressive familial intrahepatic cholestasis type 2, hereditary tyrosinemia (e.g., hereditary tyrosinemia type 1), inherited urea cycle defects, phenylketonuria (PKU), hereditary hemochromatosis, alpha I antitrypsin deficiency (AATD), Wilson's disease, etc.Non-limiting examples of inherited metabolic disorders of the liver, including metabolic disorders having at least some hepatic phenotype, pathology, and / or liver-related condition, include 5-beta-reductase deficiency, AACT deficiency, Aarskog syndrome, Abetalipoproteinemia, adrenoleukodystrophy, Alpers disease, Alpers syndrome, alpha-1-antitrypsin deficiency, antithrombin III deficiency, arginase deficiency, argininosuccinic aciduria, arteriohepatic dysplasia, autoimmune lymphoproliferative syndrome, benign recurrent cholestasis, beta thalassemia, Bloom's syndrome, Budd-related cholangiocarcinoma, and cholangiocarcinoma. Chiari syndrome, glycoprotein deficiency syndrome, ceramidase deficiency, ceroid lipofuscinosis, cholesterol ester storage disease, cholesteryl ester storage disease, chronic granulomatous, chronic hepatitis C, Crigler-Najjar syndrome, cystic fibrosis, cystinosis, diabetes mellitus, Dubin-Johnson syndrome, endemic Tyrolean cirrhosis, erythropoietic protoporphyria, Fabry disease, familial hypercholesterolemia, familial steatohepatitis, fibrinogen storage disease, galactosemia, gangliosidosis, Gaucher disease, hereditary hemochromatosis, glycoprotein deficiency syndrome, Glycogenosis type 1a, glycogenosis type 2, glycogenosis type 3, glycogenosis type 4, granulomatous disease, hepatic familial amyloidosis, hereditary fructose intolerance, hereditary spherocytosis syndrome, Hermansky-Pudlak syndrome, homocystinuria, hyperoxaluria, hypobetalipoproteinemia, hypofibrinogenemia, intrahepatic cholestasis of pregnancy, Lafora disease, lipoamide dehydrogenase deficiency, lipoproteinopathy, Mauriac syndrome, metachromatic leukodystrophy, mitochondrial cytopathies, Navajo neurohepatopathy, Niemann-Pick disease, nonsyndromic These conditions include bile duct insufficiency, North American Indian cirrhosis of childhood, ornithine transcarbamylase deficiency, partial lipodystrophy, Pearson syndrome, cutaneous porphyria, progressive familial intrahepatic cholestasis, progressive familial intrahepatic cholestasis type 1, progressive familial intrahepatic cholestasis type 2, protein C deficiency, Schwachman syndrome, Tangier disease, thrombocytopenic purpura, total lipodystrophy, type 1 glycogenosis, Tyrolean cirrhosis, tyrosinemia, urea cycle disorders, veno-occlusive disease, Wilson's disease, Wolman disease, X-linked hyper-IgM syndrome, and Zellweger syndrome.

[0180] Treatment of a subject with the methods described herein may result in a variety of clinical benefits and / or measurable outcomes, including, but not limited to, extended survival, slowing of disease progression (e.g., slowing of liver failure), prevention of liver failure, improved and / or normalized liver function, improved and / or normalized amino acid levels, improved and / or normalized ammonia levels, improved and / or normalized albumin levels, improved and / or normalized bilirubin, recovery from phenotypic failure to thrive, reduced lethargy, reduced coma, reduced seizures, reduced jaundice, improved and / or normalized serum glucose, improved and / or normalized INR, improved and / or normalized urinalysis results, and the like.

[0181] For example, in some instances, administration of genetically modified hepatocytes and / or hepatic progenitor cells as described herein results in at least a 5% increase in survival in subjects with a condition resulting in liver disease and / or liver failure, e.g., compared to subjects treated according to standard care and / or subjects administered hepatocytes and / or hepatic progenitor cells that are not genetically modified as described herein. The observed level of enhanced survival in such subjects may vary and may range from at least a 5% increase to an increase of 60% or more, including, but not limited to, for example, an increase in survival of at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60% or more. In some cases, subjects administered genetically modified hepatocytes and / or progenitor cells thereof as described herein may experience a delay in disease progression and / or the onset of one or more disease symptoms, such as, but not limited to, liver failure and / or symptoms resulting therefrom. Such a delay in disease progression and / or symptom onset may last for days, weeks, months or years, including, for example, but not limited to, at least one week, at least one month, at least two months, at least three months, at least four months, at least five months, at least six months, at least one year or more. The hepatocytes described herein administered to a patient provide a beneficial therapeutic response to the patient over time.

[0182] Non-limiting examples of liver conditions that may be treated include acute intermittent porphyria, acute liver failure, Alagille syndrome, alcoholic fatty liver disease, alcoholic hepatitis, alcoholic cirrhosis, alcoholic liver disease, alpha 1-antitrypsin deficiency, amebic liver abscess, autoimmune hepatitis, biliary cirrhosis, Budd-Chiari syndrome, chemical and drug induced liver injury, cholestasis, chronic hepatitis, chronic hepatitis B, chronic hepatitis C, chronic hepatitis D, end stage liver disease, erythroblastic protoporphyria, fascioliasis, fatty liver disease, focal nodular hyperplasia, hepatic hydatid disease, hepatic encephalopathy, hepatic infarction, liver failure, hepatic porphyria, hepatic cerebrovascular disease ... fibrosis, hepatic tuberculosis, hepatic veno-occlusive disease, hepatitis, hepatocellular carcinoma, hepatic erythropoietic porphyria, hepatolenticular degeneration, hepatomegaly, hepatopulmonary syndrome, hepatorenal syndrome, hereditary coproporphyria, liver abscess, hepatocellular adenoma, liver cirrhosis, liver failure, liver tumor, massive hepatic necrosis, non-alcoholic fatty liver disease, parasitic liver disease, peliosis hepatis, porphyria cutanea tarda, portal hypertension, pyogenic liver abscess, Reye's syndrome, variant porphyria, viral hepatitis, viral hepatitis A, viral hepatitis B, viral hepatitis C, viral hepatitis D, viral hepatitis E, and Zellweger syndrome. In some examples, the subject can be treated for fibrosis or fibrosis symptoms. In some examples, the subject can be treated for cirrhosis or cirrhosis symptoms.

[0183] Non-limiting examples of genetic conditions include 1p36 deletion syndrome, 1q21.1 deletion syndrome, 2q37 deletion syndrome, 5q deletion syndrome, 5,10-methenyltetrahydrofolate synthase deficiency, 17q12 microdeletion syndrome, 17q12 microduplication syndrome, 18p deletion syndrome, 21-hydroxylase deficiency, alpha 1-antitrypsin deficiency, AAA syndrome (achalasia-addisonianism-alacrima syndrome), Aarskog-Scott syndrome, ABCD syndrome, aceruloplasminemia, apodiatristia, achondrogenesis type II, achondroplasia, acute intermittent porphyria, adenylosuccinic acid deficiency, leukemia, and leukemia. amyloidosis, adrenoleukodystrophy, Alagille syndrome, ADULT syndrome, Aicardi-Goutières syndrome, albinism, Alexander disease, Alfi syndrome, alkaptonuria, Alport syndrome, alternating hemiplegia of childhood, amyotrophic lateral sclerosis-frontotemporal dementia, Alström syndrome, Alzheimer's disease, hereditary amelogenesis imperfecta, aminolevulinic acid dehydratase deficiency porphyria, androgen insensitivity syndrome, Angelman syndrome, Apert syndrome, arthrogryposis-renal insufficiency-cholestasis syndrome, ataxia-telangiectasia, Axenfeld syndrome, Beare-Stevenson cutis gyrata syndrome, Beckwith-Wiedemann syndrome, Benjamin syndrome, biotinidase deficiency, Bjornstad syndrome, Bloom syndrome, Birt-Hogg-Dube syndrome, Brody myopathy, Brunner syndrome, CADASIL syndrome, cat eye syndrome, CRASIL syndrome, chronic granulomatous disorder, ankle dysplasia, Canavan disease, Carpenter syndrome, CDKL5 deficiency disorder, cerebral dysplasia-neuropathy-ichthyosis-keratoderma syndrome (CEDNIK), cystic fibrosis, Charcot-Marie-Tooth disease, CHARGE syndrome, Chediak-Higashi syndrome, Grebe chondrodysplasia, cleidocranial dysostosis, Cockayne syndrome, Coffin-Lowry syndrome, Cohen syndrome, collagen-related disorders types II and XI, congenital insensitivity to pain with anhidrosis (CIPA), congenital muscular dystrophies, Cornelia de Lange syndrome (CDLS), Cowden syndrome, CPO deficiency (coproporphyria), cranio-lenticular-suture dysplasia, cri-a-cat syndrome, Crohn's disease, Crouzon syndrome,Crouzon cutaneous skeletal syndrome (Crouzon syndrome with acanthosis nigricans), Currino syndrome, Darier disease, Dent disease (hereditary hypercalciuria), Denis-Drash syndrome, De Grouchy syndrome, Down syndrome, DiGeorge syndrome, distal hereditary motor neuropathy polymorphism, distal muscular dystrophy, Duchenne muscular dystrophy, Dravet syndrome, Edwards syndrome, Ehlers-Danlos syndrome, Emanuel syndrome, Emery-Dreifuss syndrome, epidermolysis bullosa, erythropoietic protoporphyria, Fanconi anemia (FA), Fabry disease, factor V Leiden thrombophilia, fatal familial insomnia, familial adenomatous polyposis, familial dysautonomia, familial Creutzfeld-Jakob disease b disease, Feingold syndrome, FG syndrome, fragile X syndrome, Friedreich's ataxia, G6PD deficiency, galactosemia, Gaucher disease, Gerstmann-Straussler-Scheiker syndrome, Gillespie syndrome, glutaric aciduria types I and 2, GRACILE syndrome, Griscelli syndrome, Hailey-Hailey disease, harlequin ichthyosis, hemochromatosis type 1, hemochromatosis type 2A, hemochromatosis type 2B, hemochromatosis type 3, hemochromatosis type 4, hemochromatosis type 5, hemophilia A, hemophilia Disease B, myelohepatic porphyria, hereditary coproporphyria, hereditary hemorrhagic telangiectasia (Osler-Weber-Rendu syndrome), hereditary inclusion body myopathy, hereditary multiple exostoses, hereditary spastic paraplegia (infantile ascending hereditary spastic paraplegia), Hermansky-Pudlak syndrome, hereditary neuropathy with liability to pressure palsies (HNPP), ectopia, homocystinuria, Huntington's disease, Hunter syndrome, Hurler syndrome, Hutchinson-Gilford progeria syndrome, hyperlysinemia, primary hyperoxalic acidosis uremia, hyperphenylalaninemia, hypoalphalipoproteinemia (Tangier disease), hypochondroplasia, hypochondroplasia, immunodeficiency-centromeric instability-facial malformation syndrome (ICF syndrome), incontinentia pigmenti, ischiopatellar dysplasia, ischiodicentric 15, Jackson-Weiss syndrome, Jacobsen syndrome, Joubert syndrome, juvenile primary lateral sclerosis (JPLS), keloid disorders, KIF1A-associated neuropathy, Kleefstra syndrome, Kniest dysplasia, Kosaki overgrowth syndrome, Krabbe disease, Kufor-Rakeb syndrome, LCAT deficiency,Lesch-Nyhan syndrome, Li-Fraumeni syndrome, Limb-girdle muscular dystrophy, Lynch syndrome, Lipoprotein lipase deficiency, Malignant hyperthermia, Maple syrup urine disease, Marfan syndrome, Maroteaux-Lamy syndrome, McCune-Albright syndrome, McLeod syndrome, Mednik syndrome, Familial Mediterranean fever, Menkes disease, Methemoglobinemia, Methylmalonic acidemia, Microsyndrome, Microcephaly, Miller-Dieker syndrome, Morquio syndrome, Mowat-Wilson syndrome, Muenke syndrome, Multiple endocrine neoplasia type 1 (Welmer syndrome) , multiple endocrine neoplasia type 2, muscular dystrophies, Duchenne and Becker muscular dystrophies, myostatin-associated muscle hypertrophy, myotonic dystrophy, Natowicz syndrome, neurofibromatosis type I, neurofibromatosis type II, Niemann-Pick disease, nonketotic hyperglycinemia, nonsyndromic hearing loss, Noonan syndrome, Norman-Roberts syndrome, Ogden syndrome, Omenn syndrome, osteogenesis imperfecta, pantothenate kinase-associated neurodegeneration, Patau syndrome (trisomy 13), PCC deficiency (propionic acidemia), porphyria cutanea tarda ( PCT), Pendred syndrome, Peutz-Jeghers syndrome, Pfeiffer syndrome, Ferrand-McDermid syndrome, phenylketonuria, pipecolic acidemia, Pitt-Hopkins syndrome, polycystic kidney disease, polycystic ovary syndrome (PCOS), porphyria, Prader-Willi syndrome, primary ciliary dyskinesia (PCD), primary pulmonary hypertension, protein C deficiency, protein S deficiency, proximal 18q deletion syndrome, pseudo-Gaucher disease, pseudoxanthoma elasticum, retinitis pigmentosa, Rett syndrome, Robert syndrome, Rubinstein-Taybi syndrome (R STS), Sandhoff disease, Sanfilippo syndrome, Schwartz-Jampel syndrome, Sjögren-Larsson syndrome, congenital spondylo-epiphyseal dysplasia (SED), Shprintzen-Goldberg syndrome, sickle cell anemia, Siderius type X-linked mental retardation syndrome, sideroblastic anemia, Sly syndrome, Smith-Lemli-Opitz syndrome, Smith-Magenis syndrome, Schneider-Robinson syndrome, spinal muscular atrophy, spinocerebellar ataxia (types 1-29), SSB syndrome (SADDAN), Stargardt disease (macular degeneration), Stickler syndrome (polymorphism),Strudwick syndrome (spondyloepiphyseal dysplasia, Strudwick type), Tay-Sachs disease, Tetrahydrobiopterin deficiency, Thoracic dysplasia, Treacher Collins syndrome, Tuberous sclerosis complex (TSC), Turner syndrome, Usher syndrome, Atypical porphyria, von Hippel-Lindau disease, von Willebrand disease, Waardenburg syndrome, Warkany syndrome 2, Weissenbacher-Zweymuller syndrome, Williams syndrome, Wilson disease, Woodhouse-Sakati syndrome, Wolf-Hirschorn syndrome, Xeroderma pigmentosum, X-linked encephalomyelitis These include: X-linked spinal and bulbar muscular atrophy (Fragile X syndrome), X-linked severe combined immunodeficiency (X-SCID), X-linked sideroblastic anemia (XLSA), 47,XXX (triple X syndrome), XXXX syndrome (48,XXXX), XXXXX syndrome (49,XXXXX), XXXXY syndrome (49,XXXXY), XYY syndrome (47,XYY), XXYY syndrome (48,XXYY), XYYY syndrome (48,XYYY), XXXY syndrome (48,XXXY), XYYYY syndrome (49,XYYYY), and Zellweger syndrome.

[0184] Genetic conditions include many lysosomal storage diseases, including, but not limited to, gangliosidoses (e.g., GM2 gangliosidosis (types A, O, AB) and GM1 gangliosidosis types 1, 2, and 3); Niemann-Pick disease A, B, and C; Gaucher disease types 1, 2, and 3; Fabry disease; metachromatic leukodystrophy; globoid leukodystrophy; multiple sulfatase deficiency; alpha-mannosidosis; Schindler disease; aspartylglucosaminuria; fucososis; and Hurler's disease. syndrome; Scheie syndrome; Hurler-Scheie syndrome; Hunter syndrome; Sanfilippo syndromes A, B, C, and D; Morquio syndromes A and B; Maroteaux-Lamy syndrome; Sly syndrome; Neurological ceroid lipofuscinosis; Galactosialidosis; Infantile sialic acid storage disease; Salla disease; Sialuria; Sialidosis I and II; I-cell disease; Pseudo-Hurler polydystrophy; Mucolibidosis IV; Lysosomal acid lipase deficiency; Pompe disease; Danon disease; Cystinosis, etc. Causative mutations in genetic lysosomal storage diseases, as well as the genes and defective enzymes associated with individual lysosomal storage diseases, are known and are described, for example, in Rajkumar & Dumpa. (2021) In: StatPearls. Treasure Island (FL): StatPearls Publishing (available at www.ncbi.nlm.nih.gov / books / NBK563270 / ).

[0185] Genetic conditions include many urea cycle disorders (UCDs). Non-limiting examples of UCDs include N-acetylglutamate synthase deficiency (NAGS deficiency), carbamoyl phosphate synthetase I deficiency (CPS1 deficiency), ornithine transcarbamylase deficiency (OTC deficiency), citrullinemia type I (ASS1 deficiency), argininosuccinic aciduria (ASL deficiency), arginase deficiency (hyperargininemia, ARG1 deficiency), ornithine translocase deficiency (ORNT1 deficiency, hyperornithinemic-hyperammonemia-homocitrullinuria syndrome), and citrin deficiency.

[0186] The treatments described herein may be performed chronically (i.e., continuously) or non-chronically (i.e., discontinuously) and may include administration of one or more agents chronically (i.e., continuously) or non-chronically (i.e., discontinuously). Chronic administration of one or more agents according to the methods described herein may be used in various cases, including, for example, when a subject has a chronic condition, including, for example, a chronic liver condition (e.g., chronic liver disease, cirrhosis, alcoholic liver disease, non-alcoholic fatty liver disease (NAFLD / NASH), chronic viral hepatitis, etc.), a chronic genetic liver condition (alpha 1-antitrypsin deficiency, hereditary hemochromatosis, Wilson's disease, etc.), a chronic liver-associated autoimmune condition (e.g., primary biliary cirrhosis (PBC), primary sclerosing cholangitis (PSC), autoimmune hepatitis (AIH), etc.), etc. Administration of one or more agents for a chronic condition may include, but is not limited to, administration of the agent for several months, a year or more, over several years. Such chronic administration may be on any convenient and suitable dosing schedule, including, but not limited to, daily, twice daily, weekly, twice weekly, monthly, twice monthly, etc. In some instances, for example, in the case of genetic conditions or other chronic gene therapies, the chronic condition may be treated by one or several (e.g., 2, 3, 4, or 5) treatments. Non-chronic administration of one or more agents may include, but is not limited to, administration for a month or less, for example, for a few weeks, a week, a few days, including a limited number of doses (e.g., less than 10 doses, e.g., 9 doses or less, 8 doses or less, 7 doses or less, etc., including a single dose).

[0187] The effective amount of a composition of therapeutic cells will depend, at least, on the particular method of use, the subject being treated, the severity of the affliction, the manner of administration of the composition, and the mechanism of action of the therapeutic cells. A "therapeutically effective amount" of a composition is that amount of a particular reagent, e.g., therapeutic cells, sufficient to achieve a desired effect in the subject being treated.

[0188] In some examples, the amount of genetically modified hepatocytes administered to a subject can include, for example, at least 10 million, at least 25 million, at least 50 million, at least 75 million, at least 100 million, at least 250 million, at least 500 million, at least 750 million, at least 1 billion, at least 2 billion, at least 3 billion, at least 4 billion, at least 5 billion, at least 6 billion, at least 7 billion, at least 8 billion, at least 9 billion, at least 10 billion, at least 15 billion, at least 20 billion, at least 30 billion, at least 40 billion, at least 50 billion, at least 60 billion, at least 70 billion, at least 80 billion, at least 90 billion, or at least 100 billion hepatocytes. The genetically modified hepatocytes can be delivered to a subject in need thereof in a single dose or multiple doses.

[0189] The specific dose level and dosing frequency for any particular subject may vary and will depend on a variety of factors, including the cellular activity of the composition, the cellular stability and length of action of the composition, the age, weight, general health, sex and diet of the subject, the mode and time of administration, combinations of co-administered drugs, and the severity of the symptoms of the host being treated.

[0190] The examples of treatments listed above should not be construed as limiting, and essentially any suitable treatment that produces the desired therapeutic outcome in a subject identified as described may be used.

[0191] Kits and Systems Aspects of the present disclosure also include kits and systems, and in some examples, devices for use therewith or therein. The kits and / or systems may, for example, include one or more of any of the components described above with respect to the compositions and methods of the present disclosure. The kits and / or systems may be configured for use in the methods described herein. The encoded elements may be provided separately, e.g., as separate polypeptide-encoding polynucleotides, or may be combined, where appropriate, e.g., as a single polynucleotide encoding two or more separate polypeptides or non-encoding nucleic acids. Thus, multiple encoded components may be provided on a single or multiple vectors, including, for example, where such multiple encoded components are under the control of shared (e.g., a single or a set of) or separate (e.g., or individual or a set of separate) regulatory elements. The agents may be in separate containers or may be combined in a shared container according to any described or suitable combination. Useful containers include vials, tubes, syringes, bottles, bags, ampoules, and the like. In some embodiments, useful kits may further include a device.

[0192] In some examples, the kits and / or systems of the present disclosure may include one or more modification reagents, such as one or more reagents for genetic modification of cells (e.g., one or more gene editing compositions, one or more transgene reagents, etc.).

[0193] In some examples, the kit and / or system may include a vector, such as, for example, a vector that includes a transgene encoding a gene product. Useful vectors may be integrating or non-integrating. In some examples, the vector used may be an integrating vector, which is sufficient for functional integration of the transgene into hepatocytes or their progenitor cells. In some examples, the kit and / or system may include an editing composition, such as, for example, where the editing composition is sufficient to cause HLA class I deficiency in hepatocytes or their progenitor cells. In some examples, the kit and / or system may be configured to modify hepatocytes or progenitor cells, for example, through a specific configuration of the kit and / or system components (such as containers, design elements, instructions, instructions on an internet-accessible medium, etc., and / or combinations thereof). Such a specific configuration may guide a user to use the kit components, such as one or more modification reagents provided in the kit, to generate genetically modified hepatocytes and / or their progenitor cells, and to grow the resulting genetically modified cells, for example, in a bioreactor. In some examples, the kits may include components and / or instructions for storage and / or preparation of the genetically modified cells, such as for transport to a facility where the cells may be expanded, such as in an in vivo bioreactor. In some examples, the kits may include an editing composition comprising a non-viral vector, such as, for example, LNP, including, for example, where the vector is sufficient to create an HLA class I deficiency. In some examples, the kits may include one or more reagents for cryopreservation of the genetically modified hepatocytes and / or their progenitors, including where such cryopreservation occurs before and / or after expansion of the genetically modified hepatocytes.

[0194] In addition to the above components, the kits and systems may further include (in certain embodiments) instructions for carrying out the methods. These instructions may be present in the kit and / or provided with the system in a variety of forms, one or more of which may be present in the kit and / or provided with the system. One form in which these instructions may be present is printed information on a suitable medium or substrate (e.g., one or more sheets of paper on which the information is printed), in the kit and / or system packaging, package insert, etc. Yet another form in which these instructions may be present is a computer readable medium on which the information is recorded, such as a diskette, compact disc (CD), flash drive, etc. Yet another form in which these instructions may be present is a website address that may be used via the Internet to access the information at a remote location.

[0195] Regardless of the scope of the appended claims, the present disclosure is also defined by the following embodiments. 1. A method for producing hypoimmunogenic hepatocytes or their precursor cells, the method comprising: contacting a cell population comprising human hepatocytes or their progenitors with an edited composition under conditions sufficient to cause human leukocyte antigen (HLA) class I deficiency in the hepatocytes or their progenitors; contacting the cell population with a transgene encoding at least one NK cell decoy receptor under conditions sufficient for expression of the transgene by the hepatocytes or their progenitor cells; Thereby generating a population of hypoimmunogenic hepatocytes or their progenitor cells. 2. The method of embodiment 1, wherein the editing composition is a beta2-microglobulin (B2M) editing composition. 3. The method of embodiment 1 or 2, wherein the human hepatocytes or their progenitor cells are primary human hepatocytes. 4. The method according to any one of embodiments 1 to 3, further comprising introducing the generated population of low immunogenic hepatocytes or their progenitor cells into a bioreactor. 5. The method of embodiment 4, wherein the bioreactor is an in vivo bioreactor, and the in vivo bioreactor is maintained under conditions sufficient to produce an expanded population of hypoimmunogenic hepatocytes, and optionally, the in vivo bioreactor is a mouse, a rat, or a pig. 6. The method of any one of embodiments 1-6, further comprising expanding human hepatocytes or progenitor cells thereof in a bioreactor and extracting the cells from the bioreactor after expansion to obtain a cell population comprising human hepatocytes or progenitor cells thereof, optionally wherein the bioreactor is a mouse, a rat, or a pig. 7. The method of embodiment 6, wherein the human hepatocytes or progenitor cells thereof expanded in the bioreactor are primary human hepatocytes. 8. The method of any one of embodiments 1 to 7, wherein the cell population is contacted with the editing composition and the introduced gene simultaneously. 9. The method of any one of embodiments 1 to 7, wherein the cell population is contacted with the editing composition prior to contact with the transgene, and optionally, hepatocytes or progenitor cells thereof of the cell population are expanded between contact with the editing composition and contact with the transgene. 10. The method of any one of embodiments 1 to 7, wherein the cell population is contacted with an introduced gene prior to contact with the editing composition, and optionally, hepatocytes or progenitor cells thereof of the cell population are expanded between contact with the introduced gene and contact with the editing composition. 11. The method of any one of embodiments 1-10, wherein at least one NK cell decoy receptor comprises CD47, a B2M-HLA-E fusion, or a combination thereof. 12. The method of any one of embodiments 1-11, wherein contacting the cell population with the transgene comprises contacting the cell population with an integrating vector comprising the transgene, and optionally, the integrating vector is a lentiviral vector. 13. The method of any one of the preceding claims, wherein the editing composition comprises a CRISPR-Cas protein or a polynucleotide encoding a CRISPR-Cas protein, and a guide RNA (gRNA) or a polynucleotide encoding a gRNA. 14. The method of any one of embodiments 1-13, wherein contacting with the editing composition comprises contacting the cell population with a vector comprising a reagent sufficient to disrupt the B2M locus in the hepatocytes or progenitor cells, optionally wherein the vector is a non-viral vector, and optionally wherein the non-viral vector is a lipid nanoparticle (LNP). 15. Vector is encoding the Cas9 protein and a guide RNA (gRNA) that targets the B2M locus; or 15. The method of embodiment 14, comprising a ribonucleoprotein (RNP) comprising the Cas9 protein and the gRNA. 16. The method of any one of embodiments 1 to 15, further comprising contacting the cell population with an HLA class II targeting composition under conditions sufficient to cause HLA class II deficiency in the hepatocytes or progenitor cells. 17. The method of embodiment 16, wherein the HLA class II targeting composition comprises an editing composition that, under sufficient conditions, edits a locus encoding a transcription factor or coactivator that causes expression of an HLA class II gene. 18. The method of embodiment 17, wherein the HLA class II targeting composition comprises a class II major histocompatibility complex transactivator (CIITA) editing composition that edits the CIITA locus. 19. The method of embodiment 18, wherein the CIITA editing composition comprises a CRISPR-Cas protein or a polynucleotide encoding a CRISPR-Cas protein and a gRNA targeting the CIITA locus or a polynucleotide encoding this gRNA. 20. The method of any one of embodiments 17-19, wherein contacting with the editing composition comprises contacting the cell population with a vector comprising a reagent sufficient to disrupt a genetic locus encoding a transcription factor or coactivator, optionally wherein the vector is a non-viral vector, and optionally wherein the non-viral vector is a lipid nanoparticle (LNP). 21. Vector is encoding the Cas9 protein and a guide RNA (gRNA) that targets the locus; or 21. The method of embodiment 20, comprising an RNP comprising a Cas9 protein and a gRNA. 22. The method according to any one of the preceding embodiments, further comprising cryopreserving the generated hypoimmunogenic hepatocytes or their precursor cells. 23. A method of treating a condition in a subject, comprising: A method comprising administering to a subject an effective amount of hypoimmunogenic hepatocytes or progenitor cells, wherein the hypoimmunogenic hepatocytes or progenitor cells, respectively, comprise an HLA class I deficiency and an introduced gene encoding at least one NK cell decoy receptor, and optionally, the condition is a hepatic condition. 24. The method of embodiment 23, wherein the subject has a contraindication to immunosuppression. 25. The method according to embodiment 23 or 24, wherein the hypoimmunogenic hepatocytes or their precursor cells are generated according to the method according to any one of embodiments 1 to 22. 26. A non-human mammal comprising a transplanted cell population, the cell population comprising a plurality of hypoimmunogenic human hepatocytes or progenitor cells thereof, each of the plurality of hepatocytes or progenitor cells comprising an HLA class I deficiency and a transgene encoding at least one NK cell decoy receptor. 27. The non-human mammal of embodiment 26, wherein the transplanted cell population is an allogeneic or xenogeneic cell population with respect to the non-human mammal. 28. The non-human mammal according to embodiment 26 or 27, wherein the non-human mammal is an in vivo bioreactor, optionally wherein the in vivo bioreactor is a mouse, a rat, or a pig. 29. A non-human mammal according to any one of embodiments 26 to 28, wherein the low immunogenic human hepatocytes or their precursor cells are primary human hepatocytes. 30. A non-human mammal according to any one of embodiments 26 to 29, wherein the HLA class I deficiency comprises a B2M deficiency. 31. A non-human mammal according to any one of embodiments 26 to 30, wherein at least one NK cell decoy receptor comprises CD47, a B2M-HLA-E fusion, or a combination thereof. 32. The non-human mammal of any one of embodiments 26 to 31, wherein each of the plurality of hepatocytes or progenitor cells further comprises an HLA class II deficiency, optionally, the HLA class II deficiency comprises a deficiency in a transcription factor or coactivator that causes expression of an HLA class II gene, and optionally, the transcription factor or coactivator is CIITA. 33. A population of hepatocytes or their progenitor cells, comprising an expanded population of hypoimmunogenic human hepatocytes or their progenitor cells isolated from a non-human mammal according to any one of embodiments 26 to 32. 34. The population of hepatocytes or their progenitor cells according to embodiment 33, wherein the population of hepatocytes or their progenitor cells is cryopreserved. 35. A cell population comprising a plurality of low immunogenic primary human hepatocytes, each of the plurality of hepatocytes comprising an HLA class I deficiency and a transgene encoding at least one NK cell decoy receptor. 36. The cell population of embodiment 35, wherein the HLA class I deficiency comprises a B2M deficiency. 37. The cell population of embodiment 35 or 36, wherein at least one NK cell decoy receptor comprises CD47, a B2M-HLA-E fusion, or a combination thereof. 38. The cell population of any one of embodiments 35-37, wherein each of the plurality of hepatocytes further comprises an HLA class II deficiency, and optionally, the HLA class II deficiency comprises a deficiency in a transcription factor or coactivator that causes expression of an HLA class II gene, and optionally, the transcription factor or coactivator is CIITA. 39. A method for producing genetically modified human hepatocytes, the method comprising: contacting a cell population comprising human hepatocytes or progenitor cells thereof with an integration vector comprising a transgene encoding a gene product under conditions sufficient for functional integration of the transgene to produce genetically modified hepatocytes or progenitor cells thereof comprising the integrated transgene; transplanting the genetically modified hepatocytes or progenitor cells thereof into an in vivo bioreactor and maintaining the in vivo bioreactor under conditions sufficient for proliferation of the genetically modified hepatocytes or progenitor cells to generate an expanded population of genetically modified human hepatocytes that express the gene product, optionally wherein the in vivo bioreactor is a mouse, rat, or pig. 40. The method of embodiment 39, wherein the human hepatocytes or progenitor cells thereof are primary human hepatocytes. 41. The method of embodiment 39 or 40, further comprising cryopreserving the expanded population of genetically modified human hepatocytes. 42. The transgenes are copper-transporting ATPase 2 (ATP7B), hereditary hemochromatosis protein (HFE), hemojuvelin, hepcidin (HAMP), transferrin receptor protein 2 (TFR2), solute carrier family 40 member 1 (SLC40A1), factor IX, factor VIII, von Willebrand factor, carbamoyl phosphate synthase (CPS1), N-acetylglutamate synthase (NAGS), ornithine transcarbamylase (OTC), α-galactosidase A gene (GLA), phenylalanine hydroxylase enzyme (PAH), and α-galactosidase B gene (GLA). ), arginase (ARG), alpha 1-antitrypsin (AAT), fumarylacetoacetate hydrolase (FAH), argininosuccinate lyase (ASL), argininosuccinate synthase (ASS), ornithine translocase (ORNT1), citrine, UDP-glucuronosyltransferase 1A1 (UGT1A1), transthyretin (TTR), serine-pyruvate aminotransferase (AGXT), complement factor H (CFH), and combinations thereof. The method of any one of embodiments 39 to 41, wherein the gene product is selected from the group consisting of: 43. A method of treating a condition in a subject, comprising: A method comprising administering to a subject an effective amount of genetically modified human hepatocytes produced according to the method of any one of embodiments 39 to 42. 44. The method of embodiment 43, wherein the condition is a liver condition. 45. The method of embodiment 43 or embodiment 44, wherein the condition is a genetic disease, optionally a monogenic disease. 46. ​​The method of embodiment 45, wherein the condition is factor VIII deficiency and the transgene encodes factor VIII. 47. The method of embodiment 46, wherein the condition is hemophilia A. 48. The method of embodiment 45, wherein the condition is factor IX deficiency and the transgene encodes factor IX. 49. The method of embodiment 48, wherein the transgene encodes Padua variant factor IX. 50. The method of embodiment 48 or 49, wherein the condition is hemophilia B. 51. The method of any one of embodiments 46 to 50, further comprising modulating coagulation in the subject. 52. The method of embodiment 43, wherein the condition is a urea cycle disorder (UCD) and the transgene encodes one or more urea cycle polypeptides. 53a. The method of embodiment 52, wherein the introduced gene encodes one or more urea cycle polypeptides that are rate-limiting in the metabolism of nitrogenous waste products. 53b. The method of embodiment 43, wherein the condition is a lysosomal storage disease, optionally Fabry disease, and the transgene encodes an enzyme associated with the lysosomal storage disease, optionally an α-galactosidase A polypeptide. 54. A non-human mammal comprising a transplanted cell population, the cell population comprising a plurality of genetically modified human hepatocytes, each of the plurality of hepatocytes comprising a functionally integrated transgene encoding a gene product. 55. The non-human mammal of embodiment 54, wherein the transplanted cell population is an in vivo expanded cell population, and the non-human mammal further comprises hepatocytes progeny of the genetically modified human hepatocytes. 56. The non-human mammal of embodiment 54 or 55, wherein the genetically modified human hepatocytes further comprise an HLA class I deficiency and a transgene encoding at least one NK cell decoy receptor. 57. The non-human mammal of embodiment 56, wherein each of the plurality of hepatic cells further comprises an HLA class II deficiency, optionally, the HLA class II deficiency comprises a deficiency in a transcription factor or coactivator that causes expression of an HLA class II gene, and optionally, the transcription factor or coactivator is CIITA. 58. The transgenes include copper transporting ATPase 2 (ATP7B), hereditary hemochromatosis protein (HFE), hemojuvelin, hepcidin (HAMP), transferrin receptor protein 2 (TFR2), solute carrier family 40 member 1 (SLC40A1), factor IX, factor VIII, von Willebrand factor, carbamoyl phosphate synthase (CPS1), N-acetylglutamate synthase (NAGS), ornithine transcarbamylase (OTC), α-galactosidase A gene (GLA), phenylalanine hydroxylase enzyme (PAH), The non-human mammal according to any one of embodiments 54 to 57, encoding a gene product selected from the group consisting of arginase (ARG), alpha 1-antitrypsin (AAT), fumarylacetoacetate hydrolase (FAH), argininosuccinate lyase (ASL), argininosuccinate synthase (ASS), ornithine translocase (ORNT1), citrine, UDP-glucuronosyltransferase 1A1 (UGT1A1), transthyretin (TTR), serine-pyruvate aminotransferase (AGXT), complement factor H (CFH), and combinations thereof. 59. A non-human mammal according to any one of embodiments 54 to 58, wherein the non-human mammal is an in vivo bioreactor. 60. The non-human mammal of embodiment 59, wherein the in vivo bioreactor is a rodent. 61. The non-human mammal of embodiment 59, wherein the rodent in vivo bioreactor is a rat in vivo bioreactor. 62. The non-human mammal of embodiment 59, wherein the in vivo bioreactor is a pig. 63. A non-human mammal according to any one of embodiments 60 to 62, wherein the rodent in vivo bioreactor is deficient in interleukin 2 receptor subunit gamma (IL2rg), recombination activating gene 1 (RAG1), recombination activating gene 2 (RAG2), or a combination thereof. 64. A non-human mammal according to any one of embodiments 60 to 63, wherein the rodent in vivo bioreactor is deficient in fumarylacetoacetate hydrolase (FAH). 65. A non-human mammal according to any one of embodiments 54 to 62, wherein the genetically modified human hepatocytes are modified primary human hepatocytes. 66. A population of hepatocytes or their progenitor cells, comprising an expanded population of genetically modified human hepatocytes isolated from a non-human mammal according to any one of embodiments 54 to 65. 67. A population of hepatocytes or their progenitor cells according to embodiment 66, wherein the population of hepatocytes is cryopreserved. 68. A population of hepatocytes or their progenitor cells according to embodiment 66 or 67, wherein the population comprises 100 to 20 billion hepatocytes or their progenitor cells. 69. A population of hepatocytes or their progenitor cells according to any one of embodiments 66 to 68, wherein the hepatocytes or their progenitor cells are present in a container, and optionally the container is a culture vessel, a tube, a flask, a vial, a cryovial, or a cryobag. 70. A cell population comprising a plurality of low immunogenic primary human hepatocytes, each of the plurality of hepatocytes comprising an HLA class I deficiency and a transgene encoding at least one NK cell decoy receptor. 71. The cell population of embodiment 70, comprising between 7.11 billion and 20 billion low immunogenic primary human hepatocytes. 72. The cell population of embodiment 70 or embodiment 71, wherein the cell population is present in a container, optionally wherein the container is a culture vessel, a tube, a flask, a vial, a cryovial, or a cryobag. 73. A method for producing a plurality of hepatocyte therapeutic doses, the method comprising: (1a) genetically modifying human hepatocytes and expanding the genetically modified human hepatocytes in one or more in vivo bioreactors to generate an expanded population of genetically modified human hepatocytes; or (1b) genetically modifying the expanded human hepatocytes obtained from the one or more in vivo bioreactors to generate an expanded population of genetically modified human hepatocytes; (2) dividing the expanded population of genetically modified human hepatocytes of 1a or 1b into a plurality of hepatocyte therapeutic doses. 74. The method of embodiment 73, wherein the plurality comprises at least 10 administrations of at least 1 billion hepatocytes each, optionally at least 10 administrations of at least 10 billion hepatocytes each, optionally at least 100 administrations of at least 1 billion cells each. 75. The method of embodiment 73 or 74, wherein the human hepatocytes are derived from a single human liver. 76. A method of treating a plurality of subjects having a condition, the method comprising: Producing a plurality of hepatocyte therapeutic doses according to any one of embodiments 73 to 75; administering one or more doses of the plurality to each of the subjects to treat the subjects for the symptom. 77. The method of embodiment 76, wherein the plurality of subjects includes at least 10 subjects, optionally at least 100 subjects. 78. The method of embodiment 76 or 77, wherein each of the multiple subjects is treated for the same condition. 79. The method of embodiment 76 or 77, wherein two or more of the subjects are treated for different conditions. 80. A kit or system comprising: One or more modifying reagents, a vector comprising a transgene encoding a gene product, the vector being sufficient for functional integration of the transgene into hepatocytes or their precursor cells; and / or one or more modification reagents comprising an editing composition sufficient to generate HLA class I deficiency in hepatocytes or their progenitor cells; Optionally, a kit or system comprising: instructions for modifying hepatocytes or their progenitor cells using one or more modification reagents to generate genetically modified hepatocytes or their progenitor cells; and growing the genetically modified cells in a bioreactor. 81. The kit or system of embodiment 80, wherein the vector is an integrating vector sufficient for functional integration of the transgene into hepatocytes or their precursor cells. 82. The kit or system of embodiment 80 or 81, wherein the editing composition comprises a non-viral vector, optionally LNP, sufficient to generate an HLA class I deficiency. 83. A kit or system according to any one of embodiments 80 to 82, further comprising one or more reagents for cryopreservation of genetically modified hepatocytes or their precursor cells. EXAMPLES

[0196] The following examples are presented to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention. They are not intended to limit the scope of what the inventors perceive as the invention. Unless otherwise indicated, parts are parts by weight, molecular weight is average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric.

[0197] General methods in molecular and cellular biochemistry can be found in standard textbooks such as Molecular Cloning: A Laboratory Manual, 4th Ed. (Sambrook et al., Cold Spring Harbor Laboratory Press 2012); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures of which are incorporated herein by reference. Reagents, antibodies, cells, tissue samples, etc., and kits referred to in this disclosure are available from commercial suppliers, such as, but not limited to, those identified herein.

[0198] Example 1: Generation of universal human hepatocytes Universal human hepatocytes were generated by ex vivo engineering of primary human hepatocytes (PHHs) to (1) be deficient in human leukocyte antigen (HLA) class I, thereby blocking recognition by cytotoxic T cells (CTLs) in vivo, and (2) express a decoy receptor for NK cells, thereby inhibiting killing by natural killer (NK) cells in vivo. HLA class I deficiency was achieved by CRISPR / Cas9 targeted knockout of β2-microglobulin (B2M), and NK cell decoy receptor expression was achieved by transduction with lentiviral vectors carrying transgenes encoding either CD47 or a B2M-HLA-E fusion construct.

[0199] Various methods for delivering gene editing reagents to PHHs were employed and evaluated. These include, but are not limited to, the production of Cas9 and synthetic chemically modified gRNA (Synthego) containing ribonucleoprotein (RNP) delivered to cells by transfection or nucleofection. For example, RNP transfection was performed using the CRISPRMAX™ Cas9 System (ThermoFisher Scientific) according to the manufacturer's instructions. Briefly, TrueCut™ Cas9 Protein v2 (ThermoFisher Scientific) and synthetic chemically modified sgRNA (Synthego) were complexed into RNPs and then added directly to freshly thawed PHHs with CRISPRMAX™ reagent, then rocked in a 37°C incubator for 2 hours. RNP nucleofection was performed on a Lonza 4D-Nucleofector™ X Unit using the P3 Primary Cell 4D-Nucleofector Kit according to the manufacturer's instructions.

[0200] An exemplary gRNA sequence targeting exon 1 of the B2M locus used in this example is as follows: [Table 1]

[0201] As a control, an unrelated safe harbor locus, AAVS1, was targeted using the same CRISPR / Cas9 system as above, but with an AAVS1-targeting gRNA with the following sequence: [Table 2]

[0202] After editing, cells subjected to nucleofection or transfection protocols were transduced with lentiviral vectors (LVV) containing either CD47 or B2M-HLA-E fusion transgenes for 2 hours with rocking at 37° C. The sequences of the transgenes used are as follows: [Table 3]

[0203] A negative control mock transduction was also performed with 2 h rocking without the addition of LVV, allowing assessment of B2M or control locus editing in the absence of LVV transduction.

[0204] Editing efficiency was evaluated at the targeted B2M locus or the AAVS1 control locus. Briefly, genomic DNA (gDNA) was extracted from cell samples and the regions of interest were PCR amplified. The amplified DNA was sequenced by Sanger sequencing and the resulting reads were subjected to Tracking Indels by Degradation (TIDE) analysis. The resulting protein expression levels of B2M and / or expressed transgenes in cells subjected to either targeted editing or control editing were assessed by flow cytometry using anti-HLA-ABC, anti-HLA-E, and / or anti-CD47 specific antibodies.

[0205] As shown in Figure 1, editing efficiencies of 80% or greater, as measured by indels (left y-axis, black bars) or knockout (KO) scores (left y-axis, grey bars), were observed at both the B2M target locus and the AAVS1 control locus, respectively. Editing efficiencies with B2M exon 1 targeting reagent alone ("B2Mex1-7 RNP only") or control gene coordinate targeting reagent alone ("AAVS1 RNP only") were similar to those observed when NK cell decoy receptor LVV transduction, i.e., B2M-HLA-E fusion ("B2Mex1-7 HLA-E", "AAVS1 HLA-E") or CD47 ("B2Mex1-7 CD47", "AAVS1 CD47"), were included. Furthermore, the percentage of B2M-negative cells ("B2M-") measured by flow cytometry (right y-axis, red dots) showed that at least 80% of cells in the B2M edited samples ("B2Mex1-7 HLA-E", "B2Mex1-7 CD47", and "B2Mex1-7 RNP only") did not express B2M protein. In comparison, less than 30%, and in some cases less than 20%, of cells in the AAVS1 control samples ("AAVS1 HLA-E", "AAVS1 CD47", and "AAVS1 RNP only") were B2M-negative. These data demonstrate the successful production of B2M-negative PHHs by the described editing process, achieving high editing efficiency and specificity of B2M KO at both the genome and protein levels.

[0206] In addition to B2M KO, the expression of the introduced NK decoy receptor transgene, CD47 and HLA-E were also evaluated in treated PHH. The results of flow cytometry analysis of both B2M negativity and HLA-E or CD47 expression in the aforementioned groups ("B2Mex1-7 HLA-E", "B2Mex1-7 CD47", "B2Mex1-7 RNP only", "AAVS1 HLA-E", "AAVS1 CD47", "AAVS1 RNP only") are shown in Figure 2. As shown, in the groups subjected to both B2M targeted editing and decoy receptor transduction, high levels of cells negative for B2M and positive for decoy receptor expression ("%B2M- / HLA-E" or "%B2M- / CD47+") were observed. Correspondingly, low levels of B2M negativity were observed in the control editing reactions ("AAVS1 HLA-E", "AAVS1 CD47", "AAVS1 RNP only") and decoy receptors were essentially absent in reactions not treated with LVV ("B2Mex1-7 RNP only", "AAVS1 RNP only"). These data demonstrate the successful and efficient generation of PHHs that are B2M negative and express one of two different NK cell decoy receptors.

[0207] In addition, these data demonstrate that the above approaches result in populations of PHHs containing greater than 50%, and in some cases at least 60%, at least 70%, or at least 80% doubly engineered PHHs that express NK cell decoy receptors but lack HLA class I. Such percentages are not believed to be limiting, and thus populations with greater than 80% doubly engineered hepatocytes can be readily achieved by these and other methods described herein.

[0208] Example 2: Dual engineered primary human hepatocytes that are less immunogenic Doubly engineered PHHs with B2M KO and expressing either CD47 or B2M-HLA-E fusion transgenes were produced essentially as described above. Doubly engineered cells were mixed with various immune cell compositions at various ratios and survival assays were performed. Briefly, engineered cells were mixed with immune cells, including cytotoxic T lymphocytes (CTL) and natural killer (NK) cells, which are activated by cytokine stimulation and have strong effector functions, and the survival (i.e., viability) of the doubly engineered cells was evaluated over time.

[0209] For example, survival in 2:1 immune cell to target cell co-cultures was assessed for four different target cell groups: (1) double engineered B2M exon 1 KO+B2M-HLA-E transgene cells, (2) double engineered B2M exon 1 KO+CD47 transgene cells, (3) single engineered B2M exon 1 KO RNP only cells, and (4) AAVS1 RNP only control cells. Immune cells included a mixture of effector cells generated primarily from CTLs, and survival was assessed by a quantitative imaging-based cell viability assay over 72 hours. Substantial increases in survival were observed in all B2M knockout (B2M-; groups 1, 2, 3) PHHs over all time points (24 hours, 48 ​​hours, and 72 hours) compared to the control group (4).

[0210] In another example, survival in 2:1 immune cell to target cell co-cultures, where the immune cell mixture contained primarily NK cells, was evaluated for four different groups of target cells: (1) double engineered B2M exon 1 KO+B2M-HLA-E transgene cells, (2) double engineered B2M exon 1 KO+CD47 transgene cells, (3) single engineered B2M exon 1 KO RNP only cells, and (4) AAVS1 RNP only control cells. Both double engineered groups (1) and (2) showed increased levels of survival over the 24, 48, and 72 hour time points compared to the control group (4), whereas the single engineered group (3) showed decreased survival compared to the control group due to increased "non-self recognition" by NK cells caused by the B2M knockout.

[0211] These data show that PHHs dually engineered to be B2M negative and express an NK cell decoy receptor transgene undergo reduced immune cell killing compared to the levels of immune cell killing seen in unengineered cells and cells engineered with B2M KO alone. Collectively, these assays demonstrate that engineering HLA class I deficiency and NK cell decoy receptor expression into PHHs generates hypoimmunogenic PHHs that exhibit increased survival in the presence of activated immune effector cell populations, including populations containing activated CTL and NK cell subpopulations.

[0212] Example 3: Liver repopulation with hypoimmunogenic engineered primary human hepatocytes Engineered PHHs were generated by CRISPR / Cas9 KO of B2M via RNP transfection or nucleofection, with or without LVV transgene transduction, essentially as described above. Four different groups of engineered cells, (1) Cas9 B2M KO RNP via transfection, (2) Cas9 B2M KO RNP via transfection + LVV, (3) Cas9 B2M KO RNP via nucleofection, and (4) Cas9 B2M KO RNP via nucleofection + LVV, were cultured at 5 × 10 per animal.5 Viable cells were separately transplanted into recipient FRGN mice via intrasplenic injection. To introduce selection pressure and promote engraftment of transplanted cells, animals were cycled with NTBC. As a surrogate for engraftment and proliferation of transplanted engineered PHHs, human albumin levels (hALB) were assessed at 2, 4, and 8 weeks post-transplantation.

[0213] Levels of hALB were observed to increase in all groups across all three time points, indicating that engineered cells from all groups (1)-(4) were able to engraft and expand in recipient animals. Furthermore, hALB levels were comparable between transfection and nucleofection modes of RNP delivery at corresponding time points, indicating that either delivery method of editing constructs can be successfully used to generate functional engineered PHHs capable of liver engraftment and repopulation. In addition, the representation of cells with the desired engineered features (i.e., B2M KO, HLA-E transgene expression, or both KO and transgene expression) in the input population (i.e., ex vivo engineered PHHs used for transplantation into the FRGN bioreactor) was compared to the output population (i.e., hepatocytes purified from the repopulated FRGN bioreactor following in vivo expansion). Figures 3A-D provide the percent of desired engineered cells (generated using transfection or nucleofection) from the input and output populations that were measured as having B2M KO by DNA analysis (Figure 3A), B2M KO by flow cytometry analysis (Figure 3B), HLA-E transgene expression by flow cytometry analysis (Figure 3C), and dual modification (i.e., both B2M KO and transgene expression) by flow cytometry analysis (Figure 3D). Samples from untreated control (NTC) animals (i.e., animals transplanted with unmodified PHH) were also evaluated in parallel. As shown, these comparisons revealed a strikingly similar presentation of the desired engineered cells between the input and output populations, with comparable engraftment, proliferation, and repopulation kinetics between engineered and unmodified hepatocytes. In addition, at the end of the study (24 weeks post-transplant), host FRGN livers transplanted with engineered PHHs showed similar levels of repopulation and humanization (as measured by liver immunohistochemistry for FAH and hAlb ELISA) compared with NTC animals that received unmodified PHHs.For example, two representative animals transplanted with engineered cells demonstrated 89.76% and 89.54% FAH+ cell repopulation and hAlb levels of 12,489 μg / mL and 11,615 μg / mL, compared to 90.81% FAH+ cells and 11,607 μg / mL hAlb observed in a representative NTC animal.

[0214] Taken together, these data show that the low immunogenic PHHs engineered with genome editing and / or transgenes incorporated according to the methods described herein, as well as PHHs in general, are functional and can repopulate recipient livers.Such repopulation was observed to occur with kinetics comparable to non-edited / non-modified cells, indicating that the hepatocytes engineered in this way and their progeny persist in the host liver.Thus, any edited or transgene engineered universal hepatocytes and hepatocytes in general as described herein can be transplanted into an in vivo bioreactor and successfully propagated, or transplanted into a subject for therapeutic purposes, for example.

[0215] Example 4: Transgenic engineered PHHs that engraft, proliferate, and produce physiologically relevant amounts of a therapeutic transgene product in vivo In vivo FRG rat expanded human hepatocytes (huFRG) were isolated and cryopreserved. For cryopreservation, the hepatocyte cell suspension was aliquoted into containers and pelleted by centrifugation. The cell pellet was gently resuspended in cryopreservation medium under cryo-conditions to reach the desired final concentration (e.g., 10 million viable cells per mL) and the resuspended cells were maintained at 4-8 °C. Hepatocytes prepared for cryopreservation were aliquoted into freezing containers and frozen using a rate-controlled freezer. After rate-controlled freezing was completed, the cryopreserved hepatocytes were transferred to vapor-phase liquid nitrogen for storage. Cryopreserved huFRG hepatocytes were thawed and transduced via lentiviral vectors with expression cassettes encoding either human factor IX (i.e., F9 or FIX) or firefly luciferase (i.e., Luc) as a marker / control.

[0216] The lentiviral vector (LakePharma / Curia) F9 expression construct used in this example comprised an MND promoter (SEQ ID NO:001) operably linked to an F9 coding sequence (SEQ ID NO:002), encoding an F9 Padua variant polypeptide (SEQ ID NO:003), operably linked to a 3' LTR (SEQ ID NO:004).

[0217] The lentiviral vector (Imanis LV050L) Luc expression construct used in this example comprised an SFFV promoter (SEQ ID NO:005) operably linked to a Luc coding sequence (SEQ ID NO:006), encoding a Luc polypeptide (SEQ ID NO:007), and an EmGFP coding sequence (SEQ ID NO:008), encoding an EmGFP polypeptide (SEQ ID NO:009), operably linked to the 3'LTR (SEQ ID NO:004).

[0218] Following transduction, the transduced huFRG hepatocytes were transplanted into FRGN recipient mice via intrasplenic injection, and the mice were maintained under conditions sufficient for engraftment and proliferation of the transplanted huFRG hepatocytes. Subsequently, either mice transplanted with a lentiviral vector encoding F9 (hereafter, "LV-F9 mice") or mice transplanted with a lentiviral vector encoding luciferase (hereafter, "LV-Luc mice") were assayed for luciferase bioluminescence at various time points during proliferation of the transplanted cells within the host mouse liver using an IVIS live animal bioluminescence imaging system (PerkinElmer, Waltham, Massachusetts, USA). Figure 4 provides representative IVIS images of LV-F9 and LV-Luc mice at days 57-60, 85, and 97 post-transplantation, showing substantial bioluminescence in the LV-Luc mice, with increasing intensity at later time points. In this assay, LV-F9 mice serve as a useful negative control, since the LV-F9 vector does not encode luciferase and therefore no bioluminescence is expected to be detected in LV-F9 mice.

[0219] Bioluminescence measured by IVIS was quantified, and FIG. 5 provides such quantification (measured as total flux of photons per second (p / s)) for individual LV-F9 and LV-Luc mice at 57 or 60, 85, and 97 days post-transplant. Quantification confirms the qualitative observations described above, i.e., LV-Luc animals exhibited substantial bioluminescence compared to, for example, LV-F9 animals, and bioluminescence intensity was greater at later time points compared to earlier 57 or 60 day time points. Taken together, these findings demonstrate effective engraftment of transduced huFRG hepatocytes in host mice, and that the introduced transgene (in this case luciferase) was successfully and persistently expressed from the engrafted hepatocytes and / or their progeny for at least several months post-transplant.

[0220] Using a method similar to that described above, huFRG hepatocytes were transfected with the Padua variant of human F9, also known as the “R338L” substitution (Simioni, et al. N Engl J Med 2009;361:1671-5), which corresponds to the R384L substitution (wild-type UniProt P00740; RefSeq LV-F9 mice were transduced with a lentiviral vector containing an expression cassette encoding huFRG hepatocytes (NP_000124.1; compared to SEQ ID NO:010), which exhibits 8 times (8x) the normal physiological level of coagulation activity (see Lozier. Blood (2012) 120(23):4452-4453). 500,000 transduced huFRG hepatocytes were transplanted into FRGN recipient mice via intrasplenic injection, and the mice were maintained under conditions sufficient for the engraftment and proliferation of transplanted huFRG hepatocytes. Human albumin and human F9 levels were measured in blood samples collected from LV-F9 mice at various times after transplantation. Mice transplanted with huFRG hepatocytes transduced with LV-Luc were used as controls, and corresponding human albumin and human F9 measurements were collected from LV-Luc control animals.

[0221] Figure 6 provides the levels of xenogeneic human albumin (micrograms / milliliter, log scale) measured in peripheral blood samples from LV-F9 and LV-Luc mice collected at days 14, 28, 47, and 98 post-transplant. As can be readily seen, the levels of human albumin steadily increased in both cohorts, indicating similar levels of engraftment and proliferation of LV-F9 and LV-Luc huFRG engineered hepatocytes in their respective host livers. In addition, human albumin levels eventually reached levels consistent with at least 70-80% humanization by day 98, indicating robust in vivo engraftment and proliferation of ex vivo engineered hepatocytes.

[0222] FIG. 7 provides the levels of xenogeneic human F9 (nanograms / milliliter, log scale) measured in peripheral blood samples from LV-F9 and LV-Luc mice collected 14, 28, 47, and 98 days after transplantation. The lower limit of detection (LOD) of the assay is indicated by the horizontal dotted line. As a surrogate for evaluating the therapeutic potential of engineered huFRG hepatocytes in clinical deficiencies (e.g., as observed in monogenic diseases), the F9 levels corresponding to (1) the level required to achieve the desired therapeutic effect in F9-deficient human subjects (i.e., 5% of normal physiological levels, 250 ng / mL, "5% normal F9") or (2) normal physiological levels in human subjects (i.e., 100% of normal physiological levels, 5000 ng / mL, "100% normal F9") are also indicated by the horizontal dotted lines.

[0223] As can be readily seen in Figure 7, LV-F9 mice reached human F9 levels above the levels required for the desired therapeutic effect at least as early as the first time point assessed after transplantation (i.e., day 14). Furthermore, LV-F9 mice reached human F9 levels above 100% of normal physiological levels by at least day 28 after transplantation. Such mice continued to exhibit supraphysiological levels of human F9 at all subsequent time points.

[0224] Taken together, these findings demonstrate that huFRG hepatocytes engineered ex vivo to express human F9 readily engraft, proliferate, and produce detectable levels of human F9 in recipient peripheral blood. Moreover, transplanted mice rapidly reached levels of human F9 in peripheral blood that corresponded to sufficient levels for therapeutic efficacy in human F9 deficiency. In addition, levels that corresponded to and even exceeded 100% of normal human physiological F9 levels were achieved and sustained until the last measured time point.

[0225] HuFRG hepatocytes transplanted into LV-Luc mice contain an endogenous human gene encoding factor IX. Thus, although these cells do not carry a heterologous F9 transgene like LV-F9 huFRG hepatocytes, Luc hepatocytes nevertheless express human F9 from the endogenous locus. Although the initial (i.e., 14 and 28 days after transplantation) levels of human F9 in peripheral blood collected from LV-Luc mice were below the LOD (see, e.g., FIG. 7), human F9 levels eventually reached significant levels at later time points after substantial expansion of huFRG cells in the host liver (as confirmed by measuring human albumin levels) (see, e.g., FIG. 7, LV-F9 d47 and d98). Compared to such human F9 production in LV-Luc mice, human F9 production in LV-F9 mice was substantially higher at each time point, indicating a more rapid attainment of therapeutic and physiological levels as well as an overall higher level at the final time point measured. For example, LV-F9 mice reached 100% of normal physiological levels of F9 by day 28, whereas LV-Luc mice did not reach 100% of normal physiological levels by day 98. Thus, these data indicate that the presence of the F9 transgene provides a significant advantage in both the onset and efficacy of the therapeutic effect.

[0226] FIG. 8 provides a plot of the human F9 levels measured in each animal at day 47 versus the corresponding human albumin levels in each animal. Reference levels for 0.1%, 1%, and 5% engraftment, and for 5% and 100% of normal physiological human F9, are shown as vertical and horizontal dotted lines, respectively. In all cases, when comparing mice with substantially similar levels of engraftment, mice receiving huFRG hepatocytes engineered ex vivo with the Padua F9 transgene had higher human F9 levels in peripheral blood compared to corresponding LV-Luc mice. Thus, the data further supports the higher level of F9 expression per cell in cells that received the F9 transgene, for example, compared to cells expressing F9 from an endogenous locus. Furthermore, this analysis demonstrates that engraftment of less than 1%, and even as low as 0.2%, of huFRG hepatocytes engineered ex vivo to express the human F9 transgene is sufficient to achieve both therapeutic and even normal physiological concentrations of human F9 in peripheral blood.

[0227] Figure 9 provides plots corresponding to Figure 8 for animals at day 96. Despite similar levels of engraftment in LV-Luc and LV-F9 animals (indicated by all data points being substantially similarly positioned on the x-axis), peripheral blood of LV-F9 animals contained approximately 60-fold (60x) more human F9 compared to peripheral blood from LV-Luc animals. Given this high level of expression of the Padua variant and enhanced clotting activity, LV-F9 mice exhibit 490-fold (490x) greater theoretical clotting activity than LV-Luc control animals.

[0228] Taken together, these data demonstrate the successful engraftment and proliferation of human hepatocytes engineered to contain and express a therapeutic transgene within a host liver. Moreover, these data demonstrate that the engraftment and proliferation of engineered hepatocytes carrying a transgene (regardless of the identity of the transgene) is at least comparable to the engraftment and proliferation seen in control cells that do not carry the transgene. Moreover, given the observed high levels of expression of therapeutic factors from transgene-engineered hepatocytes (e.g., compared to the corresponding expression of the relevant endogenous factor in unengineered cells), the engraftment and proliferation of such engineered hepatocytes provides for rapid achievement of therapeutically relevant levels of transgene expression product that increase and persist over time, including over several months, as described herein.

[0229] Example 5: Generation and expansion of factor IX engineered human hepatocytes for hemophilia B The following expression constructs were designed such that introduction into human hepatocytes would promote expression of a therapeutic transgene product by the engineered hepatocytes transplanted into a subject in need thereof, such as a human subject with factor IX deficiency, such as hemophilia B.

[0230] The F9 expression construct used in this example comprises a suitable promoter, such as, for example, the MND promoter (SEQ ID NO:001), operably linked to an F9 coding sequence, such as, for example, a full-length F9 coding sequence (SEQ ID NO:011), encoding a full-length F9 polypeptide (SEQ ID NO:010), a Padua variant F9 coding sequence (SEQ ID NO:002), encoding an F9 Padua variant polypeptide (SEQ ID NO:003), e.g., a suitable 3' sequence comprising a polyadenylation signal (polyA).

[0231] As will be readily appreciated, in some instances substitutions may be made in the above constructs including, for example, replacing the described promoter with another suitable promoter, replacing the transgene coding sequence with another coding sequence encoding the same transgene or a variant of the transgene, replacing the sequence 3' of the transgene with another 3' sequence (e.g., including an alternative polyA or other 3' moiety), etc. The expression constructs are introduced into a suitable lentiviral vector for transduction into hepatocytes.

[0232] Freshly isolated human hepatocytes or recently thawed cryopreserved hepatocytes are transduced with one of the above expression constructs. Useful freshly isolated human hepatocytes include those isolated from cadaver donor liver tissue, as well as those grown in an in vivo bioreactor and isolated from the in vivo bioreactor. Useful cryopreserved hepatocytes include those cryopreserved after isolation from cadaver donor liver tissue, as well as those cryopreserved after growth in an in vivo bioreactor and isolation from the in vivo bioreactor. Thus, transduction is performed before or after the growth of human hepatocytes in an in vivo bioreactor (such as a rodent bioreactor).

[0233] Human hepatocytes transduced with any of the above constructs may be otherwise unmodified, for example, if the introduction of the construct is the only genetic modification made. Alternatively, human hepatocytes transduced with any of the above constructs may be modified to include additional genetic modifications, such as hypoimmune (including, for example, hepatocytes made hypoimmune by a disruption at the HLA class I locus (such as the B2M locus) and the introduction of an NK cell decoy receptor transgene (such as a CD47, HLA-E, or B2M-HLA-E fusion transgene)). Contacting the human hepatocytes with a reagent for inducing hypoimmunity (e.g., a B2M editing composition and an NK cell decoy receptor transgene) may occur before, during, or after transduction with the above identified expression constructs.

[0234] If transduction is performed prior to hepatocyte expansion, the transduced hepatocytes are transplanted into one or more recipient rodent bioreactors (e.g., FRG rats, FRGN mice, etc.) via intrasplenic or portal vein injection, and the rodents are maintained under conditions sufficient for engraftment and proliferation of the transplanted engineered hepatocytes. After expansion in the bioreactor, the bioreactor liver is harvested and perfused to harvest an expanded population of engineered human hepatocytes. The harvested engineered human hepatocytes are processed by enrichment, purification, and / or isolation procedures. The resulting processed cell population is then prepared for delivery or cryopreserved for later delivery to a subject in need thereof.

[0235] If transduction is performed after expansion of the hepatocytes, the expanded hepatocytes are harvested from one or more rodent bioreactors and transduced with one of the constructs identified above (with or without cryopreservation at any convenient time point) before or after further processing for enrichment, isolation, purification and / or isolation of the desired hepatocytes. The resulting transduced and processed cell population is then prepared for delivery or cryopreserved for later delivery to a subject in need thereof.

[0236] The prepared population of engineered hepatocytes is formulated into a dosage formulation in a suitable delivery medium. The prepared dosage formulation is delivered to a subject in need thereof by a medically appropriate route, such as, for example, via intrasplenic or portal vein injection or infusion, to treat the subject for factor IX deficiency and hemophilia B.

[0237] Example 6: Generation and expansion of factor VIII engineered human hepatocytes for hemophilia A The feasibility of using the LVV approach to introduce an exogenous factor VIII (F8) transgene into primary human hepatocytes to generate F8 engineered hepatocytes, e.g., grown in an in vivo bioreactor before or after transgene transduction. As a first test, primary human hepatocytes were transduced ex vivo with commercially available LVV overexpressing human F8 (a non-optimized surrogate of the corresponding clinical construct) at various multiplicities of infection (MOI), and the cells were maintained in vitro. As a control, non-transduced primary human hepatocytes (i.e., untreated control, NTC) were maintained under the same in vitro culture conditions. Supernatants were collected from MOI2-transduced samples, MOI7-transduced samples, and NTC samples on days 4, 5, and 6 of culture, and F8 activity was measured using a commercially available kit (Chromogenix Coatest SP4 Factor VIII Kit; DiaPharma, West Chester, OH). After harvesting the supernatant on day 6 of culture, cells were harvested and lysed, and the cell lysates were also subjected to the F8 activity assay.

[0238] The amount of F8 activity in both MOI2 and MOI7 samples showed increasing activity across the 4, 5 and 6 day time points. In comparison, F8 activity in the NTC samples was at baseline at all three time points. By the 6 day time point, F8 activity measured in the MOI7 supernatant samples was at least 4x greater than the NTC baseline level. Importantly, detection of F8 activity indicates that exogenous F8 is being expressed and secreted by the engineered cells. Human F8 activity was correspondingly high in the day 6 cell lysates. These data demonstrate the ability to generate engineered human hepatocytes that overexpress human F8 and exhibit substantially higher F8 activity than corresponding unengineered human hepatocytes, even using a surrogate F8-LVV that is not optimized for transduction.

[0239] Having demonstrated the ability to generate F8-overexpressing human hepatocytes, the following improved expression constructs were designed for introduction into human hepatocytes to promote expression of a therapeutic transgene product by engineered hepatocytes transplanted into a subject in need thereof, e.g., a human subject with factor VIII deficiency such as hemophilia A.

[0240] The F8 expression construct used in this example comprises a suitable promoter, such as, for example, the MND promoter (SEQ ID NO:001), operably linked to an F8 coding sequence, such as, for example, a full-length F8 coding sequence (SEQ ID NO:012) encoding a full-length F8 polypeptide (SEQ ID NO:013), a B-domain deleted F8 (i.e., BDDrFVIII) coding sequence (SEQ ID NO:014) encoding a BDDrFVIII variant polypeptide (SEQ ID NO:015), a FVIII-Fc fusion protein (i.e., F8.Fc) coding sequence (SEQ ID NO:016) encoding an F8.Fc polypeptide (SEQ ID NO:017), etc., operably linked to a suitable 3' sequence, including, for example, a polyA signal.

[0241] Useful constructs include those that encode multiple polypeptides, such as an F8 polypeptide and a von Willebrand factor (vWF) polypeptide (e.g., a vWF Fc fusion (i.e., vWF.Fc SEQ ID NO:019) encoded by SEQ ID NO:018), including, for example, when such polypeptides are expressed from an F8 coding sequence operably linked to a vWF coding sequence via a 2A self-cleaving sequence (such as a furin and glycine-serine-glycine-containing 2A sequence, such as furin.GSG.T2A (SEQ ID NO:020) or furin.GSG.P2A (SEQ ID NO:021)). When multiple polypeptides, such as vWF and F8, are used, the coding sequences may be arranged in any order.

[0242] Useful expression cassette configurations include, for example, the following: [MND promoter]-[F8 full length]-[polyA], [MND promoter]-[F8 (B domain deleted)]-[polyA], [MND promoter]-[F8.Fc]-[Furin.GSG.T2A]-[VWF.Fc]-[PolyA], [MND promoter]-[VWF.Fc]-[furin.GSG.T2A]-[F8.Fc]-[polyA] etc.

[0243] As will be readily appreciated, in some instances substitutions may be made in the above constructs including, for example, replacing the described promoter with another suitable promoter, replacing the transgene coding sequence with another coding sequence encoding the same transgene or a variant of the transgene, replacing the sequence 3' of the transgene with another 3' sequence (e.g., including an alternative polyA or other 3' moiety), etc. The expression constructs are introduced into a suitable lentiviral vector for transduction into hepatocytes.

[0244] Hepatocytes are prepared, expanded, and transduced essentially as described in Example 5, substituting the above constructs for those described therein.

[0245] The prepared population of engineered hepatocytes is formulated into a dosage formulation in a suitable delivery medium. The prepared dosage formulation is delivered to a subject in need thereof by a medically appropriate route, such as, for example, via intrasplenic or portal vein injection or infusion, to treat the subject for factor VIII deficiency and hemophilia A.

[0246] Example 7: Generation and proliferation of human hepatocytes engineered with urea cycle genes for urea cycle disorders (UCDs) The following expression constructs were designed such that introduction into human hepatocytes would promote expression of a therapeutic transgene product (or multiple transgene products) by the engineered hepatocytes transplanted into a subject in need thereof, e.g., a human subject with UCD.

[0247] The expression constructs used in this example comprise a suitable promoter, such as, for example, the MND promoter (SEQ ID NO: 001), operably linked to one or more urea cycle genes, such as urea cycle genes that are rate limiting in the metabolism of nitrogenous waste products, operably linked to a suitable 3' sequence, e.g., including a polyA signal.

[0248] Useful sequences encoding urea cycle genes include, for example: For example, a codon-optimized CPS1 coding sequence (SEQ ID NO: 022) encoding a CPS1 polypeptide (SEQ ID NO: 023), a carbamoyl phosphate synthase (CPS1) coding sequence, such as a codon-optimized NAGS coding sequence (SEQ ID NO: 024) encoding a NAGS polypeptide (SEQ ID NO: 025), an N-acetylglutamate synthase (NAGS) coding sequence, such as a codon-optimized OTC coding sequence (SEQ ID NO: 026) encoding an OTC polypeptide (SEQ ID NO: 027), an ornithine transcarbamylase (OTC) coding sequence, and the like.

[0249] Useful constructs include those that encode multiple polypeptides, such as, for example, CPS1 and NAGS, CPS1 and OTC, NAGS and OTC, or CPS1, NAGS, and OCT, including, for example, where such polypeptides are expressed from a first coding sequence operably linked to a second coding sequence via a 2A self-cleaving sequence (such as a furin and glycine-serine-glycine containing 2A sequence, such as furin.GSG.T2A (SEQ ID NO:020) or furin.GSG.P2A (SEQ ID NO:021)). When multiple polypeptides are used, such as a first urea cycle coding sequence encoding a first polypeptide and a second urea cycle coding sequence encoding a second polypeptide, the coding sequences may be arranged in any order.

[0250] Useful expression cassette configurations include, for example, the following: [MND promoter]-[CPS1]-[polyA] [MND promoter]-[NAGS]-[polyA] [MND promoter]-[OTC]-[polyA] [MND promoter]-[CPS1]-[polyA]-[furin.GSG.T2A]-[OTC]-[polyA] [MND promoter]-[OTC]-[polyA]-[furin.GSG.T2A]-[CPS1]-[polyA] [MND promoter]-[NAGS]-[polyA]-[furin.GSG.T2A]-[CPS1]-[polyA] [MND promoter]-[CPS1]-[polyA]-[furin.GSG.T2A]-[NAGS]-[polyA] [MND promoter]-[NAGS]-[polyA]-[furin.GSG.T2A]-[CPS1]-[furin.GSG.P2A]-[OTC]-[polyA]

[0251] As will be readily appreciated, in some instances substitutions may be made in the above constructs including, for example, replacing the described promoter with another suitable promoter, replacing the transgene coding sequence with another coding sequence encoding the same transgene or a variant of the transgene, replacing the sequence 3' of the transgene with another 3' sequence (e.g., including an alternative polyA or other 3' moiety), etc. The expression constructs are introduced into a suitable lentiviral vector for transduction into hepatocytes.

[0252] Hepatocytes are prepared, expanded, and transduced essentially as described in Example 5, substituting the above constructs for those described therein.

[0253] The prepared population of engineered hepatocytes is formulated into a dosage formulation in a suitable delivery medium, which is delivered to a subject in need thereof by a medically appropriate route, such as, for example, via intrasplenic or portal vein injection or infusion, to treat the subject for a urea cycle disorder.

[0254] Example 8: Generation and expansion of GLA engineered human hepatocytes for Fabry disease The feasibility of using the LVV approach to introduce an exogenous α-galactosidase A (GLA) transgene into primary human hepatocytes to generate GLA-engineered hepatocytes, e.g., expanded in an in vivo bioreactor before or after transgene transduction. As a first test, primary human hepatocytes were transduced ex vivo with commercially available LVV overexpressing human GLA (a non-optimized surrogate of the corresponding clinical construct) at various multiplicities of infection (MOI), and the cells were maintained in vitro. As a control, non-transduced primary human hepatocytes (i.e., untreated control, NTC) were maintained under the same in vitro culture conditions. Cells were collected from MOI2-transduced samples, MOI12-transduced samples, and NTC samples on day 5 of culture, then lysed and homogenized. α-Galactosidase (α-Gal) activity was measured using a commercial assay (Abcam, Cambridge, UK) with a specific synthetic substrate that releases a fluorophore (quantifiable at Ex / Em of 360 / 445 nm) upon α-Gal cleavage. A positive control sample included in the kit was also used.

[0255] The amount of α-Gal activity measured in all MOI2 and MOI12 samples was at least 5x greater than the highest level of activity observed in NTCs. Furthermore, the α-Gal activity measured in some of the most highly active transduced samples was more than 10x greater than the highest activity observed in the positive control samples. Taken together, these data demonstrate the ability to generate engineered human hepatocytes that overexpress human GLA and exhibit substantially higher α-Gal activity than corresponding unengineered human hepatocytes, even using a surrogate GLA-LVV that is not optimized for transduction.

[0256] Having demonstrated the ability to generate F8-overexpressing human hepatocytes, the following improved expression constructs were designed for introduction into human hepatocytes to promote expression of a therapeutic transgene product by engineered hepatocytes transplanted into a subject in need thereof, e.g., a human subject with a lysosomal storage disorder such as Fabry disease.

[0257] The expression construct used in this example comprises a suitable promoter, such as, for example, the MND promoter (SEQ ID NO:001), operably linked to an alpha-galactosidase A gene (GLA), such as, for example, a GLA(1) coding sequence (SEQ ID NO:028) encoding a GLA(1) polypeptide (SEQ ID NO:029) or a GLA(2) coding sequence (SEQ ID NO:030) encoding a GLA(2) polypeptide (SEQ ID NO:029), operably linked to a suitable 3' sequence, including, for example, a polyA signal.

[0258] Useful expression cassette configurations include, for example, the following: [MND promoter]-[GLA(1)]-[polyA] [MND promoter]-[GLA(2)]-[polyA]

[0259] As will be readily appreciated, in some instances substitutions may be made in the above constructs including, for example, replacing the described promoter with another suitable promoter, replacing the transgene coding sequence with another coding sequence encoding the same transgene or a variant of the transgene, replacing the sequence 3' of the transgene with another 3' sequence (e.g., including an alternative polyA or other 3' moiety), etc. The expression constructs are introduced into a suitable lentiviral vector for transduction into hepatocytes.

[0260] Hepatocytes are prepared, expanded, and transduced essentially as described in Example 5, substituting the above constructs for those described therein.

[0261] The prepared population of engineered hepatocytes is formulated into a dosage formulation in a suitable delivery medium, which is delivered to a subject in need thereof by a medically appropriate route, such as, for example, via intrasplenic or portal vein injection or infusion, to treat the subject for lysosomal storage disorders and Fabry disease.

[0262] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those skilled in the art in light of the teachings of this invention that certain changes and modifications can be made without departing from the spirit or scope of the appended claims.

[0263] Thus, the above merely describes the principles of the invention. It will be appreciated that those skilled in the art can devise various configurations that embody the principles of the invention and are within the spirit and scope of the invention, although not expressly described or shown herein. Furthermore, all examples and conditional language recited herein are intended primarily to aid the reader in understanding the principles of the invention and the concepts that the inventors have contributed to advancing the art, and should not be construed as being limited to such specifically recited examples and conditions. Furthermore, all statements herein that describe the principles, aspects, and embodiments of the invention, as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Moreover, such equivalents are intended to include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. Furthermore, nothing disclosed herein is intended to be dedicated to the public, regardless of whether such disclosure is expressly recited in the claims.

[0264] Therefore, the scope of the present invention is not limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of the present invention is embodied by the appended claims. In the claims, 35 U.S.C. 112(f) or 35 U.S.C. 112(6) is expressly defined as being invoked for a limitation in a claim only if the precise phrase "means for" or the precise phrase "step for" is recited at the beginning of such limitation in the claim. If such precise phrase is not used in a limitation in a claim, 35 U.S.C. 112(f) or 35 U.S.C. 112(6) is not invoked.

Claims

1. 1. A method for generating hypoimmunogenic hepatocytes or their precursor cells, the method comprising: contacting a population of cells comprising human hepatocytes or progenitor cells thereof with an edited composition under conditions sufficient to cause human leukocyte antigen (HLA) class I deficiency in said hepatocytes or progenitor cells thereof; Thereby generating a population of hypoimmunogenic hepatocytes or their progenitor cells.

2. The method of claim 1, wherein the edited composition is a beta2-microglobulin (B2M) edited composition.

3. 3. The method of claim 1 or 2, further comprising introducing the generated population of hypoimmunogenic hepatocytes or their progenitor cells into a bioreactor.

4. 4. The method of claim 3, wherein the bioreactor is an in vivo bioreactor, and the in vivo bioreactor is maintained under conditions sufficient to produce an expanded population of hypoimmunogenic hepatocytes, and optionally, the in vivo bioreactor is a mouse, a rat, or a pig.

5. The method of generating the hypoimmunogenic hepatocytes or their precursor cells further comprises: The method of any one of claims 1 to 4, comprising contacting the cell population with a transgene encoding at least one NK cell decoy receptor under conditions sufficient for expression of the transgene by the hepatocytes or their precursor cells.

6. The method of claim 5, wherein the at least one NK cell decoy receptor comprises CD47, a B2M-HLA-E fusion, or a combination thereof.

7. 1. A pharmaceutical composition for use in a method of treating a condition in a subject, said pharmaceutical composition comprising an effective amount of hypoimmunogenic hepatocytes or progenitor cells, respectively, comprising an HLA class I deficiency, and optionally said condition is a hepatic condition.

8. A method for producing the pharmaceutical composition described in claim 7, comprising generating the low immunogenic hepatocytes or their precursor cells according to a method described in any one of claims 1 to 6.

9. 1. A non-human mammal comprising a transplanted cell population, said cell population comprising a plurality of hypoimmunogenic human hepatocytes or progenitor cells thereof, each of said plurality of hepatocytes or progenitor cells comprising an HLA class I deficiency, and optionally, said HLA class I deficiency comprising a B2M deficiency.

10. The non-human mammal of claim 9, wherein each of the plurality of hepatocytes or progenitor cells further comprises an introduced gene encoding at least one NK cell decoy receptor, and optionally, the at least one NK cell decoy receptor comprises CD47, a B2M-HLA-E fusion, or a combination thereof.

11. A method for producing low immunogenic human hepatocytes or their precursor cells, the method comprising isolating a population of expanded low immunogenic human hepatocytes or their precursor cells from a non-human mammal described in claim 9 or 10.

12. A cell population comprising a plurality of low immunogenic primary human hepatocytes, each of said plurality of hepatocytes comprising an HLA class I deficiency, and optionally, said HLA class I deficiency comprises a B2M deficiency.

13. 1. A method for producing genetically modified human hepatocytes, the method comprising: contacting a cell population comprising human hepatocytes or progenitor cells thereof with an integration vector comprising a transgene encoding a gene product under conditions sufficient for functional integration of said transgene to produce genetically modified hepatocytes or progenitor cells thereof comprising said integrated transgene; transplanting the genetically modified hepatocytes or progenitor cells thereof into an in vivo bioreactor and maintaining the in vivo bioreactor under conditions sufficient for proliferation of the genetically modified hepatocytes or progenitor cells to generate an expanded population of genetically modified human hepatocytes that express the gene product, optionally wherein the in vivo bioreactor is a mouse, rat, or pig.

14. The transgene may be copper transporting ATPase 2 (ATP7B), hereditary hemochromatosis protein (HFE), hemojuvelin, hepcidin (HAMP), transferrin receptor protein 2 (TFR2), solute carrier family 40 member 1 (SLC40A1), factor IX, factor VIII, von Willebrand factor, carbamoyl phosphate synthase (CPS1), N-acetylglutamate synthase (NAGS), ornithine transcarbamylase (OTC), α-galactosidase A gene (GLA), phenylalanine hydroxylase enzyme (PHASE), ornithine transcarbamylase (OTC), α-galactosidase A gene (GLA), ornithine transcarbamylase (TCR ...

14. The method of claim 13, wherein the gene product encodes a gene product selected from the group consisting of protease, progesterone, arginase (PAH), arginase (ARG), alpha 1-antitrypsin (AAT), fumarylacetoacetate hydrolase (FAH), argininosuccinate lyase (ASL), argininosuccinate synthase (ASS), ornithine translocase (ORNT1), citrine, UDP-glucuronosyltransferase 1A1 (UGT1A1), transthyretin (TTR), serine-pyruvate aminotransferase (AGXT), complement factor H (CFH), and combinations thereof.

15. 1. A method of manufacturing a pharmaceutical composition for treating a condition in a subject, the method comprising:

15. A method comprising producing an effective amount of genetically modified human hepatocytes according to the method of claim 13 or 14.

16. 1. A non-human mammal comprising a transplanted cell population, said cell population comprising a plurality of genetically modified human hepatocytes, each of said plurality of hepatocytes comprising a functionally integrated transgene encoding a gene product.

17. A method for producing genetically modified human hepatocytes or their precursor cells, comprising isolating a propagated population of genetically modified human hepatocytes from a non-human mammal described in claim 16.

18. A cell population comprising a plurality of low immunogenic primary human hepatocytes, each of the plurality of hepatocytes comprising an HLA class I deficiency.

19. 1. A method for producing a plurality of hepatocyte therapeutic doses, the method comprising: (1a) genetically modifying human hepatocytes and expanding the genetically modified human hepatocytes in one or more in vivo bioreactors to generate an expanded population of genetically modified human hepatocytes; or (1b) genetically modifying the expanded human hepatocytes obtained from the one or more in vivo bioreactors to generate an expanded population of genetically modified human hepatocytes; and (2) dividing the expanded population of the genetically modified human hepatocytes of 1a or 1b into a plurality of hepatocyte therapeutic doses.

20. 1. A method of manufacturing a pharmaceutical composition for treating a plurality of subjects having a condition, the method comprising:

20. A method comprising producing a plurality of hepatocyte therapeutic doses as described in claim 19 for administering one or more of the plurality of doses to each of the subjects to treat the subjects for the condition, and optionally, the human hepatocytes are derived from a single human liver.

Images