Mesothelin-binding molecules and their applications

Abstract

The present invention provides mesothelin binding molecules comprising an anti-mesothelium single domain antibody, the complementarity determining region (CDR) of which comprises CDR1 as set forth in SEQ ID NO:1, CDR2 as set forth in SEQ ID NO:2, and CDR3 as set forth in SEQ ID NO:3.

Description

[Technical field]

[0001] The present invention relates to the field of biomedical or biopharmaceutical technology, and more specifically to mesothelin-binding molecules and their applications. [Background technology]

[0002] The mesothelin (MSLN) gene is located on chromosome 1p13.3 and has a total length of 8 kD. The gene contains an open reading frame of 1884 bp, 17 exons, and encodes 628 amino acids. The precursor protein of MSLN is a glycoprotein with a length of 69 kD, anchored to the cell membrane with glycosylphosphopeptide inositol, and can be hydrolyzed by proteolytic enzymes into two parts, the N-terminus of which is a soluble protein of 31 kD with megakaryocyte stimulating activity, called megakaryocyte potentiating factor (MPF), and the C-terminus of which is a membrane-bound protein of about 40 kD with cell adhesive properties, called MSLN. The structure of MSLN in the membrane protein can be divided into three different regions, of which the I region is the binding site for the ligand CA125.

[0003] Mesothelin is highly expressed in various malignant tumors as a differentiation antigen and is deeply involved in the development and progression of tumors. This target is one of the most promising antitumor targets, and many major pharmaceutical companies have been developing drugs against this target, including CAR-T, monoclonal antibodies, and ADCs. Over the past 20 years, various anti-mesothelin monoclonal antibodies have been developed, including mainly SS1P immunotoxin and MORAB-009. SS1P is a recombinant immunotoxin composed of a fusion of scFv and a truncated Pseudomonas aeruginosa exotoxin, which mainly mediates cell killing. Meanwhile, MORAB-009 is an IgG1 antibody engineered with the SS1P sequence, which mainly induces antibody-dependent cell-mediated cytotoxicity (ADCC).

[0004] The SS1P antibody binds to the mesothelin I domain and can block the binding of CA125 to mesothelin. This antibody is also used in the treatment of CAR-T, but the therapeutic effect is insufficient (Jiang, H. et al., Protein Cell 8, 926-931, 2017; Adusumilli, PS et al., Sci. Transl. Med. 6, 261ra151, 2014; Lanitis, E. et al., Mol. Ther. 20, 633-643, 2012). Nanobodies have the natural advantages of high stability, high osmolality, and broad epitope binding (Muyldermans S. Annu Rev Biochem. 2013;82:775-97.), but nanobodies at the membrane-proximal end of MSLN have been little studied. The development of novel anti-mesothelium nanobodies with excellent specificity, blocking activity, and clinical efficacy, as well as easy production, low cost, and reduced drug burden, is an urgent task to be solved. Summary of the Invention [Problem to be solved by the invention]

[0005] An object of the present invention is to provide mesothelin-binding molecules and applications thereof. [Means for solving the problem]

[0006] A first aspect of the invention provides a mesothelin binding molecule comprising an anti-mesothelium single domain antibody, the complementarity determining regions (CDRs) of which comprise CDR1, CDR2 and CDR3, of which CDR1 comprises the sequence set forth in SEQ ID NO:1, CDR2 comprises the sequence set forth in SEQ ID NO:2 and CDR3 comprises the sequence set forth in SEQ ID NO:3. In one or more embodiments, SEQ ID NO:1 is X1X2X3X4X5X6X7X8X9X 10 X 11where X1 is G, E, T or A, X2 is S, N, P, A, H, D, K, I or F, X3 is I, S, V, T, D, L, A, M or H, X4 is F, S, I, A, L or G, X5 is N, S, G, A, D, T, E, R or H, X6 is I, L, F, Y, E or N, and X7 is N, A, G, D, K , Y, L or S, X8 is A, Y, V, D or N, X9 is E or none, and X 10 is F or nothing, X 11 is A or nothing.

[0007] In one or more embodiments, SEQ ID NO:1 is X1X2X3X4X5X6X7X8, where X1 is G, E, T or A, X2 is S, N, P, A, H, D, K, I or F, X3 is I, S, V, T, D, L, A, M or H, X4 is F, S, I, A, L or G, X5 is N, S, G, A, D, T, E or H, X6 is I, L, F, Y or N, X7 is N, A, G, D, K, Y or S, and X8 is A, Y, V or N.

[0008] In one or more embodiments, SEQ ID NO: 1 is GX2X3X4X5X6X7A, where X2 is S, N, A, D, I or F, X3 is I, V, T, D, A, L or S, X4 is F, S, I, A or L, X5 is N, S, A, D, E, T or H, X6 is I, F, N or Y, and X7 is N, G, D or Y. Preferably, SEQ ID NO:1 is X1X2X3X4X5X6X7X8, wherein X1 is G, E, T or A, X2 is S, N, P, H or I, X3 is I, S, T, D, L or A, X4 is F, I or L, X5 is S, T or E, X6 is I, F or Y, X7 is N, A, D or Y, and X8 is A or Y.

[0009] In one or more embodiments, CDR1 comprises a sequence set forth in any one of SEQ ID NOs: 4-27, 73. Preferably, CDR1 comprises a sequence set forth in any one of SEQ ID NOs: 5, 11, 14, 15, 17, 21, 27, 73. In one or more embodiments, SEQ ID NO:2 is 10 X 11 X 12 where X1 is I, M, A, T or L, X2 is S, G, N, D, T or V, X3 is S, N, A, R, G or T, X4 is S, T, G, D or N, X5 is N, G, T or I, X6 is S, R, N, D, K, T or G, X7 is D, T, S, I or K, X8 is N, T, G, D or none, X9 is T, K, G or none, and X 10 is G, R or none, and X 11 is V, T or none, X 12 is T or nothing. In one or more embodiments, X3 is S, N, A, R or T.

[0010] In one or more embodiments, SEQ ID NO:2 is IX2X3X4X5X6X7X8X9, where X2 is S, G, N or D, X3 is S, N, A or T, X4 is S, T, G, D or N, X5 is N or G, X6 is S, R, N, D or K, X7 is D, T, S or K, X8 is N, T or none, and X9 is T, K or none. Preferably, SEQ ID NO:2 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 where X1 is I, A or T, X2 is S, G, N or T, X3 is S or R, X4 is T, G or D, X5 is N, G or T, X6 is S, R, N, K or T, X7 is D, T, S, I or K, X8 is N, G or none, X9 is T, G or none, and X 10 is G or nothing, X11 is V or nothing, X 12 is T or nothing. In one or more embodiments, CDR2 comprises a sequence set forth in any one of SEQ ID NOs: 28-47, 74. Preferably, CDR2 comprises a sequence set forth in any one of SEQ ID NOs: 29, 35, 37, 38, 39, 43, 40, 74.

[0011] In one or more embodiments, SEQ ID NO:3 is 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 X 23 where X1 is N, H, A or Q, X2 is L, A, G or V, X3 is S, R, E, G, D or T, X4 is N, A, R, G, D, K, V, T, I, E or Q, X5 is Y, F, K, S, C, I, D, G, H or R, X6 is D, A, V, G, R, N, P, T, C, Q or S, X7 is R, Y, T, A, D, K, L, E, S or G, X8 is K, S, F, T, D, Q, E, G, P, R, Y or N, X9 is D, G, I, H, S, Y, Q, K, T, R or V, and X 10 is R, Y, H, N, T, D, P, V, K, C, L or S, and X 11 is Y, D, E, P, F, S, L, I or none, and X 12 is P, V, Q, A, Y, F, N, D, R or None, and X1 3 is D, A, Y, V, Q, P or None, X 14 is Y, L, P, A, E or none, and X 15 is C, S, M, P, T or none, X 15 is C, S, M, P or none, X 16 is V, D, S, Y or none, and X17 is L, F, V, D or none, and X 18 is R, G, M, S or None, and X 19 is D, N, S or none, X 20 is Y, L or nothing, and X 21 is Y or nothing, and X 22 is A or nothing, X 23 is D or none.

[0012] In one or more embodiments, SEQ ID NO:3 is 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 X 23 where X1 is N, H, A or Q, X2 is L, A, G or V, X3 is S, R, E, G, D or T, X4 is N, A, R, G, D, K, V, T, I or Q, X5 is Y, F, K, S, C, I, D, G, H or R, X6 is D, A, V, G, R, N, P, T, C, Q or S, X7 is R, Y, T, A, D, K, L, E, S or G, X8 is K, S, F, T, D, Q, E, G, P, R, Y or N, X9 is D, G, I, H, S, Y, Q, K, T or V, and X 10 is R, Y, H, N, T, D, P, V, K, C or S, and X 11 is Y, D, E, P, F, S, L or none, X 12 is P, V, Q, A, Y, F, N, D or None, and X 13 is D, A, Y, V, Q or none, and X 14 is Y, L, P, A, E or none, and X 15 is C, S, M, P or none, X 16 is V, D, S, Y or none, and X 17 is L, F, V, D or none, and X 18is R, G, M, S or None, and X 19 is D, N, S or none, X 20 is Y, L or nothing, and X 21 is Y or nothing, and X 22 is A or nothing, X 23 is D or none.

[0013] In one or more embodiments, SEQ ID NO:3 is AX2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 with the proviso that X2 is A, G or V, X3 is S, E, G, D or T, X4 is N, R, D, K, T or I, X5 is Y, F, K, I, D, G, H or R, X6 is D, A, G, N, P, T, C, Q or S, X7 is R, Y, T, A, D, K, L or G, X8 is K, S, F, D, Q, G, P, Y or N, X9 is D, G, I, S, Y, Q, K or V, and X 10 is R, Y, H, T, D, P, V, K or C, and X 11 is Y, D, E, F, S, L or none, X 12 is P, V, A, Y, F, N, D or None, and X 13 is D, A, Y, V or none, and X 14 is Y, P, E or none, and X 15 is S, P or none, X 16 is D, Y or none, X 17 is F, D or none, X 18 is G, S or none, X 19 is N or None.

[0014] Preferably, SEQ ID NO: 3 is AX2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X14 X 15 X 16 X 17 X 18 X 19 with the proviso that X2 is A or V, X3 is S, E, G or D, X4 is N, R, D or I, X5 is Y, F, K, D or H, X6 is D, G, P, C or S, X7 is R, Y, D, K or L, X8 is K, Q, G or N, X9 is D, S, Y or Q, and X 10 is R, Y, D, V or S, and X 11 is Y, D, F, S, L or none, and X 12 is P, F, or None, and X 13 is D, V or none, X 14 is P or nothing, and X 15 is S or nothing, X 16 is D or nothing, X 17 is F or nothing, X 18 is G or nothing, X 19 is N or None.

[0015] In one or more embodiments, the anti-mesothelium single domain antibody is a single domain antibody specific for the mesothelin III domain (membrane proximal end). In one or more embodiments, the CDR3 comprises a sequence set forth in any one of SEQ ID NOs: 48-72, 75. Preferably, the CDR3 comprises a sequence set forth in any one of SEQ ID NOs: 49, 55, 58, 59, 61, 65, 72, 75. In one or more embodiments, the CDR1 of the single domain antibody comprises a sequence set forth in any one of SEQ ID NOs: 4-27, 73, the CDR2 comprises a sequence set forth in any one of SEQ ID NOs: 28-47, 74, and the CDR3 comprises a sequence set forth in any one of SEQ ID NOs: 48-72, 75.

[0016] In one or more embodiments, the single domain antibody comprises a CDR1, a CDR2 and a CDR3 as set forth in any one of the following groups a1-a26: [Table 1]

[0017] In one or more embodiments, FR1 of the single domain antibody VHH is selected from FR1 of the VHH of each antibody number in Table 1, FR2 of the VHH is selected from FR2 of the VHH of each antibody number in Table 1, FR3 of the VHH is selected from FR3 of the VHH of each antibody number in Table 1, and FR4 of the VHH is selected from FR4 of the VHH of each antibody number in Table 1. In one or more embodiments, the FR region of the single domain antibody is a FR region of any one of VHH selected from SEQ ID NOs: 76-120.

[0018] In one or more embodiments, the single domain antibody VHH is set forth in any one of SEQ ID NOs: 76-120. Preferably, the single domain antibody is set forth in any one of SEQ ID NOs: 74, 83, 86, 87, 89, 93, 100, 103. In one or more embodiments, the mesothelin binding molecule is a monovalent or multivalent single domain antibody, including one, two or more anti-mesothelin single domain antibodies described herein, a multispecific single domain antibody, a heavy chain antibody or antigen-binding fragment thereof, or an antibody or antigen-binding fragment thereof. In one or more embodiments, the multivalent or multispecific single domain antibody is linked to multiple single domain antibodies by a linker, the linker consisting of 1-15 amino acids selected from G and S.

[0019] In one or more embodiments, the antigen-binding fragment of a heavy chain antibody is a single-chain heavy chain antibody. In one or more embodiments, the heavy chain antibody is a camelid heavy chain antibody or a carcinoma heavy chain antibody. It is a bony fish heavy chain antibody. In one or more embodiments, the heavy chain antibody further comprises a heavy chain constant region.

[0020] In one or more embodiments, the heavy chain constant region is a camelid heavy chain antibody constant region and comprises a CH2 and a CH3. In one or more embodiments, the CH2 and CH3 are human IgG Fc CH2 and CH3, such as IgG4 CH2 and CH3. Preferably, the heavy chain constant region is set forth in SEQ ID NO: 121. In one or more embodiments, the heavy chain constant region is a chondrichthyan heavy chain antibody constant region and includes CH1, CH2, CH3, CH4 and CH5.

[0021] In one or more embodiments, the antibody comprises an anti-mesothelin single domain antibody as the heavy chain variable domain of the antibody. In one or more embodiments, the antibody further comprises a light chain variable domain, a heavy chain constant domain, and a light chain constant domain. In one or more embodiments, the antigen-binding fragment of the antibody is selected from a Fab, F(ab')2, Fv, or scFv. In one or more embodiments, the binding molecule according to any one of the embodiments of the invention is a chimeric antibody or a fully human antibody, preferably a fully human antibody.

[0022] The present invention further provides a polynucleotide comprising: (1) a coding sequence for a single domain antibody described in any of the embodiments herein or an antibody or antigen-binding fragment thereof described herein; (2) The complementary sequence of (1); (3) A 5-50 bp fragment of either (1) or (2) Selected from.

[0023] In one or more embodiments, the fragment is a primer. The present invention further provides a nucleic acid construct comprising a polynucleotide described herein. In one or more embodiments, the nucleic acid construct is a recombinant vector or an expression vector.

[0024] The invention also provides phage of a mesothelin binding molecule described in any of the embodiments herein. In one or more embodiments, the mesothelin binding molecule is displayed on the surface of the phage. The present invention further provides a host cell, (1) expressing a mesothelin binding molecule described in any of the embodiments herein; (2) comprising a polynucleotide described herein; and / or (3) It is selected because it comprises a nucleic acid construct described herein.

[0025] The invention also provides a method of producing a mesothelin binding molecule, comprising culturing a host cell described herein under conditions suitable for production of a mesothelin binding molecule (e.g., a monovalent or multivalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody, an antibody or antigen-binding fragment thereof) and, optionally, purifying the mesothelin binding molecule from the culture. The invention provides pharmaceutical compositions, comprising a mesothelin binding molecule, polynucleotide, nucleic acid construct, phage or host cell described in any of the embodiments herein, and a pharma- ceutical acceptable excipient. In one or more embodiments, the pharmaceutical composition is used to treat cancer. . In one or more embodiments, the cancer is a mesothelin-associated cancer. Preferably, the cancer includes mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, gastric cancer, and the like.

[0026] The present invention further provides the use of a mesothelin binding molecule described in any of the embodiments herein in the manufacture of a medicament for preventing or treating cancer. In one or more embodiments, the cancer is a mesothelin-associated cancer. Preferably, the cancer includes mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, gastric cancer, and the like. The invention also provides a method for treating or preventing cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of a mesothelin binding molecule according to any one of the embodiments of the invention, or a pharmaceutical composition comprising a mesothelin binding molecule according to any one of the embodiments of the invention.

[0027] In one or more embodiments, the cancer is a mesothelin-associated cancer. Preferably, the cancer includes mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, gastric cancer, and the like. The present invention also provides a mesothelin detection kit for use in evaluating the efficacy of drug treatment or diagnosing cancer, the kit comprising a mesothelin-binding molecule, polynucleotide, nucleic acid construct, phage, or host cell described in any of the embodiments herein.

[0028] In one or more embodiments, the kit further comprises a reagent for detecting binding of mesothelin to the single domain antibody, antibody, or antigen-binding fragment thereof, e.g., by enzyme immunoassay. In one or more embodiments, the bound detection reagent is a detectable label, such as biotin, that can be bound to the mesothelin binding molecule, either bound to the mesothelin binding molecule or separately present in the kit.

[0029] The invention also provides a non-diagnostic method for detecting the presence of mesothelin in a sample, comprising incubating a mesothelin binding molecule as described in any embodiment herein with the sample and detecting binding of mesothelin to the single domain antibody, antibody or antigen-binding fragment thereof, thereby determining the presence of mesothelin in the sample, said detection being by enzyme immunoassay. The invention further provides the use of a mesothelin binding molecule described in any of the embodiments herein in the detection of mesothelin in a sample, in assessing the efficacy of drug treatment, or in the preparation of a kit for cancer diagnosis. [Brief description of the drawings]

[0030] [Figure 1] FIG. 1 shows titer detection of alpaca antiserum against MSLN protein. [Diagram 2] FIG. 2 shows titer detection of alpaca antisera against MSLN-overexpressing cell lines. [Diagram 3] FIG. 3 shows the detection of binding between a candidate antibody and a cell line overexpressing an MSLN III region protein. [Figure 4] FIG. 4 shows the binding detection of candidate antibodies to the SKOV3 tumor cell line. [Diagram 5] FIG. 5. Binding detection of candidate antibodies to the Aspc-1 tumor cell line. [Figure 6] Figures 6A and 6B are epitope competition detection between M044 antibody and YP218 antibody, Figure 6A is binding with YP218 antibody first, and then detecting the binding status of M044 antibody, and Figure 6B is the reverse of the binding order of Figure 6A. The unit of EC50 is nM. Isotype is the isotype control (negative control), and its amino acid sequence is as shown in SEQ ID NO.:2 described in CN106046152A. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0031] The present inventors have conducted extensive research and conducted numerous screening tests to identify anti-mesothelin single domain antibodies. The present invention provides a method for the preparation of single domain antibodies that specifically bind to mesothelin, and further ... Specifically, the present invention uses human-derived mesothelin to immunize alpacas to obtain a high-quality immune single-domain antibody gene library. Then, MSLN protein and membrane proximal end fragments are bound to an ELISA plate, and the immune single-domain antibody gene library is screened by phage display technology to obtain MSLN-specific single-domain antibody genes. Then, this gene is introduced into mammalian cells to obtain single-domain antibody strains that can be highly expressed in mammalian cells and have high specificity. Then, single-domain antibodies with high affinity and low tissue cross-reactivity are identified by methods such as plasmon resonance technology, flow cytometry, epitope competition test, and biotin reporter gene detection system.

[0032] antibody As used herein, a "mesothelin-binding molecule" or "MSLN-binding molecule" is a protein that specifically binds to mesothelin, including, but not limited to, antibodies, antigen-binding fragments of antibodies, heavy chain antibodies, nanobodies, minibodies, affibodies, target-binding domains of receptors, cell adhesion molecules, ligands, enzymes, cytokines, and chemokines. As described herein, "MD50" is a 94 amino acid long (GenBank: AAH09272.1, 487-580) protein located at the membrane proximal end of mesothelin.

[0033] As used herein, the term "antibody" includes monoclonal antibodies (including full-length antibodies having an immunoglobulin Fc region), antibody compositions with multi-epitope specificity, multispecific antibodies (e.g., bispecific antibodies), diabodies, single-chain molecules, and antibody fragments (particularly antigen-binding fragments, such as Fab, F(ab')2, and Fv). As used herein, the terms "immunoglobulin" (Ig) and "antibody" are interchangeable.

[0034] The basic four-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light chains (L) and two identical heavy chains (H). IgM antibodies consist of five basic heterotetrameric units and another polypeptide called the J chain, and contain 10 antigen-binding sites. IgA antibodies contain 2-5 basic four-chain units, which can polymerize with J chains to form multivalent aggregates. In the case of IgG, the four-chain unit is usually about 150,000 daltons. Each light chain is linked to a heavy chain by one covalent disulfide bond, and the two heavy chains are linked to each other by one or more disulfide bonds, with the number of disulfide bonds determined by the heavy chain isotype. Each heavy and light chain further has regularly spaced interchain disulfide bridges. Each heavy chain has a variable domain (VH) at the N-terminus and three (CH1, CH2 and CH3 for each α and γ chain) and four (CH1, CH2, CH3 and CH4 for μ and ε isotypes) constant domains (CH), and a hinge region (Hinge) between the CH1 and CH2 domains. Each light chain has a variable domain (VL) at the N-terminus and a constant domain (CL) at its other end. The VL is aligned with the VH, and the CL is aligned with the first constant domain (CH1) of the heavy chain. Certain amino acid residues are believed to form an interface between the light and heavy chain variable domains. The paired VH and VL together form an antigen-binding site. For the structure and properties of the different classes of antibodies, see Basic and Clinical Immunology, 8th Edition, Daniel P. Sties, Abba I. Terr and Tristram G. Parsolw (eds.), Appleton & Lange, Norwalk, CT, 1994, page 71 and chapter 6. Light chains from any vertebrate species can be assigned to one of two different types, called kappa and lambda, depending on the amino acid sequence of their constant domain. Immunoglobulins can be assigned to different classes or isotypes depending on the amino acid sequence of their heavy chain constant domain (CH). There are five types of immunoglobulins, IgA, IgD, IgE, IgG and IgM, with heavy chains called alpha, delta, epsilon, gamma and mu, respectively.The gamma and alpha classes are further distinguished by relatively minor differences in CH sequence and function, for example, IgG1, IgG2A, IgG2B, Ig expressed in humans. It is divided into the subclasses IgA1, IgA2, and IgG3.

[0035] A "heavy chain antibody" as described herein is an antibody derived from a camelid or elasmobranch organism. Compared to the above four-chain antibodies, a heavy chain antibody lacks a light chain and a heavy chain constant region 1 (CH1) and contains only two heavy chains consisting of a variable region (VHH) and another constant region, the variable region being linked to the constant region by a structure similar to a hinge region structure. Each heavy chain of a camelid heavy chain antibody contains one variable region (VHH) and two constant regions (CH2 and CH3), while each heavy chain of an elasmobranch heavy chain antibody contains one variable region and five constant regions (CH1-CH5). Antigen-binding fragments of heavy chain antibodies include VHH and single-chain heavy chain antibodies. A heavy chain antibody can have the CH2 and CH3 of human IgG Fc by fusion with the constant region of human IgG Fc.

[0036] As used herein, the terms "single domain antibody", "anti-mesothelin single domain antibody", "heavy chain variable region domain of a heavy chain antibody", "VHH" and "nanobody" are used interchangeably and all refer to a single domain antibody that specifically recognizes and binds to mesothelin. A single domain antibody is the variable region of a heavy chain antibody. Typically, a single domain antibody comprises three CDRs and four FRs. Preferably, a single domain antibody of the present invention comprises CDR1 as shown in SEQ ID NO:1, CDR2 as shown in SEQ ID NO:2, and CDR3 as shown in SEQ ID NO:3. Single domain antibodies are the smallest functional antigen-binding fragments. Typically, an antibody that naturally lacks a light chain and heavy chain constant region 1 (CH1) is obtained, and then the variable region of the antibody heavy chain is cloned to construct a single domain antibody consisting of only one heavy chain variable region.

[0037] A binding molecule comprising two or more single domain antibodies is a multivalent single domain antibody; a binding molecule comprising two or more different specificity single domain antibodies is a multispecific single domain antibody. A multivalent single domain antibody or a multispecific single domain antibody is a linker that links the multiple single domain antibodies. The linker is usually selected from G and S and consists of 1-15 amino acids.

[0038] As used herein, heavy chain antibody and antibody are intended to distinguish between different combinations of antibodies. Due to structural similarities, the structural description of antibodies below applies to heavy chain antibodies, except for those related to light chains. The "variable region" or "variable domain" of an antibody is the amino-terminal domain of either the heavy or light chain of an antibody. The heavy and light chain variable domains are designated "VH" and "VL", respectively. These domains are typically the most variable parts of an antibody (relative to other antibodies of the same type) and contain the antigen-binding site.

[0039] The term "variable" means that certain segments in the variable domains differ extensively in sequence among antibodies. The variable domains mediate antigen binding and define the specificity of a particular antibody for its particular antigen. However, the variability is not uniformly distributed over the entire amino acid span of the variable domain. Instead, it is concentrated in three segments (present in both light and heavy chain variable domains) called hypervariable regions (HVRs), namely, HCDR1, HCDR2, HCDR3 (which may be abbreviated as CDR1, CDR2, CDR3 in heavy chain antibodies) in the heavy chain variable region and LCDR1, LCDR2, LCDR3 in the light chain variable region. The more highly conserved parts of the variable domains are called framework regions (FRs). Natural heavy and light chain variable domains each contain four FR regions (FR1, FR2, FR3, and FR4), which usually adopt a β-pleated sheet structure, but are connected by three HVRs that form a cyclic linkage and sometimes form part of the β-pleated sheet structure. The HVRs in each chain are held in close proximity by the FR regions and, together with the HVRs in the other chain, promote the formation of the antigen-binding site of the antibody. Usually, the structure of the light chain variable region is FR1-LCDR1-FR2-LCDR2-FR3-LCDR3-FR4, and the structure of the heavy chain variable region is FR1-HCDR1-FR2-HCDR2-FR3-HCDR3-FR4. The constant domains are not directly involved in the binding of the antibody to the antigen, but are involved in the regulation of the cellular functions of the antibody, such as those mediated by antibody-dependent cell proliferation. Various effector functions have been demonstrated, including the involvement of antibodies in cytotoxicity.

[0040] "Fc region" (fragment crystallizable region) or "Fc domain" or "Fc" refers to the C-terminal region of an antibody heavy chain, which mediates the binding of the immunoglobulin to host tissues or factors, including binding to Fc receptors located on various cells of the immune system (e.g., effector cells) or to the first component (C1q) of the classical complement system. In IgG, IgA and IgD antibody isotypes, the Fc region is composed of two identical protein fragments derived from the CH2 and CH3 domains of the two heavy chains of the antibody; the Fc region of IgM and IgE contains three heavy chain constant domains (CH domains 2-4) in each polypeptide chain. Although the boundaries of the Fc region of an immunoglobulin heavy chain may vary, the Fc region of a human IgG heavy chain is generally defined as the sequence segment from an amino acid residue at position C226 or P230 of the heavy chain to the carboxyl terminus, e.g., as in Kabat, with numbering according to the EU index. As used herein, the Fc region may be a native sequence Fc or a variant Fc.

[0041] An "antibody fragment" comprises a portion of an intact antibody, preferably the antigen-binding and / or variable regions of the intact antibody. The antibody fragment is preferably an antigen-binding fragment of an antibody. Examples of antibody fragments include Fab, Fab', F(ab')2 and Fv fragments, diabodies, linear antibodies, single-chain antibody molecules, scFv-Fc fragments, multispecific antibodies formed by antibody fragments, and any fragment whose half-life can be increased by chemical modification or incorporation into liposomes. Papain digestion of an antibody produces two identical antigen-binding fragments called "Fab" fragments, and one remaining "Fc" fragment, a name reflecting the ability to crystallize readily. Fab fragments are composed of complete light and heavy chain variable domains (VH) and one heavy chain first constant domain (CH1). Each Fab fragment is monovalent with respect to antigen binding, i.e., it has a single antigen-binding site. Pepsin treatment of antibodies produces one large F(ab')2 fragment, roughly equivalent to two Fab fragments linked by disulfide bonds, with different antigen-binding activity and still capable of cross-linking antigen. Fab' fragments differ from Fab fragments by the addition of several other residues at the carboxy terminus of the CH1 domain, including one or more cysteines from the antibody hinge region. F(ab')2 antibody fragments are naturally produced as paired Fab' fragments, with hinge cysteines between the Fab' fragments. Other chemical couplings of antibody fragments are already known. Fc fragments contain the carboxy terminal portions of two heavy chains held together by disulfide bonds. The effector functions of antibodies are determined by sequences in the Fc region, which is also the region recognized by Fc receptors (FcR) found on several types of cells.

[0042] "Fv" is the minimum antibody fragment that contains a complete antigen recognition and binding site. This fragment consists of a dimer of one heavy and one light chain variable region domain in tight, non-covalent association. Folding of these two domains results in six hypervariable loops (three loops each from the heavy and light chain) that contribute amino acid residues for antigen binding and confer antigen specificity to the antibody. However, even a single variable domain (or half of an Fv containing only three CDRs specific for an antigen) has the ability to recognize and bind antigen, albeit with a lower affinity than the complete binding site. "Single-chain Fv", abbreviated as "sFv" or "scFv", is an antibody fragment that contains antibody VH and VL domains and is linked into a single polypeptide chain. Preferably, the sFv polypeptide further comprises a polypeptide linker between the VH and VL domains, allowing the sFv to form the desired antigen-binding structure.

[0043] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., each antibody in the population is similar except for possible naturally occurring mutations and / or post-translational modifications (e.g., isomerization, amidation) that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. In contrast to polyclonal antibody preparations (which typically contain different antibodies directed against different determinants (epitopes)), each monoclonal antibody is directed against a single determinant on the antigen. These specific In addition to their specificity, an advantage of monoclonal antibodies is that they are synthesized by the culture of a hybridoma and are therefore uncontaminated by other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody obtained from a population of substantially homogeneous antibodies and is not to be construed as requiring production of the antibody by any particular method. For example, monoclonal antibodies for use in accordance with the present invention may be produced by a variety of techniques including, for example, hybridoma techniques, phage display techniques, recombinant DNA techniques, and techniques for producing human or human-like antibodies from animals having partial or entire human immunoglobulin loci or genes encoding human immunoglobulin sequences, and single-cell sequencing techniques.

[0044] As used herein, monoclonal antibodies include "chimeric" antibodies, in which a portion of the heavy and / or light chains are identical or homologous to corresponding sequences in antibodies from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chains are identical or homologous to corresponding sequences in antibodies from another species or belonging to another antibody class or subclass, so long as the desired biological activity is exhibited, as well as fragments of such antibodies.

[0045] "Humanized" forms of non-human (e.g., murine) antibodies are chimeric antibodies that contain minimal sequences derived from non-human immunoglobulins. Thus, a "humanized antibody" is typically a non-human antibody in which the variable domain framework regions have been replaced with sequences found in a human antibody. Typically, in a humanized antibody, the entire antibody (except for the CDRs) is encoded by a polynucleotide of human origin or is identical to such an antibody (except for the CDRs). CDRs (partially or entirely encoded by nucleic acids derived from a non-human organism) are grafted onto the β-pleated sheet framework of a human antibody variable region to produce an antibody whose specificity is determined by the grafted CDRs. Methods for producing such antibodies are well known in the art, for example, by using mice with genetically engineered immune systems. In the present invention, all of the antibodies, single domain antibodies, heavy chain antibodies, etc., include humanized variants of the respective antibodies.

[0046] A "human antibody" is an antibody having an amino acid sequence which corresponds to that of an antibody produced from a human and / or which is produced using any technique disclosed herein for producing human antibodies. This definition of a human antibody expressly excludes humanized antibodies which contain non-human antigen-binding residues. Human antibodies may be produced using a variety of techniques known in the art, including phage display libraries. In some embodiments, the invention also provides single domain antibodies, heavy chain antibodies, antibodies or antigen-binding fragments thereof that bind to the same mesothelin epitope (e.g., the membrane proximal end of mesothelin III region or MD50) as any of the anti-mesothelin single domain antibodies of the invention, i.e., single domain antibodies, heavy chain antibodies, antibodies or antigen-binding fragments thereof that can cross-compete for binding to mesothelin with any of the single domain antibodies of the invention.

[0047] In the present invention, the CDR1 of the single domain antibody comprises the sequence shown in SEQ ID NO:1, which is X1X2X3X4X5X6X7X8X9X 10 X 11 where X1 is G, E, T or A, X2 is S, N, P, A, H, D, K, I or F, X3 is I, S, V, T, D, L, A, M or H, X4 is F, S, I, A, L or G, X5 is N, S, G, A, D, T, E, R or H, X6 is I, L, F, Y, E or N, X7 is N, A, G, D, K, Y, L or S, X8 is A, Y, V, D or N, X9 is E or none, and X 10 is F or nothing, X 11 is A or none. In one or more embodiments, SEQ ID NO:1 is X1X2X3X4X5X6X7X8, where X1 is G, E, T or A, X2 is S, N, P, A, H, D, K, I or F, X3 is I, S, V, T, D, L, A, M or H, X4 is F, S, I, A, L or G, X5 is N, S, G, A, D, T, E or H, X6 is I, L, F, Y or N, X7 is N, A, G, D, K, Y or S, and X8 is A, Y, V or N. Preferably, X1 is G, E, T or A, X2 is S, N, P, H or I, X3 is I, S, T, D, L or A, X4 is F, I or L, and X5 is S, T or none. or E, X6 is I, F or Y, X7 is N, A, D or Y, and X8 is A or Y. In one or more embodiments, SEQ ID NO: 1 is GX2X3X4X5X6X7A, wherein X2 is S, N, A, D, I or F, X3 is I, V, T, D, A, L or S, X4 is F, S, I, A or L, X5 is N, S, A, D, E, T or H, X6 is I, F, N or Y, and X7 is N, G, D or Y. In one or more embodiments, CDR1 comprises a sequence set forth in any one of SEQ ID NOs: 4-27, 73.

[0048] In the present invention, the CDR2 of the single domain antibody comprises the sequence shown in SEQ ID NO:2, which is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 where X1 is I, M, A, T or L, X2 is S, G, N, D, T or V, X3 is S, N, A, R, G or T, X4 is S, T, G, D or N, X5 is N, G, T or I, X6 is S, R, N, D, K, T or G, X7 is D, T, S, I or K, X8 is N, T, G, D or none, X9 is T, K, G or none, and X 10 is G, R or none, and X 11 is V, T or none, X 12 is T or none. Preferably, X1 is I, A or T, X2 is S, G, N or T, X3 is S or R, X4 is T, G or D, X5 is N, G or T, X6 is S, R, N, K or T, X7 is D, T, S, I or K, X8 is N, G or none, X9 is T, G or none, and X 10 is G or nothing, X 11 is V or nothing, X 12is T or none. In one or more embodiments, X3 is S, N, A, R or T. In one or more embodiments, SEQ ID NO:2 is IX2X3X4X5X6X7X8X9, wherein X2 is S, G, N or D, X3 is S, N, A or T, X4 is S, T, G, D or N, X5 is N or G, X6 is S, R, N, D or K, X7 is D, T, S or K, X8 is N, T or none, and X9 is T, K or none. In one or more embodiments, CDR2 comprises a sequence set forth in any one of SEQ ID NOs: 28-47, 74.

[0049] In the present invention, the CDR3 of the single domain antibody comprises the sequence shown in SEQ ID NO:3, which is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 X 23 where X1 is N, H, A or Q, X2 is L, A, G or V, X3 is S, R, E, G, D or T, X4 is N, A, R, G, D, K, V, T, I, E or Q, X5 is Y, F, K, S, C, I, D, G, H or R, X6 is D, A, V, G, R, N, P, T, C, Q or S, X7 is R, Y, T, A, D, K, L, E, S or G, X8 is K, S, F, T, D, Q, E, G, P, R, Y or N, X9 is D, G, I, H, S, Y, Q, K, T, R or V, and X 10 is R, Y, H, N, T, D, P, V, K, C, L or S, and X 11 is Y, D, E, P, F, S, L, I or none, and X 12 is P, V, Q, A, Y, F, N, D, R or None, and X 13 is D, A, Y, V, Q, P or none, and X14 is Y, L, P, A, E or none, and X 15 is C, S, M, P, T or none, X 15 is C, S, M, P or none, X 16 is V, D, S, Y or none, and X 17 is L, F, V, D or none, and X 18 is R, G, M, S or None, and X 19 is D, N, S or none, X 20 is Y, L or nothing, and X 21 is Y or nothing, and X 22 is A or nothing, X 23 is D or nothing. In one or more embodiments, X1 is N, H, A or Q, X2 is L, A, G or V, X3 is S, R, E, G, D or T, X4 is N, A, R, G, D, K, V, T, I or Q, X5 is Y, F, K, S, C, I, D, G, H or R, X6 is D, A, V, G, R, N, P, T, C, Q or S, X7 is R, Y, T, A, D, K, L, E, S or G, X8 is K, S, F, T, D, Q, E, G, P, R, Y or N, X9 is D, G, I, H, S, Y, Q, K, T or V, and X 10 is R, Y, H, N, T, D, P, V, K, C or S, and X 11 is Y, D, E, P, F, S, L or none, X 12 is P, V, Q, A, Y, F, N, D or None, and X 13 is D, A, Y, V, Q or none, and X 14 is Y, L, P, A, E or none, and X 15 is C, S, M, P or none, X 16 is V, D, S, Y or none, and X 17 is L, F, V, D or none, and X 18 is R, G, M, S or None, and X 19 is D, N, S or none, X 20 is Y, L or nothing, and X 21 is Y or nothing, and X 22 is A or nothing, X 23is D or absent. In one or more embodiments, SEQ ID NO: 3 is AX2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 where X2 is A, G or V, X3 is S, E, G, D or T, and X4 is N, X5 is Y, F, K, I, D, G, H or R, X6 is D, A, G, N, P, T, C, Q or S, X7 is R, Y, T, A, D, K, L or G, X8 is K, S, F, D, Q, G, P, Y or N, X9 is D, G, I, S, Y, Q, K or V, and X 10 is R, Y, H, T, D, P, V, K or C, and X 11 is Y, D, E, F, S, L or none, X 12 is P, V, A, Y, F, N, D or None, and X 13 is D, A, Y, V or none, and X 14 is Y, P, E or none, and X 15 is S, P or none, X 16 is D, Y or none, X 17 is F, D or none, X 18 is G, S or none, X 19 is N or nothing. Preferably, X1 is A, X2 is A or V, X3 is S, E, G or D, X4 is N, R, D or I, X5 is Y, F, K, D or H, X6 is D, G, P, C or S, X7 is R, Y, D, K or L, X8 is K, Q, G or N, X9 is D, S, Y or Q, and X 10 is R, Y, D, V or S, and X 11 is Y, D, F, S, L or none, and X 12 is P, F, or None, and X 13 is D, V or none, X 14 is P or nothing, and X 15is S or nothing, X 16 is D or nothing, X 17 is F or nothing, X 18 is G or nothing, X 19 is N or none, and X 20 -X 23 In one or more embodiments, the CDR3 comprises a sequence set forth in any one of SEQ ID NOs: 48-72, 75.

[0050] In one or more embodiments, the CDR1 of the single domain antibody comprises a sequence set forth in any one of SEQ ID NOs: 5, 11, 14, 15, 17, 21, 27, 73, the CDR2 comprises a sequence set forth in any one of SEQ ID NOs: 29, 35, 37, 38, 39, 43, 40, 74, and the CDR3 comprises a sequence set forth in any one of SEQ ID NOs: 49, 55, 58, 59, 61, 65, 72, 75. In one or more embodiments, the single domain antibody comprises a CDR1, CDR2 and CDR3 as set forth in any one of groups a1-a26 of Table 1:

[0051] [Table 2] Preferably, it comprises CDR1, CDR2 and CDR3 shown in any one of the groups selected from a2, a8, a11, a12, a14, a18, a25 and a26.

[0052] In one or more embodiments, FR1 of the single domain antibody VHH is selected from FR1 of the VHH of each antibody number in Table 1, FR2 of the VHH is selected from FR2 of the VHH of each antibody number in Table 1, FR3 of the VHH is selected from FR3 of the VHH of each antibody number in Table 1, and FR4 of the VHH is selected from FR4 of the VHH of each antibody number in Table 1. In a preferred embodiment, the FR regions of the single domain antibody VHH of the invention are the FR regions of any one of the VHHs selected from the antibody SEQ ID NOs: 76-120. More preferably, the CDRs of such antibodies are selected from any one of the groups a1-a25. In one or more embodiments, the single domain antibody VHH is depicted in any one of SEQ ID NOs: 76-120. Preferably, the single domain antibody is depicted in any one of SEQ ID NOs: 77, 83, 86, 87, 89, 93, 100, 103.

[0053] A mesothelin binding molecule as described herein can be a monovalent or polyvalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody or antigen-binding fragment thereof, or an antibody or antigen-binding fragment thereof, comprising one, two or more of the anti-mesothelin single domain antibodies as described herein. The heavy chain antibody further comprises a heavy chain constant region, e.g., a camelid heavy chain antibody or a cartilaginous fish heavy chain antibody constant region. Preferably, the heavy chain constant region is set forth in SEQ ID NO:121.

[0054] The present invention further includes the antibody derivatives and analogs. The terms "derivative" and "analog" refer to proteins that essentially retain a biological function or activity that is homologous to the antibody of the present invention. The derivative or analog of the present invention may be (i) a polypeptide having a substitution at one or more amino acid residues, or (ii) a polypeptide formed by fusing the mature polypeptide to another compound (e.g., a compound that extends the half-life of the polypeptide, such as polyethylene glycol), or (iii) a polypeptide formed by fusing an additional amino acid sequence to the polypeptide sequence (e.g., a leader sequence, a secretion sequence, a sequence for purifying the polypeptide, or a proteinogenic sequence, or a fusion protein formed with a 6His tag). As taught herein, these derivatives and analogs are within the knowledge of those skilled in the art.

[0055] A person skilled in the art can obtain a variant of the antibody or functional fragment thereof by modifying one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) amino acids in the sequence of the present invention, provided that the antibody activity is not substantially affected. These variants include, but are not limited to, those obtained by deleting, inserting, and / or substituting one or more (usually 1-50, preferably 1-30, more preferably 1-20, and most preferably 1-10) amino acids, and adding one or more (usually 20 or less, preferably 10 or less, and more preferably 5 or less) amino acids to the C-terminus and / or N-terminus. In the art, conservative substitution with amino acids having close or similar properties usually does not change the function of the protein. For example, amino acids having similar properties are substituted in the FR and / or CDR regions of the variable region. Amino acid residues that can be conservatively substituted are well known in the art. Such substituted amino acid residues may or may not be encoded by the genetic code. For example, addition of one or more amino acids to the C-terminus and / or N-terminus usually does not alter the function of the protein. These are considered to be within the scope of the present invention. Table 2 shows the VHH sequences of the M2339 antibody and exemplary variants thereof.

[0056] [Table 3]

[0057] Variants of the antibodies described herein include homologous sequences, conservative variants, allelic variants, naturally occurring variants, induced variants, and proteins encoded by DNA capable of hybridizing to DNA encoding an antibody of the invention under high or low stringency conditions, and polypeptides or proteins obtained using antisera against an antibody of the invention.

[0058] In some embodiments, the sequence of a variant according to the invention may have at least 95%, 96%, 97%, 98% or 99% identity to the sequence from which it is derived. Sequence identity according to the invention can be measured using sequence analysis software, such as the computer program BLAST using default arguments, in particular BLASTP or TBLASTN. The invention further includes molecules having antibody heavy chain variable regions with CDRs, so long as those CDRs have greater than 90% homology (preferably greater than 95%, most preferably greater than 98%) with the CDRs identified herein.

[0059] The antibodies of the present invention may be produced by methods routinely used in the art, such as, for example, hybridoma techniques well known in the art. The heavy chain antibodies of the present invention may be produced by methods routinely used in the art, such as, for example, phage display techniques well known in the art. Alternatively, the antibodies or heavy chain antibodies of the present invention may be expressed in other cell systems. A suitable mammalian host cell may be transformed with a sequence encoding the antibody of the present invention. The transformation may be performed by any known method, including, for example, packaging the polynucleotide into a virus (or viral vector) and transducing the host cell with the virus (or vector). The transformation process used is determined by the host to be transformed. Methods for introducing heteropolynucleotides into mammalian cells are well known in the art and include dextran-mediated transfection, calcium phosphate precipitation, polybrene-mediated transfection, protoplast fusion, electroporation, encapsulation of polynucleotides in liposomes, and direct microinjection of DNA into the cell nucleus. Mammalian cell lines available as hosts for expression are well known in the art and include, but are not limited to, the various immortalized cell lines available from the American Type Culture Collection (ATCC), including, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., HepG2), etc. Particularly preferred cell lines are selected by identifying cell lines that have high expression levels and produce antibodies with basic mesothelin binding properties.

[0060] nucleic acid The present invention further provides a polynucleotide encoding the antibody or a fragment thereof. The present specification provides polynucleotides encoding the heavy chain variable region, the light chain variable region, the heavy chain, the light chain, and each CDR. The polynucleotide of the present invention may be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand.

[0061] As will be appreciated by those skilled in the art, the degeneracy of the genetic code allows for the production of a large number of nucleic acids, all of which will encode the antibody or antigen-binding fragment thereof of the invention. Thus, once a particular amino acid sequence has been identified, one skilled in the art can produce any number of different nucleic acids by simply modifying one or more codons in a manner that does not alter the amino acid sequence encoding the protein. Thus, the present invention also relates to polynucleotides that hybridize with the above polynucleotide sequences and have at least 50%, preferably at least 70%, more preferably at least 80% identity between the two sequences. In particular, the present invention relates to polynucleotides that can hybridize with the polynucleotides of the present invention under stringent conditions. In the present invention, "stringent conditions" refers to (1) hybridization at low ionic strength and high temperature, e.g., 0.2×SSC, 0.1% SDS, 60° C., and (2) hybridization at low ionic strength and high temperature, e.g., 0.2×SSC, 0.1% SDS, 60° C. or (2) hybridization with a denaturing agent, e.g., 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll at 42°C; or (3) hybridization occurs only if the identity between the two sequences is at least 90% or greater, more preferably 95% or greater. Furthermore, the polypeptides encoded by the hybridizable polynucleotides have the same biological function and activity as the mature polypeptides.

[0062] The full length nucleotide sequence of the antibody of the present invention or fragments thereof can usually be obtained by PCR amplification, recombinant techniques or artificial synthesis. The relevant sequences can be synthesized by artificial synthesis, especially when the fragments are short in length. Usually, several small fragments are synthesized and then joined to obtain a fragment of a long sequence. In addition, the coding sequence of the heavy chain can be fused to an expression tag (such as 6His) to form a fusion protein.

[0063] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. It is usually cloned into a vector and introduced into a cell, and then isolated from the host cell grown by conventional methods to obtain the relevant sequence. The biomolecules (nucleic acids, proteins, etc.) according to the present invention also include biomolecules that exist in isolated form. Currently, it is possible to obtain DNA sequences that code for the proteins of the present invention (or fragments thereof, or derivatives thereof) only by chemical synthesis. The DNA sequences are then introduced into a variety of existing DNA molecules (e.g., vectors) and cells known in the art. Mutations may also be introduced into the protein sequences of the present invention by chemical synthesis.

[0064] Therefore, the present invention further relates to nucleic acid constructs, such as expression vectors and recombinant vectors, that contain the appropriate DNA sequences described above and appropriate promoter or control sequences. These vectors can be used to transform appropriate host cells to express the protein. Vectors usually contain sequences used for maintaining the plasmid and cloning and expressing exogenous nucleotide sequences. Said sequences (collectively referred to in some embodiments as "flanking sequences") usually contain one or more of the following nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcription termination sequence, a complete intron sequence including donor and acceptor splice sites, a sequence encoding a leader sequence used for polypeptide secretion, a ribosome binding site, a polyadenylation sequence, a multiconnexon region for inserting a nucleic acid encoding an antibody to be expressed, and any tagging elements.

[0065] The host cell may be a prokaryotic cell such as a bacterial cell, a lower eukaryotic cell such as a yeast cell, or a higher eukaryotic cell such as a mammalian cell. Representative examples include bacterial cells such as E. coli, Streptomyces, Salmonella typhimurium, fungal cells such as yeast, insect cells such as fruit fly S2 or Sf9, and animal cells such as CHO, COS7, and 293 cells.

[0066] In some embodiments, the host cell may be a variety of functional cells known in the art, such as, for example, a variety of killer cells, including, but not limited to, cytokine-induced killer cells (CIK), dendritic cell-stimulated cytokine-induced killer cells (DC-CIK), cytotoxic T lymphocytes (CTL), gamma delta T cells, natural killer cells (NK), tumor-infiltrating lymphocytes (TIL), lymphokine-activated killer cells (LAK), CD3AK cells (anti-CD3 monoclonal antibody killer cells), and CAR-T / TCR-T cells. In some embodiments, the killer cells are T cells or NK cells. Exemplary NK cells include, but are not limited to, primary NK cells, NK cell lines (e.g., NK92), and NKT cells. In some embodiments, the NK cells are primary NK cells. Exemplary T cells include, but are not limited to, T cells of mixed cell populations such as peripheral blood T lymphocytes, cytotoxic killer T cells (CTLs), helper T cells, suppressor / regulatory T cells, γδ T cells, cytokine-induced killer cells (CIKs), tumor infiltrating lymphocytes (TILs), etc. In some embodiments, the T cells are T cells derived from peripheral blood T lymphocytes and TILs.

[0067] Transformation of host cells with recombinant DNA can be performed by conventional techniques well known to those skilled in the art. If the host is a prokaryotic organism such as E. coli, competent cells capable of incorporating DNA can be harvested after exponential growth phase and treated with CaCl2 using procedures well known in the art. Another method is to utilize MgCl2. If necessary, transformation can also be performed by electroporation. If the host is a eukaryotic organism, DNA transfection methods such as calcium phosphate co-precipitation, microinjection, electroporation, liposome packaging, and other conventional mechanical methods can be used.

[0068] The obtained transformant can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used for the culture may be selected from various conventional media depending on the host cells used. The culture is performed under conditions suitable for the growth of the host cells. After the host cells have grown to an appropriate cell density, the selected promoter is induced by an appropriate method (such as temperature change or chemical induction), and the cells are further cultured for a certain period of time.

[0069] The polypeptide in the above method is expressed intracellularly or in the cell membrane, or secreted extracellularly. If necessary, the recombinant protein may be separated and purified by various separation methods utilizing its physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to, conventional renaturation, treatment with protein precipitants (salting out method), centrifugation, osmotic sterilization, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques, as well as combinations of these methods.

[0070] Therapeutic Uses and Pharmaceutical Compositions By constructing a library of nanobodies, the inventors discovered, expressed and purified 25 nanobodies that can bind to MSLN and MD50 proteins. The binding ability and drug safety of these antibodies to antigens and cells were verified by protein-level affinity detection, cell-level affinity detection, tumor cell-MSLN binding detection, epitope competition experiments and tissue cross-reactivity. Accordingly, all of the antibody embodiments described herein may be utilized in the manufacture of a medicament for preventing or treating various conditions and diseases described herein, particularly conditions that are diseases or conditions associated with cells that express mesothelin, hi some embodiments, the conditions and diseases are cancers, including but not limited to mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, gastric cancer, and the like.

[0071] The pharmaceutical compositions described herein comprise a binding molecule described herein and a pharma- ceutically acceptable auxiliary, including, but not limited to, a diluent, vector, solubilizer, emulsifier, preservative, and / or adjuvant. The auxiliary is preferably non-toxic to the recipient at the dosage and concentration employed. Such auxiliary includes, but is not limited to, saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. In some embodiments, the pharmaceutical composition may include substances to improve, maintain, or retain, for example, the pH value, osmolarity, viscosity, clarity, color, isotonicity, odor, sterility, stability, dissolution or release rate, absorption or penetration of the composition. These substances are well known in the art. The optimal pharmaceutical composition is determined by the desired route of administration, delivery mode, and required dosage.

[0072] Pharmaceutical compositions for in vivo administration are usually provided in the form of a sterile preparation. Sterilization is achieved by filtration through a sterile filtration membrane. If the composition is lyophilized, it is sterilized by this method before or after lyophilization and reconstitution. The pharmaceutical composition of the present invention may be used for parenteral delivery. Compositions utilized for parenteral administration can be stored in lyophilized form or in solution. For example, It can be prepared by conventional methods using aqueous solutions containing saline, glucose and other additives. Parenteral compositions are usually placed into a container having a sterile access port, such as an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle. Alternatively, the composition may be used for inhalation or gastrointestinal (e.g., oral) delivery. The pharmaceutically acceptable composition is prepared by techniques within the art. Other pharmaceutical compositions will be apparent to those skilled in the art, including formulations in which the antibody is in a sustained or controlled release delivery formulation. Several other techniques for providing sustained or controllable delivery modes (e.g., liposomal vectors, biodegradable microparticles or porous beads, and depot injections) are also well known to those skilled in the art.

[0073] Once prepared, the pharmaceutical composition is stored in a sterile vial in the form of a solution, suspension, gel, emulsion, solid, crystal, or dehydrated or lyophilized powder. The preparation can be stored either in a ready-to-use form or in a form for reconstitution immediately prior to administration (e.g., lyophilized). The present invention further provides a reagent kit for producing a single-dose administration unit. The reagent kit of the present invention includes a first container having a dried protein and a second container having an aqueous preparation, respectively. In some embodiments of the present invention, a reagent kit is provided that includes single-chamber and multi-chamber prefilled syringes (e.g., a liquid syringe and a lyophilized syringe).

[0074] The present invention provides a method for treating a patient (particularly a patient with a mesothelin-related disease) by administering a binding molecule according to any one of the embodiments of the present invention or a pharmaceutical composition thereof. As used herein, the terms "patient", "subject", "individual" and "object" are used interchangeably and include any living organism, preferably an animal, more preferably a mammal (e.g., rat, mouse, dog, cat, rabbit, etc.), and most preferably a human. "Treatment" refers to administering a therapeutic regimen described herein to a subject to obtain at least one positive therapeutic effect (e.g., a reduction in the number of cancer cells, a reduction in tumor volume, a reduction in the rate of cancer cell invasion into surrounding organs, or a reduction in the rate of tumor metastasis or tumor growth). The therapeutic regimen that effectively treats a patient will vary depending on various factors (e.g., the patient's disease state, age, weight, and the ability of the therapy to activate the subject's anti-cancer response).

[0075] The therapeutically effective amount of the pharmaceutical composition comprising the binding molecule of the present invention to be employed is determined, for example, by the extent and goal of the treatment. As will be understood by those skilled in the art, the appropriate dosage level used for treatment varies in part depending on the molecule to be delivered, the indication, the route of administration, and the size (weight, body surface or organ size) and / or condition (age and general health condition) of the patient. In some embodiments, the dosage may be set by the clinician and the route of administration may be modified to obtain optimal therapeutic effect. For example, about 10 μg / kg body weight to about 50 μg / kg body weight per day. The frequency of administration depends on the pharmacokinetic parameters of the binding molecule in the preparation used.Typically, the clinician administers the composition to a dosage that achieves the desired effect.Thus, the composition may be administered as a single dose, or as two or more doses (which may or may not contain the same amount of the required molecule) over time, or as a continuous infusion via an implantation device or catheter.

[0076] The route of administration of the pharmaceutical compositions follows known methods, for example, via injection via oral, intravenous, intraperitoneal, intracerebral (intracerebral), intraventricular, intramuscular, intraocular, intraarterial, portal or intralesional routes, by sustained release systems or by implantation devices.

[0077] Diagnostic, Detection and Reagent Kits The binding molecules of the invention, due to their high affinity for mesothelin, can be used in assays, for example in conjunction with assays to detect and / or quantitate mesothelin expressed in tissues or cells. Binding molecules, such as single domain antibodies, can be used to further study the role of mesothelin in disease. Methods for detecting mesothelin include, but are not limited to, the following: cell and / or tissue samples. and detecting the level of mesothelin in the sample.

[0078] The mesothelin of the present invention can be used for diagnostic purposes to detect, diagnose, or monitor diseases and / or conditions associated with mesothelin. The present invention provides for detecting the presence of mesothelin in a sample by representative immunohistological methods well known to those of skill in the art. Mesothelin can be detected in vivo or in vitro. Examples of suitable methods for detecting the presence of mesothelin include ELISA, FACS, RIA, and the like.

[0079] For diagnostic applications, the binding molecule, such as a single domain antibody, is usually labeled with a detectable labeling group. Suitable labeling groups include, but are not limited to, the following: radioisotopes or radionuclides (e.g., 3H, 14C, 15N, 35S, 90Y, 99Tc, 111In, 125I, 131I), fluorophores (e.g., FITC, rhodamine, lanthanide phosphors), enzymophores (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), chemiluminophores, biotin moieties or predetermined polypeptide epitopes recognized by secondary reporters (e.g., leucine zipper sequences, binding sites utilized for secondary antibodies, metal binding domains, epitope tags), MRI (magnetic resonance imaging) or CT (computed tomography) contrast agents. Each method for labeling proteins is well known in the art and can be used in the practice of the present invention.

[0080] Another aspect of the invention provides a method for detecting the presence of a test molecule that competitively binds with mesothelin to an antibody of the invention. An illustrative example of the measurement involves detecting the amount of free antibody in a solution containing a given amount of mesothelin in the presence or absence of the test molecule. An increase in the amount of free antibody (i.e., antibody that is not bound to mesothelin) indicates that the test molecule is capable of competitively binding with mesothelin relative to the antibody. In one embodiment, the antibody is labeled with a labeling group. Alternatively, the test molecule is labeled and the amount of free test molecule is monitored in the presence or absence of the antibody.

[0081] The present invention also provides a detection kit for detecting levels of mesothelin, which includes an antibody that recognizes mesothelin, a dissolution medium for dissolving a sample, general reagents and buffers required for detection, such as various buffers, a detection label, a detection substrate, etc. The detection kit may be an in vitro diagnostic device.

[0082] The present invention specifically includes any of the following embodiments. 1. A mesothelin binding molecule comprising an anti-mesothelium single domain antibody having complementarity determining regions (CDRs) including CDR1, CDR2 and CDR3, wherein CDR1 comprises the sequence shown in SEQ ID NO:1, CDR2 comprises the sequence shown in SEQ ID NO:2 and CDR3 comprises the sequence shown in SEQ ID NO:3;

[0083] SEQ ID NO:1 is X1X2X3X4X5X6X7X8X9X 10 X 11 where X1 is G, E, T or A, X2 is S, N, P, A, H, D, K, I or F, X3 is I, S, V, T, D, L, A, M or H, X4 is F, S, I, A, L or G, X5 is N, S, G, A, D, T, E, R or H, X6 is I, L, F, Y, E or N, X7 is N, A, G, D, K, Y, L or S, X8 is A, Y, V, D or N, X9 is E or none, and X 10 is F or nothing, X 11 is A or nothing,

[0084] SEQ ID NO: 2 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 where X1 is I, M, A, T or L, X2 is S, G, N, D, T or V, X3 is S, N, A, R, G or T, X4 is S, T, G, D or N, X5 is N, G, T or I, X6 is S, R, N, D, K, T or G, X7 is D, T, S, I or K, X8 is N, T, G, D or none, X9 is T, K, G or none, and X 10 is G, R or none, and X 11 is V, T or none, X 12 is T or nothing,

[0085] SEQ ID NO: 3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 X 23 where X1 is N, H, A or Q, X2 is L, A, G or V, X3 is S, R, E, G, D or T, X4 is N, A, R, G, D, K, V, T, I, E or Q, X5 is Y, F, K, S, C, I, D, G, H or R, X6 is D, A, V, G, R, N, P, T, C, Q or S, X7 is R, Y, T, A, D, K, L, E, S or G, X8 is K, S, F, T, D, Q, E, G, P, R, Y or N, X9 is D, G, I, H, S, Y, Q, K, T, R or V, and X 10 is R, Y, H, N, T, D, P, V, K, C, L or S, and X 11 is Y, D, E, P, F, S, L, I or none, and X 12 is P, V, Q, A, Y, F, N, D, R or None, and X 13 is D, A, Y, V, Q, P or none, and X 14 is Y, L, P, A, E or none, and X 15 is C, S, M, P, T or none, X 15 is C, S, M, P or none, X 16 is V, D, S, Y or none, and X 17 is L, F, V, D or none, and X 18 is R, G, M, S or None, and X 19 is D, N, S or none, X 20 is Y, L or nothing, and X 21 is Y or nothing, and X 22 is A or nothing, X 23 is D or absent, mesothelin binding molecule.

[0086] 2. The mesothelin-binding molecule according to item 1, SEQ ID NO:1 is X1X2X3X4X5X6X7X8, wherein X1 is G, E, T or A, X2 is S, N, P, A, H, D, K, I or F, X3 is I, S, V, T, D, L, A, M or H, X4 is F, S, I, A, L or G, X5 is N, S, G, A, D, T, E or H, X6 is I, L, F, Y or N, X7 is N, A, G, D, K, Y or S, and X8 is A, Y, V or N; preferably, SEQ ID NO: 1 is X1X2X3X4X5X6X7X8, where X1 is G, E, T or A, X2 is S, N, P, H or I, X3 is I, S, T, D, L or A, X4 is F, I or L, X5 is S, T or E, X6 is I, F or Y, X7 is N, A, D or Y, and X8 is A or Y;

[0087] SEQ ID NO: 2 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 where X1 is I, M, A, T or L, X2 is S, G, N, D, T or V, X3 is S, N, A, R or T, X4 is S, T, G, D or N, X5 is N, G, T or I, X6 is S, R, N, D, K, T or G, X7 is D, T, S, I or K, X8 is N, T, G, D or none, X9 is T, K, G or none, and X 10 is G, R or none, and X 11 is V, T or none, X 12 is T or nothing; preferably, SEQ ID NO:2 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 where X1 is I, A or T, X2 is S, G, N or T, X3 is S or R, X4 is T, G or D, X5 is N, G or T, X6 is S, R, N, K or T, X7 is D, T, S, I or K, X8 is N, G or none, X9 is T, G or none, and X 10 is G or nothing, X 11is V or nothing, X 12 is T or nothing,

[0088] SEQ ID NO: 3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 X 23 where X1 is N, H, A or Q, X2 is L, A, G or V, X3 is S, R, E, G, D or T, X4 is N, A, R, G, D, K, V, T, I or Q, X5 is Y, F, K, S, C, I, D, G, H or R, X6 is D, A, V, G, R, N, P, T, C, Q or S, X7 is R, Y, T, A, D, K, L, E, S or G, X8 is K, S, F, T, D, Q, E, G, P, R, Y or N, X9 is D, G, I, H, S, Y, Q, K, T or V, and X 10 is R, Y, H, N, T, D, P, V, K, C or S, and X 11 is Y, D, E, P, F, S, L or none, X 12 is P, V, Q, A, Y, F, N, D or None, and X 13 is D, A, Y, V, Q or none, and X 14 is Y, L, P, A, E or none, and X 15 is C, S, M, P or none, X 16 is V, D, S, Y or none, and X 17 is L, F, V, D or none, and X 18 is R, G, M, S or None, and X 19 is D, N, S or none, X 20 is Y, L or nothing, and X 21 is Y or nothing, and X 22 is A or nothing, X 23is D or absent; preferably, SEQ ID NO: 3 is AX2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 where X2 is A or V, X3 is S, E, G or D, X4 is N, R, D or I, X5 is Y, F, K, D or H, and X6 is D, G, P, C or S, X7 is R, Y, D, K or L, X8 is K, Q, G or N, X9 is D, S, Y or Q, and X 10 is R, Y, D, V or S, and X 11 is Y, D, F, S, L or none, and X 12 is P, F, or none, and X 13 is D, V or none, X 14 is P or nothing, and X 15 is S or nothing, X 16 is D or nothing, X 17 is F or nothing, X 18 is G or nothing, X 19 is N or none.

[0089] 3. The mesothelin binding molecule of claim 1 or 2, wherein the CDR1 of the single domain antibody comprises a sequence as set forth in any one of SEQ ID NOs: 4-27, 73, the CDR2 comprises a sequence as set forth in any one of SEQ ID NOs: 28-47, 74, and the CDR3 comprises a sequence as set forth in any one of SEQ ID NOs: 48-72, 75; Preferably, the single domain antibody comprises CDR1, CDR2 and CDR3 as shown in any one of groups a1 to a26 of Table 1.

[0090] 4. The mesothelin binding molecule according to item 1 or 2, The FR region of the single domain antibody comprises the FR region of any one of VHHs selected from SEQ ID NOs: 76-120, and / or The single domain antibody VHH is depicted in any one of SEQ ID NOs: 76-120, and / or The mesothelin-binding molecule is characterized in that it is a monovalent or polyvalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody or antigen-binding fragment thereof, or an antibody or antigen-binding fragment thereof, comprising one, two or more of the single domain antibodies.

[0091] 5. The mesothelin-binding molecule of claim 4, wherein the mesothelin-binding molecule is a heavy chain antibody, and the heavy chain antibody further comprises heavy chain constant regions CH2 and CH3; Preferably, the heavy chain constant region comprises the sequence shown in SEQ ID NO:121.

[0092] 6. A polynucleotide, comprising: (1) a coding sequence for a mesothelin binding molecule according to any one of items 1-5; (2) The complementary sequence of (1); (3) A 5-50 bp fragment of either (1) or (2) A polynucleotide selected from the group consisting of:

[0093] 7. A nucleic acid construct, comprising the polynucleotide according to item 6; Preferably, said nucleic acid construct is characterized in that it is a recombinant vector or an expression vector.

[0094] 8. A phage comprising a mesothelin-binding molecule according to any one of items 1 to 5, Preferably, the mesothelin-binding molecule is displayed on the surface of the phage.

[0095] 9. A host cell, comprising: (1) expressing a mesothelin binding molecule according to any one of items 1-5; and / or (2) comprising the polynucleotide according to item 6; and / or (3) A host cell comprising the nucleic acid construct according to item 7.

[0096] 10. A method for producing a mesothelin binding molecule, comprising culturing the host cell of item 9 under conditions suitable for production of the mesothelin binding molecule, and optionally purifying the mesothelin binding molecule from the culture.

[0097] 11. A pharmaceutical composition comprising a mesothelin-binding molecule according to any one of items 1 to 5, a polynucleotide according to item 6, a nucleic acid construct according to item 7, a phage according to item 8 or a host cell according to item 9, and a pharma- ceutically acceptable auxiliary; Preferably, the pharmaceutical composition is utilized to treat cancer.

[0098] 12. Use of the mesothelin-binding molecule according to any one of items 1 to 5 in the manufacture of a drug for preventing or treating cancer.

[0099] 13. A mesothelin or MD50 detection kit for use in evaluating the efficacy of drug therapy or diagnosing cancer, the kit comprising a mesothelin-binding molecule according to any one of items 1 to 5, a polynucleotide according to item 6, a nucleic acid construct according to item 7, and a phage according to item 8 or a host cell according to item 9; Preferably, the kit further comprises a reagent for detecting binding of mesothelin or MD50 to the single domain antibody, antibody, or antigen-binding fragment thereof; More preferably, the reagent is a reagent for detecting the binding by enzyme immunoassay.

[0100] 14. A non-diagnostic method for detecting the presence of mesothelin or MD50 in a sample, comprising incubating a mesothelin binding molecule of any one of items 1-5 with the sample and detecting binding of mesothelin or MD50 to the single domain antibody, antibody or antigen-binding fragment thereof, thereby determining the presence of mesothelin or MD50 in the sample.

[0101] 15. Use of the mesothelin-binding molecule according to any one of items 1 to 5 in the detection of mesothelin or MD50 in a sample, in the evaluation of the effect of drug treatment, or in the preparation of a kit for cancer diagnosis.

[0102] The present invention will be described below with reference to specific examples. These examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The methods and materials used in the examples are well known in the art unless otherwise specified. EXAMPLES

[0103] Example 1, Alpaca Immunization 1.1 Immunogen preparation: The mesothelin sequence was examined at NCBI, fused with the human IgG Fc fragment sequence, and synthesis was outsourced to GenScript (Nanjing). A eukaryotic expression vector was constructed using the pCDNA3.4 (Thermo) plasmid, and the synthesized plasmid was then transferred to ExpiCHO. TM (Thermo Fisher) expression system, and after expression, further affinity purification was performed using a 5 mL Protein A prepacked column (GE). The purified sample was replaced with, for example, PBS buffer, and the purity was identified by SDS-PAGE electrophoresis gel and HPLC, and the activity was identified by ELISA. After that, it was aliquoted and frozen and stored in a -80°C refrigerator for subsequent immunization.

[0104] 1.2 Alpaca immunity: The amount of the first immunization antigen (MSLN.hFc) was 400μg, which was mixed uniformly with the adjuvant (GERBU FAMA) and injected subcutaneously into four selected sites on the back of the alpaca, with the immunization volume at each site being 1mL. From the second to the sixth immunization: the amount of the immunization antigen was 200μg, which was injected subcutaneously into four selected sites on the back of the alpaca, with the immunization volume at each site being 1mL. The interval between each immunization was one week.

[0105] 1.3 Immune serum titer detection: 1.3.1 Protein level titer detection The MSLN.His antigen was coated overnight at 4°C, blocked and washed, and then gradient diluted The serum was added to an ELISA plate and incubated, then further incubated with anti-llama (anti-alpaca) IgG HRP (Abcam) antibody, washed, and colored with TMB coloring solution. The reaction was terminated with 2M HCl, and the absorbance value at OD450nm was detected with a microplate reader. The experimental results are shown in Figure 1. After six immunizations, the titer of the alpaca reached a relatively high level (>243,000). 1.3.2 Cell-level titer detection MSLN-transfected HEK293T cells were plated in 96-well plates, with the amount of cells being 3 × 10 5 The cells were incubated with 3-fold gradient dilutions of serum. After incubation and washing, anti-llama IgG PE (Jackson) antibody was added and incubated, and after washing, the cells were resuspended in PBS and the fluorescence intensity (MFI) was detected by a flow cytometer (Beckman). The results are shown in Figure 2.

[0106] Example 2. Construction and screening of nanobody immune library against MSLN (1) After six immunizations, 100 mL of camel peripheral blood lymphocytes were extracted, and total RNA was extracted. RNA extraction was performed according to the instructions for use with the RNAiso reagent from Takara. (2) Using RNA as a template and oligo dT as a primer, the first strand of cDNA was synthesized according to the instructions for reverse transcriptase manufactured by Takara. (3) Using PrimeSTAR high fidelity DNA polymerase, genes encoding the variable regions of heavy chain antibodies were obtained by nested PCR. Amplification of variable region fragments of heavy chain antibodies by nested PCR:

[0107] 1st PCR: Upstream primer: GTCCTGGCTGCTCTTCTACAAGGC Downstream primer: GGTACGTGCTGTTGAACTGTTCC The fragment between the heavy chain antibody guide peptide and antibody CH2 was amplified, annealed at 55° C., and cycled for 30 cycles; a DNA fragment of approximately 600 bp was recovered and used as a template for the second PCR. Second PCR: Upstream primer: GATGTGCAGCTGCAGGAGTCTGGRGGAGG Downstream primer: GGACTAGTGCGGCCGCTGGAGACGGTGACCTGGGT Fragments between the heavy chain antibody FR1 region and the long and short hinge regions (long and short fragments) were amplified, annealed at 55°C, and cycled for 30 cycles to recover the targeted fragment, which had a size of approximately 500 bp, i.e., the electrophoretic band of the nanobody gene was approximately 500 bp.

[0108] (4) The phagemid pME207 and the PCR amplified product were double-enzymatically cleaved (NEB) with Sfi I and Not I, respectively, recovered and quantified, and then the two fragments were ligated with T4 DNA ligase (TaKaRa) at a molar ratio of 1:3 and ligated overnight at 16°C. (5) The ligation product was precipitated with ethanol, dissolved in 100 μL of sterile water, and electroporated 10 times to transform E. coli TG1. After electric shock, 100 μL of the cultured bacterial liquid was taken, diluted several-fold, and spread on an ampicillin LB culture plate to calculate the library volume. The remainder was spread on an ampicillin 2×YT culture plate and inverted cultured at 37°C for 13 to 16 hours. The bacterial lawn on the culture plate was rubbed and washed with 10 mL of 2×YT medium, and then glycerol was added to a final concentration of 25%, divided into small portions, and stored at -80°C. The library volume was 4.3×10 9 To detect the insertion rate of the library, 48 clones were randomly selected and subjected to colony PCR, which revealed an insertion rate of over 90%.

[0109] (6) Based on the calculated library volume, 10x the library volume of viable cells was inoculated into 200 mL of 2xYT (containing 2% glucose, 100 μg / mL ampicillin) and cultured at 37°C and 200 rpm until OD600 reached 0.5. Helper phage was added at a multiplicity of infection of 20:1, and the culture was left to stand at 37°C for 30 min, then incubated at 37°C and 200 rpm for 30 min. The culture was centrifuged, resuspended and precipitated in 200 mL of 2xYT (containing 100 μg / mL ampicillin and 50 μg / mL kanamycin), and incubated at 37°C for 250 rpm. After overnight incubation at 4°C for 1 min, the mixture was centrifuged at 8000 rpm and the supernatant was collected. 5×PEG / NaCl solution was added, the mixture was left on ice for 60 min, centrifuged at 8000 rpm for 30 min, and resuspended in 5 mL of PBS to obtain an anti-MSLN single domain heavy chain antibody (VHH) immune library. 10 μL was taken for titer measurement, and the remainder was aliquoted and stored at -80°C.

[0110] (7) MD50, a 94 amino acid long protein (GenBank: AAH09272.1, 487-580) located at the membrane proximal end of mesothelin, was used to coat an ELISA plate with 10 μg / mL, 100 μL / well, and left at 4°C overnight to simultaneously set up a negative control. On the second day, 200 μL of 3% BSA was added to each of five wells and blocked for 2 hours at room temperature. After 2 hours, the plate was washed three times with PBST (PBS containing 0.05% Tween 20). After washing the plate, phages (2-3 × 10 11 100μL of tfu immune camel nanobody phage display library was added to each negative selection well and incubated at room temperature for 1.5 hours. The supernatant after negative selection was transferred to the target antigen-coating well and incubated at room temperature for 1.5 hours. The unbound phages were washed 12 times with PBST (PBS containing 0.05% Tween 20) to wash away the unbound phages. Phages that specifically bind to MSLN were dissociated using Glycine (SIGMA), and the eluted phages were neutralized with Tris (Invitrogen, 1M, PH8.0), then infected with TG1 in the logarithmic phase, and amplified before the next "adsorption-elution" step. Finally, the eluted phages were infected with TG1, and TG1 was induced to express nanobodies using IPTG (Thermo), and ELISA plates were coated with MSLN protein and MD50 protein, the supernatant was taken for ELISA detection, and clones with OD450>0.5 were taken and sequenced.

[0111] (8) Sequence analysis yielded a total of 25 clones capable of binding to MSLN protein and MD50 protein, and one clone capable of binding to MSLN.His protein (Sino Biological, Inc. (China), MSN-H5223), as shown in the table below. The amino acid sequence of the negative control is as shown in SEQ ID NO.:2 in CN106046152A.

[0112] [Table 4] [Table 5]

[0113] Example 3. Expression and purification of candidate antibodies The nanobody was constructed in pCDNA3.4-IgG4 vector and expressed by ExpiCHOTM (Thermo Fisher) expression system for 1 week, after which the supernatant was taken and purified by Protein A (GE). Next, the protein mass and concentration were detected by Nanodrop, and the protein purity was detected by HPLC. The purity and yield of the obtained protein met the needs of subsequent experiments.

[0114] Example 4. Characterization of candidate antibodies (1) Protein-level affinity detection: Surface plasmon resonance (SPR) was used to detect the binding kinetics and affinity of heavy chain antibodies to human MSLN.His antigen. Purified antibodies were flowed onto a sensor chip pre-immobilized with protein A, and the antibodies were captured by protein A. Five different concentrations of MSLN.His protein were then used as the mobile phase, with the binding and dissociation times being 30 and 60 min, respectively. The binding rate (referred to as kon or ka), dissociation rate (referred to as koff or kd), and equilibrium constant (KD) were analyzed using Biacore Evaluation Software 2.0 (GE). Rabbit antibody YP218, which binds to the mesothelin III region, was used as a positive control (Zhang et al., Sci Rep 2003). 2015, 21;5:9928.) The results are shown in the table below. [Table 6]

[0115] (2) Cell-level affinity detection: HEK293T cells expressing the MSLN Ш domain were cultured in a 96-well plate at 3 × 10 5The heavy chain antibodies were plated at 1000 cells / well and incubated with HEK293T MSLN-Ш cells in a gradient dilution, incubated for half an hour, then incubated with detection secondary antibody Anti-human IgG PE (Jackson Immuno Research, Code: 109-117-008, Lot: 145501), and detected using a CytoFLEX flow cytometer. The EC50 of the antibodies was calculated by curve fitting. Isotype is the isotype control (negative control), whose amino acid sequence is as shown in SEQ ID NO.:2 in CN106046152A. The results are shown in Figure 3 and Figure 7. The EC50 of the remaining heavy chain antibodies was 3.637-171.4 nM.

[0116] (3) Detection of MSLN binding to tumor cells: Two types of tumor cells expressing MSLN, SKOV3 and Aspc-1, were plated on a 96-well plate at 3 × 10 5 The heavy chain antibodies were plated at 1000 cells / well, and the gradient diluted heavy chain antibodies were incubated with the tumor cells, incubated on ice for half an hour, and then incubated with the detection secondary antibody Anti-human IgG PE (Jackson Immuno Research, Code: 109-117-008, Lot: 145501), and detected using a CytoFLEX flow cytometer. The EC50 of the antibodies was calculated by curve fitting. Isotype is the isotype control (negative control). The results are shown in Figure 4 and Figure 5. The EC50 of the remaining heavy chain antibodies for the SKOV3 tumor cell line was 0.429-10.253 nM, and the EC50 for the Aspc-1 tumor cell line was 2.337-31.764 nM.

[0117] Example 5, Epitope Competition Experiment The Biacore T200 (GE) was used, and the detection temperature was 25°C, and the buffer was 1x HBS-EP+ (10 mM HEPES, The buffer was 150 mM NaCl, 3 mM EDTA and 0.05% v / v Surfactant P20, GE) and the flow rate was 30 ul / min. MSLN-His was dissolved in acetate buffer at pH 4.0 (Biacore Amine Coupling Kit, GE) to a final concentration of 10 ug / ml, and MSLN-His was immobilized on CM5 chip (GE) channel 2 (FC-2) according to the instructions of the amino coupling kit product, with approximately 21 RU. Channel 1 (FC-1) was used as a blank control. M044 antibody and YP218 antibody were each diluted to the target concentration with 1×HBS-EP+, and one antibody was injected at a saturating level into the above chips FC-1 and FC-2 on which MSLN immobilization had been completed, followed by the other antibody at a saturating level to evaluate the competitive relationship between the two antibodies. After the completion of the second antibody injection, the complex was dissociated for 400 s. Finally, the chip surface was regenerated by injecting 50 mM NaOH for 15 s. Data were processed using Biacore Evaluation Software 2.0 (GE), and the sensorgrams were subjected to double reference subtraction, and the FC2-1 signals were recorded. The results are shown in Figure 6A and Figure 6B. The results show that the binding epitopes of M044 and YP218 antibody are completely different. The relationship between the remaining nanobodies and YP218 epitopes is as follows:

[0118] [Table 7]

[0119] Example 6. Humanization of antibodies M2339 was humanized using the CDR region transplantation method, referring to the method of humanizing nanobodies (J. Biol. Chem. 2009; 284: 3273-3284). A germline with high homology to M2339 was screened as a template in the IgBLAST (http: / / www.ncbi.nlm.nih.gov / igblast / ) database. The humanized nanobodies shown in the table below were obtained. Biacore was used to detect the affinity of the antibody before and after humanization. The purified antibody was flowed onto a sensor chip on which protein A was pre-immobilized, and the antibody was captured by protein A. Then, five different concentrations of MSLN.His protein were used as the mobile phase, and the binding time and dissociation time were 30 min and 60 min, respectively. The binding rate (ka), dissociation rate (kd), and equilibrium constant (KD) were analyzed by Biacore Evaluation Software 2.0 (GE).

[0120] [Table 8]

[0121] Example 7. Tissue cross-reactivity Thirty-four tissues were selected, cryosectioned, dried at room temperature, and fixed with acetone. Reagent A and B of the Endogenous Biotin Blocking Kit (Sangon, E674001) were used for blocking. Biotin-labeled antibody samples were incubated for 30 min, washed, and then horseradish peroxidase-labeled streptavidin (Abcam, ab7403) was added and incubated for 15 min. After color reaction with DAB and counterstaining with hematoxylin, the sections were mounted with neutral plastic and air-dried for microscopic examination. The positive control was Anti-Mesothelin antibody (Biotin) (ab271813), and the negative control was a biotin-labeled IgG4 isotype control. The following table shows the tissue cross-reactivity results of M044, YP218, and M2339-z11-2. Most of the remaining nanobodies (except for the M2339-related antibodies shown in Table 2) have the same binding properties as M044 for normal human tissues, and all of them showed specific binding; five of them, namely M010, M032, M050, M137, M169, and M182, showed non-specific binding and mainly bound to neuronal cell membranes and nerve fibers. The remaining M2339-related antibodies have the same binding properties as M2339-z11-2 for normal human tissues.

[0122] [Table 9] TIFF2024505368000011.tif27170

Claims

1. 1. A mesothelin binding molecule comprising an anti-mesothelium single domain antibody having complementarity determining regions (CDRs) including CDR1, CDR2 and CDR3, CDR1 comprises the sequence shown in SEQ ID NO: 11, CDR2 comprises the sequence shown in SEQ ID NO: 35, and CDR3 comprises the sequence shown in SEQ ID NO: 55; CDR1 comprises the sequence shown in SEQ ID NO: 13, CDR2 comprises the sequence shown in SEQ ID NO: 32, and CDR3 comprises the sequence shown in SEQ ID NO: 57; CDR1 comprises the sequence set forth in SEQ ID NO: 73, CDR2 comprises the sequence set forth in SEQ ID NO: 74, and CDR3 comprises the sequence set forth in SEQ ID NO: 75; or A mesothelin binding molecule, wherein CDR1 comprises the sequence set forth in SEQ ID NO: 21, CDR2 comprises the sequence set forth in SEQ ID NO: 43, and CDR3 comprises the sequence set forth in SEQ ID NO:

65.

2. 2. The mesothelin binding molecule of claim 1, The FR region of the single domain antibody comprises the FR region of any one of VHHs selected from SEQ ID NOs: 83, 85, 101-120 and 93; and / or The single domain antibody VHH is depicted in any one of SEQ ID NOs: 83, 85, 101-120 and 93; and / or The mesothelin-binding molecule is characterized in that it is a monovalent or polyvalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody or antigen-binding fragment thereof, or an antibody or antigen-binding fragment thereof, comprising one, two or more of the single domain antibodies.

3. 3. The mesothelin binding molecule of claim 2, wherein the mesothelin binding molecule is a heavy chain antibody, the heavy chain antibody further comprising heavy chain constant regions CH2 and CH3; Preferably, the heavy chain constant region comprises the sequence shown in SEQ ID NO:

121.

4. A polynucleotide, the polynucleotide comprising: (1) A coding sequence for a mesothelin binding molecule according to any one of claims 1 to 3; (2) the complementary sequence of (1); A polynucleotide selected from the group consisting of:

5. A nucleic acid construct comprising the polynucleotide of claim 4, Preferably, the nucleic acid construct is characterized in that said nucleic acid construct is a recombinant vector or an expression vector.

6. A phage comprising the mesothelin-binding molecule of any one of claims 1 to 3, Preferably, the mesothelin-binding molecule is displayed on the surface of the phage.

7. A host cell, the host cell comprising: (1) expressing a mesothelin binding molecule according to any one of claims 1 to 3; and / or (2) comprising the polynucleotide of claim 4; and / or (3) A host cell, characterized in that it contains the nucleic acid construct described in claim 5.

8. 10. A method for producing a mesothelin binding molecule, comprising culturing a host cell of claim 7 under conditions suitable for production of the mesothelin binding molecule, and optionally purifying the mesothelin binding molecule from the culture.

9. A pharmaceutical composition comprising a mesothelin binding molecule according to any one of claims 1 to 3, a polynucleotide according to claim 4, a nucleic acid construct according to claim 5, a phage according to claim 6 or a host cell according to claim 7, and a pharma- ceutically acceptable auxiliary agent, Preferably, the pharmaceutical composition is utilized to treat cancer.

10. 4. Use of the mesothelin binding molecule of any one of claims 1 to 3 in the manufacture of a medicament for preventing or treating cancer.

11. A mesothelin or MD50 detection kit for use in evaluating the efficacy of drug therapy or diagnosing cancer, the kit comprising a mesothelin-binding molecule according to any one of claims 1 to 3, a polynucleotide according to claim 4, a nucleic acid construct according to claim 5, a phage according to claim 6 or a host cell according to claim 7; Preferably, the kit further comprises a reagent for detecting binding of mesothelin or MD50 to the single domain antibody, antibody, or antigen-binding fragment thereof; More preferably, the reagent is a reagent for detecting the binding by enzyme immunoassay.

12. 11. A non-diagnostic method for detecting the presence of mesothelin or MD50 in a sample, comprising incubating a mesothelin binding molecule of any one of claims 1 to 3 with the sample and detecting binding of mesothelin or MD50 to the single domain antibody, antibody or antigen-binding fragment thereof, thereby determining the presence of mesothelin or MD50 in the sample.

13. 4. Use of the mesothelin-binding molecule of any one of claims 1 to 3 in the preparation of a kit for detecting mesothelin or MD50 in a sample, for assessing the effect of drug treatment, or for diagnosing cancer.

Images